Reagent and method for detecting target substance

Abstract

The present invention provides a practicable assay system using a specific aptamer, particularly a reagent and a method for detecting a homogenous target substance. A nucleic acid molecule to be used in this detection reagent or this detection method comprises a first aptamer that acts on porphyrin exhibiting a peroxidase activity to increase the peroxidase activity and a second aptamer which is linked to the first aptamer and is capable of bonding to a target substance.

Description

Target substance detection reagent and detection method

[0001] The present invention relates to a detection reagent for a target substance, which uses an aptamer that specifically binds to the target substance, and a method for detecting the target substance.

[0002] Generally, techniques for detecting target substances in samples, such as immunoassay systems using antigen-antibody reactions, are known. In particular, among immunoassay systems using antigen-antibody reactions, homogeneous assays (also referred to as homogeneous immunoassays or homogeneous detection systems) that do not require separation of the bound (B) and free (F) forms of enzyme-labeled compounds (B / F separation) have attracted attention as simple and rapid assay systems. To date, antibody-based homogeneous detection systems have been reported, including enzyme-multiplied immunoassays technology (EMIT) (Non-Patent Document 1), fluorescence polarization immunoassay (FPIA) (Non-Patent Document 2), fluorescence resonance energy transfer (FRET) (Non-Patent Document 3), and chemiluminescence resonance energy transfer (CRET) (Non-Patent Document 4).

[0003] The methods described in Non-Patent Documents 1 to 4 all require that the antibody be labeled with an enzyme, a fluorescent substance, or a chemiluminescent substance.

[0004] Furthermore, Non-Patent Documents 5 to 7 disclose homogeneous assay systems that use magnetic nanoparticles to detect viruses.

[0005] On the other hand, a detection system using a signal-emitting donor and an acceptor that specifically receives that signal and emits a detection signal has also been reported (Non-Patent Documents 8 and 9). When the donor is irradiated with light, singlet oxygen is released and diffuses in the solution for a very short time. If the singlet oxygen reaches the acceptor during that time, energy is transferred from the singlet oxygen, and light of a specific wavelength is emitted. In this detection system, a signal of the specific wavelength that is generated when the donor and acceptor come close to each other via the target to be detected is detected.

[0006] Patent Document 1 also discloses a method for measuring the concentration of a target substance in a sample by specifically binding a first enzyme and a second enzyme to the target substance and detecting a reaction catalyzed by the second enzyme. Here, the reaction catalyzed by the second enzyme utilizes a product produced by the reaction catalyzed by the first enzyme. Therefore, when the target substance is present in a reaction solution containing the first enzyme, the second enzyme, and their substrates, the first enzyme and the second enzyme come into proximity, and the reaction catalyzed by the second enzyme proceeds. Patent Document 1 discloses that specific examples of the first enzyme and the second enzyme are glucose oxidase and peroxidase, respectively. In this case, the hydrogen peroxide generated by glucose oxidase is utilized by the second enzyme, peroxidase, to proceed with an enzymatic reaction using a substrate such as orthophenyleneamine.

[0007] An aptamer refers to a nucleic acid molecule that specifically binds to a specific target substance. Aptamers that specifically bind to growth factors, enzymes, receptors, membrane proteins, viral proteins, etc. have been found, and aptamers that bind to metal ions, low-molecular-weight organic compounds, viruses, etc. are also known. For example, Patent Document 2 discloses an aptamer that has a guanine quadruplex structure (hereinafter also referred to as a G4 structure) and specifically binds to hemoproteins such as myoglobin and hemoglobin. The aptamer disclosed in Patent Document 2 has the function of significantly increasing the peroxidase activity of hemoproteins.

[0008] Furthermore, Non-Patent Document 10 discloses an aptamer that specifically binds to the above-mentioned hemoproteins having peroxidase activity or porphyrins containing hemin, and describes their function as DNA enzymes (DNAzymes). Porphyrins that exhibit peroxidase activity are also disclosed in Non-Patent Document 11. Furthermore, Patent Document 3 and Non-Patent Document 12 disclose techniques for further increasing the peroxidase activity by introducing a mutation into an aptamer that specifically binds to hemin to increase the peroxidase activity.

[0009] JP 2003-28874 A JP 2017-200472 A JP 2020-39300 A

[0010] [ PubMed ] Rubenstein KE, Schneider RS, Ullman EF, Biochemical and Biophysical Research Communications, 1972, 47, 846-851.Dandliker WB and Feigen GA, Biochemical and Biophysical Research Communications, 1961, 5, 299-3 Biologiacl Chemistry, 1976, 251, 4172-4178.Campbell AK and Patel A, Biochemical Journal, 1983, 216, 185-194.Zhong J, Rosch EL, Viereck T, Schilling M, Ludwig F, ACS Sensors, 2021, 6, 2021; 976-984.Zhang X, Reeves DB, Perreatd IM, Kett WC, Griswold KE, Gimi B, Weaver JB, Biosensors and Bioelectronics, 2013, 50, 441-446.Wu K, Liu J, Saha R, Su D, Krishna VD, Cheeran MCJ, Wang JP, ACS Applied Material and Interfaces, 2020, 12, 13686-13697.Ulluman EF, Kirakossian H, Switchenko AC, Ishkanian J, Ericson M, Wartchow CA, Pirio M, Pease J, Irvin BR, Singh S, Singh R, Patel R, Dafforn A, Davalian D, Skold C, Kurn N, Wagner DB, Clinical Chemistry, 1996, 42, 1518-1526.Eglen RM, Reisine T, Roby P, Rouleau N, Illy C, Bosse R, Bielefeld M, Current Chemical Genomics, 2008, 1, 2-10.Genevieve Pratviel, Coordination Chemistry Reviews 308 (2016) 460-477Bettina Neumann and Ulla Wollenberger, Sensors 2020, 20, 3692Renzo A. Fenati, Zifei Chen, Yasuko Yamagishi, Kaori Tsukakoshi, Kazunori Ikebukuro, Anjay Manian, Salvy P. Russo, Tomohiko Yamazaki, and Amanda V.Ellis, J. Mater. Chem. B, 2022, 10, 8960-8969.

[0011] However, no practical assay system using an aptamer that increases peroxidase activity in porphyrins, such as peroxidase or hemin, particularly a detection reagent or method for homogeneous target substances, has been known. In view of the above-mentioned circumstances, an object of the present invention is to provide a detection reagent or method for target substances that uses an aptamer that increases peroxidase activity in porphyrins, or a detection reagent or method for target substances that does not use the aptamer.

[0012] In order to achieve the above-mentioned objective, the inventors conducted extensive research and, as a result, succeeded in developing practical detection kits and detection methods for target substances by controlling the three-dimensional structure of an aptamer that increases the peroxidase activity of porphyrin, thereby completing the present invention.

[0013] The present invention encompasses the following: (1) A kit for detecting a target substance, comprising: a nucleic acid molecule having a first aptamer that acts on a porphyrin exhibiting peroxidase activity to increase the peroxidase activity, and a second aptamer linked directly or indirectly to the first aptamer; a first enzyme having oxidase activity that is capable of binding to a target substance to which the second aptamer binds and that catalyzes an oxidation reaction to produce hydrogen peroxide; a first substrate that is a substrate for the first enzyme; a porphyrin having peroxidase activity whose activity is increased by the first aptamer; and a second substrate that is a substrate for the peroxidase activity of the porphyrin. (2) The porphyrin is a second enzyme having peroxidase activity, and the first aptamer has a base sequence represented by the formula [I]: ggg(n) 1-2 ggg(n) 1-8 ggg(n) 1-2 The detection kit according to (1), comprising a polynucleotide represented by ggg [I] and enhancing the peroxidase activity of the second enzyme. (3) The detection kit according to (2), wherein the base sequence represented by formula [I] is a base sequence represented by any one of SEQ ID NOs: 2 to 16. (4) The detection kit according to (1), wherein the nucleic acid molecule is a polynucleotide consisting of a base sequence represented by any one of SEQ ID NOs: 21, 22, and 46. (5) The detection kit according to (1), wherein the porphyrin is hemin, and the first aptamer enhances the peroxidase activity for hemin. (6) The first aptamer that enhances the peroxidase activity for hemin has a base sequence represented by formula [IV]: ggg(n) 1-3 ggg(n) 1-7 ggg(n) 1-3The detection kit according to (5), characterized in that it contains a polynucleotide represented by formula [IV]. (7) The detection kit according to (6), characterized in that the base sequence represented by formula [IV] is any of the base sequences represented by SEQ ID NOs: 26, 27, 29, 30, and 32 to 42. (8) The detection kit according to (1), characterized in that the second aptamer binds to the surface of a virus. (9) The detection kit according to (1), characterized in that the second aptamer has a G-quadruplex structure. (10) The detection kit according to (1), characterized in that it further comprises catalase. (11) The detection kit according to (1), characterized in that the first enzyme and the first substrate are glucose oxidase and glucose, respectively, and the porphyrin and the second substrate are myoglobin and luminol, respectively. (12) The detection kit according to (1), characterized in that it comprises a first reagent containing at least the first substrate and a second reagent containing at least the first enzyme. (13) A method for detecting a target substance, comprising the steps of mixing the detection kit according to any one of (1) to (12) with a sample that may contain a target substance and measuring an enzymatic reaction based on the peroxidase activity of porphyrin contained in the detection kit, and detecting the target substance in the sample based on the enzymatic reaction. (14) A detection kit for a target substance, comprising: a first enzyme supported on particles exhibiting peroxidase activity, the first enzyme having oxidase activity capable of binding to a target substance and catalyzing an oxidation reaction to produce hydrogen peroxide; a first substrate that is a substrate for the first enzyme; and a second substrate that is a substrate for the peroxidase activity of the particles. (15) The detection kit according to (14), wherein the first enzyme and the first substrate are glucose oxidase and glucose, respectively, and the second substrate is luminol. (16) The detection kit according to (14), comprising a first reagent containing at least the first substrate and a second reagent containing at least the first enzyme. (17) The detection kit according to (14), wherein the particles are viruses and the target substance is a protein present on the surface of the viruses. (18) The detection kit according to (14), wherein the particles are magnetic particles.(19) The detection kit according to (14), wherein the particles are magnetic particles having on their surface either a tag peptide or a tag capture peptide produced by magnetic bacteria, and the target substance is a protein fused to the other of the tag peptide and the tag capture peptide, and is bound to the magnetic particles via the tag peptide and the tag capture peptide. (20) A method for detecting a target substance, comprising the steps of mixing the detection kit according to any one of (14) to (19) with a sample that may contain the target substance, and measuring an enzymatic reaction based on peroxidase activity in the particles, and detecting the target substance in the sample based on the enzymatic reaction. (21) A nucleic acid molecule having a first aptamer that acts on a porphyrin exhibiting peroxidase activity and increases the peroxidase activity, and a second aptamer linked directly or indirectly to the first aptamer and capable of binding to a target substance. (22) The first aptamer has a base sequence represented by the formula [I]: ggg(n). 1-2 ggg(n) 1-8 ggg(n) 1-2 (20) The nucleic acid molecule according to (20), comprising a polynucleotide represented by formula [I]: ggg(n) and increasing peroxidase activity in a hemoprotein. (23) The nucleic acid molecule according to (21), wherein the base sequence represented by formula [I] is a base sequence represented by any one of SEQ ID NOs: 2 to 16. (24) The nucleic acid molecule according to (20), wherein the polynucleotide is a polynucleotide consisting of a base sequence represented by any one of SEQ ID NOs: 21, 22, and 46. (25) The nucleic acid molecule according to (21), wherein the first aptamer increases peroxidase activity for hemin. (26) The first aptamer that increases peroxidase activity for hemin has a base sequence represented by formula [IV]: ggg(n) 1-3 ggg(n) 1-7 ggg(n) 1-3(25) The nucleic acid molecule according to (25), comprising a polynucleotide represented by formula [IV]. (27) The nucleic acid molecule according to (26), wherein the base sequence represented by formula [IV] is a base sequence represented by any one of SEQ ID NOs: 26, 27, 29, 30 and 32 to 42. (28) The nucleic acid molecule according to (21), wherein the second aptamer binds to the surface of a virus. (29) The nucleic acid molecule according to (21), wherein the second aptamer is a polynucleotide having a G-quadruplex structure. (30) The nucleic acid molecule according to (21), wherein the base sequence is a polynucleotide represented by formula [I]: ggg(n) 1-2 ggg(n) 1-8 ggg(n) 1-2 A method for detecting hemoglobin, comprising the steps of: mixing an aptamer molecule, which is a polynucleotide represented by ggg [I] and which increases the peroxidase activity of a hemoprotein; a first enzyme having an ability to specifically bind to hemoglobin and having oxidase activity that catalyzes an oxidation reaction to produce hydrogen peroxide; a first substrate that is a substrate for the first enzyme; a second substrate that is a substrate for the peroxidase; and a sample that may contain hemoglobin; and measuring the peroxidase activity of the hemoglobin. (31) The method for detecting hemoglobin according to (30), wherein the base sequence represented by formula [I] is the base sequence represented by any of SEQ ID NOs: 2 to 16. (32) The method for detecting hemoglobin according to (30), wherein the base sequence represented by formula [I] is the base sequence of SEQ ID NO: 2. (33) The hemoglobin detection method according to (30), wherein the first enzyme and the first substrate are glucose oxidase and glucose, respectively, and the second substrate is luminol.

[0014] According to the present invention, a target substance can be detected with high accuracy using an aptamer that has a predetermined base sequence and enhances the peroxidase activity of a porphyrin that exhibits peroxidase activity.

[0015] Furthermore, according to the present invention, hemoglobin can be detected with high accuracy using an aptamer that has a predetermined base sequence and increases the peroxidase activity of a hemoprotein.

[0016] FIG. 1 is a schematic diagram showing a target substance detection system using a nucleic acid molecule according to the present invention. FIG. 2 is a schematic diagram showing another example of a target substance detection system using a nucleic acid molecule according to the present invention. FIG. 3 is a schematic diagram showing yet another example of a target substance detection system using a nucleic acid molecule according to the present invention. FIG. 4 is a schematic diagram showing a hemoglobin detection system to which the present invention is applied. FIG. 5 is a photograph showing the results of SDS-polyacrylamide gel electrophoresis for confirming the antibody-enzyme complex prepared in Example 1. FIG. 6 is a characteristic diagram showing the results of measuring the oxidase activity of the antibody-enzyme complex prepared in Example 1. FIG. 7 is a characteristic diagram showing the results of measuring the structure of a fusion aptamer by circular dichroism (CD) spectroscopy. FIG. 8 is a characteristic diagram showing the results of examining the folding conditions of a fusion aptamer by blotting. FIG. 9 is a characteristic diagram showing the results of examining the concentration ratio of myoglobin to the fusion aptamer. FIG. 10 is a characteristic diagram showing the results of measuring a virus (inactivated SARS-CoV-2) using the system according to the present invention shown in Example 6. FIG. 11 is a characteristic diagram showing the results of measuring a virus (inactivated SARS-CoV-2) using the system according to the present invention shown in Example 7. FIG. 11 is a characteristic diagram showing the results of measuring a virus (inactivated SARS-CoV-2) using the system according to the present invention shown in Example 8. FIG. 12 is a characteristic diagram showing the results of measuring a virus (inactivated SARS-CoV-2) using the system according to the present invention shown in Example 9. FIG. 13 is a characteristic diagram showing the results of measuring a virus (inactivated SARS-CoV-2) using the system according to the present invention shown in Example 10. FIG. 14 is a photograph showing the results of imaging a plate using the camera function of an iPhone (registered trademark) 12 in Example 10. FIG. 15 is a photograph showing the results of imaging a membrane using the camera function of an iPhone (registered trademark) 12 in Example 11. FIG. 16 is a photograph showing the results of SDS-polyacrylamide gel electrophoresis for confirming the antibody-enzyme complex prepared in Example 12. FIG. 17 is a characteristic diagram showing the results of measuring an inactivated influenza virus using the system according to the present invention shown in Example 13. FIG. 18 is a characteristic diagram showing the results of measuring an inactivated influenza virus using the system according to the present invention shown in Example 14.1 is a characteristic diagram showing the results of measuring a virus (inactivated SARS-CoV-2) using the system according to the present invention shown in Example 15. FIG. 2 is a photograph showing the results of confirming, by dot plot, the expression of the Mms13-SC-Flag fusion protein in the Mms13-SC-Flag-BMP prepared in Example 16. FIG. 3 is a photograph showing the results of SDS-polyacrylamide gel electrophoresis to confirm Mms13-VHH for the VHH-presenting BMP (VHH-BMP) prepared in Example 17. FIG. 4 is a characteristic diagram showing the results of measuring chemiluminescence intensity to confirm the anti-CRP scFv antibody-presenting BMP (scFv-BMP) prepared in Example 18. FIG. 5 is a photograph showing the results of SDS-polyacrylamide gel electrophoresis to confirm the complex of GOx and scFv-ST prepared in Example 19. FIG. 6 is a characteristic diagram showing the chemiluminescence intensity measured to evaluate the binding ability of the antibody-enzyme complex prepared in Example 19 to CRP. 1 is a characteristic diagram showing the results of evaluating the CRP capturing ability of an antibody-enzyme complex and anti-CRPscFv antibody-presented BMP in Example 20.

