Variant neurodegenerative disease-associated protein

Abstract

This variant neurodegenerative disease-associated protein comprises an amino acid sequence in which one or several amino acids present in a region of interaction between two protofilaments (PF) among the amino acid sequences of the neurodegenerative disease-associated protein are deleted, substituted or added, and has a reduced activity of seeds serving as a core of an aggregate of said protein.

Description

Mutant neurodegenerative disease-associated proteins

[0001] The present invention relates to mutant neurodegenerative disease-associated proteins, vaccines against neurodegenerative diseases, and the like.

[0002] Immunotherapy is being actively developed as a new treatment for dementia. Aducanumab (Patent Document 1), approved in the United States in June 2021, is the world's first antibody drug targeting the accumulation of amyloid beta (Aβ) in Alzheimer's disease. This drug is a monoclonal antibody against Aβ, and is administered to patients as an antibody therapy (passive immunotherapy). In response to this issue, active immunotherapy, or so-called vaccine therapy, is being developed, in which patients are inoculated with a certain antigen to induce the production of antibodies (Immunization with amyloid-beta attenuates Alzheimer's disease-like pathology in the PDAPP mouse. Schenk D, et al. Nature; 400(6740):173-177, 1999; Past, present and future of therapeutic strategies against amyloid-beta peptides in Alzheimer's disease: a systematic review. Jeremic D, Jimenez-Diaz L, Navarro-Lopez JD. Ageing Res Rev. 2021 Dec;72:101496. doi: 10.1016 / j.arr.2021.101496. Epub 2021 Oct 21).

[0003] However, it is said that only 0.1% of antibodies present in the blood are transferred to the brain. Therefore, passive immunotherapy, which can deliver large amounts of antibodies from the periphery, is considered more effective than vaccines as a therapeutic agent. However, purified monoclonal antibodies are very expensive, and the high cost of treatment is a major problem. For example, in the case of aducanumab, the annual treatment cost per patient is said to be as high as 6 million yen. Furthermore, in the case of antibody therapy for dementia, even if administered to patients who have already developed the disease, it is said that while it is effective in removing aggregated proteins in the brain, it has little effect on improving cognitive function.

[0004] In other words, neuronal cell death has already occurred at the time of onset, and antibody therapy at this stage cannot halt the progression of the disease. Therefore, antibody therapy for dementia is thought to be most effective when administered to people in the "preclinical stage," when pathological changes have begun but symptoms are not yet present, or in the "prodromal stage," when symptoms remain at the level of mild cognitive impairment. In such cases, antibody administration is expected to begin more than 10 years before the onset of the disease, which is expected to result in high treatment costs, especially for passive immunotherapy.

[0005] US10,842,871B2

[0006] Disease-Modifying Therapies for Alzheimer's Disease: More Questions than Answers. Golde TE. Neurotherapeutics. 28:1-19. 2022. https: / / investors.biogen.com / news-releases / news-release-details / biogen-announces-reduced-price-aduhelmr-improve-access-patients

[0007] Given the above background, there was a desire to develop vaccine therapies for neurodegenerative diseases such as α-synucleinopathy, a general term for diseases in which α-synuclein accumulates in the brain (including dementia with Lewy bodies (DLB), Parkinson's disease (PD), and multiple system atrophy (MSA)).

[0008] The present inventors have conducted extensive research to solve the above problems, and as a result have succeeded in solving the above problems and have completed the present invention.

[0009] That is, the present invention is as follows: [1] A mutant neurodegenerative disease-associated protein comprising an amino acid sequence in which one or several amino acids are deleted, substituted or added in the amino acid sequence of the interaction region of two protofilaments (PF) molecules in the amino acid sequence of a neurodegenerative disease-associated protein, and wherein the seed activity of the protein functioning as a nucleus for protein aggregates is reduced to 70% or less compared to the seed activity of a wild-type neurodegenerative disease-associated protein. [2] The mutant neurodegenerative disease-associated protein according to [1], wherein the neurodegenerative disease-associated protein is any protein selected from alpha-synuclein, tau, and amyloid beta. [3] The mutant neurodegenerative disease-associated protein according to [2], wherein the neurodegenerative disease-associated protein is alpha-synuclein and one or several basic amino acids are deleted or substituted. [4] The mutant neurodegenerative disease-associated protein according to [3], wherein the basic amino acid is at least one selected from Lys43, Lys45, and His50. [5] The mutant neurodegenerative disease-related protein according to [3], wherein the amino acid sequence of alpha-synuclein is as set forth in SEQ ID NO: 2. [6] The mutant neurodegenerative disease-related protein according to [2], wherein the neurodegenerative disease-related protein is tau and wherein one or several basic amino acids or an amino acid sequence comprising the amino acid sequence represented by PGGG is deleted or substituted. [6-2] The mutant neurodegenerative disease-related protein according to [6], wherein the amino acid sequence comprising the amino acid sequence represented by PGGG is as set forth in KPGGGQ. [7] The mutant neurodegenerative disease-related protein according to [6], wherein the basic amino acid is a basic amino acid contained in any isoform selected from the 3R0N, 3R1N, 3R2N, 4R0N, 4R1N, and 4R2N isoforms of tau, and is at least one selected from His329, His330, and Lys331 in the 4R2N isoform, or at least one selected from basic amino acids corresponding to His329, His330, and Lys331 in isoforms other than the 4R2N isoform.[8] The mutant neurodegenerative disease-related protein according to [6], wherein the amino acid sequence of tau is set forth in SEQ ID NO: 4, 6, 8, 10, 12 or 14. [9] The mutant neurodegenerative disease-related protein according to [2], wherein the neurodegenerative disease-related protein is amyloid beta and one or several hydrophobic amino acids or basic amino acids are deleted or substituted.

[10] The mutant neurodegenerative disease-related protein according to [9], wherein the hydrophobic amino acid or basic amino acid is at least one selected from Leu34, Val36 and Lys28.

[11] The mutant neurodegenerative disease-related protein according to [9], wherein the amino acid sequence of amyloid beta is set forth in SEQ ID NO: 16.

[12] A nucleic acid encoding the mutant neurodegenerative disease-related protein according to any one of [1] to

[11] .

[13] A recombinant vector comprising the nucleic acid according to

[12] .

[14] An aggregate of the neurodegenerative disease-related protein, wherein the mutant neurodegenerative disease-related protein according to any one of [1] to

[11] is aggregated.

[15] An antibody against the aggregate described in

[14] .

[16] A pharmaceutical composition for a neurodegenerative disease, comprising the mutant neurodegenerative disease-associated protein described in any one of [1] to

[11] .

[17] A pharmaceutical composition for a neurodegenerative disease, comprising the nucleic acid described in

[12] .

[18] A pharmaceutical composition for a neurodegenerative disease, comprising the recombinant vector described in

[13] .

[19] A vaccine for a neurodegenerative disease, comprising the aggregate described in

[14] .

[20] A method for preventing or treating a neurodegenerative disease, comprising administering the pharmaceutical composition described in

[16] to a human.

[21] A method for preventing or treating a neurodegenerative disease, comprising administering the pharmaceutical composition described in

[17] to a human.

[22] A method for preventing or treating a neurodegenerative disease, comprising administering the pharmaceutical composition described in

[18] to a human.

[23] A method for preventing or treating a neurodegenerative disease, comprising administering the vaccine described in

[19] to a human.

[24] A mutant neurodegenerative disease-associated protein comprising an amino acid sequence in which one or several hydrophobic or basic amino acids are substituted with basic amino acids in the amino acid sequence of the interaction region (PF-interacting region) of two protofilaments (PFs) of a neurodegenerative disease-associated protein (provided that when a basic amino acid is substituted, it is substituted with another basic amino acid that has a higher charge than the basic amino acid), or an amino acid sequence in which one or several basic amino acids are added to the PF-interacting region, and which has a seed activity that functions as a nucleus for protein aggregates that is 71% or more of the seed activity of a wild-type neurodegenerative disease-associated protein.

[25] The mutant neurodegenerative disease-associated protein according to

[24] , wherein the neurodegenerative disease-associated protein is any protein selected from alpha-synuclein, tau, and amyloid beta.

[26] The mutant neurodegenerative disease-associated protein according to

[25] , wherein the neurodegenerative disease-associated protein is alpha-synuclein.

[27] The mutant neurodegenerative disease-related protein according to

[26] , wherein one or several basic amino acids in the PF-interacting region are at least one selected from Lys43, Lys45, and His50.

[28] The mutant neurodegenerative disease-related protein according to

[26] , wherein the amino acid sequence of alpha-synuclein is set forth in SEQ ID NO: 2.

[29] The mutant neurodegenerative disease-related protein according to

[25] , wherein the neurodegenerative disease-related protein is tau.

[30] The mutant neurodegenerative disease-related protein according to

[29] , wherein the one or several basic amino acids in the PF-interacting region are basic amino acids contained in any isoform selected from the 3R0N, 3R1N, 3R2N, 4R0N, 4R1N, and 4R2N isoforms of tau, and are at least one selected from His329, His330, and Lys331 in the 4R2N isoform, or at least one selected from basic amino acids corresponding to His329, His330, and Lys331 in isoforms other than the 4R2N isoform.

[31] The mutant neurodegenerative disease-related protein according to

[29] , wherein the amino acid sequence of tau is set forth in SEQ ID NO: 4, 6, 8, 10, 12, or 14.

[32] The mutant neurodegenerative disease-associated protein according to

[25] , wherein the neurodegenerative disease-associated protein is amyloid beta.

[33] The mutant neurodegenerative disease-associated protein according to

[32] , wherein one or several hydrophobic amino acids or basic amino acids in the PF-interacting region are at least one selected from Leu34, Val36, and Lys28.

[34] The mutant neurodegenerative disease-associated protein according to

[32] , wherein the amino acid sequence of amyloid beta is set forth in SEQ ID NO: 16.

[35] An aggregate of the neurodegenerative disease-associated protein according to any one of

[24] to

[34] .

[36] A cell or non-human animal into which the aggregate according to

[35] has been introduced.

[37] A mutant neurodegenerative disease model cell or non-human animal, comprising the cell or non-human animal according to

[36] .

[38] A nucleic acid encoding the mutant neurodegenerative disease-associated protein according to any one of

[24] to

[34] .

[39] A recombinant vector comprising the nucleic acid according to

[38] .

[40] A transformed cell or transformed non-human animal comprising the recombinant vector according to

[39] .

[41] A neurodegenerative disease model cell or non-human animal comprising the transformed cell or transformed non-human animal according to

[40] .

[42] A method for screening for a therapeutic drug for neurodegenerative disease, comprising contacting or administering a test candidate substance to the model cell or non-human animal according to

[37] or the model cell or non-human animal according to

[41] .

[43] A screening kit for a therapeutic drug for neurodegenerative disease, comprising at least one selected from the group consisting of the aggregate according to

[35] , the nucleic acid according to

[38] , the recombinant vector according to

[39] , the transformed cell or transformed non-human animal according to

[40] , and the transformed cell or transformed non-human animal according to

[41] .

[0010] The present invention provides mutant neurodegenerative disease-associated proteins that have reduced seed activity, which functions as a nucleus for aggregates of neurodegenerative disease-associated proteins. Aggregates of the mutant proteins with reduced seed activity are useful as vaccines for neurodegenerative diseases. Furthermore, the mutant proteins with reduced seed activity and the nucleic acids encoding them are useful as biopharmaceuticals and gene therapies for neurodegenerative diseases. The present invention also provides mutant proteins that have seed activity, which function as a nucleus for aggregates of neurodegenerative disease-associated proteins. Cells or non-human animals into which aggregates of the protein have been introduced, and cells or non-human animals in which the protein is expressed, are useful as model cells or model animals for neurodegenerative diseases.