[0041] FIG. 1 is a characteristic diagram showing the results of measuring the peroxidase activity of Mms13-SC-Flag-BMP in Example 21.

[0042] FIG. 1 is a characteristic diagram showing the results of measuring the luminol luminescence intensity at different CRP concentrations for the complex of scFv-BMP, CRP, and GOx-scFv (washed) prepared in Example 21.

[0043] FIG. 1 is a characteristic diagram showing the results of measuring the luminol luminescence intensity at different CRP concentrations for the complex of scFv-BMP, CRP, and GOx-scFv (without washing) prepared in Example 21.

[0044] FIG. 1 is a characteristic diagram showing the results of measuring the luminol luminescence intensity at different CRP concentrations in a reaction system containing no catalase in the reaction solution, as carried out in Example 22.

[0045] FIG. 1 is a characteristic diagram showing the results of measuring the luminol luminescence intensity at different CRP concentrations for the reaction solution containing and not containing catalase, as carried out in Example 22.

[0017] The present invention will now be described in detail with reference to the drawings.

[0018] [First Aptamer] In the present invention, the term "first aptamer" refers to a nucleic acid molecule consisting of a polynucleotide having a specific base sequence and capable of increasing the peroxidase activity of a porphyrin exhibiting peroxidase activity. An example of such a nucleic acid molecule is the aptamer molecule disclosed in Japanese Patent Application Laid-Open No. 2017-200472. As will be described in detail below, the nucleic acid molecule can be used in conjunction with another aptamer that binds to a target substance. Therefore, in this embodiment, to distinguish the nucleic acid molecule from the other aptamer, the nucleic acid molecule is referred to as the "first aptamer." In this embodiment, the other aptamer is referred to as the "second aptamer."

[0019] In one embodiment, the base sequence of the first aptamer is represented by the formula [I]: ggg(n) 1-2 ggg(n) 1-8 ggg(n) 1-2 The base sequence of the first aptamer is represented by ggg. Here, n is adenine (a), cytosine (c), guanine (g), thymine (t) (uracil (u) in the case of RNA), inosine (i), or a modified form (methylated form, etc.) of these bases or an artificial nucleic acid. In addition, the base sequence of the first aptamer is represented by the base sequence represented by formula [I], and the base sequence of formula [II]: ggg(n) 1-2 ggg(n) 1-6 ggg(n) 1-2 Those represented by ggg are preferred, and further, those represented by the formula [III]: gggngggnnggg(n) 1-2 The one designated by ggg is more preferred.

[0020] Preferred examples of the base sequence represented by formula [I] include the base sequences represented by any of SEQ ID NOs: 2 to 16, which were prepared in JP 2017-200472 A and whose effects were specifically confirmed (Table 1 below). That is, the base sequence of the first aptamer may be any of SEQ ID NOs: 2 to 16, and is not particularly limited. Of these, it is most preferable that the first aptamer be a polynucleotide consisting of the base sequence of SEQ ID NO: 2, which was used in this example.

[0021]

[0022] The first aptamer may consist of the base sequence represented by formula [I], but may also have one or more nucleotides added to its 5'-end and / or 3'-end. It is generally believed that the specific binding of an aptamer to a target substance is due to the aptamer's specific structure (three-dimensional or planar structure). Therefore, even if a base sequence not exhibiting a specific structure is added to one or both ends of the base sequence represented by formula [I], the enhancement of peroxidase activity is maintained. In particular, it is preferable that the base sequence represented by formula [I] contains one to three natural bases other than ACGT, such as inosine or methylated cytosine, or highly hydrophobic unnatural bases. This configuration allows the first aptamer to exhibit a more effective enhancement of peroxidase activity. Furthermore, adding an adenine to the 3'-end of the base sequence represented by formula [I] plays a role similar to that of a histidine residue involved in peroxidase activity, thereby exhibiting a more effective enhancement of peroxidase activity. Whether or not DNA exhibits a particular structure can be determined by computer software analysis (for example, RAMAPO COLLEGE's Mapper (Nucleic Acids Research 2006 July; 34 (Web Server issue):W676-W682), available at http: / / bioinformatics.ramapo.edu / QGRS / analyze.php). Therefore, base sequences that do not exhibit a particular structure can be easily determined by those skilled in the art. For example, poly(t) sequences are widely known as DNA sequences that do not exhibit a particular structure, and aptamers represented by formula [I] to which poly(t) sequences have been added at one or both ends also have the effect of increasing hemoprotein peroxidase activity and are included in the scope of the present invention.However, as specifically shown in JP 2017-200472 A, excellent effects are exhibited even if no nucleotides are added to the 5'-end and 3'-end of the base sequence represented by formula [I]. Furthermore, since the cost and effort required for synthesis increase as the length of the aptamer increases, an aptamer having 0 to 10, preferably 0 to 6, and more preferably 0 to 3 nucleotides added to one or both ends of formula [I] is preferred (note that "0 nucleotides added" means that no nucleotides are added).

[0023] Furthermore, as disclosed in JP 2017-200472 A, the first aptamer has a guanine quadruplex structure (also referred to as a G4 structure). It is generally known that aptamers having a G4 structure (also referred to as a G4 aptamer) include parallel G4 and antiparallel G4 structures. However, as described in JP 2017-200472 A, the first aptamer has been confirmed to be a parallel G4 structure as a result of circular dichroism (CD) spectroscopy measurements. In addition, in a G4 aptamer, G-quartets formed by four guanines arranged in a plane are arranged in parallel, and it is known that a target substance binds by being inserted into this G-quartet.

[0024] The first aptamer of the present invention is not limited to one that binds to peroxidase as in the first embodiment described above, but may also be one that specifically binds to a porphyrin other than peroxidase and has the function of increasing the peroxidase activity of the porphyrin other than peroxidase. That is, another embodiment of the first aptamer is an aptamer that specifically binds to a porphyrin other than peroxidase and has the function of increasing the peroxidase activity of the porphyrin other than peroxidase.

[0025] Here, porphyrin refers to a compound having a structure in which a porphine ring having the following structure is used as a skeleton and functional groups are bound to the skeleton.

[0026]

[0027] Thus, the term "porphyrin" is not limited to the above-mentioned peroxidase (protein, enzyme), but also encompasses organic compounds such as hemin. The porphyrin used in the present invention is not particularly limited, and examples thereof include hemin, chlorin, phlorin, porphodimethene, porphomethene, bacteriochlorin, isobacteriochlorin, porphyrinogen, phorbin, porphyrazine, phthalocyanine, phytoporphyrin, cytoporphyrin, uroporphyrins I to IV, coproporphyrins I to IV, hematoporphyrin, mesoporphyrin, protoporphyrin, rhodoporphyrin, phylloporphyrin, etioporphyrins I to IV, pyroporphyrin, deuteroporphyrin, phytochlorin, rhodochlorin, phyllochlorin, and pyrochlorin. Porphyrins for use in the present invention also include the group of compounds disclosed in Genevieve Pratviel, Coordination Chemistry Reviews 308 (2016) 460-477.

[0028] An example of the porphyrin used in the present invention is hemin, which has the following structure:

[0029]

[0030] The first aptamer, which specifically binds to various porphyrins as described above and has the function of improving the peroxidase activity of the porphyrins, can have its base sequence designed, for example, by the method described in Renzo A. Fenati, Zifei Chen, Yasuko Yamagishi, Kaori Tsukakoshi, Kazunori Ikebukuro, Anjay Manian, Salvy P. Russo, Tomohiko Yamazaki, and Amanda V.Ellis, J. Mater. Chem. B, 2022, 10, 8960-8969, and can be chemically synthesized based on the designed base sequence.

[0031] For example, the first aptamer having the function of specifically binding to hemin and improving the peroxidase activity of hemin is, but is not particularly limited to, a compound represented by the formula [IV]: ggg(n) 1-3 ggg(n) 1-7 ggg(n) 1-3 An example of an aptamer having a base sequence represented by gg is gg, where n is adenine (a), cytosine (c), guanine (g), thymine (t) (uracil (u) in the case of RNA), inosine (i), or a modified form (e.g., a methylated form) of these bases, or an artificial nucleic acid. Furthermore, examples of the first aptamer having the function of improving peroxidase activity in hemin include, but are not limited to, polynucleotides (which may also be referred to as oligonucleotides) having the base sequence shown in Table 2, which are disclosed in Cheng et al., Biochemistry, 2009, 48, 7817-7823.

[0032]

[0033] Among the polynucleotides shown in Table 2, the base sequences of SEQ ID NOs: 26, 27, 29, 30, and 32 to 42 in particular contain the base sequence shown in formula [IV]. Therefore, it is preferable to use, as the first aptamer, an aptamer comprising a polynucleotide consisting of any one of the base sequences of SEQ ID NOs: 26, 27, 29, 30, and 32 to 42 among the polynucleotides shown in Table 2 in particular. Note that aptamers consisting of the base sequences of SEQ ID NOs: 29, 37, 40, and 41 are aptamers consisting of the polynucleotide shown in formula [IV], and aptamers consisting of the base sequences of SEQ ID NOs: 26, 27, 30, 32 to 36, 38, 39, and 42 are aptamers in which one or more nucleotides have been added to the 5' end and / or 3' end of the polynucleotide shown in formula [IV].

[0034] Among the aptamers containing the polynucleotide represented by formula [IV], particularly, the aptamer containing the polynucleotide represented by formula [V]: ggg(n) 1-2 ggg(n) 1-3 ggg(n) 1-2It is preferable to use an aptamer containing a polynucleotide represented by gg. Among the polynucleotides shown in Table 2, the base sequences of SEQ ID NOS: 32, 33, 34, 37, and 38 contain the base sequence shown in formula [V] above. Therefore, it is more preferable to use, as the first aptamer, an aptamer containing a polynucleotide consisting of any one of the base sequences of SEQ ID NOS: 32, 33, 34, 37, and 38 among the polynucleotides shown in Table 2. Cheng et al., Biochemistry, 2009, 48, 7817-7823, has disclosed that EAD2 (SEQ ID NOS: 33), c-Myc (SEQ ID NOS: 38), EAD (SEQ ID NOS: 32), EAD3 (SEQ ID NOS: 34), and VEGF (SEQ ID NOS: 37) are highly effective in improving kcat (turnover number: catalytic constant for the conversion of substrate to product). Furthermore, it is most preferable that the first aptamer is a polynucleotide (PS2.M) consisting of the base sequence of SEQ ID NO: 30 used in this example, which is an aptamer containing a polynucleotide represented by formula [V].

[0035] The first aptamer may be composed of a polynucleotide shown in Table 2 or Formula [IV] or [V], or may be a polynucleotide shown in Table 2 or Formula [IV] or [V] to which one or more nucleotides have been added at the 5'-end and / or 3'-end. It is generally believed that the reason an aptamer specifically binds to a target substance is that the aptamer exhibits a specific structure (three-dimensional structure or planar structure). Therefore, even if a base sequence not exhibiting a specific structure is added to one or both ends of the base sequence shown in Table 2 or Formula [IV] or Formula [V], the effect of enhancing peroxidase activity is maintained. In particular, it is preferable that the base sequence shown in Table 2 or Formula [IV] or Formula [V] contains one to three natural bases other than ACGT, such as inosine or methylated cytosine, or highly hydrophobic unnatural bases, at one or both ends. This configuration allows the first aptamer to exhibit a more excellent effect of enhancing peroxidase activity. Furthermore, adding an adenine to the 3' end of the base sequence shown in Table 2 or Formula [IV] or [V] can serve the same purpose as the histidine residue involved in peroxidase activity, thereby achieving a more effective increase in peroxidase activity. Whether or not a DNA exhibits a specific structure can be determined by computer software analysis (e.g., RAMAPO COLLEGE's Mapper (Nucleic Acids Research 2006 July; 34 (Web Server issue):W676-W682), available at http: / / bioinformatics.ramapo.edu / QGRS / analyze.php). Therefore, base sequences that do not exhibit a specific structure can be easily determined by those skilled in the art. For example, poly(t) sequences are widely known as DNA sequences that do not exhibit a specific structure. Aptamers shown in Table 2 or Formula [IV] or [V] with a poly(t) sequence added to one or both ends also have the effect of enhancing the peroxidase activity of hemoproteins and are included within the scope of the present invention.Furthermore, since the cost and effort required for synthesis increases as the length of the aptamer increases, aptamers having 0 to 10, preferably 0 to 6, and more preferably 0 to 3 nucleotides added to one or both ends of the base sequence shown in Table 2 or formula [IV] or formula [V] are preferred (note that "0 nucleotides added" means that no nucleotides have been added).

[0036] The first aptamer that specifically binds to hemin and has the function of improving peroxidase activity in the hemin is not particularly limited, but examples thereof include the polynucleotide (which may also be referred to as an oligonucleotide) described in JP 2020-039300 A, which has a particularly excellent function of improving peroxidase activity. The polynucleotide described in JP 2020-039300 A also has a sequence containing the polynucleotide shown in formula [IV].

[0037] On the other hand, as mentioned above, the porphyrin used in the present invention is not limited to peroxidase or hemin, and so-called microperoxidase can also be used. Microperoxidase is a compound having a structure in which some amino acid residues constituting peroxidase are bound to a heme moiety and exhibiting peroxidase activity. Known microperoxidases include MP-6, which contains the 14th cysteine ​​to the 19th threonine constituting peroxidase; MP-8, which contains the 14th cysteine ​​to the 21st glutamic acid constituting peroxidase; MP-9, which contains the 13th lysine to the 21st glutamic acid constituting peroxidase; and MP-11, which contains the 11th valine to the 21st glutamic acid constituting peroxidase.

[0038] The base sequence of the first aptamer that specifically binds to these microperoxidases and has the function of improving the peroxidase activity of the microperoxidases can be designed, for example, by the method described in Renzo A. Fenati, Zifei Chen, Yasuko Yamagishi, Kaori Tsukakoshi, Kazunori Ikebukuro, Anjay Manian, Salvy P. Russo, Tomohiko Yamazaki, and Amanda V.Ellis, J. Mater. Chem. B, 2022, 10, 8960-8969, and the first aptamer can be chemically synthesized based on the designed base sequence.

[0039] [Nucleic Acid Molecule of the Present Invention] The nucleic acid molecule of the present invention comprises the first aptamer described above and a second aptamer linked to the first aptamer directly or indirectly via an oligonucleotide and capable of binding to a predetermined target substance. Although not particularly limited, the second aptamer preferably has a G-quadruplex structure. Examples of target substances include, but are not limited to, biomolecules such as proteins, glycoproteins, lipids, glycolipids, polysaccharides, sugar chains, and nucleic acids. Examples of proteins include, but are not limited to, growth factors, enzymes, receptors, membrane proteins, and viral proteins. Furthermore, target substances can also be cells, viruses, or microorganisms displaying these biomolecules on their surface. Examples of cells include cancer cells, iPS cells, and ES cells. Target viruses can be either DNA or RNA viruses, and can be enveloped viruses such as coronaviruses and influenza viruses, as well as non-enveloped viruses such as noroviruses and polioviruses. Structures large enough for the second aptamer and antibody to bind to, such as protein aggregates with a diameter of 10 nm or more, or liposomes displaying such structures on their surface, can also be used as target substances.

[0040] As an example of the second aptamer, one having the ability to bind to the receptor binding domain (RBD) of a spike protein can be used. Spike proteins are glycoproteins that are present in multiple, almost uniform distribution on the surface of a virus and interact with cell surface receptors of host cells. The receptor binding domain (RBD) refers to the region that interacts with the cell surface receptor of a host cell. Examples of viruses having spike proteins include seasonal influenza viruses, novel influenza viruses, coronaviruses, novel coronaviruses, orthomyxoviruses, paramyxoviruses, rhabdoviruses, filoviruses, bunyaviruses, arenaviruses, and retroviruses.

[0041] In particular, the second aptamer preferably binds to the receptor binding domain (RBD) of a virus that causes disease in humans, such as the novel coronavirus or seasonal influenza virus. Furthermore, the second aptamer preferably binds to the receptor binding domain (RBD) of the spike protein of the novel coronavirus (SARS-CoV-2). The nucleotide sequence of an aptamer that binds to the receptor binding domain (RBD) of the spike protein of the novel coronavirus (SARS-CoV-2) is shown in SEQ ID NO: 1. That is, a polynucleotide containing the nucleotide sequence of SEQ ID NO: 1 (ggggctgctcgggattgcggatatgg) can be used as the second aptamer.

[0042] Furthermore, the second aptamer preferably binds to the spike protein of seasonal influenza viruses. Seasonal influenza viruses contain two types of spike proteins: hemagglutinin (HA) and neuraminidase (NA). Therefore, the second aptamer can be designed to bind to hemagglutinin or neuraminidase of seasonal influenza viruses. As an example, the nucleotide sequence of an aptamer that binds to hemagglutinin (HA) of seasonal influenza viruses is shown in SEQ ID NO: 45. That is, a polynucleotide containing the nucleotide sequence of SEQ ID NO: 45 (ttggggttattttgggtgtggtgggtgggggtt) can be used as the second aptamer.

[0043] The nucleic acid molecule of the present invention may be DNA or RNA, but chemically stable DNA is preferred. Furthermore, this nucleic acid molecule can be easily prepared by chemical synthesis using a commercially available DNA synthesizer or the like. Here, the order of the first aptamer and the second aptamer contained in the nucleic acid molecule is arbitrary. That is, the first aptamer and the second aptamer may be arranged in this order from the 5' end to the 3' end, or the second aptamer and the first aptamer may be arranged in this order.

[0044] The first and second aptamers may be linked directly or indirectly via an oligonucleotide consisting of one to several nucleotides. For example, the first and second aptamers may be linked by one nucleotide, two dinucleotides, three oligonucleotides, four oligonucleotides, or five oligonucleotides. These one to five nucleotides may all be thymines, although they are not particularly limited thereto. The first and second aptamers may also be linked via a synthetic linker such as PEG or PEO.

[0045] The nucleic acid molecule configured as described above exhibits the function of increasing the peroxidase activity of porphyrin caused by the first aptamer when the second aptamer is bound to a target substance. In other words, in the nucleic acid molecule of the present invention, when the second aptamer is not bound to a target substance, the G-quadruplex structure of the first aptamer is not stabilized, and the effect of enhancing peroxidase activity is not fully exerted. Furthermore, in the nucleic acid molecule configured as described above, it is preferable that the second aptamer has a G-quadruplex structure. When the second aptamer has a G-quadruplex structure, the effect of enhancing peroxidase activity by the first aptamer changes more significantly between when the second aptamer is bound to a target substance and when it is not bound to a target substance. This is thought to be because the second aptamer has a G-quadruplex structure, which changes the structure and stability of the nucleic acid molecule when the second aptamer binds to a target substance, stabilizing the G-quadruplex structure in the first aptamer and further enhancing the effect of enhancing peroxidase activity. Thus, when the second aptamer in the nucleic acid molecule has a G-quadruplex structure, the detection sensitivity for the target substance can be further improved.

[0046] Examples of porphyrins on which the first aptamer acts include hemoproteins such as peroxidase, myoglobin, hemoglobin, metmyoglobin, catalase, and cytochrome P450. Of these, myoglobin and hemoglobin are preferred. Furthermore, as described above, the porphyrin on which the first aptamer acts may be a compound such as hemin or microperoxidase, with hemin being particularly preferred.

[0047] [Detection of Target Substance 1] By utilizing the nucleic acid molecule according to the present invention described above, a system for detecting a target substance with high accuracy can be constructed. An outline of this system is shown in Figure 1. The example shown in Figure 1 is a scheme for detecting the novel coronavirus (SARS-CoV-2) as a target substance using the nucleic acid molecule. As described above, the second aptamer constituting the nucleic acid molecule is not limited to one that binds to the RBD of the novel coronavirus (SARS-CoV-2). Aptamers that bind to other viruses, growth factors, enzymes, receptors, or membrane proteins can also be used. Therefore, the target substance may be the virus, or a cell expressing a specific growth factor, enzyme, receptor, or membrane protein.

[0048] In this system, as shown in FIG. 1 , a first enzyme 103 is prepared that specifically binds to a target substance 102 to which a second aptamer 101 in a nucleic acid molecule 100 binds. Here, the first enzyme 103 has oxidase activity that catalyzes an enzymatic reaction using a predetermined substance as a substrate (first substrate 104) and generates hydrogen peroxide. The first enzyme 103 also forms a complex with a binding moiety 105 that specifically binds to the target substance 102. Here, the binding moiety 105 can be a molecule that specifically binds to the target substance 102, i.e., the target substance 102, such as an antibody molecule against the RBD of the novel coronavirus (SARS-CoV-2) or a nucleic acid aptamer that has the ability to bind to the RBD of the novel coronavirus (SARS-CoV-2).

[0049] Examples of the first enzyme 103 that can be used include glucose oxidase, aldehyde oxidase, cytochrome oxidase, catechol oxidase, diphenol oxidase, cholesterol oxidase, cytochrome C oxidase, hypoxanthine oxidase, xanthine oxidase, NADPH oxidase, lactate oxidase, galactose oxidase, and alcohol oxidase. Among these, glucose oxidase is preferably used as the first enzyme 103. These enzymes may be enzymes primarily composed of proteins, or may be DNAzymes (deoxyribozymes) that are primarily composed of DNA, or ribozymes that are primarily composed of RNA.

[0050] The first substrate 104 can be appropriately selected and used depending on the type of the first enzyme 103. The pair of the first enzyme 103 and the first substrate 104 is preferably glucose oxidase and glucose, because glucose, which is the first substrate 104, is a stable compound and is inexpensive.

[0051] The binding moiety 105 is used as a means for binding the first enzyme 103 to the target substance 102. The binding moiety 105 is not limited to an antibody molecule whose antigen is the RBD of the target substance 102, i.e., the novel coronavirus (SARS-CoV-2), but an ACE2 fragment that interacts with the RBD can also be used. The binding moiety 105 may also be an antibody molecule whose antigen is a region of the spike protein of the novel coronavirus (SARS-CoV-2) other than the RBD, or an antibody molecule whose antigen is a protein other than the spike protein, such as the N protein, M protein, or E protein. The binding moiety 105 may also be an aptamer composed primarily of nucleic acids.

[0052] Here, the first enzyme 103 and the binding portion 105 may directly bind to each other to form a complex, or may indirectly bind to each other to form a complex. The method for indirectly binding the first enzyme 103 and the binding portion 105 is not particularly limited, but a method using a tag peptide and a tag capture peptide can be applied. Examples of tag peptides and tag capture peptides include the SpyTag / SpyCatcher system (Bijan Zakeri et al., PNAS, 109 (12) E690-E697, 2012) and the SnoopCatcher / SnoopTag system (Gianluca Veggiani et al., PNAS, 113 (5) 1202-1207, 2016). Alternatively, the tag peptide and tag capture peptide may be an improved version of the SpyTag / SpyCatcher system, the SpyTag2 / SpyCatcher2 system (Keeble et al., Angew. Chem. Int. Ed. 2017, 56, 16521-16525), or the SpyTag3 / SpyCatcher3 system (Keeble et al., PNAS, 116 (52) 26523-26533, 2019).

[0053] That is, either the first enzyme 103 or the binding part 105 has either a tag peptide or a tag capture peptide, and the other either the first enzyme 103 or the binding part 105 has either a tag peptide or a tag capture peptide. This allows the first enzyme 103 and the binding part 105 to be indirectly bound to each other, thereby forming the complex.

[0054] When the binding portion 105 is an antibody molecule, the antibody molecule may be any of an immunoglobulin (IgG, IgA, IgM, IgD, IgE) antibody, a heavy chain antibody, and a fragment antibody. An immunoglobulin antibody consists of a heavy chain (VH) and a light chain (LH), and each of the heavy chain and light chain has three CDRs: CDR1, CDR2, and CDR3. A heavy chain antibody consists only of a heavy chain, and the heavy chain has three CDRs: CDR1, CDR2, and CDR3. A fragment antibody is an antibody fragmented using an enzyme or genetic engineering technique, and includes Fab, F(ab'), F(ab')2, Fv, VHH antibody, etc. Furthermore, a fragment antibody also includes scFab, scF(ab'), and scF(ab')2, which are single-chain antibodies formed by linking the light chain and heavy chain constituting Fab, F(ab'), and F(ab')2 via a linker sequence. Here, scFab, scF(ab'), and scF(ab')2 may have a linker sequence attached to the C-terminus of the light chain, and a heavy chain attached to the C-terminus of that. Furthermore, they may have a linker sequence attached to the C-terminus of the heavy chain, and a light chain attached to the C-terminus of that. Furthermore, scFV, which is a single-chain antibody formed by linking the light chain variable region and heavy chain variable region via a linker sequence, can also be used as binding moiety 105.

[0055] When the binding portion 105 is an aptamer, the above-mentioned second aptamer can be used as the aptamer molecule.

[0056] As shown in FIG. 1 , the system also includes a porphyrin 107 having peroxidase activity to which a first aptamer 106 in a nucleic acid molecule 100 can bind, and a second substrate 108 serving as a substrate for the porphyrin 107. As described above, the porphyrin 107 is an enzyme having peroxidase activity, such as peroxidase, myoglobin, hemoglobin, metmyoglobin, catalase, or cytochrome P450, or a compound having peroxidase activity, such as hemin, or a compound such as microperoxidase. The second substrate 108 can be appropriately selected depending on the type of porphyrin 107, but it is particularly preferable to use a substance that can optically detect the progress of the enzymatic reaction of the porphyrin 107. Specifically, orthophenylenediamine or luminol can be used as the second substrate 108.

[0057] As described above, when an enzyme having peroxidase activity such as peroxidase, myoglobin, hemoglobin, metmyoglobin, catalase, or cytochrome P450 is used as the porphyrin 107, this enzyme is referred to as the second enzyme to distinguish it from the first enzyme 103.

[0058] 1 , the present system preferably further includes a third enzyme 109 that consumes, as a substrate, hydrogen peroxide generated by the oxidase reaction of the first enzyme 103. The third enzyme 109 is not particularly limited as long as it is an enzyme that consumes hydrogen peroxide as a substrate and, unlike the second substrate 108, does not bind to the first aptamer 106. For example, catalase can be used as the third enzyme 109.

[0059] In the present system configured as described above, a target substance 102 can be detected in a reaction system containing a nucleic acid molecule 100, a first enzyme 103 fused to a binding moiety 105, a first substrate 104, a porphyrin 107, and a second substrate 108. Specifically, when the target substance 102 is present in the reaction system, a state is created in which the porphyrin 107 indirectly binds to the target substance 102 via the nucleic acid molecule 100, and the first enzyme 103 indirectly binds to the target substance 102 via the binding moiety 105. In this state, an oxidase reaction using the first substrate 104 by the first enzyme 103 proceeds, generating hydrogen peroxide. Because the porphyrin 107 is located in close proximity to the first enzyme 103, it consumes the hydrogen peroxide generated by the enzymatic reaction of the first enzyme 103. This allows a peroxidase reaction using the second substrate 108 by the porphyrin 107 to proceed.

[0060] Therefore, according to this system, the target substance 102 can be detected by measuring the peroxidase reaction using the second substrate 108 by the porphyrin 107. For example, when an optically detectable substance such as luminol is used as the second substrate 108, the target substance 102 can be detected by measuring the chemiluminescence generated by the so-called luminol reaction. The means for measuring the chemiluminescence is not particularly limited, and may be visual observation or an ultra-weak chemiluminescence measurement method.

[0061] On the other hand, when the target substance 102 is not present in a reaction system containing the nucleic acid molecule 100, the first enzyme 103 fused to the binding portion 105, the first substrate 104, the porphyrin 107, and the second substrate 108, the first enzyme 103 causes an oxidase reaction using the first substrate 104 to generate hydrogen peroxide, but the porphyrin 107 is not present in a nearby position. Therefore, the peroxidase reaction using the second substrate 108 by the porphyrin 107 hardly proceeds. Therefore, the nucleic acid molecule 100 and the binding portion 105 are detected only when they are closely bound, enabling specific detection.

[0062] Furthermore, when the third enzyme 109 is present in the reaction system, the hydrogen peroxide produced by the enzymatic reaction of the first enzyme 103 can be consumed by the third enzyme 109. In this case, the hydrogen peroxide necessary for the enzymatic reaction by the porphyrin 107 has been consumed, so that the peroxidase reaction using the second substrate 108 can be more reliably stopped. In this way, in this system, the occurrence of false positives can be suppressed by adding the third enzyme 109 to the reaction system.

[0063] Furthermore, in the above-described method for detecting a target substance 102 using the present system, a first reagent containing at least a first substrate 104 and a second reagent containing at least a first enzyme 103 can be used. Note that components other than the first substrate 104 and the first enzyme 103 (e.g., the nucleic acid molecule 100) may be contained in either the first reagent or the second reagent, or in both. By separating the first reagent from the second reagent, the progress of the oxidase reaction using the first substrate 104 by the first enzyme 103 can be suppressed during storage of the reagents. Then, when the first reagent and the second reagent are mixed, the oxidase reaction using the first substrate 104 by the first enzyme 103 can be allowed to proceed, and the target substance 102 can be detected as described above.