[0011] These figures show the three-dimensional structure of α-synuclein (aS) aggregates analyzed by cryo-electron microscopy. Left panel (AF): Two structures of aS aggregates prepared from the brains of patients with multiple system atrophy (MSA) have been elucidated, each with a core structure consisting of two aS protofilaments (amyloid fibril precursors: PFs) interacting with each other. The first structure (A and C) consists of two PFs, Gly14-Phe94 and Lys21-Gln99. The second structure (BF) consists of two PFs, Gly14-Phe94 and Gly36-Gln99, although a portion of the PF, Gly36-Gln99, adopts a slightly different conformation (E, F). Right panel (G): Structures of recombinant aS aggregates. Several structures have been elucidated so far. Each basically has a core structure consisting of two PFs interacting with each other. This shows the formation of aggregates from recombinant α-synuclein monomers. Wild-type or mutant aS monomer (1 mg / mL) was incubated at 37°C for 30 minutes with shaking. Aliquots were taken on days 0, 2, 5, 8, 12, and 16 after shaking and mixed with 20 mM Hepes, pH 7.5, containing 4 μM ThT. The samples were then incubated at 37°C for 30 minutes. Fluorescence intensity was measured at an excitation wavelength of 442 nm and an emission wavelength of 485 nm. au: arbitrary units. Wild-type (WT) monomer: black solid line; K43&45A monomer: gray dotted line; K43&45R monomer: gray solid line. Electron microscopy images of α-synuclein aggregates. Each aggregate (0.05 mg / mL) was added to a collodion mesh and negatively stained with 2% sodium phosphotungstate solution. The stained mesh was then examined using a JEM-1400 electron microscope to examine the fibrillar structure of each aggregate. Fibrillar structures were observed in both wild-type (WT) and mutant aS aggregates. This figure shows the seeding activity of aS aggregates in vitro (1). A wild-type aS monomer solution (1 mg / mL, 100 μL) and aggregates (wild-type WT, K43&45A, and K43&45R: 1 μg each) were mixed and incubated at 37°C. The fluorescence intensity of the reaction solution was measured continuously at an excitation wavelength of 442 nm and an emission wavelength of 485 nm.When wild-type monomer alone was incubated at 37°C, ThT fluorescence intensity did not increase (no aggregation), but when wild-type or K43&45R aggregates were added, seed-dependent aggregation occurred. However, when K43&45A aggregates were added, wild-type monomer did not aggregate at all. The values ​​in parentheses indicate the fluorescence values ​​at the final measurement time point. This figure shows the seed activity of aS aggregates in vitro (2). A wild-type aS monomer solution (1 mg / mL, 100 μL) and aggregates (wild-type WT, K43R, K45R, and K43&45R: 1 μg each) were mixed and incubated at 37°C. The fluorescence intensity of the reaction solution was continuously measured at an excitation wavelength of 442 nm and an emission wavelength of 485 nm. When wild-type monomer alone (none) was incubated at 37°C, ThT fluorescence intensity did not increase (no aggregation), but when wild-type or other aggregates were added, seed-dependent aggregation occurred. The values ​​in parentheses indicate the fluorescence value at the final measurement time point. The seeding activity of each aggregate is as follows: All mutant aggregates had a stronger seeding effect than wild-type aggregates: K45R aggregates > K43&45R aggregates > K43R aggregates > WT aggregates. This figure shows the seeding activity of aS aggregates in vitro (3). A wild-type aS monomer solution (1 mg / mL, 100 μL) and aggregates (wild-type WT, K43A, K45A, and K43&45A: 1 μg each) were mixed and incubated at 37°C. The fluorescence intensity of the reaction solution was continuously measured at an excitation wavelength of 442 nm and an emission wavelength of 485 nm. Incubation of wild-type monomer alone (none) at 37°C did not increase the ThT fluorescence intensity (no fibrillization), but addition of wild-type or other aggregates resulted in fibrillization in a seed-dependent manner. The values ​​in parentheses indicate the fluorescence value at the final measurement time point. The seeding activity of each aggregate is as follows: WT aggregate > K43A aggregate > K45A aggregate > K43&45A aggregate. Figure 4 shows the seeding activity of aS aggregates in vitro (4). A wild-type aS monomer solution (1 mg / mL, 100 μL) and aggregates (wild-type WT, K43&45A, K43&45E, K43&45R, and K43&45delta: 1 μg each) were mixed and incubated at 37°C.The fluorescence intensity of the reaction mixture was continuously measured at an excitation wavelength of 442 nm and an emission wavelength of 485 nm. Incubation of wild-type monomer alone (none) at 37°C did not result in an increase in ThT fluorescence intensity (i.e., no aggregation). However, addition of wild-type or other aggregates resulted in seed-dependent aggregation. The values ​​in parentheses indicate the fluorescence value at the final measurement time point. The seed activity of each aggregate was as follows: K43&45R aggregate > WT aggregate >> K43&45E aggregate > K43&45A aggregate > K43&45delta aggregate. This figure shows the seed activity of aS aggregates in vitro (5). A wild-type aS monomer solution (1 mg / mL, 100 μL) and aggregates (wild-type WT, K43&45A, K43&45R, and H50A: 1 μg each) were mixed and incubated at 37°C. The fluorescence intensity of the reaction solution was continuously measured at an excitation wavelength of 442 nm and an emission wavelength of 485 nm. Incubation of wild-type monomer alone (none) at 37°C did not increase ThT fluorescence intensity (no aggregation), but addition of wild-type or other aggregates resulted in seed-dependent aggregation. The values ​​in parentheses indicate the fluorescence value at the final measurement time point. The seed activity of each aggregate was as follows: K43&45R aggregate > WT aggregate > H50A aggregate > K43&45A aggregate. This figure shows the seed activity of aS aggregates using cultured cells. Various aggregates (wild-type WT, K43&45A, and K43&45R aggregates: 0.24 μg each) were added as seeds to SH-SY5Y cells transiently expressing the wild-type aS plasmid. After harvesting, the cells were homogenized using the detergent sarkosyl and then centrifuged to obtain sarkosyl-soluble (Sar-sup) and insoluble (Sar-ppt) fractions. These were immunoblotted with anti-131-140 (antibody recognizing the C-terminus of aS) and anti-64 (antibody recognizing phosphorylated aS). The amount of the Sar-ppt fraction detected by the anti-64 antibody was quantified using Image J, indicating the amount of plasmid-derived aS accumulated in the cells.Arrows: aS. Double arrows: ubiquitinated aS or aS multimers. Of the three bands, the one near 25 kJ represents a single ubiquitin bond to aS, the one near 30 kJ represents an aS dimer, and the one near 45 kJ represents two ubiquitin bonds to aS or an aS trimer. Figure 1 shows the prion-like activity of aS aggregates in mouse brain. Each aggregate (10 μg) was injected into the mouse brain and striatum, and the brains were removed 3 months later. The removed brains were fixed and stained with a phosphorylated aS-specific antibody (anti-pS129). Numerous phosphorylated aS antibody-positive aggregates (round structures in the figure) were observed in brains injected with wild-type (WT) aggregates or K43&45R aggregates (near the right cerebral cortex), whereas almost no phosphorylated aS aggregates were observed in brains injected with saline or K43&45A aggregates. au: arbitrary unit. Scale bar: 200 μm. Figure 1 shows an outline of the vaccination study. Figure 2 shows the results of ELISA analysis of serum from vaccinated mice. Blood was collected from two mice immunized three times with saline, 20 μg of K43&45A aggregates, and 100 μg of K43&45A aggregates, and serum fractions were obtained. The serum fractions were added to 96-well plates pre-adsorbed with mouse wild-type aS aggregates or K43&45A aggregates, and assayed by ELISA. Reactivity (absorbance at 490 nm) with mouse wild-type aS aggregates is indicated by black bars, and reactivity with K43&45A aggregates is indicated by shaded bars. An antibody recognizing the C-terminus of aS (anti-131-140) was used as a positive control. None: No serum; Pre: Mouse serum before vaccination; Saline-1, -2: Group inoculated with saline; 20 μg-1, -2: Group inoculated with 20 μg of K43&45A aggregates; 100 μg-1, -2: Group inoculated with 100 μg of K43&45A aggregates. Figure 1 shows the suppression of aS aggregate formation in the mouse brain by vaccination (1). Mice immunized with saline, 20 μg of K43&45A aggregates, and 100 μg of K43&45A aggregates were inoculated intracerebrally with aS fibers (2.5 μg) as seeds.One month later, the brains were removed, and aS aggregates that appeared in the mouse brain were stained with a phosphorylated aS antibody (anti-pS129 antibody) (photographs were taken near the right cerebral cortex). The stained images were analyzed using an all-in-one microscope (KEYENCE), and the area of ​​the anti-pS129-positive aggregates was calculated and compared (bottom graph). au: arbitrary units. Scale bar: 200 μm. Figure 2 shows the suppression of aS aggregate formation in the mouse brain by vaccination (2). Mice immunized with saline or 50 μg of K43&45A aggregates were inoculated intracerebrally with 2.5 μL of insolubilized aS prepared from the brain of an MSA patient as a seed. One month later, the brains were removed, and aS aggregates that appeared in the mouse brain were stained with a phosphorylated aS antibody (anti-pS129 antibody) (photographs were taken near the right cerebral cortex). The stained images were analyzed using an all-in-one microscope (KEYENCE), and the area of ​​the anti-pS129-positive aggregates was calculated and compared (bottom graph). au: arbitrary units. Scale bar: 200 μmin. Figure 1 shows seed-dependent aggregation of aS monomers in vitro. Wild-type aS and mutant monomer solutions (1 mg / mL, 100 μL) were mixed with shaking-induced wild-type aS aggregates (FWT: 1 μg each) and incubated at 37°C. The fluorescence intensity of the reaction solution was continuously measured at an excitation wavelength of 442 nm and an emission wavelength of 485 nm. Incubation of each monomer alone at 37°C did not result in an increase in ThT fluorescence intensity (no aggregation), but addition of wild-type aggregates (FWT) resulted in seed-dependent aggregation of each monomer. The values ​​in parentheses indicate the fluorescence value at the final measurement time point. Figure 1 shows the seed effect of various aS aggregates aggregated by the addition of shaking-induced aS aggregates (FWT). A wild-type aS monomer solution (1 mg / mL, 100 μL) and each seed-dependent aggregate (WT+FWT, KR+FWT, Kdelta+FWT, and KA+FWT: 1 μg each) were mixed and incubated at 37°C. The fluorescence intensity of the reaction mixture was continuously measured at an excitation wavelength of 442 nm and an emission wavelength of 485 nm. The values ​​in parentheses indicate the fluorescence value at the final measurement point.Figure 1 shows a conceptual diagram of aS aggregation inhibition by expression of WT: wild-type, KR: K43&45R, Kdelta: K43&45delta, KA: K43&45AK43&45A monomers. WT: wild-type aS, KA: K43&45A, FWT: WT aggregates obtained by shaking. Figure 2 shows the results of purification of recombinant tau monomer. Aliquots of samples from each purification step of recombinant tau monomer were analyzed by SDS-PAGE (CBB staining). 1: heat-treated fraction, 2: 0.1 M NaCl wash fraction, 3: 0.35 M NaCl elution fraction, 4: final product after dialysis (recombinant tau monomer). Figure 3 shows aggregate formation of recombinant tau monomer. Dextran sulfate and ThT were added to wild-type (WT) and mutant tau monomers (ΔPG and ΔKP, each 3 mg / ml). The mixture was shaken at 37°C using a FLUOstar Omega plate reader, and the ThT fluorescence intensity was measured over time at an excitation wavelength of 450 nm and an emission wavelength of 480 nm. Electron microscopy images of each aggregate are shown. Wild-type (WT) and mutant tau (ΔPG and ΔKP) aggregates (0.2 mg / ml, 2 μl) were placed on a mesh, negatively stained with 2% phosphotungstic acid, and then observed under an electron microscope. This figure shows the seeding activity of wild-type and mutant aggregates in vitro. Wild-type tau monomer (1 mg / ml) was added to each aggregate (1 mg / ml) and ThT, and the mixture was incubated at 37°C using an infinite M200 PRO / infinite M NANO+ plate reader (TECAN). The fluorescence intensity of ThT in these samples was measured over time at an excitation wavelength of 442 nm and an emission wavelength of 485 nm.

[0012] 1. Overview The present invention relates to mutant neurodegenerative disease-associated proteins that comprise an amino acid sequence in which one or several amino acids are deleted, substituted, or added in the amino acid sequence of an interaction region (PF-interacting region) between two protofilaments (PF) of the amino acid sequence of a neurodegenerative disease-associated protein, and that have reduced seed activity that functions as a nucleus for protein aggregates.

[0013] In another aspect, the present invention relates to a mutant neurodegenerative disease-related protein comprising an amino acid sequence in which one or several hydrophobic amino acids or basic amino acids in the amino acid sequence of the PF-interacting region of two molecules of the amino acid sequence of the neurodegenerative disease-related protein have been substituted with basic amino acids (provided that when a basic amino acid is substituted, it is substituted with another basic amino acid that has a higher charge than the basic amino acid in question), or in which one or several basic amino acids have been added to the PF-interacting region, and which has seed activity that functions as a nucleus for the protein aggregates.

[0014] In recent years, immunotherapy (vaccine / antibody therapy) has attracted attention as a fundamental treatment for various dementias. In this invention, we focused on cheaper vaccine therapy and aimed to develop a novel vaccine therapy for neurodegenerative diseases such as α-synucleinopathy. Based on the three-dimensional structure of neurodegenerative disease-related protein aggregates or recombinant aggregates obtained by cryo-electron microscopy, we created new mutant aggregates with almost no prion-like activity. We aimed to develop a safe and effective vaccine therapy using these novel mutant aggregates without prion-like activity. Furthermore, we attempted to develop a novel treatment to suppress the accumulation of the protein in the brain by expressing the protein mutants discovered in this invention in the brain using adeno-associated virus (AAV).

[0015] Neurodegenerative disease-related proteins include proteins such as α-synuclein (also referred to as "αS"), tau protein (also referred to simply as "tau"), and amyloid beta (also referred to as "Aβ"). These proteins contain two molecules of protofilament (PF). The present inventors focused on the region where these two molecules of PF interact, and prepared mutant proteins by deleting or substituting one or several amino acids present in the region, or by adding one or several amino acids to the region, and measured the seed activity.

[0016] The term "seed activity" refers to an activity that triggers a molecular reaction in which a soluble protein polymerizes to form an insoluble aggregate, and includes both the activity of causing protein monomers to aggregate to form aggregates, and the activity of aggregates that once aggregated act as nuclei or seeds for the aggregation of monomers together to form aggregates.

[0017] Neurodegenerative disease-associated proteins aggregate when shaken in the monomeric state, but do not aggregate when left standing without shaking. Adding a small amount of pre-prepared aggregates to a stationary monomer solution causes the monomers to aggregate (seed activity). However, by mutating some of the amino acids in the neurodegenerative disease-associated protein, aggregates with reduced seed activity could be obtained. As a result, it was confirmed that mutant protein aggregates with reduced seed activity, or protein aggregates that originally lack seed activity, function as vaccines without promoting further aggregation of monomers. The present invention was completed based on this finding.