[0064] The system described above is not particularly limited and can be applied to various situations in which a target substance 102 is detected. This system can be particularly applied to a system for detecting viruses as the target substance 102. To detect viruses using this system, an aptamer that binds to the surface of the virus can be used as the second aptamer. Applying this system to virus detection allows for rapid and simple virus detection. In one example of a system for detecting viruses using this system, the first and second reagents are sprayed onto a location where a virus is suspected to be attached, creating the above-described reaction system. Whether a target substance 102 is attached to that location can be determined based on chemiluminescence resulting from a peroxidase reaction by porphyrin 107.

[0065] The present system can also be applied to devices that detect whether viruses, which are target substances 102, are present in the air. Examples of such devices include air purifiers, air conditioners, simple handheld air collectors, air collectors installed at entrances and exits of buildings and rooms, and devices for collecting exhaled or coughed air installed in hospitals, etc. These devices have in common the fact that air is passed through a filter, and the present system can be applied to detect viruses attached to the filter. In this case, the above-described reaction system can be constructed by spraying the first and second reagents onto the filter, or by spraying the first and second reagents onto fine particles or dust collected by the filter. Furthermore, by making the filters in these devices disposable, sequential detection of viruses, which are target substances 102, becomes possible.

[0066] Furthermore, this system can be applied to devices for detecting whether a target substance 102, i.e., a virus, is contained in a liquid. Examples of such devices include devices for collecting saliva or other bodily fluids from patients with feverish symptoms, and devices for collecting liquids soaked in clothing or masks worn by medical professionals. Such devices recover liquids that may contain the target substance 102, i.e., viruses. The first and second reagents can be added to the recovered liquid to create the aforementioned reaction system. In this way, when detecting the target substance 102 contained in a liquid, a homogeneous detection system can be created by simply adding reagents, eliminating the need for bound / free separation. In particular, chemiluminescence in a liquid can be easily detected using solid-state imaging devices such as CCD (charge-coupled device) image sensors and CMOS image sensors. Therefore, by combining this system with a microfluidic device, for example, a simple yet high-performance virus testing device can be fabricated.

[0067] In the above-described system, a specific virus (novel coronavirus (SARS-CoV-2)) was detected as the target substance 102. However, a different target substance 102 can be detected simply by using a second aptamer 101 and binding portion 105 designed for a different target substance 102. In other words, this system is highly versatile and can be easily redesigned for each target substance 102 to be detected. Furthermore, this system can also simultaneously detect multiple different target substances 102. For example, by using multiple types of nucleic acid molecules 100 with different second aptamers 101, the presence of any one of multiple different target substances 102 can be detected.

[0068] In particular, when the first enzyme 103 and the binding part 105 are indirectly bound via a tag peptide and a tag capture peptide, although different binding parts 105 are used depending on the target substances 102, the same tag peptide and tag capture peptide can be used between the first enzyme 103 and the binding part 105. In this case, even if the target substances 102 are different, by preparing the binding part 105 depending on the target substances 102, the target substances 102 can be detected using the same first enzyme 103 and other components via the tag peptide and tag capture peptide.

[0069] [Target Substance Detection 2] Furthermore, the system for detecting a target substance is not limited to the system using the nucleic acid molecule according to the present invention described above, but may also be a detection system such as that shown in FIG. 2 . Similar to the system shown in FIG. 1 , FIG. 2 illustrates a scheme for detecting the novel coronavirus (SARS-CoV-2) as a target substance. The system shown in FIG. 2 detects the virus, particularly the novel coronavirus (SARS-CoV-2), by utilizing the phenomenon that, when a target substance 102 (a virus, particularly the novel coronavirus (SARS-CoV-2)) and a first enzyme 103 coexist in the same reaction system, hydrogen peroxide is generated by the oxidase activity of the first enzyme 103, and a series of reactions between the generated hydrogen peroxide and a second substrate 108 is accelerated. The mechanism by which the coexistence of a virus and the first enzyme 103 in the same reaction system accelerates the series of reactions is unclear, but one hypothesis is that weak peroxidase activity exists on the surface of the virus, catalyzing the reaction between the hydrogen peroxide generated by the first enzyme 103 and the second substrate.

[0070] In the system shown in FIG. 2 , a first enzyme 103 that specifically binds to a target substance 102 is prepared. Here, the first enzyme 103 has oxidase activity that catalyzes an enzymatic reaction using a predetermined substance as a substrate (first substrate 104) and generates hydrogen peroxide. The first enzyme 103 also forms a complex with a binding moiety 105 that specifically binds to the target substance 102. Here, the binding moiety 105 can be a molecule that specifically binds to the target substance 102, i.e., the target substance 102, such as an antibody molecule against the RBD of the novel coronavirus (SARS-CoV-2) or a nucleic acid aptamer that has the ability to bind to the RBD of the novel coronavirus (SARS-CoV-2).

[0071] Examples of the first enzyme 103 that can be used include glucose oxidase, aldehyde oxidase, cytochrome oxidase, catechol oxidase, diphenol oxidase, cholesterol oxidase, cytochrome C oxidase, hypoxanthine oxidase, xanthine oxidase, NADPH oxidase, lactate oxidase, galactose oxidase, and alcohol oxidase.

[0072] The first substrate 104 can be appropriately selected and used depending on the type of the first enzyme 103. The pair of the first enzyme 103 and the first substrate 104 is preferably glucose oxidase and glucose, because glucose, which is the first substrate 104, is a stable compound and is inexpensive.

[0073] The binding moiety 105 is used as a means for binding the first enzyme 103 to the target substance 102, but the binding moiety 105 is not limited to an antibody molecule whose antigen is the RBD of the target substance 102, i.e., the novel coronavirus (SARS-CoV-2), and an ACE2 fragment that interacts with the RBD can also be used. Furthermore, the binding moiety 105 may be an antibody molecule whose antigen is a region of the spike protein of the novel coronavirus (SARS-CoV-2) other than the RBD, or may be an antibody molecule whose antigen is a protein other than the spike protein, such as the N protein, M protein, or E protein.

[0074] When the binding portion 105 is an antibody molecule, the antibody molecule may be any of an immunoglobulin (IgG, IgA, IgM, IgD, IgE) antibody, a heavy chain antibody, and a fragment antibody. An immunoglobulin antibody consists of a heavy chain (VH) and a light chain (LH), and each of the heavy chain and light chain has three CDRs: CDR1, CDR2, and CDR3. A heavy chain antibody consists only of a heavy chain, and the heavy chain has three CDRs: CDR1, CDR2, and CDR3. A fragment antibody is an antibody fragmented using an enzyme or genetic engineering technique, and includes Fab, F(ab'), F(ab')2, Fv, VHH antibody, etc. Furthermore, a fragment antibody also includes scFab, scF(ab'), and scF(ab')2, which are single-chain antibodies formed by linking the light chain and heavy chain constituting Fab, F(ab'), and F(ab')2 via a linker sequence. Here, scFab, scF(ab'), and scF(ab')2 may have a linker sequence attached to the C-terminus of the light chain, and a heavy chain attached to the C-terminus of that. Furthermore, they may have a linker sequence attached to the C-terminus of the heavy chain, and a light chain attached to the C-terminus of that. Furthermore, scFV, which is a single-chain antibody formed by linking the light chain variable region and heavy chain variable region via a linker sequence, can also be used as binding moiety 105.

[0075] When the binding portion 105 is an aptamer, the above-mentioned second aptamer can be used as the aptamer molecule.

[0076] 2, the system also includes a second substrate 108 that serves as a substrate for peroxidase activity on the surface of the target substance 102, specifically the novel coronavirus (SARS-CoV-2). The second substrate 108 is preferably a substance that serves as a substrate for peroxidase activity and allows optical detection of the progress of the peroxidase reaction. Specifically, orthophenylenediamine or luminol can be used as the second substrate 108.

[0077] The system configured as described above can detect a virus, particularly the novel coronavirus (SARS-CoV-2), as the target substance 102 in a reaction system containing the first enzyme 103 fused to the binding moiety 105, the first substrate 104, and the second substrate 108. Specifically, when the target substance 102 is present in the reaction system, the first enzyme 103 indirectly binds to the target substance 102 via the binding moiety 105. In this state, the first enzyme 103 initiates an oxidase reaction using the first substrate 104, generating hydrogen peroxide. Specifically, hydrogen peroxide is generated near the surface of the virus, particularly the novel coronavirus (SARS-CoV-2). Therefore, one hypothesis is that peroxidase activity on the surface of the virus, particularly the novel coronavirus (SARS-CoV-2), initiates a peroxidase reaction using the hydrogen peroxide generated by the enzymatic reaction of the first enzyme 103 and the second substrate 108.

[0078] Therefore, this system can detect the target substance 102 by measuring a chemical reaction that is promoted by the presence of a virus, particularly the novel coronavirus (SARS-CoV-2), and the first enzyme 103 in the same reaction system. For example, if an optically detectable substance such as luminol is used as the second substrate 108, the target substance 102, that is, a virus, particularly the novel coronavirus (SARS-CoV-2), can be detected by measuring the chemiluminescence generated by the so-called luminol reaction. The means for measuring the chemiluminescence is not particularly limited, and may be visual observation or an ultraweak chemiluminescence measurement method.

[0079] On the other hand, when the target substance 102 is not present in a reaction system containing the first enzyme 103 fused to the binding portion 105, the first substrate 104, and the second substrate 108, the first enzyme 103 causes an oxidase reaction using the first substrate 104, generating hydrogen peroxide. However, since the target substance 102, a virus, particularly the novel coronavirus (SARS-CoV-2), is not present in a position close to the first enzyme 103, the second substrate 108 hardly reacts.

[0080] Furthermore, in the above-described method for detecting a target substance 102 using the present system, a first reagent containing at least a first substrate 104 and a second reagent containing at least a first enzyme 103 can be used. Note that components other than the first substrate 104 and the first enzyme 103 (e.g., the second substrate 108) may be contained in either the first reagent or the second reagent, or in both. By separating the first reagent and the second reagent, the progress of the oxidase reaction using the first substrate 104 by the first enzyme 103 can be suppressed during storage of the reagents. Then, when the first reagent and the second reagent are mixed, the oxidase reaction using the first substrate 104 by the first enzyme 103 can be allowed to proceed, and the target substance 102 can be detected as described above.

[0081] The system described above is not particularly limited and can be applied to various situations in which a target substance 102 having peroxidase activity is detected. This system is particularly applicable to systems for detecting viruses, particularly the novel coronavirus (SARS-CoV-2). Applying this system to virus detection allows for rapid and simple virus detection. In one example of a system for detecting viruses using this system, the first and second reagents are sprayed onto a location suspected of virus attachment, creating the aforementioned reaction system. Whether a target substance 102, i.e., a virus, is attached to the location can be determined based on chemiluminescence resulting from the presence of the first enzyme 103 contained in the second reagent and the virus in the same reaction system.

[0082] The present system can also be applied to devices that detect whether viruses, which are target substances 102, are present in the air. Examples of such devices include air purifiers, air conditioners, simple handheld air collectors, air collectors installed at entrances and exits of buildings and rooms, and devices for collecting exhaled or coughed air installed in hospitals, etc. These devices have in common the fact that air is passed through a filter, and the present system can be applied to detect viruses attached to the filter. In this case, the above-described reaction system can be constructed by spraying the first and second reagents onto the filter, or by spraying the first and second reagents onto fine particles or dust collected by the filter. Furthermore, by making the filters in these devices disposable, sequential detection of viruses, which are target substances 102, becomes possible.

[0083] Furthermore, this system can be applied to devices for detecting whether a target substance 102, i.e., a virus, is contained in a liquid. Examples of such devices include devices for collecting saliva or other bodily fluids from patients with feverish symptoms, and devices for collecting liquids soaked in clothing or masks worn by medical professionals. Such devices recover liquids that may contain the target substance 102, i.e., viruses. The first and second reagents can be added to the recovered liquid to create the aforementioned reaction system. In this way, when detecting the target substance 102 contained in a liquid, a homogeneous detection system can be created by simply adding reagents, eliminating the need for bound / free separation. In particular, chemiluminescence in a liquid can be easily detected using solid-state imaging devices such as CCD (charge-coupled device) image sensors and CMOS image sensors. Therefore, by combining this system with a microfluidic device, for example, a simple yet high-performance virus testing device can be fabricated.

[0084] In the above-described system, a specific virus (novel coronavirus (SARS-CoV-2)) was detected as the target substance 102, but a different target substance 102 can be detected simply by using a binding part 105 designed for a different target substance 102. In other words, this system can be said to be a highly versatile system whose design can be easily modified for each target substance 102 to be detected.

[0085] [Target Substance Detection 3] Alternatively, a system for detecting a target substance may be a detection system as shown in FIG. 3 , which does not utilize the nucleic acid molecule according to the present invention. In the system shown in FIG. 3 , the target substance 102 is captured on the surface of a magnetic particle 110 and then detected. The system shown in FIG. 3 detects the target substance 102 by utilizing the phenomenon in which the coexistence of the target substance 102 and the first enzyme 103 in the same reaction system promotes a series of reactions in which hydrogen peroxide is generated by the oxidase activity of the first enzyme 103 and the generated hydrogen peroxide reacts with a second substrate 108. For information on the peroxidase activity of the magnetic particles 110, see Nat. Nanotechnol., 2007, 2, 577-583. In other words, in this system, the peroxidase activity on the surface of the magnetic particles 110 catalyzes the reaction between the hydrogen peroxide generated by the first enzyme 103 and the second substrate.

[0086] In the system shown in Fig. 3, a first enzyme 103 that specifically binds to a target substance 102 is prepared. Here, the first enzyme 103 has oxidase activity that catalyzes an enzymatic reaction using a predetermined substance as a substrate (first substrate 104) and generates hydrogen peroxide. The first enzyme 103 also forms a complex with a binding moiety 105 that specifically binds to the target substance 102. Here, the binding moiety 105 can be a molecule that specifically binds to the target substance 102, such as an antibody molecule or a nucleic acid aptamer against the target substance 102.

[0087] The enzyme and substrate described in [Detection of Target Substance 2] can be used as the first enzyme 103 and the first substrate 104. As described in [Detection of Target Substance 2], an antibody molecule or an aptamer molecule such as the second aptamer described above can be used as appropriate for the binding portion 105. As described in [Detection of Target Substance 2], orthophenylenediamine or luminol can be used as the second substrate 108.

[0088] In particular, in this system, the magnetic particles 110 are not particularly limited, and commercially available magnetic particles or magnetic particles produced by magnetic bacteria can be used. Among these, it is preferable to use magnetic particles produced by magnetic bacteria (also called bacterial magnetic particles (BMP)). Magnetic bacteria are not particularly limited, and examples include Magnetospirillum magnetotacticum MS-1, M. magneticum AMB-1, M. gryphiswaldense MSR-1, Magnetococcus marinus MC-1, Magnetovibrio blakemorei MV1, and Desulfovibrio magneticus RS-1. Magnetic particles produced by these magnetic bacteria can be used as appropriate.

[0089] The magnetic particles 110 carry target substances 102 on their surfaces. There are no particular limitations on the method for carrying target substances 102 on the surfaces of the magnetic particles 110, and examples include a method in which a functional group introduced on the surface of the magnetic particles 110 chemically reacts with a functional group introduced on the target substance 102, and a method in which a means for carrying target substances 102 on the surfaces of the magnetic particles 110 produced by magnetic bacteria is provided.

[0090] In particular, a method of introducing a so-called tag capture peptide 111 onto the surface of a magnetic particle 110 is exemplified. In this case, the target substance 102 has a tag peptide 112, and the tag peptide 112 binds to the tag capture peptide 111, thereby being supported on the surface of the magnetic particle 110. Note that in the example shown in FIG. 3 , the tag capture peptide 111 is introduced onto the surface of the magnetic particle 100, and the tag peptide 112 is introduced into the target substance 102, but this may be reversed. In other words, the tag peptide 112 may be introduced onto the surface of the magnetic particle 100, and the tag capture peptide 111 may be introduced into the target substance 102.

[0091] Examples of tag peptides 112 and tag capture peptides 111 include the SpyTag / SpyCatcher system (Bijan Zakeri et al., PNAS, 109 (12) E690-E697, 2012) and the SnoopCatcher / SnoopTag system (Gianluca Veggiani et al., PNAS, 113 (5) 1202-1207, 2016). Furthermore, the tag peptide 112 and the tag capture peptide 111 may be an improved version of the SpyTag / SpyCatcher system, such as the SpyTag2 / SpyCatcher2 system (Keeble et al., Angew. Chem. Int. Ed. 2017, 56, 16521-16525), or the SpyTag3 / SpyCatcher3 system (Keeble et al., PNAS, 116 (52) 26523-26533, 2019).

[0092] To introduce the tag capture peptide 111 onto the surface of the magnetic particles 110, for example, a magnetosome display technique using a magnetite-binding protein such as Mms13 can be applied. Specifically, a polynucleotide encoding the tag capture peptide 111 is linked downstream of the Mms13 gene, and a fusion protein having the tag capture peptide 111 downstream of Mms13 is expressed in the magnetic bacteria. This allows magnetic particles 110 displaying the fusion protein on their surface to be produced within the magnetic bacteria. The magnetic particles 110 can be recovered from the magnetic bacteria according to standard methods.

[0093] Another method for supporting the target substance 102 on the surface of the magnetic particle 110 is to express a fusion protein having an antibody against the target substance 102 downstream of Mms13 in the magnetic bacterium. This method does not require the introduction of a tag peptide 112 into the target substance 102, and allows the target substance 102 to be supported on the surface of the magnetic particle 110 based on an antibody-antigen reaction.

[0094] In the present system configured as described above, the target substance 102 can be detected in a reaction system in which the first enzyme 103 fused to the binding moiety 105, the first substrate 104, and the second substrate 108 are present. Specifically, when the target substance 102 is present in the reaction system, a state is created in which the first enzyme 103 indirectly binds to the target substance 102 via the binding moiety 105. In this state, the first enzyme 103 causes an oxidase reaction using the first substrate 104 to proceed, generating hydrogen peroxide. That is, hydrogen peroxide is generated near the surface of the magnetic particles 110. Therefore, due to the peroxidase activity present on the surface of the magnetic particles 110, a peroxidase reaction using the hydrogen peroxide generated by the enzymatic reaction of the first enzyme 103 and the second substrate 108 proceeds.

[0095] Therefore, according to this system, the target substance 102 can be detected by measuring a chemical reaction that is promoted by the presence of the target substance 102 and the first enzyme 103 in the same reaction system. For example, when an optically detectable substance such as luminol is used as the second substrate 108, the target substance 102 can be detected by measuring the chemiluminescence generated by the so-called luminol reaction. The means for measuring the chemiluminescence is not particularly limited, and may be visual observation or an ultra-weak chemiluminescence measurement method.

[0096] On the other hand, when the target substance 102 is not present in a reaction system in which the first enzyme 103 fused to the binding portion 105, the first substrate 104, and the second substrate 108 are present, the first enzyme 103 causes an oxidase reaction using the first substrate 104, generating hydrogen peroxide, but since the magnetic particle 110 is not present in a position close to the first enzyme 103, the second substrate 108 hardly reacts.

[0097] Furthermore, in the above-described method for detecting a target substance 102 using the present system, a first reagent containing at least a first substrate 104 and a second reagent containing at least a first enzyme 103 can be used. Note that components other than the first substrate 104 and the first enzyme 103 (e.g., the second substrate 108) may be contained in either the first reagent or the second reagent, or in both. By separating the first reagent and the second reagent, the progress of the oxidase reaction using the first substrate 104 by the first enzyme 103 can be suppressed during storage of the reagents. Then, when the first reagent and the second reagent are mixed, the oxidase reaction using the first substrate 104 by the first enzyme 103 can be allowed to proceed, and the target substance 102 can be detected as described above.

[0098] The system described above is not particularly limited and can be applied to various situations in which a target substance 102 is detected by supporting the target substance 102 on the surface of magnetic particles 110 having peroxidase activity. Viruses can be detected quickly and easily by using a protein that viruses specifically possess as the target substance 102. Furthermore, allergens can be detected quickly and easily by using a specific allergen as the target substance 102.

[0099] Furthermore, similar to the system described in [Target Substance Detection 2], this system can be applied to a device that detects whether a target substance 102 is contained in the air. That is, it can detect a target substance that has adhered to a filter through which air passes.

[0100] Furthermore, similar to the system described in [Target Substance Detection 2], this system can be applied to a device for detecting whether a target substance 102 is contained in a liquid. In such a device, a liquid that may contain the target substance 102 is collected. The first and second reagents can be added to the collected liquid to create the aforementioned reaction system. In this way, when detecting the target substance 102 contained in the liquid, a homogeneous detection system can be created that does not require bound / free separation by simply adding reagents. In particular, chemiluminescence in the liquid can be easily detected using a solid-state imaging device such as a CCD (charge-coupled device) image sensor or a CMOS image sensor. Therefore, by combining this system with a microfluidic device, for example, a simple yet high-performance virus testing device can be fabricated.

[0101] In particular, this system can detect target substances 102 by carrying the target substances 102 on the surfaces of magnetic particles 110. The magnetic particles 110 carrying the target substances 102 can be accumulated by magnetic force, and the chemiluminescence generated by a luminol reaction or the like can be made highly sensitive. Therefore, even target substances 102 present at extremely low concentrations can be detected with high accuracy by using this system.

[0102] [Detection of Hemoglobin] By utilizing the first aptamer described above, a system for detecting hemoglobin with high accuracy can be constructed. An outline of this system is shown in FIG. 4. In this system, as shown in FIG. 4, an aptamer molecule 200 consisting of the first aptamer described above and a first enzyme 202 that specifically binds to hemoglobin 201 are prepared. Here, the first enzyme 202 has oxidase activity that catalyzes an enzymatic reaction using a predetermined substance as a substrate (first substrate 203) to generate hydrogen peroxide. Furthermore, the first enzyme 202 forms a complex with an antibody 204 that specifically binds to hemoglobin 201. Here, the antibody 204 can be an antibody molecule against hemoglobin 201.

[0103] Examples of the first enzyme 202 that can be used include glucose oxidase, aldehyde oxidase, cytochrome oxidase, catechol oxidase, diphenol oxidase, cholesterol oxidase, cytochrome C oxidase, hypoxanthine oxidase, xanthine oxidase, and NADPH oxidase. Among these, it is preferable to use glucose oxidase as the first enzyme 202.

[0104] The first substrate 203 can be appropriately selected and used depending on the type of the first enzyme 202. The pair of the first enzyme 202 and the first substrate 203 is preferably glucose oxidase and glucose, because glucose, which is the first substrate 203, is a stable compound and is inexpensive.

[0105] The means for binding the first enzyme 202 to the hemoglobin 201 is not limited to the antibody 204 which uses the hemoglobin 201 as an antigen, but may also use an aptamer molecule (an aptamer other than the aptamer molecule 200), a protein, or a partial fragment thereof that interacts with the hemoglobin 201. The antibody 204 may use any region of the hemoglobin 201 as an epitope.

[0106] 4, the present system also includes a second substrate 205 that serves as a substrate for hemoglobin 201 having peroxidase activity. The second substrate 205 is preferably a substance that can optically detect the progress of the peroxidase reaction caused by hemoglobin 201. Specifically, orthophenylenediamine or luminol can be used as the second substrate 205.

[0107] 4, the present system preferably includes a third enzyme that consumes, as a substrate, hydrogen peroxide generated by the oxidase reaction of the first enzyme 202. The third enzyme is an enzyme that consumes hydrogen peroxide as a substrate, and for example, catalase can be used.

[0108] In the present system configured as described above, hemoglobin 201, which is a target substance, can be detected in a reaction system containing aptamer molecule 200, first enzyme 202 fused to antibody 204, first substrate 203, and second substrate 205. Specifically, when hemoglobin 201 is present in the reaction system, the aptamer molecule 200 binds to hemoglobin 201, and the first enzyme 202 indirectly binds to hemoglobin 201 via the antibody 204. In this state, an oxidase reaction using the first substrate 203 by the first enzyme 202 proceeds, generating hydrogen peroxide. Because hemoglobin 201 is located in close proximity to the first enzyme 202, it consumes the hydrogen peroxide generated by the enzymatic reaction of the first enzyme 202. This allows a peroxidase reaction using the second substrate 205 by hemoglobin 201 to proceed.

[0109] Therefore, according to this system, hemoglobin 201 can be detected by measuring the peroxidase reaction of hemoglobin 201 using second substrate 205. For example, when an optically detectable substance such as luminol is used as second substrate 205, hemoglobin 201 can be detected by measuring chemiluminescence generated by a so-called luminol reaction. The means for measuring chemiluminescence is not particularly limited, and may be visual observation or an ultra-weak chemiluminescence measurement method.

[0110] On the other hand, when hemoglobin 201 is not present in a reaction system containing aptamer molecule 200, first enzyme 202 fused to antibody 204, first substrate 203, and second substrate 205, the first enzyme 202 causes an oxidase reaction using first substrate 203, generating hydrogen peroxide, but the hemoglobin 201 does not cause a peroxidase reaction using second substrate 205.

[0111] Furthermore, in the above-described method for detecting hemoglobin 201 using the present system, a first reagent containing at least a first substrate 203 and a second reagent containing at least a first enzyme 202 can be used. Note that components other than the first substrate 203 and the first enzyme 202 (e.g., the aptamer molecule 200) may be contained in either the first reagent or the second reagent, or in both. By separating the first and second reagents, the progress of the oxidase reaction using the first substrate 203 by the first enzyme 202 can be suppressed during storage of the reagents. Then, when the first and second reagents are mixed, the oxidase reaction using the first substrate 203 by the first enzyme 202 can be allowed to proceed, and hemoglobin 201 can be detected as described above.

[0112] The present invention will be described in more detail below using examples, but the technical scope of the present invention is not limited to the following examples.

[0113] Example 1: Preparation of antibody-enzyme conjugates In this example, SpyCatcher-fused glucose oxidase and SpyTag-fused anti-SARS-CoV-2 S protein antibodies were prepared by recombinant production using Escherichia coli BL21(DE3) strain. For the SpyCatcher-fused glucose oxidase, a fusion protein consisting of glucose oxidase (GOx) and SpyCatcher in this order from the N-terminus (referred to as GOx-SpyCatcher) was prepared, while another fusion protein consisting of SpyCatcher and GOx in this order from the N-terminus (referred to as SpyCatcher-GOx) was prepared. Furthermore, two types of SpyTag-fused anti-SARS-CoV-2 S protein antibodies were prepared: one with a variable domain of heavy chain of heavy chain antibody (VHH) and the other with a single-chain variable fragment (scFv) antibody moiety.

[0114] The amino acid sequence of GOx-SpyCatcher is shown in SEQ ID NO: 17, and the amino acid sequence of SpyCatcher-GOx is shown in SEQ ID NO: 18. The amino acid sequence of the SpyTag-fused anti-SARS-CoV-2 S protein VHH is shown in SEQ ID NO: 19, and the amino acid sequence of the SpyTag-fused anti-SARS-CoV-2 S protein scFv is shown in SEQ ID NO: 20.

[0115] Complex formation experiments were performed using SpyCatcher-GOx and SpyTag-fused anti-SARS-CoV-2 S protein VHH or SpyTag-fused anti-SARS-CoV-2 S protein scFv as follows: SpyCatcher-GOx and SpyTag-fused anti-SARS-CoV-2 S protein VHH, or SpyCatcher-GOx and SpyTag-fused anti-SARS-CoV-2 S protein scFv, were stoichiometrically mixed and incubated. The mixtures were diluted to 10 μM and 5 μM in phosphate buffer (pH 7.0), respectively, and then mixed in equal amounts and incubated overnight at 4°C.

[0116] The bands were then confirmed by SDS-polyacrylamide gel electrophoresis (SDS-PAGE). The SDS-PAGE results are shown in Figure 5. As shown in Figure 5, for all combinations, a clear band was observed near the molecular weight predicted for the formation of a complex between GOx and the antibody (VHH or scFv) via covalent bond formation between SpyCatcher and SpyTag. From these results, we concluded that a complex had been formed between glucose oxidase and the antibody against the SARS-CoV-2 S protein.

[0117] Example 2: Measurement of oxidase activity of antibody-enzyme conjugate. In this example, the oxidase activity of GOx, SpyCatcher-fused GOx, and the antibody-enzyme conjugate prepared in Example 1 was measured. 20 μL of diluted measurement sample was mixed with 160 μL of phosphate buffer (pH 7.0) containing 4-aminoantipyrine (4AA) at a final concentration of 1.5 mM, N-ethyl-N-(2-hydroxy-3-sulfopropyl)-3-methoxyaniline (TOOS) at a final concentration of 1.5 mM, and horseradish peroxidase at a final concentration of 2 U / mL. 20 μL of glucose at final concentrations of 0, 10, 20, 50, 100, and 200 mM was added, and immediately thereafter, the absorbance at 555 nm was measured over 30 seconds using a Shimadzu spectrophotometer. The resulting change in absorbance, cell length (1 cm), and molar extinction coefficient ε (39.2 mM) of the reaction product of 4AA and TOOS were used. -1 cm -1 ) to obtain the kinetic parameters (Km, V max ) was calculated.

[0118] The results are shown in FIG.

[0119]

[0120] As a result, no significant changes in Km were observed due to SpyCatcher fusion and complex formation. max Regarding V, a slight decrease was observed by fusion with SpyCatcher, and a further decrease was observed by antibody-enzyme complex formation. Furthermore, when SpyCatcher was fused to the N-terminus of GOx, V was slightly decreased compared to when it was fused to the C-terminus. maxwas confirmed to be high.

[0121] Example 3: Evaluation of Fusion Aptamer Structure by Circular Dichroism (CD) Spectroscopy and Evaluation of Structural Changes Upon Target Binding In this example, fusion aptamers were synthesized between an aptamer (RBD-46) that binds to the RBD of the SARS-CoV-2 S protein and an aptamer (PEA3-01) that enhances peroxidase activity, as disclosed in JP 2017-200472 A. The fusion aptamers synthesized in this example were RBD-46-PEA3-01 (SEQ ID NO: 21), in which RBD-46 and PEA3-01 are arranged in this order from the 5' to the 3' end, and PEA3-01-RBD-46 (SEQ ID NO: 22), in which PEA3-01 and RBD-46 are arranged in this order from the 5' to the 3' end, and were produced by chemical synthesis. In addition, in these RBD-46-PEA3-01 and PEA3-01-RBD-46, a ttt sequence is inserted between PEA3-01 and RBD-46.