[0018] 2. Mutant Neurodegenerative Disease-Associated Proteins with Reduced Seed Activity 2.1. Amino Acid Mutations and Aggregates The mutant neurodegenerative disease-associated proteins of the present invention comprise an amino acid sequence in which one or several amino acids are deleted, substituted, or added in the amino acid sequence of the interaction region (PF-interacting region) of two protofilaments (PF) molecules in the amino acid sequence of the neurodegenerative disease-associated protein, and are proteins with reduced seed activity that function as the nucleus of aggregates of the protein. In this section, mutant neurodegenerative disease-associated proteins with reduced seed activity are also referred to as "seed activity-reduced mutant proteins" or "seed activity-reduced mutants." Aggregates of mutant neurodegenerative disease-associated proteins with reduced seed activity are also referred to as "seed activity-reduced aggregates."

[0019] Here, "reduction" in activity means that the seed activity that functions as a nucleus for protein aggregates is reduced to 70% or less compared to the seed activity of the wild-type neurodegenerative disease-associated protein. A reduction of less than 10%, i.e., a substantial or complete loss of activity, is referred to as "loss" of activity. Loss also includes a complete loss of activity (0%).

[0020] The activity can be measured, for example, by a fibrillation measurement test using thioflavin. In this case, the thioflavin level of the test mutant neurodegenerative disease-associated protein and the thioflavin level when wild-type seeds are added are measured, and if the thioflavin levels at both endpoints decrease to 70% or less, it can be determined that the activity has decreased.

[0021] Hereinafter, unless otherwise specified, in this specification, the term "reduced" simply refers to the seed activity that functions as a nucleus for protein aggregates being reduced to 70% or less compared to the seed activity of the wild-type neurodegenerative disease-related protein, and such mutant proteins are referred to as "seed activity-reduced mutant proteins" or "reduced mutant proteins."

[0022] "Aggregates" refer to insoluble protein structures that deposit or accumulate within or outside neurons and glial cells in the brains of patients with neurodegenerative diseases. Aggregates are proteins formed by the aggregation of neurodegenerative disease-related proteins (monomers), and include not only fibrils but also oligomers formed by the polymerization of several molecules. Fibrillar protein aggregates are one of the pathological hallmarks of many neurodegenerative diseases, and their formation process is thought to be closely related to the onset of the disease. The pathological appearance of these aggregates is called Lewy bodies in Parkinson's disease and neurofibrillary tangles in Alzheimer's disease. α-Synuclein has been identified as the main component of Lewy bodies, and tau as the main component of neurofibrillary tangles.

[0023] Another degenerative disease in which accumulations appear in nerve cells is amyotrophic lateral sclerosis, in which TAR-DNA binding protein of 43 kDa (TDP-43) accumulates. TDP-43 is a protein that is thought to exert cytotoxicity and is known to accumulate in inclusion bodies in amyotrophic lateral sclerosis. Furthermore, TDP-43 aggregates themselves are thought to have a novel cytotoxic effect.

[0024] On the other hand, amyloid β protein (Aβ), which is known to accumulate extracellularly in Alzheimer's disease, is thought to interact weakly with tau.

[0025] Therefore, examples of the neurodegenerative disease-related protein in the present invention include at least one protein selected from the group consisting of α-synuclein, tau, Aβ, and TDP-43.

[0026] The seed activity-reduced mutant protein used in the present invention refers to a protein in which a mutation such as deletion, substitution, or addition has occurred in one or several (e.g., 1 to 10, preferably 1 to 5) amino acids (meaning amino acid residues, but simply referred to as "amino acids"; the same applies below) in the amino acid sequence of the PF interaction region of the protein, and includes proteins with reduced seed activity inside or outside the cell.

[0027] The amino acid sequence to be mutated in the amino acid sequence of the PF interaction region is not particularly limited, but is preferably a basic amino acid present in the region. The PF interaction region refers to the region where PFs contact each other. Examples of amino acid mutations in neurodegenerative disease-related proteins include the following:

[0028] (1) α-synuclein In the case of α-synuclein, the interaction region with PF is the region from amino acid 24 to 64 in the α-synuclein sequence. Therefore, α-synuclein mutants include mutants containing an amino acid sequence in which one or more basic amino acids are deleted, mutants containing an amino acid sequence in which one or more basic amino acids are substituted with non-basic amino acids, or mutants containing an amino acid sequence in which one or more amino acids have been added in the interaction region. These mutants have reduced seed activity.

[0029] Examples of α-synuclein mutations include those in which at least one of the 43rd lysine (Lys43), 45th lysine (Lys45), and 50th histidine (His50) is substituted with another amino acid (e.g., a non-basic amino acid) or deleted (e.g., SEQ ID NO: 18, excluding those in which the 43rd, 45th, and 50th amino acids in SEQ ID NO: 18 are all wild-type amino acids (lysine, lysine, and histidine, respectively) or basic amino acids).

[0030] In the present invention, examples of such mutants include those in which the lysine at position 43 or 45 in the amino acid sequence of α-synuclein (e.g., SEQ ID NO: 2) is substituted with alanine (K43A, K45A), those in which both positions 43 and 45 are substituted with alanine (K43&45A), those in which both positions 43 and 45 are substituted with glutamic acid (K43&45E), those in which both positions 43 and 45 are deleted (K43&45delta), and those in which the histidine at position 50 is substituted with alanine (H50A).

[0031] (2) Tau In the case of tau, the PF interaction region is the region of the tau amino acid sequence from amino acid 329 to amino acid 338. Therefore, tau mutants include mutants comprising an amino acid sequence in which one or several basic amino acids are deleted in the interaction region, mutants comprising an amino acid sequence in which an amino acid sequence containing an amino acid represented by PGGG is deleted, mutants comprising an amino acid sequence in which one or several basic amino acids are substituted with non-basic amino acids, mutants comprising an amino acid sequence in which an amino acid represented by PGGG is substituted with a non-basic amino acid, and mutants comprising an amino acid sequence in which one or several amino acids have been added.

[0032] Here, tau exists in six isoforms ranging in length from 352 to 441 amino acids due to alternative splicing, and each isoform type has different N-terminal near-regions and microtubule-binding domains (MBDs). The N-terminal near-region has two types of inserts, N1 and N2, which are encoded by exons 2 and 3, respectively, of the tau gene. When both exons 2 and 3 are deleted due to alternative splicing, the isoform becomes 0N type. When only exon 2 is present, the isoform becomes 1N type, and when both exons 2 and 3 are present, the isoform becomes 2N type. On the other hand, the MBD is classified into four regions, designated R1 to R4, of which the presence or absence of R2 (encoded by exon 10) determines the isoform as 4R type or 3R type. The region from 329 to 338 of the PF interaction region is based on the 4R2N type isoform.

[0033] The insert configurations of the six isoforms are as follows: 3R0N type: R1- R3-R4 3R1N type: N1- R1- R3-R4 3R2N type: N1-N2-R1- R3-R4 4R0N type: R1-R2-R3-R4 4R1N type: N1- R1-R2-R3-R4 4R2N type: N1-N2-R1-R2-R3-R4

[0034] Therefore, one embodiment of a 4R2N type amino acid sequence mutation is one in which the histidine at position 329 (His329), the histidine at position 330 (His330), and the lysine at position 331 (Lys331) are substituted with other amino acids (e.g., SEQ ID NO: 30, excluding embodiments in which positions 329, 330, and 331 are all wild-type amino acids (histidine, histidine, and lysine, respectively) or basic amino acids).

[0035] In the present invention, examples of such mutants include those in which the histidine at position 329 or 330 in the amino acid sequence of tau (e.g., SEQ ID NO: 14) is substituted with alanine (H329A, H330A), those in which the lysine at position 331 is substituted with alanine (K331A), and those in which the histidines at positions 329 and 330, and the lysine at position 331 are substituted with alanine (H329&H330&K331A).

[0036] In the present invention, the basic amino acid to be mutated is at least one selected from His329, His330, and Lys331 based on the amino acid sequence of the 4R2N isoform. His329, His330, and Lys331 are located in R3 of the MBD. The numbers for His329, His330, and Lys331 indicate their positions based on the 4R2N amino acid sequence. The amino acid sequences of each isoform are shown below (Table 1, below).

[0037] For isoforms other than the 4R2N type, the amino acids corresponding to His329, His330, and Lys331 in the R3 insert can also be targeted for mutation. The positions corresponding to the above-mentioned His329, His330, and Lys331 in isoforms other than the 4R2N type are as follows: 3R0N: His at position 240, His at position 241, Lys at position 242 in SEQ ID NO: 4 3R1N: His at position 269, His at position 270, Lys at position 271 in SEQ ID NO: 6 3R2N: His at position 298, His at position 299, Lys at position 300 in SEQ ID NO: 8 4R0N: His at position 271, His at position 272, Lys at position 273 in SEQ ID NO: 10 4R1N: His at position 300, His at position 301, Lys at position 302 in SEQ ID NO: 12 Therefore, mutations similar to the 4R2N type mutations described above can be made in the amino acids at these positions (e.g., SEQ ID NOs: 20, 22, 24, 26, 28).

[0038] (3) Aβ In the case of Aβ, the PF interacting region is the region from amino acid 26 to 29 or from amino acid 33 to 37 in the Aβ amino acid sequence. Therefore, Aβ mutants include mutants containing an amino acid sequence in which one or several hydrophobic amino acids or basic amino acids are deleted, mutants containing an amino acid sequence in which one or several hydrophobic amino acids or basic amino acids are substituted with other amino acids, or mutants containing an amino acid sequence in which one or several amino acids have been added in the interacting region.

[0039] Examples of such mutations include those in which leucine at position 34 (Leu34), valine at position 36 (Val36), and lysine at position 28 (Lys28) are deleted or substituted with other amino acids (e.g., SEQ ID NO: 32, excluding those in which positions 34, 36, and 28 in SEQ ID NO: 32 are all wild-type amino acids (leucine, valine, and lysine, respectively)). In the present invention, examples of such mutations include those in which leucine at position 34 is deleted (deltaL34), those in which valine at position 36 is deleted (deltaV36), those in which lysine at position 28 is substituted with alanine (K28A), and those in which leucine at position 34 and valine at position 36 are deleted (deltaL34&V36) in the amino acid sequence of Aβ (e.g., SEQ ID NO: 16).

[0040] 2.2. Nucleic Acids Encoding Mutant Neurodegenerative Disease-Associated Proteins (Seed Activity-Decreased Mutant Proteins) (1) Obtaining Nucleic Acids Encoding Seed Activity-Decreased Mutant Proteins The seed activity-decreased mutant proteins used in the present invention can be obtained by obtaining gene or amino acid sequence information from the accession numbers shown in Table 1 and performing known genetic engineering techniques or site-directed mutagenesis based on that information (Sambrook J. et al., Molecular Cloning, A Laboratory Manual (4th edition), Cold Spring Harbor Laboratory Press (2012)). The wild-type gene can be chemically synthesized to have the nucleotide sequence shown by the SEQ ID NO: in Table 1, or a commercially available product can be used.

[0041] Nucleic acids (DNA) encoding mutants (mutated proteins with reduced seed activity) can also be obtained by known techniques, for example, using site-directed mutagenesis. Examples of mutation introduction kits that can be used for site-directed mutagenesis include the QuikChange Site-Directed Mutagenesis Kit (Strategene), the KOD-Plus-Mutagenesis Kit (Toyobo), the GenEdit Site-Directed DNA Mutagenesis Kit (Funakoshi), and the Takara Site-Directed Mutagenesis System (Mutan-K, Mutan-Super Express Km, etc.: Takara Bio).

[0042] Nucleic acids encoding the above proteins can also be produced using conventional chemical or biochemical synthesis methods. For example, nucleic acid synthesis using a DNA synthesizer commonly used in genetic engineering techniques, or PCR or gene amplification using a cloning vector after isolating or synthesizing a template base sequence, can be used. The nucleic acid obtained as described above is then cleaved with a restriction enzyme or the like. The excised DNA fragment of the gene can be inserted into an appropriate expression vector to obtain an expression vector containing a gene encoding the protein.

[0043] As described above, the proteins include α-synuclein, tau, and Aβ. The amino acid sequences of these proteins and the accession numbers of the nucleic acids (genes) encoding these proteins are shown in Table 1.

[0044] Furthermore, in the present invention, examples of genes encoding the above-mentioned mutants (mutant proteins with reduced seed activity) include the following: <α-synuclein mutants> (a-1) Genes encoding mutant α-synuclein that contain a mutant amino acid sequence in which at least one of the amino acids at positions 43, 45, and 50 of the amino acid sequence of α-synuclein (e.g., SEQ ID NO: 2) is substituted with another amino acid or deleted, and that have reduced seed activity, which functions as a nucleus for α-synuclein aggregates. Examples of amino acid sequences of the above-mentioned mutant α-synuclein with reduced seed activity include the aforementioned "K43A," "K45A," "K43&45A," "K43&45E," "K43&45delta," and "H50A." The nucleotide sequence of the gene encoding the mutant α-synuclein is shown in SEQ ID NO: 17, and the amino acid sequence of the mutant α-synuclein is shown in SEQ ID NO: 18.

[0045] (a-2) A gene encoding a mutant α-synuclein having an amino acid sequence in which at least one of the 43rd, 45th, and 50th amino acids in the amino acid sequence of α-synuclein (e.g., SEQ ID NO: 2) is substituted with another amino acid or deleted, and one or several amino acids other than the 43rd, 45th, and 50th amino acids are deleted, substituted, or added, and which has reduced seed activity that functions as a nucleus for α-synuclein aggregates.

[0046] (a-3) A gene consisting of DNA comprising the base sequence represented by SEQ ID NO: 17. (a-4) A gene consisting of DNA encoding a mutant α-synuclein with reduced seed activity that hybridizes under stringent conditions with DNA comprising a base sequence complementary to DNA comprising the base sequence represented by SEQ ID NO: 17 and functions as a nucleus for α-synuclein aggregates.

[0047] However, among the genes that hybridize under the above-mentioned stringent conditions, the base sequences encoding the 43rd amino acid, the 45th amino acid, and the 50th amino acid always hybridize as codons for the substituted or deleted amino acids.

[0048] Here, in the present invention, hybridization can be carried out according to known methods (for example, Sambrook J. et al., Molecular Cloning, A Laboratory Manual (4th edition) (Cold Spring Harbor Laboratory Press (2012))). Highly stringent conditions refer to conditions under which so-called specific hybrids are formed and non-specific hybrids are not formed, and refer to, for example, conditions under which the sodium concentration is 10 mM to 300 mM, preferably 20 mM to 100 mM, and the temperature is 25°C to 70°C, preferably 42°C to 55°C. These stringent conditions can be applied throughout the present specification.

[0049] <Tau mutants> (i) 4R2N type (b-1-1) A gene encoding a mutant tau comprising a mutant amino acid sequence in which at least one amino acid selected from the amino acid sequence of 4R2N tau (e.g., SEQ ID NO: 14) at positions 329, 330, and 331, and an amino acid sequence comprising the amino acid sequence represented by PGGG, is substituted with or deleted from another amino acid, and the gene encoding the mutant tau has reduced seed activity that functions as a nucleus for tau aggregates. The base sequence and amino acid sequence of the 4R2N mutant are shown in Table 2 below.

[0050] In the present invention, the amino acid sequence shown in SEQ ID NO: 14 is preferably an amino acid sequence in which the histidines at the 329th and 330th amino acids are substituted with alanine, and the lysine at the 331st amino acid is substituted with alanine.

[0051] (b-1-2) A gene encoding a mutant tau having an amino acid sequence in which at least one amino acid selected from the amino acids at positions 329, 330, and 331 of the amino acid sequence of tau (e.g., SEQ ID NO: 14), and an amino acid sequence containing the amino acid sequence represented by PGGG, has been substituted with or deleted from another amino acid, and one or several amino acids other than the amino acid sequence containing the amino acids at positions 329, 330, and 331 and the amino acid sequence represented by PGGG have been deleted, substituted, or added, and the seed activity that functions as the nucleus of tau aggregates has been reduced.

[0052] (b-1-3) A gene consisting of DNA containing the base sequence represented by SEQ ID NO: 29. (b-1-4) A gene consisting of DNA encoding a mutant tau with reduced seed activity that functions as a nucleus for tau aggregates, which hybridizes under stringent conditions with DNA containing a base sequence complementary to DNA containing the base sequence represented by SEQ ID NO: 29.

[0053] However, among the genes that hybridize under the above-mentioned stringent conditions, the base sequences encoding the amino acids at positions 329, 330, and 331, as well as the amino acid sequence represented by PGGG, always hybridize as codons for the substituted amino acids.

[0054] (ii) Isoforms other than 4R2N type (b-2-1) A gene encoding a mutant tau having a mutant amino acid sequence in which at least one amino acid selected from the 329th amino acid, the 330th amino acid, and the 331st amino acid in the 4R2N type, and an amino acid sequence corresponding to an amino acid sequence containing the amino acid sequence represented by PGGG, among the amino acid sequences of isoforms other than 4R2N type (e.g., SEQ ID NO: 4, 6, 8, 10, or 12), is substituted with or deleted from another amino acid, and which has reduced seed activity functioning as a nucleus for tau aggregates.

[0055] In the present invention, the amino acid sequence is preferably an amino acid sequence shown in SEQ ID NO: 4, 6, 8, 10, or 12, in which the histidines at the amino acid positions corresponding to the 329th and 330th amino acids are substituted with alanine, and the lysine at the amino acid position corresponding to the 331st amino acid is substituted with alanine.

[0056] (b-2-2) A gene encoding a mutant tau having an amino acid sequence in which at least one amino acid selected from the amino acids at positions corresponding to the 329th, 330th, and 331st amino acids and the amino acid sequence containing the amino acid sequence represented by PGGG in the amino acid sequence in the 4R2N type (e.g., SEQ ID NO: 14) of an isoform other than the 4R2N type (e.g., SEQ ID NO: 4, 6, 8, 10, or 12) is substituted with or deleted from another amino acid, and one or several amino acids other than the amino acids at positions corresponding to the 329th, 330th, and 331st amino acids and the amino acid sequence containing the amino acid sequence represented by PGGG are deleted, substituted, or added, and the seed activity that functions as the nucleus of tau aggregates is reduced.

[0057] (b-2-3) A gene consisting of DNA containing the base sequence represented by SEQ ID NO: 19, 21, 23, 25, or 27. (b-1-4) A gene consisting of DNA encoding a mutant tau with reduced seed activity that functions as a nucleus for tau aggregates, which hybridizes under stringent conditions with DNA containing a base sequence complementary to DNA containing the base sequence represented by SEQ ID NO: 19, 21, 23, 25, or 27.

[0058] However, among the genes that hybridize under the above-mentioned stringent conditions, the base sequences encoding the amino acids at positions corresponding to the amino acid sequences containing the amino acids at positions 329, 330, and 331, as well as the amino acid sequence represented by PGGG, always hybridize as codons for the substituted amino acids. The amino acid sequences of tau isoforms other than the 4R2N type are shown in Table 1.

[0059] In isoforms other than the 4R2N type, the positions of the amino acids corresponding to the 329th amino acid, the 330th amino acid, and the 331st amino acid in the 4R2N type are as follows: 3R0N: His at position 240, His at position 241, and Lys at position 242 in SEQ ID NO: 4; 3R1N: His at position 269, His at position 270, and Lys at position 271 in SEQ ID NO: 6; 3R2N: His at position 298, His at position 299, and Lys at position 300 in SEQ ID NO: 8; 4R0N: His at position 271, His at position 272, and Lys at position 273 in SEQ ID NO: 10; 4R1N: His at position 300, His at position 301, and Lys at position 302 in SEQ ID NO: 12.

[0060] The nucleotide sequences of the genes encoding these mutant tau isoforms and the amino acid sequences of the isoforms are shown in Table 2.

[0061] <Aβ Mutants> (c-1) A gene encoding a mutant Aβ that contains a mutant amino acid sequence in which at least one of the amino acids at positions 34, 36, and 28 of the amino acid sequence of Aβ (e.g., SEQ ID NO: 16) is substituted with another amino acid, and that has reduced seed activity that functions as a nucleus for Aβ aggregates.

[0062] In the present invention, the amino acid sequence shown in SEQ ID NO: 16 is preferably an amino acid sequence in which the 34th amino acid, leucine, is deleted, the 36th amino acid, valine, is deleted, and the 28th amino acid, lysine, is substituted with alanine. The nucleotide sequence of a gene encoding mutant Aβ is shown in SEQ ID NO: 31, and the amino acid sequence of the mutant Aβ is shown in SEQ ID NO: 32.

[0063] (c-2) A gene encoding a mutant Aβ having an amino acid sequence in which at least one of the amino acids at positions 34, 36, and 28 of the Aβ amino acid sequence (e.g., SEQ ID NO: 16) is substituted with another amino acid, and one or several amino acids other than the amino acids at positions 34, 36, and 28 are deleted, substituted, or added, and which has reduced seed activity functioning as a nucleus for Aβ aggregates.

[0064] (c-3) A gene consisting of DNA containing the base sequence represented by SEQ ID NO: 31. (c-4) A gene consisting of DNA that hybridizes under stringent conditions with DNA consisting of a base sequence complementary to DNA containing the base sequence represented by SEQ ID NO: 31 and encodes a mutant Aβ with reduced seed activity that functions as a nucleus for Aβ aggregates. However, among the genes that hybridize under the above-mentioned stringent conditions, the base sequences encoding the 34th amino acid, the 36th amino acid, and the 28th amino acid always hybridize as codons for the substituted amino acids.

[0065] (2) Construction and transformation of expression vector In the present invention, a mutant protein with reduced seed activity can be obtained by constructing an expression vector (recombinant vector) by introducing a nucleic acid encoding the mutant protein into a vector as shown below, and then introducing this into a host and culturing it.

[0066] The vector into which the nucleic acid (e.g., DNA) encoding the mutant protein of the present invention is inserted is not particularly limited as long as it is replicable in a host, and examples thereof include plasmid DNA, phage DNA, viruses, etc. Plasmid DNA includes Escherichia coli-derived plasmids, Bacillus subtilis-derived plasmids, and yeast-derived plasmids, and phage DNA includes λ phage, etc. Viruses such as adenoviruses (e.g., adeno-associated viruses) and retroviruses can also be used.

[0067] In the present invention, in addition to a promoter and DNA, cis elements such as enhancers, splicing signals, poly A addition signals, ribosome binding sequences (SD sequences), selection marker genes, reporter genes, etc. can be linked to the expression vector, if desired.

[0068] The expression vector is introduced into a host to produce a transformant, which is then used to express the target gene. The host is not particularly limited as long as it can express the target gene, and examples include bacteria such as Escherichia coli and Bacillus subtilis, yeast such as Saccharomyces cerevisiae, and mammalian cells such as COS cells and CHO cells. Insect cells, insects, rodents (e.g., mice, rats, guinea pigs), and non-human mammals (e.g., goats and cows) can also be used as hosts. Methods for introducing recombinant vectors into hosts are known, including, for example, electroporation, liposomes, spheroplasts, and lithium acetate (Sambrook J. et al., Molecular Cloning, A Laboratory Manual (4th edition), Cold Spring Harbor Laboratory Press (2012)).

[0069] (3) Collection and purification of seed activity-reduced mutant protein or its aggregates The transformant is cultured or bred, and the target seed activity-reduced mutant protein is collected from the culture or non-human mammal. "Culture" refers to (a) the culture supernatant as well as (b) cultured cells or cultured bacterial cells or their disrupted products.

[0070] After cultivation, if the seed activity-reduced mutant protein is produced intracellularly or intracellularly, the mutant protein is extracted by disrupting the cells or bacteria. If the mutant protein is produced extracellularly or extracellularly, the culture medium is used as is, or the cells or bacteria are removed by centrifugation or other methods. If the host is a mammal (e.g., rodent, goat, cow), the seed activity-reduced mutant protein is collected from body fluids (e.g., serum, saliva), secretions (e.g., milk), or tissues (e.g., brain). The desired mutant protein can then be isolated and purified using common biochemical methods used for protein isolation and purification, such as ammonium sulfate precipitation, gel filtration, ion exchange chromatography, affinity chromatography, hydrophobic chromatography, reversed-phase chromatography, etc., either alone or in appropriate combinations.

[0071] The purified seed activity-reduced mutant protein can be aggregated by shaking a solution containing the protein, for example, at 37° C. The aggregates obtained by aggregation are recovered by ultracentrifugation or the like, and then suspended in an appropriate amount of buffer solution for use in cell introduction, as a pharmaceutical composition, or as a vaccine.

[0072] 2.3. Antibodies Against Aggregates of Seed Activity-Reduced Mutant Proteins The "antibody" of the present invention refers to an antibody or a fragment thereof that specifically binds to aggregates of the mutant proteins (seed activity-reduced aggregates), and may be a polyclonal or monoclonal antibody. The antibody of the present invention also includes an antibody that binds to an antigenic determinant (epitope) to which the antibody of the present invention binds. The antigenic determinant is the entire seed activity-reduced mutant protein or a partial region of the aggregate, such as the interaction region of two protofilaments (PF) in the amino acid sequence of a neurodegenerative disease-related protein, or a region other than PF.

[0073] The antibodies of the present invention may be polyclonal or monoclonal antibodies, and include antibody fragments thereof. The antibodies of the present invention also include chimeric antibodies, humanized antibodies, and humanized antibodies. Methods for producing antibodies are known in the art.

[0074] (1) Preparation of Polyclonal Antibodies To prepare polyclonal antibodies, a seed activity-reduced mutant protein or a partial peptide is administered to a non-human mammal, such as a rabbit, dog, guinea pig, mouse, rat, or goat, either by itself or together with a carrier or diluent, for immunization. The dose of antigen per animal, the dose when an adjuvant is used, the type of adjuvant, the immunization site, the interval between immunizations, and the like are well known.

[0075] Measurement of antibody titers in serum is also well known in the art and can be performed by ELISA, EIA, RIA, etc. After confirming that the antibody titer has risen sufficiently, whole blood is collected and the antibodies can be separated and purified by a commonly used method. Separation and purification can be performed by appropriately selecting known methods such as ammonium sulfate precipitation, ion exchange chromatography, gel filtration chromatography, affinity chromatography, etc., or by combining these methods.

[0076] (2) Preparation of Monoclonal Antibodies Methods for preparing monoclonal antibodies are also well known. For example, collection of antibody-producing cells, cell fusion of antibody-producing cells with myeloma cells to obtain hybridomas, selection and cloning of hybridomas, and collection of monoclonal antibodies can be performed by methods well known to those skilled in the art.

[0077] Furthermore, in the present invention, the epitope (antigenic determinant) of an antibody is not limited as long as it is at least a part of the aggregate-derived protein that is the antigen. The antibody of the present invention includes antibodies that bind to the site (e.g., epitope) to which the antibody binds, for example, antibodies that bind to the site to which an antibody produced by a hybridoma binds.

[0078] (3) Production of Recombinant Antibodies One preferred embodiment of the antibody of the present invention is a recombinant antibody. Examples of recombinant antibodies include, but are not limited to, chimeric antibodies, humanized antibodies, and the like. Chimeric antibodies (i.e., human chimeric antibodies) are antibodies in which the variable regions of a mouse-derived antibody are linked (conjugated) to human-derived constant regions (see, for example, Proc. Natl. Acad. Sci. USA 81, 6851-6855, (1984)). When producing a chimera, such linked antibodies can be constructed using recombinant techniques.