[0122] The synthesized fusion aptamers (RBD-46-PEA3-01, PEA3-01-RBD-46) were prepared in potassium acetate buffer (pH 5.0) to a final concentration of 10 μM. They were then folded by heating at 95°C for 10 minutes and slowly cooling to 25°C. The CD spectra of the folded fusion aptamers were measured at wavelengths of 220–320 nm using a J-720 circular dichroism spectrometer (JASCO) in a quartz cell (1 cm path length). Measurements were performed after diluting the aptamers with potassium phosphate buffer (pH 7.0) to a final concentration of 1 μM and incubating at room temperature for 1 hour. The aptamers were also mixed with 50 dC inactivated SARS-CoV-2 virus (Sugiyamagen) or 50 dC inactivated SARS-CoV-2 virus and myoglobin (Life Diagnostics) at a final concentration of 1 μM, and then incubated at room temperature for 1 hour. Data processing was performed by subtracting the measurement results in the absence of the fusion aptamer under each condition.

[0123] A G4 structure is formed by a plane of four guanines aligned parallel to the vertical axis. This G4 structure can be broadly classified as parallel or antiparallel, depending on the order of the guanines. In CD spectroscopy, a positive peak near 260 nm and a negative peak near 240 nm are observed, indicating a parallel structure. A positive peak near 290 nm and a negative peak near 260 nm are observed, indicating an antiparallel structure. The fusion aptamer evaluated in this study exhibited a positive peak near 290 nm and a negative peak near 240 nm, suggesting a mixture of parallel and antiparallel structures (Figure 7). This is likely due to the fact that the fusion aptamer used in this study is composed of two aptamers linked together. On the other hand, when inactivated SARS-CoV-2 virus or inactivated SARS-CoV-2 virus mixed with myoglobin, a shoulder was observed in the spectrum near 260 nm. These results indicated that the RBD-46 portion of the fusion aptamer binds to SARS-CoV-2, stabilizing the parallel structure, and that this state is maintained even when mixed with myoglobin.

[0124] Example 4: Investigation of fusion aptamer folding conditions by blotting. In this example, biotinylated fusion aptamers (RBD-46-PEA3-01, PEA3-01-RBD-46) were diluted to 1 μM using four buffers: sodium acetate buffer (pH 5.0) or sodium phosphate buffer (pH 7.0) combined with potassium chloride at 10 mM or 150 mM. Folding was performed as in Example 3. 0.35 μg and 3.5 μg of myoglobin or 5dC and 20dC inactivated SARS-CoV-2 virus were spotted onto a nitrocellulose membrane and allowed to air-dry. The membrane was blocked with 2% bovine serum albumin and washed with sodium phosphate buffer containing 0.05% Tween-20. The plates were immersed in biotinylated fusion aptamer diluted to a final concentration of 100 nM with sodium phosphate buffer containing various potassium chloride concentrations and incubated for 1 hour at room temperature. After washing, commercially available streptavidin-fused alkaline phosphatase was diluted 1000-fold and incubated for 1 hour at room temperature. The chemiluminescent substrate CDP-Star (Sigma-Aldrich) was added and incubated for 5 minutes at room temperature. Chemiluminescence was then observed using an ImageQuant LAS4000 chemiluminescence imager (GE Healthcare).

[0125] The results are shown in Figure 8. As shown in Figure 8, strong chemiluminescence was observed when either sodium acetate buffer or sodium phosphate buffer was used, and whether the potassium chloride concentration was 10 mM or 150 mM. In particular, strong chemiluminescence was observed for both targets with the fusion aptamer folded using sodium phosphate buffer (pH 7.0) containing 10 mM potassium chloride.

[0126] Example 5: Investigation of the mixing ratio of myoglobin and fusion aptamer Folding was performed in the same manner as in Example 3 for the fusion aptamer (PEA3-01-RBD-46) diluted to 10 μM with sodium phosphate buffer (pH 7.0) containing 10 mM potassium chloride. Myoglobin (Life Diagnostics) at a final concentration of 100 nM and the fusion aptamer were diluted with sodium phosphate buffer (pH 7.0) containing 10 mM potassium chloride to give molar ratios of 1:10, 1:5, 1:2, 1:1, 1:0.5, 1:0.1, and 1:0, and 10 μL of each mixture was mixed in a 96-well plate and allowed to stand at room temperature for 1 hour. 80 μL of 50 mM Tris buffer (pH 8.0) containing hydrogen peroxide (Kanto Chemical) at a final concentration of 0.5 mM, luminol (Tokyo Chemical Industry) at a final concentration of 100 μM, and potassium chloride at a final concentration of 10 mM was added, and the chemiluminescence intensity was immediately measured every minute using a plate reader (Thermo Fisher Scientific).

[0127] The results are shown in Figure 9. As shown in Figure 9, the chemiluminescence intensity increased in a mixing ratio-dependent manner up to a mixing ratio of 1:5. Three minutes after the start of measurement, the chemiluminescence intensity was found to be up to 374-fold higher when five times the amount of fusion aptamer was added compared to the intensity in the absence of the fusion aptamer, demonstrating that the peroxidase activity of myoglobin was greatly enhanced by the fusion aptamer.

[0128] Example 6: Detection of Inactivated SARS-CoV-2 Virus 1. An antibody-enzyme conjugate was prepared using the anti-SARS-CoV-2 S protein antibody scFv prepared in Example 1 and SpyCatcher-GOx. As described in Example 4, the fusion aptamer (PEA3-01-RBD-46) was folded in sodium phosphate (pH 7.0) containing 10 mM potassium chloride. 5 μL each of 1 μM antibody-enzyme conjugate, 2 μM myoglobin, 10 μM fusion aptamer, and 50 dC, 30 dC, or 10 dC inactivated SARS-CoV-2 virus was mixed in a 96-well plate and incubated at room temperature for 1 hour. For comparison, a similar experiment was performed using 50 particles of inactivated influenza virus (Sino Bio) or 500 ng of bovine serum albumin (Thermo Fisher Scientific) instead of the inactivated SARS-CoV-2 virus. Eighty microliters of Tris buffer (pH 8.0) containing glucose (Fujifilm Wako Pure Chemical Industries, Ltd.) at a final concentration of 100 mM, luminol (Tokyo Chemical Industry Co., Ltd.) at a final concentration of 100 μM, catalase (Fujifilm Wako Pure Chemical Industries, Ltd.) at a final concentration of 0.1 nM, and potassium chloride at a final concentration of 10 mM was added, and the chemiluminescence intensity was immediately measured using a plate reader.

[0129] Figure 10 shows the results of measuring chemiluminescence intensity 2 minutes after the start of measurement. An increase in chemiluminescence intensity dependent on the amount of inactivated virus was confirmed from 10 dC to 50 dC. On the other hand, the inactivated influenza virus and bovine serum albumin used for comparison showed chemiluminescence intensity at the same level as the background. Therefore, it was demonstrated that inactivated SARS-CoV-2 can be detected. The sensitivity, which is the slope of the calibration curve, was 39 dC. -1 The detection limit, which is three times the standard deviation of the background, was calculated to be 9.8 dC.

[0130] Example 7: Detection of Inactivated SARS-CoV-2 Virus 2 An antibody-enzyme conjugate was prepared using the anti-SARS-CoV-2 S protein antibody scFv prepared in Example 1 and SpyCatcher-GOx. In this example, the fusion aptamer used was PS2.M-RBD-46, consisting of the nucleotide sequence of SEQ ID NO: 43, unlike the fusion aptamer (PEA3-01-RBD-46) used in Example 4. This fusion aptamer (PS2.M-RBD-46) was designed with PS2.M and RBD-46 arranged in this order from the 5' end to the 3' end and produced by chemical synthesis. PS.2 is known as an aptamer that binds to hemin and enhances its peroxidase activity, as disclosed in Cheng et al., Biochemistry, 2009, 48, 7817-7823.

[0131] In this example, the fusion aptamer (PS2.M-RBD-46) was folded in sodium phosphate (pH 7.0) containing 10 mM potassium chloride. 5 μL each of 1 μM antibody-enzyme conjugate, 1 μM hemin, 1 μM fusion aptamer, and inactivated SARS-CoV-2 virus at 50 dC, 25 dC, 12.5 dC, 5 dC, or 2.5 dC was mixed in a 96-well plate and incubated at room temperature for 1 hour. Eighty μL of a reaction solution consisting of 200 mM glucose (Fujifilm Wako Pure Chemical Industries) and BM chemiluminescent ELISA substrate (POD) solution A (Roche) was added, and the chemiluminescence intensity was immediately measured using a plate reader.

[0132] The results of measuring the chemiluminescence intensity in this example are shown in Figure 11. As shown in Figure 11, a viral load-dependent increase in chemiluminescence was observed across the range of inactivated SARS-CoV-2 viral loads tested. This example demonstrated that inactivated SARS-CoV-2 can be detected using hemin as the porphyrin and an aptamer that increases the peroxidase activity of hemin as the fusion aptamer.

[0133] Example 8: Detection of inactivated SARS-CoV-2 virus under modified conditions 3 An antibody-enzyme conjugate was prepared using the anti-SARS-CoV-2 S protein antibody scFv and SpyCatcher-GOx prepared in Example 1. In this example, the fusion aptamer (PS2.M-RBD-46) was folded in sodium phosphate (pH 7.0) containing 10 mM potassium chloride, as in Example 7. 5 μL each of 1 μM antibody-enzyme conjugate, 1 μM hemin, 1 μM fusion aptamer, and 50 dC, 25 dC, 12.5 dC, 5 dC, or 2.5 dC inactivated SARS-CoV-2 virus was mixed in a 96-well plate and allowed to stand at room temperature for 1 hour. For comparison, a similar experiment was performed using 50 particles of inactivated influenza virus (Sino Bio) or 500 ng of bovine serum albumin (Thermo Fisher Scientific) instead of the inactivated SARS-CoV-2 virus. After adding 80 μL of a reaction solution consisting of a final concentration of 154 mM glucose (Fujifilm Wako Pure Chemical Industries, Ltd.), a final concentration of 24 ng / mL catalase (Fujifilm Wako Pure Chemical Industries, Ltd.), and BM chemiluminescent ELISA substrate (POD) solution A (Roche), the chemiluminescence intensity was immediately measured using a plate reader.

[0134] The results of measuring the chemiluminescence intensity in this example are shown in Figure 12. As shown in Figure 12, a virus amount-dependent increase in chemiluminescence was observed within the range of inactivated SARS-CoV-2 virus amounts tested, as in Example 7. In particular, in this example, it was confirmed that the chemiluminescence intensity was generally even greater than under the conditions of Example 7. On the other hand, the chemiluminescence intensity was confirmed to be at the same level as the background when using inactivated influenza virus and bovine serum albumin used for comparison.

[0135] Example 9: Visual Detection of Inactivated SARS-CoV-2 Virus In this example, the mixing ratio of the fusion aptamer (PS2.M-RBD-46) and hemin was varied to investigate a reaction system for visual detection of inactivated SARS-CoV-2 virus. In this example, the fusion aptamer (PS2.M-RBD-46) was also folded in sodium phosphate buffer (pH 7.0) containing 10 mM potassium chloride. Five μL each of 10 μM fusion aptamer and various concentrations of hemin (100 μM, 70 μM, 50 μM, 20 μM, 10 μM, or 5 μM) was mixed with 10 μL of sodium phosphate buffer (pH 7.0) containing 10 mM potassium chloride in a 96-well low-protein-binding plate and allowed to stand at room temperature for 1 hour. 80 μL of a reaction solution consisting of glucose (Fujifilm Wako Pure Chemical Industries, Ltd.) with a final concentration of 200 mM, hydrogen peroxide (Fujifilm Wako Pure Chemical Industries, Ltd.) with a final concentration of 0.1 mM, and BM chemiluminescent ELISA substrate (POD) solution A (Roche) was added, and the chemiluminescence intensity was immediately measured using a plate reader.

[0136] The results of measuring the chemiluminescence intensity in this example are shown in Figure 13. As shown in Figure 13, it was found that extremely excellent chemiluminescence intensity could be achieved when the mixing ratio of the fusion aptamer (PS2.M-RBD-46) to hemin (fusion aptamer:hemin) was 1:5, i.e., when the hemin concentration was more than five times the aptamer concentration.

[0137] Example 10: Visual Detection of Inactivated SARS-CoV-2 Virus In this example, a system for visual detection of inactivated SARS-CoV-2 virus was constructed. An antibody-enzyme conjugate was prepared using the anti-SARS-CoV-2 S protein antibody scFv and SpyCatcher-GOx prepared in Example 1. In this example, the fusion aptamer (PS2.M-RBD-46) was folded in sodium phosphate (pH 7.0) containing 10 mM potassium chloride, as in Example 7. 5 μL each of 1 μM antibody-enzyme conjugate, 50 μM hemin, 10 μM fusion aptamer, and 50 dC, 40 dC, 25 dC, or 15 dC inactivated SARS-CoV-2 virus was mixed in a 96-well plate and allowed to stand at room temperature for 1 hour. For comparison, a similar experiment was performed using 50 particles of inactivated influenza virus (Sino Bio) or 500 ng of bovine serum albumin (Thermo Fisher Scientific) instead of inactivated SARS-CoV-2 virus. A reaction solution (80 μL) consisting of a final concentration of 200 mM glucose (Fujifilm Wako Pure Chemical Industries, Ltd.), a final concentration of 24 ng / mL catalase (Fujifilm Wako Pure Chemical Industries, Ltd.), and BM chemiluminescent ELISA substrate (POD) solution A (Roche) was added, and the chemiluminescence intensity was immediately measured using a plate reader. The reaction solution was then placed on a plate, and the plate was imaged using the iPhone® 12 camera to detect chemiluminescence.

[0138] The results of measuring the chemiluminescence intensity in this example are shown in Figure 14, and the results of capturing images using an iPhone (registered trademark) 12 are shown in Figure 15. As shown in Figure 14, under the conditions of this example, a significantly high chemiluminescence intensity was observed, and it was confirmed that the chemiluminescence intensity increased depending on the amount of virus. Furthermore, as shown in Figure 15, under the conditions of this example, it was demonstrated that the chemiluminescence on the plate could be detected using the camera function of the iPhone (registered trademark) 12 (ISO sensitivity: 8000, F-number: 1.6, shutter speed: 1.1 seconds (3-second capture in night mode)). Note that under these conditions, a 1.5 x 10 7 It was possible to detect up to about au.

[0139] Example 11: Detection of Inactivated SARS-CoV-2 Virus by Spraying Reaction Solution This example aimed to develop a system capable of on-site virus detection, and examined whether inactivated SARS-CoV-2 virus could be detected by spraying the reaction solution. In this example, inactivated SARS-CoV-2 at 50 dC, 25 dC, or 0 dC was spotted onto a nitrocellulose membrane and allowed to dry at room temperature for several minutes. Next, 15 μL of a reaction solution containing 333 nM antibody-enzyme conjugate, 3.3 μM fusion aptamer, and 16.7 μM hemin was spotted onto the membrane and incubated for 20 minutes at room temperature. An 800 μL dispenser was filled with a detection solution consisting of BM chemiluminescent ELISA substrate (POD) solution A (Roche) containing a final concentration of 250 mM glucose (Fujifilm Wako Pure Chemical Industries) and a final concentration of 30 ng / mL catalase (Fujifilm Wako Pure Chemical Industries). Finally, the detection solution was sprayed onto the membrane, and the membrane was photographed using the camera function of the iPhone (registered trademark) 12 to detect chemiluminescence.