[0079] Humanized antibodies can be produced using a technique known as CDR grafting. Such humanized antibody production methods are well known in the art (see Nature, 321, 522-525 (1986); J. Mol. Biol., 196, 901-917 (1987); Queen C et al., Proc. Natl. Acad. Sci. USA, 86: 10029-10033 (1989); Japanese Patent No. 2828340, etc.).

[0080] A human antibody (fully human antibody) generally has the same structures as a human antibody in the hypervariable region (V region), which is the antigen-binding site, the remaining parts of the V region, and the constant region. Techniques for producing human antibodies are also known, and methods for producing gene sequences common to humans using genetic engineering techniques have been established. Human antibodies can be produced, for example, by a method using a human antibody-producing mouse having a human chromosome fragment containing genes for the heavy chain (H chain) and light chain (L chain) of a human antibody (Tomizuka, K. et al., Nature Genetics, (1977) 16, 133-143; Kuroiwa, Y. et al., Nuc. Acids Res., (1998) 26, 3447-3448; Yoshida, H. et al., Animal Cell Technology: Basic and Applied Aspects, (1999) 10, 69-73 (Kitagawa, Y., Matuda, T. and Iijima, S. eds.), Kluwer Academic Publishers; Tomizuka, K. et al., Proc. Natl. Acad. Sci. USA, (2000) 97, 722-727). or a method for obtaining a phage-display-derived human antibody selected from a human antibody library (see, for example, Wormstone, I. et. al., Investigative Ophthalmology & Visual Science., (2002) 43 (7), 2301-8; Carmen, S. et. al., Briefings in Functional Genomics and Proteomics, (2002) 1 (2), 189-203; Siriwardena, D. et. al., Ophthalmology, (2002) 109 (3), 427-431).

[0081] (4) Preparation of antibody fragments Examples of antibody fragments against seed activity-reduced mutant proteins used in the present invention include Fab, Fab', F(ab')2, Fv, diabody (dibodies), dsFv, scFv (single chain Fv), etc. The above antibody fragments can be obtained by cleaving the antibody of the present invention with various proteases depending on the purpose.

[0082] For example, Fab can be obtained by treating an antibody molecule with papain, and F(ab')2 can be obtained by treating an antibody molecule with pepsin. Fab' can be obtained by cleaving the disulfide bond in the hinge region of the F(ab')2. In the case of scFv, cDNA encoding the heavy chain variable region (H chain V region) and light chain variable region (L chain V region) of an antibody is obtained, and DNA encoding the scFv is constructed. This DNA is inserted into an expression vector, and the expression vector is introduced into a host organism for expression, thereby producing scFv.

[0083] In the case of diabodies, cDNA encoding the H chain V region and L chain V region of an antibody is obtained, and DNA encoding an scFv is constructed so that the amino acid sequence of the peptide linker is 8 residues or less in length. This DNA is inserted into an expression vector, and the expression vector is introduced into a host organism for expression, thereby producing a diabody. In the case of dsFv, cDNA encoding the H chain V region and L chain V region of an antibody is obtained, and DNA encoding a dsFv is constructed. This DNA is inserted into an expression vector, and the expression vector is introduced into a host organism for expression, thereby producing a dsFv.

[0084] 2.4. Pharmaceutical Composition and Method for Treating or Preventing Neurodegenerative Diseases The pharmaceutical composition of the present invention contains, as an active ingredient, the seed activity-reduced mutant protein of the present invention, a nucleic acid encoding the mutant protein, or a vector containing the nucleic acid, and is effective for preventing or treating diseases such as neurodegenerative diseases related to α-synucleinopathy (dementia with Lewy bodies, Parkinson's disease, multiple system atrophy), Alzheimer's disease, and motor neuron disease. The seed activity-reduced mutant protein of the present invention is used as a pharmaceutical composition for protein therapy, and the nucleic acid encoding the mutant protein is used as a pharmaceutical composition for gene therapy.

[0085] The seed activity-reduced mutant protein of the present invention, or a nucleic acid encoding the mutant protein, or a vector containing the nucleic acid, can be administered alone or together with a pharmaceutically acceptable carrier or diluent to a subject requiring treatment or prevention (e.g., a patient with a neurodegenerative disease), and can be administered once or in several doses.

[0086] Neurodegenerative diseases that can be treated or prevented by the present invention refer to diseases in which neurodegeneration, a phenomenon in which nerve cells die without any apparent cause such as trauma or bacterial infection, is observed, and examples of such diseases include α-synucleinopathy (dementia with Lewy bodies, Parkinson's disease, multiple system atrophy), Alzheimer's disease, etc. In addition to these diseases, other examples include Huntington's disease, triplet repeat disease, amyotrophic lateral sclerosis, Creutzfeldt-Jakob disease, Gerstmann-Straussler syndrome, mad cow disease, spinal-bulbar muscular atrophy, spinocerebellar ataxia, dentatorubral-pallidoluysian atrophy, FTDP-17, progressive superior paraplegia, corticobasal degeneration, and Pick's disease.

[0087] Here, "pharmaceutically acceptable carriers" include excipients, diluents, bulking agents, disintegrants, stabilizers, preservatives, buffers, emulsifiers, flavoring agents, coloring agents, sweeteners, thickeners, flavoring agents, solubilizers, and other additives. By using one or more of such carriers, pharmaceutical compositions in the form of tablets, pills, powders, granules, injections, liquids, capsules, troches, elixirs, suspensions, emulsions, syrups, and the like can be prepared. These pharmaceutical compositions can be administered orally or parenterally. Carriers also include carriers used in protein formulations or gene therapy, such as lipid nanoparticles (LNPs).

[0088] For oral administration, various excipients such as microcrystalline cellulose, sodium citrate, calcium carbonate, dipotassium phosphate, glycine, etc. can be used together with disintegrants, binders, etc. Disintegrants include starch, alginic acid, certain types of double silicates, etc., and binders include polyvinylpyrrolidone, sucrose, gelatin, gum arabic, etc. Lubricants such as magnesium stearate, sodium lauryl sulfate, talc, etc. are very effective for tablet formation. When preparing aqueous suspensions or elixirs for oral administration, they can be used together with emulsifiers and suspending agents as necessary, and with diluents such as water, ethanol, propylene glycol, glycerin, etc., or combinations thereof.

[0089] Other forms for parenteral administration include injections containing one or more active substances and formulated in a conventional manner. Injections can be prepared by dissolving or suspending the active ingredient in a pharmaceutically acceptable carrier, such as physiological saline or commercially available distilled water for injection, to a predetermined concentration. The concentrations of the active ingredient in the carrier for each pharmaceutical composition are as follows:

[0090] - Seed activity reduced mutant protein: can be administered once a day at intervals of several days to several months in a range of 10 μg / kg to 100 mg / kg, preferably 100 μg / kg to 50 mg / kg. - Nucleic acid encoding seed activity reduced mutant protein: it is desirable to adjust the dosage (effective amount) depending on the type of nucleic acid contained, dosage form, etc., but for adults, the amount of nucleic acid encoding seed activity reduced mutant protein can be administered once a day at intervals of several days to several months in a range of 0.1 mg to 100 g / human per day, preferably 1 mg to 5 g / human. When administering a gene therapy virus, for example, an effective amount is 1 x 10 10 ~1×10 15 This dose can be administered one to several times.

[0091] The injections prepared in this manner can be administered to human patients requiring treatment or prevention at a dose of 1 μg to 500 mg per kg of body weight, preferably 100 μg to 50 mg per kg, one to several times per day. However, the dose is not limited to this range and may vary depending on the patient's body weight, symptoms, and individual administration route. The dosage may vary depending on differences in the patient's drug sensitivity, the drug prescription method, and the administration period and interval. Therefore, in some cases, a dosage lower than the lower limit of the above range may be appropriate, while in other cases a higher dosage may be required.

[0092] Administration routes include intravenous, subcutaneous, intradermal, and intramuscular injections, with intravenous injections being preferred. Injections can also be prepared as suspensions or emulsions using non-aqueous diluents (e.g., propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and alcohols such as ethanol). Sterilization of such injections can be achieved by filtration sterilization through a bacteria-retaining filter, the addition of a disinfectant, or irradiation. Injections can be prepared as ready-to-use preparations. That is, they can be prepared as sterile solid compositions by freeze-drying or other methods, and then dissolved in sterile distilled water for injection or other solvents before use.

[0093] 2.5 Vaccine The seed activity-reduced aggregate of the present invention is used as a vaccine. Target diseases are the same as those described in the section on pharmaceutical compositions, and representative examples include the treatment or prevention of α-synucleinopathy (dementia with Lewy bodies, Parkinson's disease, multiple system atrophy) and Alzheimer's disease.

[0094] The vaccine of the present invention can be used to prevent or treat the onset of α-synucleinopathy (a general term for diseases in which aS accumulates). A feature of the vaccine of the present invention is that aggregates with reduced seeding activity (i.e., low pathogenicity) are used as vaccines. Furthermore, aggregates with low seeding activity can be used as vaccines not only for aS but also for tau and Abeta.

[0095] Therefore, in the present invention, it is possible to use a combination of vaccines. This makes it possible to prevent or treat multiple neurodegenerative diseases with a single vaccination. For example, a two-component vaccine consisting of an Abeta vaccine (Aβ aggregates) and a tau vaccine (tau aggregates) is effective in preventing or treating Alzheimer's disease, and a two-component vaccine consisting of a tau vaccine and an aS vaccine (aS aggregates) can simultaneously prevent or treat tauopathies and α-synucleinopathies. Furthermore, these three-component vaccines can also simultaneously prevent or treat tauopathies, including Alzheimer's disease, and α-synucleinopathies.

[0096] In a preferred embodiment of the present invention, the seed activity-reducing aggregates are combined with a pharmaceutically acceptable carrier, which may include, for example, KLH (keyhole limpet hemocyanin), albumin-binding protein, bovine serum albumin, dendrimers, peptide linkers, etc. Additionally, the vaccine composition may be formulated with an adjuvant, such as aluminum hydroxide, aluminum phosphate, calcium phosphate, saponin, emulsions (e.g., Freund's adjuvant), liposomes, etc.

[0097] The vaccines of the present invention can be administered by administration methods or delivery devices such as intradermal, intravenous, intraperitoneal, intramuscular, intranasal, oral, and subcutaneous. Typically, the vaccine can contain 100 ng to 200 μg, e.g., 1 μg to 10 mg, or 1 mg to 100 mg, of the seed activity-reduced aggregates of the present invention. For vaccine administration methods and formulations, see the section "Pharmaceutical Compositions" above.

[0098] 3. Mutant Neurodegenerative Disease-Associated Proteins with Seed Activity 3.1. Amino Acid Mutations and Aggregates The mutant neurodegenerative disease-associated proteins of the present invention are mutant neurodegenerative disease-associated proteins that comprise an interaction region of two protofilament (PF) molecules in the amino acid sequence of a neurodegenerative disease-associated protein (in which one or several hydrophobic amino acids or basic amino acids in the amino acid sequence of the PF-interacting region are substituted with basic amino acids (provided that when a basic amino acid is substituted, it is substituted with another basic amino acid that has a higher charge than the basic amino acid in question)), or an amino acid sequence in which one or several basic amino acids are added to or deleted from the PF-interacting region, and that have seed activity that functions as a nucleus for protein aggregates that is 71% or more of the seed activity of the wild-type neurodegenerative disease-associated protein.

[0099] As used herein, a seed activity that is 71% or more of the seed activity of a wild-type neurodegenerative disease-associated protein is referred to as "having seed activity," and a mutant neurodegenerative disease-associated protein having such seed activity is also referred to as a "mutant protein possessing seed activity" or a "mutant possessing seed activity." Aggregates formed by the aggregation of mutant neurodegenerative disease-associated proteins having seed activity are also referred to as "aggregates possessing seed activity." Here, an activity of 71% or more includes not only mutants that maintain substantially the same activity (71 to 100%) as the wild-type, but also mutants that have increased activity compared to the wild-type activity, such as greater than 100% activity (e.g., 1.1-fold (110%), 1.2-fold (120%), 1.3-fold (130%), 1.4-fold (140%), 1.5-fold (150%), 2-fold (200%), or 3-fold (300%)).

[0100] The amino acid sequence present in the PF interaction region is not particularly limited, but is preferably a hydrophobic amino acid or a basic amino acid present in said region. Examples of amino acid mutations in neurodegenerative disease-related proteins include the following.

[0101] (1) α-synuclein In the case of α-synuclein, the PF interaction region is the region from amino acid residues 24 to 64 in the amino acid sequence of α-synuclein. Therefore, α-synuclein mutants include mutants containing an amino acid sequence in which one or several hydrophobic amino acids or basic amino acids are substituted with basic amino acids in the amino acid sequence of the PF interaction region, or mutants containing an amino acid sequence in which one or several amino acids are added or deleted. However, when a basic amino acid is substituted with another basic amino acid, it is substituted with another basic amino acid that has a higher charge than the basic amino acid before substitution. Basic amino acids are arginine, lysine, and histidine, with the order of increasing charge being arginine, lysine, and histidine. Therefore, when the amino acid to be substituted is lysine, it is substituted with arginine. These mutants retain seed activity.

[0102] Examples of mutations include substitutions of the 43rd lysine (Lys43), the 45th lysine (Lys45), and the 50th histidine (His50) with other amino acids (e.g., SEQ ID NO: 34, excluding embodiments in which the 43rd, 45th, and 50th amino acids in SEQ ID NO: 34 are all wild-type amino acids (lysine, lysine, and histidine, respectively) or non-basic amino acids).

[0103] In the present invention, examples of α-synuclein mutants include those in which the lysine at position 43 or 45 in the amino acid sequence of α-synuclein (e.g., SEQ ID NO: 2) is substituted with arginine (K43R, K45R), those in which both positions 43 and 45 are substituted with arginine (K43&45R), and those in which the histidine at position 50 is substituted with arginine or lysine (H50R, H50K).

[0104] (2) Tau In the case of tau, the PF interaction region is the region from amino acid residues 329 to 338 in the amino acid sequence of tau. Therefore, tau mutants include mutants containing an amino acid sequence in which one or several basic amino acids are substituted with other basic amino acids in the amino acid sequence of the PF interaction region, mutants containing an amino acid sequence in which an amino acid represented by PGGG is substituted with a basic amino acid, or mutants containing an amino acid sequence in which one or several basic amino acids are added or deleted. However, when a basic amino acid is substituted with another basic amino acid, the substitution is with another basic amino acid that has a higher charge than the basic amino acid before substitution.

[0105] Examples of mutations include substitutions of histidine at position 329 (His329), histidine at position 330 (His330), and lysine at position 331 (Lys331) with other amino acids (e.g., SEQ ID NO: 46, excluding embodiments in which positions 329, 330, and 331 are all wild-type amino acids (histidine, histidine, and lysine, respectively) or non-basic amino acids).

[0106] In the present invention, examples of such mutants include those in which the histidine at position 329 or 330 in the 4R2N amino acid sequence of tau (e.g., SEQ ID NO: 14) is substituted with arginine or lysine (H329R, H329K, H330R, H330K), those in which the lysine at position 331 is substituted with arginine (K331R), and those in which the histidines at positions 329 and 330, and the lysine at position 331 are substituted with arginine (H329&H330&K331R).

[0107] There are six types of tau isoforms, and the amino acid sequences of tau isoforms other than the 4R2N type are shown in Table 1. In addition, in isoforms other than the 4R2N type, the positions of the amino acids corresponding to the 329th, 330th, and 331st amino acids of the 4R2N type are as described above. The correspondence between the above-mentioned His329, His330, and Lys331 isoforms, or the correspondence between the 329th, 330th, and 331st amino acids in SEQ ID NOs: 4, 6, 8, 10, 12, and 14, is also as described above.

[0108] (3) Aβ In the case of Aβ, the PF interaction region is the region from amino acid residues 26 to 29 or from amino acid residues 33 to 37 in the amino acid sequence of Aβ. Therefore, Aβ mutants include mutants containing an amino acid sequence in which one or several hydrophobic amino acids are substituted with basic amino acids in the amino acid sequence of the PF interaction region, mutants containing an amino acid sequence in which one or several basic amino acids are substituted with other basic amino acids, or mutants containing an amino acid sequence to which one or several basic amino acids have been added. Here, when a basic amino acid is substituted with another basic amino acid, it is substituted with another basic amino acid that has a higher charge than the basic amino acid before substitution.

[0109] Examples of mutations include substitution of leucine at position 34 (Leu34), valine at position 36 (Val36), and lysine at position 28 (Lys28) with other basic amino acids. Examples include a mutant in which leucine at position 34 in the amino acid sequence of Aβ (e.g., SEQ ID NO: 16) is substituted with arginine (L34R), a mutant in which valine at position 36 is substituted with arginine (V36R), a mutant in which lysine at position 28 is substituted with arginine (K28R), or a mutant in which leucine at position 34 is substituted with arginine, valine at position 36 is substituted with arginine, and lysine at position 28 is substituted with arginine (L34&V36&K28R).

[0110] 3.2 Nucleic acids, vectors, and transformants encoding mutant proteins with seed activity The mutant proteins with seed activity used in the present invention can be obtained by obtaining gene or amino acid sequence information from the accession numbers shown in Table 1 and performing known genetic engineering techniques or site-directed mutagenesis based on that information (Sambrook J. et al., Molecular Cloning, A Laboratory Manual (4th edition), Cold Spring Harbor Laboratory Press (2012)). The wild-type gene can be chemically synthesized to have the nucleotide sequence shown in the sequence number in Table 1, or a commercially available product can be used.

[0111] <α-synuclein mutants> (a-1) A gene encoding a mutant α-synuclein that contains a mutant amino acid sequence in which at least one of the amino acids at positions 43, 45, and 50 of the amino acid sequence of α-synuclein (e.g., SEQ ID NO: 2) is substituted with another amino acid, and that has seed activity that functions as a nucleus for α-synuclein aggregates.

[0112] In the present invention, the amino acid sequence shown in SEQ ID NO: 2 is preferably an amino acid sequence in which the lysines at positions 43 and 45 are substituted with arginine, and the histidine at position 50 is substituted with arginine. The nucleotide sequence of the gene encoding the mutant α-synuclein is shown in SEQ ID NO: 33, and the amino acid sequence of the mutant α-synuclein is shown in SEQ ID NO: 34.

[0113] (a-2) A gene encoding a mutant α-synuclein that contains an amino acid sequence in which at least one of the 43rd, 45th, and 50th amino acids in the amino acid sequence of α-synuclein (e.g., SEQ ID NO: 2) is substituted with another amino acid, and one or several amino acids other than the 43rd, 45th, and 50th amino acids are deleted, substituted, or added, and that has seed activity that functions as a nucleus for α-synuclein aggregates.

[0114] (a-3) A gene consisting of DNA comprising the base sequence represented by SEQ ID NO: 34. (a-4) A gene consisting of DNA encoding a mutant α-synuclein that hybridizes under stringent conditions with DNA comprising a base sequence complementary to DNA comprising the base sequence represented by SEQ ID NO: 34 and has seed activity that functions as a nucleus for α-synuclein aggregates.

[0115] However, among the genes that hybridize under the above-mentioned stringent conditions, the base sequences encoding the 43rd amino acid, the 45th amino acid, and the 50th amino acid always hybridize as codons for the substituted amino acids.

[0116] <Tau mutants> (i) 4R2N type (b-1-1) A gene encoding a mutant tau that contains a mutant amino acid sequence in which at least one of the amino acids at positions 329, 330, and 331 of the amino acid sequence of tau (e.g., SEQ ID NO: 14) is substituted with another amino acid, and that has seed activity functioning as a nucleus for tau aggregates.

[0117] In the present invention, the amino acid sequence shown in SEQ ID NO: 14 is preferably an amino acid sequence in which the histidines at the 329th and 330th amino acids are substituted with lysine or arginine, and the lysine at the 331st amino acid is substituted with arginine.

[0118] (b-1-2) A gene encoding a mutant tau having an amino acid sequence in which at least one of the amino acids at positions 329, 330, and 331 of the amino acid sequence of tau (e.g., SEQ ID NO: 14) is substituted with another amino acid, and one or several amino acids other than the amino acids at positions 329, 330, and 331 are deleted, substituted, or added, and which has seed activity that functions as a nucleus for tau aggregates.

[0119] (b-1-3) A gene consisting of DNA comprising the base sequence represented by SEQ ID NO: 45. (b-4) A gene consisting of DNA encoding a mutant tau that hybridizes under stringent conditions with DNA comprising a base sequence complementary to DNA comprising the base sequence represented by SEQ ID NO: 45 and has seed activity that functions as a nucleus for tau aggregates.

[0120] However, among the genes that hybridize under the above-mentioned stringent conditions, the base sequences encoding the 329th amino acid, the 330th amino acid, and the 331st amino acid always hybridize as codons for the substituted amino acids.

[0121] (ii) Isoforms other than the 4R2N type (b-2-1) A gene encoding a mutant tau that contains a mutant amino acid sequence in which at least one of the amino acids at positions corresponding to the 329th amino acid, the 330th amino acid, and the 331st amino acid in the 4R2N type amino acid sequence (e.g., SEQ ID NO: 4, 6, 8, 10, or 12) is substituted with another amino acid, and that has seed activity that functions as a nucleus for tau aggregates.

[0122] In the present invention, the amino acid sequence is preferably an amino acid sequence shown in SEQ ID NO: 4, 6, 8, 10, or 12, in which the histidines at the amino acid positions corresponding to the 329th and 330th amino acids are substituted with lysine or arginine, and the lysine at the amino acid position corresponding to the 331st amino acid is substituted with arginine.

[0123] (b-2-2) A gene encoding a mutant tau that contains an amino acid sequence in which the amino acids at positions corresponding to at least one of the 329th, 330th, and 331st amino acids in the 4R2N-type amino acid sequence of tau (e.g., SEQ ID NO: 4, 6, 8, 10, or 12) are substituted with other amino acids, and one or several amino acids other than the amino acids at positions corresponding to the 329th, 330th, and 331st amino acids are deleted, substituted, or added, and that has seed activity that functions as a nucleus for tau aggregates.

[0124] (b-2-3) A gene consisting of DNA comprising any one of the nucleotide sequences represented by SEQ ID NOs: 35, 37, 39, 41, or 43. (b-4) A gene consisting of DNA encoding a mutant tau that hybridizes under stringent conditions with DNA comprising a nucleotide sequence complementary to DNA comprising any one of the nucleotide sequences represented by SEQ ID NOs: 35, 37, 39, 41, or 43, and has seed activity that functions as a nucleus for tau aggregates.

[0125] However, among the genes that hybridize under the above-mentioned stringent conditions, the base sequences encoding the amino acids at the positions corresponding to the 329th, 330th, and 331st amino acids always hybridize as codons for the substituted amino acids. In isoforms other than the 4R2N type, the positions of the amino acids corresponding to the 329th, 330th, and 331st amino acids of the 4R2N type are as described above.

[0126] The nucleotide sequences of the genes encoding these mutant tau isoforms and the amino acid sequences of the isoforms are shown in Table 3.

[0127] <Aβ Mutants> (c-1) A gene encoding a mutant Aβ that contains a mutant amino acid sequence in which at least one of the amino acids at positions 34, 36, and 28 of the amino acid sequence of Aβ (e.g., SEQ ID NO: 15) is substituted with another amino acid, and that has seed activity functioning as a nucleus for Aβ aggregates.

[0128] In the present invention, the amino acid sequence shown in SEQ ID NO: 15 is preferably an amino acid sequence in which the 34th amino acid, leucine, is substituted with arginine, the 36th amino acid, valine, is substituted with arginine, and the 28th amino acid, lysine, is substituted with arginine. The nucleotide sequence of a gene encoding mutant Aβ is shown in SEQ ID NO: 47, and the amino acid sequence of the mutant Aβ is shown in SEQ ID NO: 48.

[0129] (c-2) A gene encoding a mutant Aβ, which contains an amino acid sequence in which at least one of the amino acids at positions 34, 36, and 28 of the amino acid sequence of Aβ (e.g., SEQ ID NO: 15) is substituted with another amino acid, and one or several amino acids other than the amino acids at positions 34, 36, and 28 are deleted, substituted, or added, and which has seed activity functioning as a nucleus for Aβ aggregates.

[0130] (c-3) A gene consisting of DNA containing the base sequence represented by SEQ ID NO: 47. (c-4) A gene consisting of DNA encoding a mutant Aβ that hybridizes under stringent conditions with DNA consisting of a base sequence complementary to DNA containing the base sequence represented by SEQ ID NO: 47 and has seed activity that functions as a nucleus for Aβ aggregates. However, among the genes that hybridize under the above-mentioned stringent conditions, the base sequences encoding the 34th amino acid, the 36th amino acid, and the 28th amino acid always hybridize as codons for the substituted amino acids.

[0131] For the preparation of nucleic acids, vectors, and transformants encoding mutant proteins with seed activity, please refer to the section "2. Mutant neurodegenerative disease-related proteins with reduced seed activity."

[0132] 3.3. Neurodegenerative Disease Model Animals or Cells Model cells containing aggregates of the seed activity-retaining mutant protein of the present invention induce cell death. This is evident from the fact that when the cells are cultured for a certain period of time, clear morphological changes are observed compared to cells in which the protein aggregates have not been introduced, and a decrease in cell number is also observed. Therefore, the cells of the present invention can be used as model cells for neurodegenerative diseases.

[0133] The present invention also provides a non-human animal comprising an aggregate retaining seed activity. The non-human animal of the present invention can be used as a model animal for neurodegenerative disease. For the type of animal that can be used as a model animal and for introducing a mutant protein retaining seed activity or an aggregate of said protein into cells or animals, please refer to the section "2.2. Nucleic acid encoding a mutant neurodegenerative disease-related protein (mutant protein with reduced seed activity)."

[0134] Induction of cell death in the aggregate accumulation model cells can be confirmed, for example, by a cell death assay. The cell death assay method is not particularly limited, and examples thereof include a lactate dehydrogenase leakage assay.

[0135] 3.4. Screening Method and Kit for Neurodegenerative Disease Drugs The screening method of the present invention is characterized by contacting a candidate substance (test substance) with cells or a non-human mammal into which the above-described seed activity-retaining mutant protein or aggregates thereof have been introduced. This makes it possible to screen for substances that suppress the intracellular accumulation of protein aggregates, and also makes it possible to screen for therapeutic drugs for neurodegenerative diseases. For the diseases that can be targeted by the drugs to be screened, see the diseases described in the above section "2.4. Pharmaceutical Compositions and Methods for Treating or Preventing Neurodegenerative Diseases."