[0140] The results of imaging the membrane surface with an iPhone® 12 are shown in Figure 16. As shown in Figure 16, spraying the detection solution demonstrated that the inactivated SARS-CoV-2 virus spotted on the nitrocellulose membrane could be detected using the camera function of the iPhone® 12 (ISO sensitivity: 4000, F value: 1.6, shutter speed: 3.3 seconds (29 seconds in night mode)). Under these conditions, a 9.0 × 10 5 It was possible to detect up to about au.

[0141] Example 12 Preparation of Antibody-Enzyme Conjugate for Influenza Virus Detection In this example, a SpyTag-fused anti-influenza virus hemagglutinin antibody scFv (SEQ ID NO: 44) was prepared by recombinant production using Escherichia coli BL21(DE3) strain. In this example, an antibody-enzyme conjugate was also prepared by mixing SpyCatcher-GOx, which was prepared in the same manner as in Example 1, with the SpyTag-fused anti-influenza virus hemagglutinin antibody scFv.

[0142] The prepared antibody-enzyme conjugate was then examined for bands by SDS-PAGE. The results are shown in Figure 17. A clear band was observed near the molecular weight predicted for the complex formed by covalent bond formation between SpyCatcher and SpyTag. From these results, it was concluded that a complex had been formed between glucose oxidase and an antibody against influenza virus hemagglutinin.

[0143] Example 13: Detection of inactivated influenza virus In this example, a fusion aptamer was synthesized between an aptamer (2R-01, SEQ ID NO: 45) that binds to influenza virus hemagglutinin and an aptamer (PEA3-01) that enhances peroxidase activity, as disclosed in JP 2017-200472 A. The fusion aptamer synthesized in this example was designed as PEA3-01-2R-01 (SEQ ID NO: 46), in which PEA3-01 and 2R-01 are arranged in this order from the 5' end to the 3' end, and produced by chemical synthesis. In addition, PEA3-01-2R-01 has a ttt sequence inserted between PEA3-01 and 2R-01.

[0144] In this example, PEA3-01-2R-01 was folded using sodium phosphate buffer (pH 7.0) containing 10 mM potassium chloride, as in Example 4. A 96-well plate was charged with 1 μM antibody-enzyme conjugate, 2 μM myoglobin, 10 μM PEA3-01-2R-01, 55 × 10 4 , 40×10 4 , 20×10 4 , 55×10 3 , 22×10 3 or 55 x 10 2 5 μL of each of the inactivated influenza virus particles was mixed and allowed to stand at room temperature for 1 hour. In this example, the reagents were mixed in the same manner as in Example 6, and the chemiluminescence intensity was measured.

[0145] The measurement results of the chemiluminescence intensity 2 minutes after the start of the measurement are shown in Figure 18. As shown in Figure 18, 4 From 55 x 10 2The chemiluminescence intensity increased depending on the amount of inactivated influenza virus particles. This example demonstrates that it is possible to detect influenza viruses as well as SARS-CoV-2 viruses.

[0146] Example 14: Detection of inactivated SARS-CoV-2 using antibody-enzyme conjugate In this example, a system for detecting inactivated SARS-CoV-2 virus was constructed without using a fusion aptamer, but using an antibody-enzyme conjugate consisting of the anti-SARS-CoV-2 S protein antibody scFv and SpyCatcher-GOx prepared in Example 1 (Figure 2).

[0147] In this example, 5 μL each of 1 μM antibody-enzyme conjugate, 50dC, 25dC, 12.5dC, 5dC, or 2.5dC inactivated SARS-CoV-2 virus, and 10 μL of sodium phosphate (pH 7.0) containing 10 mM potassium chloride were mixed into a 96-well plate and incubated at room temperature for 1 hour. For comparison, a similar experiment was performed using 50 particles of inactivated influenza virus (Sino Bio) or 500 ng of bovine serum albumin (Thermo Fisher Scientific) instead of the inactivated SARS-CoV-2 virus. Eighty μL of a reaction solution consisting of 154 mM glucose (Fujifilm Wako Pure Chemical Industries), 24 ng / mL catalase (Fujifilm Wako Pure Chemical Industries), and BM chemiluminescent ELISA substrate (POD) solution A (Roche) was added, and the chemiluminescence intensity was immediately measured using a plate reader.

[0148] The results of measuring the chemiluminescence intensity in this example are shown in Figure 19. As shown in Figure 19, an increase in chemiluminescence intensity dependent on the amount of inactivated SARS-CoV-2 virus was confirmed from 2.5 to 25 dC. This example demonstrated that the virus (inactivated SARS-CoV-2 in this example) can be detected using the antibody-enzyme conjugate prepared in Example 1, luminol reagent, and glucose, by utilizing the promotion of the luminol reaction due to the presence of the virus and the antibody-enzyme conjugate in the same reaction system.

[0149] Example 15: Detection of inactivated SARS-CoV-2 virus and examination of reaction time. 1 μM antibody-enzyme conjugate, 2 μM myoglobin, 10 μM fusion aptamer, and 50 dC, 30 dC, or 10 dC inactivated SARS-CoV-2 virus were mixed in a 96-well plate (5 μL each) and allowed to stand at room temperature for 15 minutes. Chemiluminescence intensity was measured as in Example 6. The results of chemiluminescence intensity measurements taken 2 minutes after the start of measurement are shown in Figure 20. As shown in Figure 20, an increase in chemiluminescence intensity dependent on the amount of inactivated virus was observed from 50 dC to 500 dC. The results of this example demonstrate that inactivated SARS-CoV-2 virus can be detected in a shorter time.

[0150] Example 16: Preparation of Mms13-SC-Flag-BMP In this example, to construct the system shown in Figure 3, magnetic particles (referred to as Mms13-SC-Flag-BMP) bearing a fusion protein of Mms13 protein and Spycatcher (hereinafter referred to as SC) on their surface were prepared. The fusion protein of Mms13 protein and SC has a Flag tag fused downstream (C-terminal side) of SC so that it can be detected with a tag antibody. First, the magnetic bacterium Magnetospirillum magneticum AMB-1 wild-type strain was cultured at OD 660 After aerobic cultivation until the pH reached 0.3, the cells were centrifuged at 8,000 g for 10 minutes at 4°C. The bacterial pellet was washed with TES buffer (10 mM TES, 272 mM glycerol, pH 7.4) to prepare competent cells. The expression vector pUMtOR13-SC-Flag, which fused SpyCatcher (SC) and Flag tag to Mms13, was constructed and used to transform the magnetic bacterium M. magneticum AMB-1 strain by electroporation. The vector was then incubated in 10 mM Mg 2+The transformants were then inoculated into 40 mL of MSGM medium (Amp, fc 0.5 μg / mL) and cultured for 6 to 12 hours to recover. The transformants were then inoculated into 40 mL of MSGM medium (Amp, fc 5 μg / mL), and the atmosphere was replaced with argon to create microaerobic conditions. The transformants were then cultured at 28°C for approximately 5 days. The transformants were then subcultured in 40 mL of MSGM medium (Amp, fc 5 μg / mL) and cultured under the same conditions until the stationary phase. The initial bacterial cell concentration was 1.0 × 10 5 After inoculation at 100 cells / mL and incubation at 28°C, the cells reached the mid-logarithmic growth phase (3.0-5.0 × 10 7 ATc (100 ng / mL), succinic acid (1.52 mM), sodium nitrate (3.16 mM), and iron(II) sulfate heptahydrate (0.194 mM) were added to the medium and filter-sterilized for expression induction. The medium was then cultured for 2 days in the dark. The culture was centrifuged at 8,000 xg for 15 minutes at 4°C. The resulting cells were suspended in 10 mM HEPES buffer (pH 7.4) and disrupted using a French press (Otake Seisakusho). The cells were then magnetically separated using a neodymium-iron-boron (Nd-Fe-B) magnet, and the supernatant was removed and resuspended in HEPES. This procedure was repeated 10 times to obtain purified Mms13-SC-Flag-BMP. The nucleotide sequence encoding the Mms13-SC-Flag fusion protein and the amino acid sequence of the fusion protein are shown in SEQ ID NOs: 47 and 48, respectively. In the amino acid sequence shown in SEQ ID NO: 48, the 1st to 127th positions counting from the N-terminus are Mms13, the 128th to 243rd positions are Spycatcher, and the 244th to 251st positions are Flag tag.

[0151] Next, we confirmed the expression of the Mms13-SC-Flag fusion protein in purified Mms13-SC-Flag-BMP. Purified Mms13-SC-Flag-BMP (100 μg) was added with 5 μL of 1% SDS and heated at 99°C for 15 min to extract the membrane protein fraction from BMP. Five μL of the supernatant was collected by magnetic separation and spotted onto a nitrocellulose membrane, which was then air-dried and fixed. Blocking was then performed by shaking for 1 hour in PBS-T containing 2% (w / v) bovine serum albumin (BSA). The membrane was washed three times with PBS-T (0.05% (v / v) Tween 20 in PBS buffer) and then incubated with anti-Flag antibody diluted 1:5000 in PBS-T for 1 hour. After washing three times with PBS-T, it was incubated with HRP-conjugated anti-mouse antibody diluted 1:5000 in PBS-T for 1 hour. After washing three times with PBS-T, Immobilon Western Chemiluminescent HRP Substrate (Roche) was added. After leaving the plate at room temperature for 5 minutes in the dark, the chemiluminescence intensity was measured using an ImageQuant LAS4000 (GE Healthcare). The same procedure was performed on Mms13-BMP without SC-Flag fusion as a negative control.

[0152] The results are shown in Figure 21. As shown in Figure 21, the membrane fraction of Mms13-SC-Flag-BMP exhibited stronger chemiluminescence intensity than the membrane fraction of Mms13-BMP. This demonstrated that the Mms13-SC-Flag fusion protein was expressed in the magnetic bacteria and that magnetic particles (Mms13-SC-Flag-BMP) bearing the Mms13-SC-Flag fusion protein on their surface had been produced.

[0153] Example 17: Functional Evaluation of Mms13-SC-Flag-BMP (Complex Formation Evaluation) 1.5 mg of Mms13-SC-Flag-BMP prepared in Example 16 was mixed with 50 μL of 7.5 μM variable domain of heavy chain of heavy chain antibody-SpyTag (VHH-ST) prepared by recombinant production using Escherichia coli BL21(DE3) strain, and the mixture was incubated overnight at 4°C. This resulted in the production of a VHH-presenting BMP (VHH-BMP) via a reaction between the SC in Mms13-SC-Flag-BMP and the ST in VHH-ST (SC / ST reaction). The nucleotide sequence encoding the VHH-ST fusion protein prepared in this example and the amino acid sequence of the fusion protein are shown in SEQ ID NOs: 49 and 50, respectively. In the amino acid sequence shown in SEQ ID NO: 50, positions 23 to 149 from the N-terminus correspond to VHH, and positions 156 to 168 correspond to SpyTag.

[0154] Unreacted VHH-ST was removed by magnetic separation. The VHH-ST was suspended in 100 μL of 20 mM PPB, 0.2 M NaCl (pH 7.0), and the supernatant was removed by magnetic separation. This procedure was repeated three times for washing. The membrane protein fraction was extracted from BMP by adding 5 μL of 1% SDS to the BMP and heating at 99°C for 15 minutes. The extracted membrane protein was subjected to SDS-polyacrylamide gel electrophoresis (SDS-PAGE). The gel was transferred to a nitrocellulose membrane, washed with PBS-T, and then blocked by shaking in PBS-T containing 5% skim milk (PBS-MT) for 1 hour. After washing with PBS-T, the membrane was shaken for 30 minutes with an HRP-conjugated anti-His antibody (QIAGEN) diluted 1:15,000 in PBS-MT. After washing with PBS-T, the chemiluminescence intensity was measured as in Example 16. As a negative control, the same procedure was performed on Mms13-BMP without SC-Flag fusion.

[0155] The results are shown in Figure 22. As shown in Figure 22, in the lane where only VHH-ST was electrophoresed, only chemiluminescence intensity derived from VHH-ST (19 kDa) was observed, whereas in the lane where VHH-BMP membrane protein was electrophoresed, chemiluminescence intensity was observed near the theoretical molecular weight of Mms13-VHH (46 kDa). This suggests that Mms13-SC-Flag-BMP and VHH-ST bound via the SC / ST reaction to form VHH-BMP. These results demonstrate that Mms13-SC-Flag-BMP capable of supporting target substances containing ST on its surface was prepared.

[0156] Example 18: Evaluation of binding ability of scFv-BMP In this example, an scFv-ST was prepared in which a SpyTag was attached to an anti-CRP scFv antibody against C-reactive protein (CRP), and an anti-CRP scFv antibody-presenting BMP (scFv-BMP) was produced. The nucleotide sequence encoding the scFv-ST fusion protein produced in this example and the amino acid sequence of the fusion protein are shown in SEQ ID NOs: 51 and 52, respectively. In the amino acid sequence shown in SEQ ID NO: 52, positions 27 to 269 from the N-terminus represent the anti-CRP scFv antibody, and positions 284 to 296 represent the SpyTag.

[0157] First, 40 μg of scFv-BMP suspended in carbonate-bicarbonate buffer was added to a 96-well plate (Thermo Fisher, white MaxiSorp) and allowed to stand for 1 hour for immobilization. After washing three times with PBS-T, 300 μL of 1x PBS containing 2% BSA was added to each well and allowed to stand for 2 hours for blocking. After washing three times with PBS-T, 100 μL of 100 nM C-reactive protein (CRP, Oriental Yeast Co., Ltd.) diluted in PBS containing 2% BSA (2% BSA / PBS) was added to each well and allowed to stand for 1 hour. After washing three times with PBS-T, 100 μL of 100 nM mouse anti-CRP IgG (Cat.# 4C28 Mab C2) (HyTest) diluted in 2% BSA / PBS was added to each well and allowed to stand for 1 hour. After washing three times with PBS-T, 100 μL of HRP-conjugated anti-mouse IgG (Promega) diluted 1:10,000 with 2% BSA / PBS was added and allowed to stand for 1 hour. After washing three times with PBS-T, 100 μL of HRP substrate (Roche) was added, and the chemiluminescence intensity was measured using a plate reader (Thermofisher Scientific). The same procedure was also performed on Mms13-SC-Flag-BMP not incubated with scFv-ST as a negative control, Mms13-BMP incubated with scFv-ST, and 14.7 ng / mL scFv-ST as a positive control.

[0158] The results are shown in Figure 23. As shown in Figure 23, strong chemiluminescence intensity was observed in the positive control, indicating that this system can accurately confirm the presence or absence of binding ability. Furthermore, as shown in Figure 23, the addition of CRP showed significantly higher chemiluminescence intensity compared to the negative control without CRP, indicating that anti-CRP scFv-BMP has the ability to bind to CRP. On the other hand, as shown in Figure 23, chemiluminescence intensity was also observed in the negative control without CRP and the negative control without mouse anti-CRP IgG. This was probably due to nonspecific adsorption of HRP-modified anti-mouse IgG to the scFv on BMP, as almost no chemiluminescence intensity was observed with Mms13-SC-Flag-BMP.

[0159] Example 19: Preparation of antibody-enzyme conjugate and evaluation of binding activity SpyCatcher-GOx, prepared as in Example 1, and scFv-ST, an anti-CRP scFv antibody conjugated with SpyTag, prepared in Example 18, were mixed stoichiometrically and allowed to stand. In this example, each was diluted with phosphate buffer (pH 7.0) to a concentration of 5 μM, and equal amounts were mixed and allowed to stand overnight at 4°C. Evaluation by SDS-polyacrylamide gel electrophoresis (SDS-PAGE) ( Figure 24 ) revealed a clear band near the molecular weight predicted for the formation of a complex between GOx and scFv-ST via covalent binding between SpyCatcher and SpyTag. Therefore, it was determined that an antibody-enzyme conjugate with specific binding activity to CRP and glucose oxidase activity had been formed.