[0136] "Contact" means that a cell or animal into which a seed activity-retaining mutant protein or its aggregate has been introduced is placed in the same environment, reaction system, or culture system as a candidate substance (test substance), and includes, for example, adding the candidate substance to a cell culture vessel, mixing the cell with the candidate substance, culturing the cell in the presence of the candidate substance, and administering the candidate substance to a non-human mammal.

[0137] In a preferred embodiment of the present invention, when the neurodegenerative disease is Parkinson's disease, dementia with Lewy bodies, or multiple system atrophy, it is preferable to use cells into which α-synuclein has been introduced as the fibrous structure. In this case, a candidate substance is contacted with neurons in which α-synuclein has accumulated, and an index value or property correlated with the target disease in the cells contacted with the candidate substance is compared with a control. Based on the comparison results, a substance that inhibits intracellular accumulation of α-synuclein or a substance that alleviates or eliminates the symptoms of Parkinson's disease can be screened. Examples of index values ​​or properties correlated with the target disease include the following. These index values ​​or properties may be used alone or in combination of two or more.

[0138] Parkinson's disease: presence or absence of α-synuclein accumulation, presence or absence of Lewy bodies, presence or absence of reactivity with anti-ubiquitin antibodies, presence or absence of neuronal degeneration, etc. Alzheimer's disease: presence or absence of Aβ or tau accumulation, presence or absence of neurofibrillary tangles, presence or absence of reactivity with anti-ubiquitin antibodies, presence or absence of neuronal degeneration, etc. Creutzfeldt-Jakob disease: presence or absence of prion accumulation, presence or absence of neuronal degeneration, etc. Huntington's disease: presence or absence of huntingtin accumulation, presence or absence of neuronal degeneration, etc.

[0139] When the neurodegenerative disease is Alzheimer's disease, i.e., when the target substance of screening is a therapeutic agent for Alzheimer's disease, it is preferable to use neurons into which Aβ or tau has been introduced as cells for screening candidate substances. Furthermore, when the neurodegenerative disease is Creutzfeldt-Jakob disease, Gerstmann-Straussler syndrome, or mad cow disease, it is preferable to use cells into which prion protein has been introduced. When the neurodegenerative disease is Huntington's disease, spinal-bulbar muscular atrophy, spinocerebellar ataxia, or dentatorubral-pallidoluysian atrophy, it is preferable to use neurons into which polyglutamine has been introduced. When the neurodegenerative disease is amyotrophic lateral sclerosis, it is preferable to use neurons into which TDP-43 has been introduced. When the neurodegenerative disease is FTDP-17, progressive superior lateral paralysis, corticobasal degeneration, or Pick's disease, it is preferable to use tau.

[0140] Candidate substances include, for example, peptides, proteins, non-peptide compounds, synthetic compounds (high or low molecular weight compounds), fermentation products, cell extracts, cell culture supernatants, plant extracts, tissue extracts from mammals (e.g., mice, rats, pigs, cattle, sheep, monkeys, humans, etc.), plasma, etc. These compounds may be novel compounds or known compounds. These candidate substances may form salts, and examples of the salts of candidate substances include salts with physiologically acceptable acids (e.g., inorganic acids, organic acids, etc.) or bases (e.g., metallic acids, etc.).

[0141] Cells in which seed activity-retaining mutant proteins or their aggregates have accumulated intracellularly undergo cell death. Therefore, if results are obtained that confirm that cell death is alleviated or eliminated when a candidate substance is administered, the candidate substance used can be selected as a drug for treating neurodegenerative diseases.

[0142] The cells of the present invention can be provided in the form of a kit for screening for substances that suppress the intracellular accumulation of neurodegenerative disease-associated proteins or for therapeutic agents for neurodegenerative diseases. The kit of the present invention includes the above-described cells, but can also include a labeling substance, a cell death detection reagent (e.g., LDH, etc.), etc. Labeling substances refer to enzymes, radioisotopes, fluorescent compounds, chemiluminescent compounds, etc. In addition to the above components, the kit of the present invention can also include other reagents for carrying out the method of the present invention, such as, in the case of an enzyme label, an enzyme substrate (e.g., a chromogenic substrate), an enzyme substrate solution, and an enzyme reaction stop solution. Furthermore, the kit of the present invention can also include a diluent for the test compound, various buffers, sterile water, various cell culture vessels, various reaction vessels (e.g., Eppendorf tubes), detergents, an experimental operation manual (instructions), etc.

[0143] EXAMPLES The present invention will be explained in more detail below with reference to examples. However, the scope of the present invention is not limited to these examples. Example 1: α-synuclein mutants

[0144] Experimental Methods: Preparation of Recombinant α-Synuclein (aS) Monomers. Expression plasmid pRK172-aS (provided by Dr. Michel Goedert, MRC Laboratory, UK) containing human wild-type or mutant aS cDNA was transformed into Escherichia coli BL21 / DE3 (Merck, Cat. #69450). The transformed cells were cultured overnight at 37°C on an LB plate supplemented with 50 μg / mL sodium ampicillin (Fujifilm Wako Pure Chemical Industries, Cat. #012-23303). The cells were harvested and added to 500 mL of LB medium supplemented with sodium ampicillin to a final concentration of 50 μg / mL. After 4 hours of culture, isopropyl-β-thiogalactopyranoside (IPTG, Fujifilm Wako Pure Chemical Industries, Cat. #094-05144) was added to a final concentration of 0.6 mM, and the cells were cultured for another 4 hours.

[0145] The culture medium was transferred to a centrifuge tube and centrifuged at 2,700 g for 8 minutes at 4°C. The cells were harvested and stored frozen at -80°C. The cells were then thawed, suspended in 10 mL of aS purification buffer (50 mM Tris-HCl, pH 7.5 / 1 mM EGTA / 1 mM EDTA / 1 mM DTT), transferred to a centrifuge tube, and sonicated on ice for approximately 1 minute. The suspension was centrifuged at 26,600 g for 15 minutes at 4°C, and the supernatant was collected. 50 μL of 2-mercaptoethanol was added and the mixture was heat-treated at 100°C for 5 minutes. The mixture was returned to ice to cool, and then centrifuged at 26,600 g for 15 minutes at 4°C.

[0146] The supernatant was collected and loaded onto a 2 mL Q Sepharose Fast Flow (Cytiva, Cat. # 17051001) column (column volume: 2 mL) pre-equilibrated with aS purification buffer. The column was then washed with 20 mL of aS purification buffer. After washing with 6 mL of aS purification buffer containing 0.1 M NaCl, 6 mL of aS purification buffer containing 0.35 M NaCl was added to the column to elute the adsorbed protein. Ammonium sulfate was added to the eluate to 50% saturation, and the column was left on ice for 15 minutes to precipitate the protein. The column was then centrifuged at 26,600 xg for 15 minutes at 4°C. The supernatant was removed, and the resulting precipitate was dissolved in 30 mM Tris-HCl, pH 7.5.

[0147] The solution was dialyzed overnight against the same buffer and centrifuged at 135,000 g for 20 minutes at 4°C to remove insoluble matter, and then analyzed by reverse-phase high-performance liquid chromatography (RP-HPLC: Agilent Technologies) using a Brownlee Aquapore RP-300 Column (30 mm x 4.6 mm ID, PerkinElmer, Cat. #07110055) to determine the protein concentration of the solution, which was designated as recombinant aS monomer.

[0148] Preparation of aS aggregates 200 μL of purified recombinant aS monomer solution (3-7 mg / mL) was placed in a 1.5 mL tube, and sodium azide was added to a final concentration of 0.1%. This was incubated for 194 min on a shaker (Taitec NR-3) placed in a 37°C incubator. -1 The mixture was incubated for one week with shaking at a rotation speed of 100°C. After one week, the monomer solution solidified into a jelly-like substance, which was centrifuged at 135,000 g for 20 minutes to recover the aS aggregates as a precipitate. 200 μL of saline was added to the precipitate, and the mixture was centrifuged in the same manner to remove the remaining monomer.

[0149] The precipitated aS aggregates were resuspended in 200 μL of saline and sonicated (Taitec VP-050 and Branson Sonifier SFX). Five μL of this aliquot was mixed with 15 μL of 6 M guanidine hydrochloride, and the protein concentration of the aS fibrils was measured using RP-HPLC.

[0150] Mutant aS was generated using the QuickChange Site-Directed Mutagenesis Kit (Strategene). Mutants with Lys43 or Lys45 substituted with Ala (K43A, K45A) or Arg (K43R, K45R), with both Lys43 and Lys45 substituted with Ala (K43&45A), Arg (K43&45R), or Glu (K43&45E), and with His50 substituted with Ala (H50A) were generated by PCR using pRK172-aS or pcDNA3-aS (cultured cell expression vectors) encoding wild-type aS as a template and the following primers (Table 4).

[0151]

[0152] The K43&45delta mutant lacking both Lys43 and Lys45 was prepared using the KOD-Plus-Mutagenesis Kit (Toyobo, Cat. #SMK-101) and the following primers:

[0153] K43&45 delta-FW ACCGAGGGAGTGGTGCATGGTGTGGCAAC (SEQ ID NO: 65) K43&45 delta-RV GGAGCCTACATAGAGAACACCCTCTTTTGT (SEQ ID NO: 66)

[0154] The amplified PCR product (50 μL) was mixed with 1 μL of DpnI (Toyobo, Cat. # DPN-101) and incubated at 37°C for 1 hour to digest the template plasmid. A 3 μL aliquot was taken from this reaction mixture and mixed with 15 μL of E. coli DH5 alpha competent cells (Toyobo, Cat. # DNA-903F) and incubated at 42°C for 45 seconds for transformation. 100 μL of LB medium was added to this reaction mixture and incubated at 37°C for 1 hour. The entire mixture was then plated on an ampicillin-resistant LB plate, and the resulting colonies were used to isolate the mutant plasmid. The introduced mutations were confirmed by DNA sequencing of the resulting plasmid.

[0155] Measurement of aS Monomer Fibrillization Using Thioflavin (Th)T. 300 μL of wild-type or mutant aS monomer (1 mg / mL) was placed in a 1.5 mL tube and sodium azide was added to a final concentration of 0.1%. The tube was shaken at 37°C to allow aS fibrillization. On days 0, 2, 5, 8, 12, and 16 after the start of fibrillization, 10 μL aliquots were taken and mixed with 300 μL of 4 μM ThT (Fujifilm Wako Pure Chemical Industries, Cat. # 202-01002) in 20 mM Hepes, pH 7.5, and incubated at 37°C for 30 minutes. After the incubation, 150 μL of the sample was transferred to a 96-well plate, and the ThT fluorescence intensity was measured using an infinite M200 PRO plate reader (TECAN) at an excitation wavelength of 442 nm and an emission wavelength of 485 nm.

[0156] Electron microscopy: 3 μL of each aggregate (0.05 mg / mL) was added to a collodion-coated mesh (400 mesh, Nissin EM, Cat. #6512) and allowed to stand at room temperature for 1 minute. The moisture on the mesh was then blotted with a Kimwipe, and 10 μL of 2% sodium phosphotungstate solution was added and allowed to stand at room temperature for 3 minutes. The moisture on the mesh was then blotted with a Kimwipe and the mesh was allowed to air dry for several minutes. The dried mesh was then examined for the fibrous structure of each aggregate using a JEM-1400 electron microscope (JEOL).

[0157] Measurement of seeding activity of aS aggregates using ThT. 100 μL of wild-type aS monomer (1 mg / mL), 10 μL of 1 M Hepes, pH 7.5, 10 μL of 400 μM ThT, and 5 μL of each aggregate (0.2 mg / mL) were mixed in a 96-well plate. The fluorescence intensity of ThT was measured continuously at 37°C using an infinite M200 PRO plate reader (TECAN) at an excitation wavelength of 442 nm and an emission wavelength of 485 nm.

[0158] Human neuroblastoma cells (SH-SY5Y, purchased from the American Type Culture Collection, Cat. #CRL-2266) were cultured in Dulbecco's modified eagle's medium nutrient mixture (DMEM) / F-12HAM (Sigma-Aldrich, Cat. #D8062-500ML) supplemented with 10% (v / v) fetal bovine serum, non-essential amino acid solution (MEM Non-Essential Amino Acids Solution (100X), ThermoFisher, Cat. #11140050), and penicillin-streptomycin-glutamine (100X), ThermoFisher, Cat. #10378016, in a 5% CO2 incubator (Thermo Scientific) at 37°C. For culture, collagen-coated 6 cm Petri dishes (BD Biocoat) and 6-well plates (BD Biocoat) were used.

[0159] Cells were passaged when the cells were 100% confluent using the following procedure. After removing the medium from the 6 cm dish, the cells were washed with 1.5 mL of saline, and the saline was removed. 1 mL of 0.25% trypsin was added and the mixture was incubated at 37°C for 5 minutes. 2 mL of fresh medium was then added to stop the trypsin reaction, after which the cells were thoroughly suspended and seeded into a 6 cm dish containing 3 mL of medium. Typically, 4-6 x 10 5 When cells were added to a 6 cm dish containing 3 mL of medium, they became nearly 100% confluent (2-3 × 10 6 (cells / mL).

[0160] Expression of aS plasmid and introduction of recombinant aS aggregates into cells. The seeding activity of aS aggregates using cultured cells was determined according to the method of Nonaka et al. (3). 8 x 10 cells were cultured per well in a 6-well plate. 5 Cells were seeded and cultured overnight. The next day, a wild-type aS expression plasmid (pcDNA3-aS) was introduced into the cells using X-treamGENE9 (Roche, Cat. # 6365809001). Specifically, Opti-MEM (ThermoFisher, Cat. # 31985062), the plasmid, and X-treamGENE9 were gently mixed in a ratio of 100 μL:1 μg:3 μL and incubated at room temperature for 15 minutes. The mixture was then added dropwise to the culture medium in each well. After 3–5 hours, 1.2 μL of recombinant aS aggregates (0.2 mg / mL) were added to the culture medium in each well. The treated cells were incubated in a CO2 incubator and harvested after 2 days as described below.