[0160] In this example, the antibody-enzyme conjugates were evaluated for their binding ability to CRP. First, 100 μL of 100 nM CRP suspended in carbonate-bicarbonate buffer was added to a 96-well plate (Thermo Fisher, white MaxiSorp) and incubated at 25°C for 1 hour. After washing three times with TBS buffer containing 0.05% Tween (TBS-T), 300 μL of 1×TBS-T containing 1% BSA (1% BSA / TBS-T) was added to each well and blocked at 25°C for 1 hour. After washing three times with TBS-T, 100 μL of antibody-enzyme conjugates diluted with 1% BSA / TBS-T at various concentrations (0, 1.25, 2.5, 5, 12.5, 25, 50, and 100 nM) were added to each well and incubated at 25°C for 1 hour. 1% BSA / TBS-T was added as a negative control, and 100 nM scFv-ST was added as a positive control. After washing three times with TBS-T, 100 μL of HRP-conjugated anti-c-myc antibody diluted 5000-fold with 1% BSA / TBS-T was added to each well and incubated for 1 hour at 25°C. After washing three times with TBS-T, 100 μL of HRP substrate (Roche) was added, and the chemiluminescence intensity was measured.

[0161] The results are shown in Figure 25. As shown in Figure 25, an antibody-enzyme conjugate concentration-dependent increase in chemiluminescence intensity was confirmed. This demonstrated that the antibody-enzyme conjugate prepared in this example has the ability to bind to CRP (dissociation constant K D =37.3nM).

[0162] Example 20: Evaluation of CRP capture by scFv-BMP and antibody-enzyme complex In this example, a CRP capture evaluation test was carried out using the antibody-enzyme complex prepared in Example 19 and the anti-CRP scFv antibody-presenting BMP (scFv-BMP) prepared in Example 18.

[0163] First, 120 μg of anti-CRP scFv antibody-presenting BMP (scFv-BMP) was added to a 0.5 mL protein LoBind tube. 200 μL of 2% BSA / TBS was added, and the scFv-BMP was dispersed by sonication. The tube was then incubated at 25°C for 1 hour. During this time, the scFv-BMP was dispersed by sonication every 15 minutes. 100 μL of TBS-T was then added, and the scFv-BMP was dispersed by sonication. The supernatant was then removed by magnetic separation. This washing procedure was repeated five times. Next, 100 μL of CRP (concentrations: 0, 100, and 250 nM) diluted with 20 mM PPB, pH 7.0, was added, and the BMP was dispersed by sonication. The tube was then incubated at 25°C for 1 hour. As negative controls, 100 μL each of BSA (Thermo Scientific) and EGFR 250 nM was added and incubated in the same manner. After washing five times, 100 μL of 100 nM antibody-enzyme conjugate (GOx-scFv) diluted with 2% BSA / TBS-T was added. The scFv-BMP was dispersed by sonication and then incubated at 25°C for 1 hour. After washing five times, 30 μL of 20 mM PPB pH 7.0 was added, and the scFv-BMP was dispersed by sonication. 40 μg / 10 μL of scFv-BMP was then added to a 96-well plate (NUNK, clear). 100 μL of reaction solution (fc 2 U / mL horseradish peroxidase, fc 1.5 mM N-ethyl-N-(2-hydroxy-3-sulfopropyl)-3-methoxyaniline (TOOS), fc 1.5 mM 4-aminoantipyrine (4AA), fc 200 mM glucose (Fujifilm Wako Pure Chemical Industries, Ltd.), and 20 mM PPB (pH 7.0)) was added and reacted. After magnetic separation, the absorbance of the reaction solution at 555 nm was measured.

[0164] The results are shown in Figure 26. As shown in Figure 26, when CRP was not added or when the negative controls BSA or EGFR were added, almost no increase in absorbance was observed, whereas when CRP was added, a concentration-dependent increase in absorbance was confirmed. This indicates that CRP can be captured by both scFv-BMP and the antibody-enzyme complex.

[0165] Example 21: Peroxidase activity of Mms13-SC-Flag-BMP and detection of CRP. In this example, the peroxidase activity of Mms13-SC-Flag-BMP was first measured. Regarding peroxidase activity in magnetic particles, see Nat. Nanotechnol., 2007, 2, 577-583. The Mms13-SC-Flag-BMP prepared in Example 16 was washed three times, and then 40 μg / 5 μL of Mms13-SC-Flag-BMP was added to a 96-well plate (NUNK, clear). 95 μL of reaction solution (fc0, 6, 30, 60, 150, 300, or 600 mM H2O2 (Fujifilm Wako Pure Chemical Industries, Ltd.), TMB (Nacalai Tesque)) was added to the reaction mixture, and after sufficient reaction, 100 μL of the reaction stop solution from the same kit (ELISA POD Substrate TMB Kit (HYPER)) was added to stop the reaction. The absorbance of this solution at 450 nm was measured, and kinetic parameters (K M、 V max ) was calculated.

[0166] As a result (Fig. 27), K M is 14.5mM, V max is 0.61 x 10 -8 Ms -1 It was confirmed that the peroxidase activity was almost equivalent to the literature value.

[0167] Next, in this Example, scFv-BMP, CRP, and GOx-scFv complexes were formed (i.e., washed) in the same manner as in Example 20, and 40 μg / 10 μL of each complex was added to a 96-well plate (Thermo Fisher, polypropylene, white). 100 μL of reaction solution (fc 200 mM glucose, fc 24 ng / mL catalase (Fujifilm Wako Pure Chemical Industries), luminol (Tokyo Chemical Industry)) was added, and the chemiluminescence intensity was measured using a plate reader.

[0168] The results are shown in Figure 28. As shown in Figure 28, when CRP was not added or when the negative controls BSA and EGFR were added, only background signals were observed. However, a CRP concentration-dependent increase in chemiluminescence intensity was observed in the concentration range of 10 to 250 nM. This indicates that a complex of scFv-BMP, CRP, and GOx-scFv was formed in a CRP concentration-dependent manner, and that the luminol reaction proceeded by utilizing H2O2 and luminol generated by the enzymatic reaction of GOx contained in the complex as substrates for the peroxidase activity of scFv-BMP. Therefore, it was demonstrated that the formation of the complex, i.e., the presence or absence of CRP, could be detected by detecting the luminescence accompanying the luminol reaction.

[0169] In contrast to Example 20, this example investigated whether CRP could be detected without the washing procedure. Specifically, 90 μL of CRP (fc 0, 10, 50, 100, 150, or 250 nM) and GOx-scFv (fc 100 nM) diluted in 2% BSA / TBS-T were added to scFv-BMP blocked with 2% BSA / TBS. The BMP was dispersed by sonication and then incubated at 25°C for 30 minutes. During this incubation, the BMP was dispersed by sonication every 10 minutes. Then, 40 μg / 30 μL of BMP was added to a 96-well plate (Thermo Fisher, polypropylene, white). 80 μL of reaction solution (fc 200 mM glucose, fc 24 ng / mL catalase, and luminol) was added, and the chemiluminescence intensity was measured using a plate reader.

[0170] The results are shown in Figure 29. As shown in Figure 29, a CRP concentration-dependent increase in chemiluminescence intensity was confirmed in the concentration range of 10 to 250 nM. This indicates that a simple system can be constructed that detects target substances using scFv-BMP as an acceptor and does not require a washing procedure. Furthermore, the sensitivity in the range of 10 to 250 nM was 5.81 nM. -1 It was calculated that:

[0171] Example 22: Peroxidase activity of Mms13-SC-Flag-BMP, detection of CRP In this example, a system for detecting a target substance without the washing procedure examined in Example 21 was examined, except that catalase was not included in the reaction solution. That is, in this example, the scFv-BMP, CRP, and GOx-scFv complexes were added to a 96-well plate, and 80 μL of reaction solution (fc 200 mM glucose and luminol) was added, and the chemiluminescence intensity was measured using a plate reader, in the same manner as in the case of Example 21 without the washing procedure.

[0172] The results are shown in Figure 30. As shown in Figure 30, even without catalase, a CRP concentration-dependent increase in chemiluminescence intensity was confirmed in the range of 10 to 250 nM. Furthermore, the sensitivity in the range of 10 to 250 nM was 15.6 nM. -1 was calculated. The results are compared with those of Example 21, in which catalase was used, and are shown in Figure 31. As shown in Figure 31, the results showed that sensitivity was improved when catalase was not included. This was thought to be because when catalase was added, not only free hydrogen peroxide but also hydrogen peroxide on the acceptor surface was decomposed, causing a decrease in signal and sensitivity. Therefore, it became clear that in systems that utilize peroxidase activity on the magnetic particle surface, it is better not to include catalase in the reaction solution.

Claims

1. A nucleic acid molecule having a first aptamer that acts on a porphyrin exhibiting peroxidase activity to increase the peroxidase activity, and a second aptamer that is directly or indirectly linked to the first aptamer and has a G-quadruplex structure; a first enzyme having a binding ability to a target substance to which the second aptamer binds and an oxidase activity that catalyzes an oxidation reaction to produce hydrogen peroxide; a first substrate that is a substrate for the first enzyme; a porphyrin having peroxidase activity, the activity of which is increased by the first aptamer; a second substrate which is a substrate for peroxidase activity in the porphyrin; wherein when the second aptamer binds to the target substance, the first aptamer enhances peroxidase activity in the porphyrin.

2. The porphyrin is a second enzyme having peroxidase activity, and the first aptamer has a base sequence represented by the formula [I]: ggg(n) 1-2 ggg(n) 1-8 ggg(n) 1-2 The detection kit according to claim 1, characterized in that it contains a polynucleotide represented by ggg [I] and increases the peroxidase activity of the second enzyme.

3. The detection kit according to claim 2, characterized in that the base sequence represented by the formula [I] is a base sequence represented by any one of SEQ ID NOs: 2 to 16.

4. 2. The detection kit according to claim 1, wherein the nucleic acid molecule is a polynucleotide consisting of a base sequence shown in any one of SEQ ID NOs: 21, 22 and 46.

5. 2. The detection kit according to claim 1, wherein the porphyrin is hemin, and the first aptamer increases peroxidase activity against hemin.

6. The first aptamer that increases the peroxidase activity against hemin has a base sequence represented by the formula [IV]: ggg(n) 1-3 ggg(n) 1-7 ggg(n) 1-3 The detection kit according to claim 5, characterized in that it contains a polynucleotide represented by gg [IV].

7. The detection kit according to claim 6, characterized in that the base sequence represented by the formula [IV] is any of the base sequences represented by SEQ ID NOs: 26, 27, 29, 30 and 32 to 42.

8. The detection kit according to claim 1, characterized in that the second aptamer binds to the surface of a virus.

9. The detection kit according to claim 1, further comprising catalase.

10. 2. The detection kit according to claim 1, wherein the first enzyme and the first substrate are glucose oxidase and glucose, respectively, and the porphyrin and the second substrate are myoglobin and luminol, respectively.

11. 2. The detection kit according to claim 1, comprising a first reagent containing at least the first substrate, and a second reagent containing at least the first enzyme.

12. A step of mixing the detection kit according to any one of claims 1 to 11 with a sample that may contain a target substance; measuring an enzyme reaction based on peroxidase activity in the porphyrin contained in the detection kit; A method for detecting a target substance, comprising detecting a target substance in the sample based on the enzyme reaction.

13. a first enzyme having an ability to bind to a target substance carried by a virus exhibiting peroxidase activity or a magnetic particle, and having an oxidase activity that catalyzes an oxidation reaction to produce hydrogen peroxide; a first substrate that is a substrate for the first enzyme; a second substrate which is a substrate for peroxidase activity in the virus or magnetic particle; Equipped with A detection kit for a target substance that does not have an aptamer that acts on porphyrin exhibiting peroxidase activity to increase the peroxidase activity.

14. 14. The detection kit according to claim 13, wherein the first enzyme and the first substrate are glucose oxidase and glucose, respectively, and the second substrate is luminol.

15. 14. The detection kit according to claim 13, comprising a first reagent containing at least the first substrate, and a second reagent containing at least the first enzyme.

16. The detection kit described in claim 13, characterized in that the magnetic particles have either a tag peptide or a tag capture peptide produced by magnetic bacteria on their surface, and the target substance is a protein fused to the other of the tag peptide and the tag capture peptide, and is bound to the magnetic particles via the tag peptide and the tag capture peptide.

17. A step of mixing the detection kit according to any one of claims 13 to 16 with a sample that may contain a target substance; and measuring an enzyme reaction based on peroxidase activity in the virus or magnetic particles, A method for detecting a target substance, comprising detecting a target substance in the sample based on the enzyme reaction.

18. A nucleic acid molecule comprising: a first aptamer that acts on a porphyrin exhibiting peroxidase activity to increase the peroxidase activity; and a second aptamer that is directly or indirectly linked to the first aptamer, has the ability to bind to a target substance, and has a G-quadruplex structure, wherein the second aptamer forms a G-quadruplex structure when bound to the target substance.

19. The first aptamer has a base sequence represented by the formula [I]: ggg(n) 1-2 ggg(n) 1-8 ggg(n) 1-2 The nucleic acid molecule described in claim 18, characterized in that it contains a polynucleotide represented by ggg [I] and increases peroxidase activity in a hemoprotein.

20. The nucleic acid molecule according to claim 19, characterized in that the base sequence represented by the above formula [I] is a base sequence represented by any one of SEQ ID NOs: 2 to 16.

21. The nucleic acid molecule according to claim 18, characterized in that it is a polynucleotide consisting of a base sequence shown in any one of SEQ ID NOs: 21, 22 and 46.

22. The nucleic acid molecule of claim 18, wherein the first aptamer enhances peroxidase activity against hemin.

23. The first aptamer that increases the peroxidase activity against hemin has a base sequence represented by the formula [IV]: ggg(n) 1-3 ggg(n) 1-7 ggg(n) 1-3 The nucleic acid molecule according to claim 22, characterized in that it comprises a polynucleotide represented by gg[IV].

24. The nucleic acid molecule according to claim 23, characterized in that the base sequence represented by the formula [IV] is any of the base sequences represented by SEQ ID NOs: 26, 27, 29, 30 and 32 to 42.

25. The nucleic acid molecule of claim 18, wherein the second aptamer binds to a viral surface.

26. The base sequence is formula [I]: ggg(n) 1-2 ggg(n) 1-8 ggg(n) 1-2A method for detecting hemoglobin, comprising the steps of: mixing an aptamer molecule, which is a polynucleotide represented by ggg [I] and which increases the peroxidase activity of a hemoprotein; a first enzyme having specific binding ability to hemoglobin and having oxidase activity that catalyzes an oxidation reaction to produce hydrogen peroxide; a first substrate that is a substrate for the first enzyme; a second substrate that is a substrate for peroxidase; and a sample that may contain hemoglobin; and measuring the peroxidase activity of the hemoglobin.

27. The method for detecting hemoglobin according to claim 26, characterized in that the base sequence represented by the formula [I] is a base sequence represented by any one of SEQ ID NOs: 2 to 16.

28. The method for detecting hemoglobin according to claim 26, characterized in that the base sequence represented by the above formula [I] is the base sequence of SEQ ID NO:

2.

29. 27. The method for detecting hemoglobin according to claim 26, wherein said first enzyme and said first substrate are glucose oxidase and glucose, respectively, and said second substrate is luminol.