[0161] Immunoblotting for detection of insolubilized aS. The culture medium from each well was removed using an aspirator, and 1 mL of saline was added to the well to detach and collect the cells. Cells were harvested by centrifugation at 1,800 g for 5 minutes. After centrifugation, 300 μL of 1% sarkosyl (N-lauroyl sarcosine sodium salt, Sigma-Aldrich, Cat. #L5125-500G) was added to A68 buffer (10 mM Tris-HCl, pH 7.5 / 1 mM EGTA / 10% sucrose / 0.8 M NaCl) and disrupted by ultrasonication using a TAITEC VP-050 sonicator (PWM 17% intensity) for 40–60 seconds. After this, 300 μL of 1% sarkosyl in A68 buffer was added, and the cells were centrifuged at 113,000 g for 20 minutes (himac CS100GXL, Eppendorf Himac Technologies).

[0162] 300 μL of the resulting supernatant (sarkosyl supernatant fraction: Sar-sup) was collected and 75 μL of 5x SDS sample buffer (5xSB) containing 5% 2-mercaptoethanol was added. 15 μL of the supernatant was used to quantify the protein content of the supernatant fraction using a BCA assay (BCA Protein Assay Kit, ThermoFisher, Cat. #23225). The precipitate fraction was then sonicated and heated at 100°C for 5 minutes, after which it was collected as the sarkosyl-insoluble fraction (Sar-ppt). 50 μL of 5xSB containing 5% 2-mercaptoethanol was added.

[0163] The obtained samples (Sar-sup and Sar-ppt) were electrophoresed on a 13.5% polyacrylamide gel and then transferred to a PVDF membrane (Millipore) at 200 mA for 1 hour. The PVDF membrane was blocked with saline containing 3% gelatin (Fujifilm Wako Pure Chemical Industries, Ltd., Cat. #077-03155) for 10 minutes at room temperature, and then incubated with primary antibodies (anti-phosphorylated α-synuclein monoclonal antibody (pSyn#64): anti-64 antibody, 1:1,000 dilution, Fujifilm Wako Pure Chemical Industries, Ltd., Cat. #015-25191) recognizing phosphorylated aS (phosphorylation of Ser at residue 129) and anti-α-synuclein monoclonal antibody (pSyn#64): anti-64 antibody, 1:1,000 dilution, Fujifilm Wako Pure Chemical Industries, Ltd., Cat. #015-25191) recognizing the C-terminus (residues 131-140) of aS) diluted in saline containing 10% bovine serum (CS: Bovine Serum, ThermoFisher, Cat. #16170-078) and 0.1% NaN3 (10% CS / saline). The cells were incubated overnight at room temperature with anti-131-140 (1:1,000 dilution, Cosmo Bio, Cat. # TIP-SN-P09).

[0164] The PVDF membrane was then washed with several mL of saline and incubated with secondary antibodies diluted in 10% CS / saline (1:1,000 dilution: Biotin-Goat anti-mouse IgG, Vector, Cat. # BA-9200-1.5 or Biotin-Goat anti-rabbit IgG, Vector, Cat. # BA-1000-1.5) at room temperature for 1 hour, and then washed with Tris saline (TS). The PVDF membrane was incubated with peroxidase-conjugated avidin-biotin complex (ABC Standard Kit, Vector, Cat. #PK-4000) for 30 minutes, then washed with saline and treated with saline containing 0.1% 3,3'-Diaminobenzidine (Sigma-Aldrich, Cat. #D8001-5G), 0.2 mg / mL nickel(II) chloride hexahydrate (Fujifilm Wako Pure Chemical Industries, Cat. #141-01045), and 0.05% H2O2 (hydrogen peroxide solution, Sigma-Aldrich Japan, Cat. #13-1910-5) to develop the protein bands on the membrane. The color development was stopped by rinsing the PVDF membrane with tap water.

[0165] Mice Male wild-type mice (C57BL / 6J) were purchased from Japan SLC Co., Ltd. and bred in the animal breeding facility of the Tokyo Metropolitan Institute of Medical Science.

[0166] Samples to be inoculated into mouse brains The samples to be inoculated into mouse brains are as follows: (1) Saline (5 μL): used as a negative control. (2) 10 μg of human wild-type aS fibers (2 mg / mL, 5 μL). (3) 10 μg of mutant K43&45A fibers (2 mg / mL, 5 μL). (4) 10 μg of mutant K43&45R fibers (2 mg / mL, 5 μL).

[0167] Injection of samples into mouse brains. Mice were placed in an anesthesia jar containing tissue paper moistened with anesthetic (20% isoflurane, Japanese Pharmacopoeia, Pfizer) and allowed to rest for several minutes. The anesthetized mice were then secured with auxiliary ear bars and further administered isoflurane inhalation anesthesia. Recombinant aS aggregates were injected into the right brain and striatum of mice as follows: First, an incision was made in the scalp of the mouse to identify the bregma. A mark was made 2 mm horizontally and 0.5 mm vertically from that point, and a hole was drilled in the skull. The needle of a syringe (HAMILTON, Cat. #80301) containing the sample was inserted to a depth of 3 mm, taking care not to bend it, and 5 μL was injected. To reduce sample leakage, the mouse was left to rest for 1 minute, after which the needle was removed and sutured. Finally, a hole was punched in the ear for individual identification, and the mouse was returned to its cage.

[0168] Mouse brain extraction. The brains were removed three months after inoculation of the samples. The mice were anesthetized by intraperitoneal injection of 0.1 mL of Somnopentyl (Schering-Plough), and the whole body was bled with saline (Terumo saline, Type B, Terumo). The brains were then removed carefully using surgical scissors and tweezers to avoid damaging the tissue.

[0169] Fixation of mouse brains The excised mouse brains were fixed in 10% neutral buffered formalin (Fujifilm Wako Pure Chemical Industries, Cat. #062-01661) at 4°C. Tissue fixation was carried out as quickly as possible (3-4 days) because not only does the tissue decay over time, but there is also a risk of the target antigen being lost.

[0170] Vibratome sectioning and immunohistochemical analysis. Fixed mouse brains were sliced ​​at 30 μm thickness using a vibratome (Leica) equipped with a double-edged blade (blue blade). The sections were attached to anti-peel coated glass slides (MATSUNAMI) and allowed to dry. The sections were then autoclaved at 105°C for 10 minutes in 0.01 M sodium citrate buffer. They were then incubated in 100% formic acid for 10 minutes, rinsed with running water, and immersed in 3% H2O2 in methanol.

[0171] The sections were then washed three times with 0.03% TritonX-100 in saline (Tx / saline) and blocked with 10% CS for 20 minutes. They were then incubated overnight with a 1:1,000 diluted phosphorylated aS antibody (anti-pS129, Abcam, Cat. #ab51253). The next day, they were washed three times with Tx / saline and incubated with a 1:500 diluted biotinylated anti-mouse IgG (H+L) antibody at room temperature for 1.5 hours. They were then washed three times with Tx / saline and incubated with avidin-biotin-peroxidase complex using the ABC Kit for 1 hour at room temperature. After washing three times with Tx / saline, the sections were developed with a freshly prepared color development solution (TS containing 1% DAB and 1% H2O2). The color development reaction was stopped by rinsing the slides with tap water.

[0172] After drying, the sections were treated with Mayer's Hematoxylin (Muto Chemicals, Cat. #30002) for 1 minute to stain the nuclei, and then washed in running water for 5 minutes. The specimens were then completely dried, immersed in xylene for 10 minutes, dehydrated, and mounted using Antifade Mounting Medium for fluorescence (VECTASHIELD, Cat. #H-1000-10). The prepared slides were stored at room temperature. An all-in-one microscope (KEYENCE: BZ-X710) was used for observation.

[0173] Vaccine therapy using mutant K43&45A aggregates According to the scheme shown in Figure 10, aS aggregates were inoculated into the brains of mice previously immunized with K43&45 aggregates as a vaccine, and we investigated whether vaccination suppressed seed-dependent aS aggregate formation in the brain.

[0174] Six mice (6-8 weeks old) were divided into three groups of two. The mice were placed in an anesthesia jar containing tissue paper moistened with anesthetic (20% isoflurane: Pfizer) and left to stand for several minutes. The entire amount of the following samples was inoculated subcutaneously into several sites on the backs of the anesthetized mice.

[0175] (1) Saline immunization group: 125 μL of saline (Otsuka Saline Injection, Otsuka Pharmaceutical) and 125 μL of adjuvant (Freund's complete adjuvant was used for the first immunization, and Freund's incomplete adjuvant for the second and third immunizations: Freund's complete adjuvant, Sigma-Aldrich, Cat. #F5881-10ML; Freund's incomplete adjuvant, Sigma-Aldrich, Cat. #F5506-10ML) were mixed in a 1.5 mL tube and sonicated in an ultrasonicator (Taitec, VP-050) until a white emulsion formed. For one immunization, the entire amount was inoculated subcutaneously (at several sites) onto the back of one mouse.

[0176] (2) Group immunized with 20 μg of K43&45A aggregate (vaccine): 20 μg of K43&45A aggregate was mixed with saline (total volume 125 μL), and 125 μL of adjuvant (Freund's complete adjuvant was used for the first immunization, and Freund's incomplete adjuvant for the second and third immunizations) was added. The mixture was then sonicated using an ultrasonicator (Taitec, VP-050) until a white emulsion formed. For each immunization, the entire amount was inoculated subcutaneously (at several sites) onto the back of one mouse.

[0177] (3) Group immunized with 50 μg of K43&45A aggregate: 50 μg of K43&45A aggregate was mixed with saline (total volume 125 μL), and 125 μL of adjuvant (Freund's complete adjuvant was used for the first immunization, and Freund's incomplete adjuvant for the second and third immunizations) was added. The mixture was then sonicated using an ultrasonicator (Taitec, VP-050) until a white emulsion formed. For each immunization, the entire amount was inoculated subcutaneously (at several sites) onto the back of one mouse.

[0178] (4) Group immunized with 100 μg of K43&45A aggregate: 100 μg of K43&45A aggregate was mixed with saline (total volume 125 μL), and 125 μL of adjuvant (Freund's complete adjuvant was used for the first immunization, and Freund's incomplete adjuvant for the second and third immunizations) was added. The mixture was then sonicated using an ultrasonicator (Taitec, VP-050) until a white emulsion formed. For each immunization, the entire amount was inoculated subcutaneously (at several sites) onto the back of one mouse.

[0179] Antibody titer measurement in mouse peripheral blood by enzyme-linked immunosorbent assay (ELISA). To determine whether the target antibodies were produced in mice following administration of the K43&45A aggregate (vaccine), peripheral blood was collected from the mouse tail and antibody titers were measured by ELISA. After the first and third vaccine administrations, 50-200 μL of blood was collected from the tail vein of each mouse. This blood was incubated at 37°C for 1 hour and then left overnight at 4°C. Serum was then collected by centrifugation at 10,000 g for 10 minutes and stored at -20°C until use. 50 μL of 2 ng / μL antigen solution (wild-type or K43&45A aggregate) was added to each well of a 96-well plate (SUMILON: high-adsorption, flat bottom) and left overnight at 4°C.

[0180] The antigen solution was removed from each well, and the wells were washed twice with 100 μL of saline. 150 μL of 10% calf serum (CS) was added to each well and incubated at room temperature for 90 minutes. The wells were washed twice with 200 μL of saline, and 100 μL of serum solution diluted 500-fold with 10% CS was added to the wells and incubated at room temperature for 1 hour. The wells were washed three times with 150 μL of saline, and 100 μL of peroxidase-labeled goat anti-mouse IgG (BioRad, Cat. #170-6516) diluted 3,000-fold with 10% CS was added to the wells and incubated at room temperature for 1 hour. After washing the wells three times with 150 μL of citrate-phosphate buffer, pH 5.0, 100 μL of substrate solution (a mixture of 6 mg of o-phenylenediamine (Fujifilm Wako Pure Chemical Industries, Cat. #160-11022), 10 mL of citrate-phosphate buffer, pH 5.0, and 10 μL of H2O2) was added, and the wells were left to stand at room temperature for 5–10 minutes to allow color development.

[0181] After an appropriate time had elapsed, 20 μL of 2N sulfuric acid was added to each well to stop the color development. The absorbance of each well was measured at 490 nm using a plate reader, Infinite M200 PRO (TECAN).

[0182] Injection of wild-type aS aggregates and detergent-insoluble fractions prepared from MSA patient brains into mouse brains administered with K43&45A aggregates (vaccine). Two weeks after the first vaccination, a second vaccination was administered, followed by a third vaccination two weeks later. Two weeks after the three vaccinations, 2.5 μg of recombinant mouse wild-type aS aggregates (5 μL of 0.5 mg / mL) was inoculated into the right hemisphere and striatum of the mice.

[0183] Detergent-insoluble fractions (seed fractions) from MSA patient brains were prepared as follows: A frozen sample (0.5 g) of patient brain was homogenized in 5 volumes of A68 buffer (10 mM Tris, pH 7.5, 0.8 M NaCl, 1 mM EGTS, 1 mM DTT). Sarkosyl was added to the suspension to a final concentration of 1%, and the mixture was stirred and incubated at 37°C for 30 minutes. The suspension was then centrifuged (12,000 g, 10 minutes, 25°C) and the supernatant was collected. This supernatant was further centrifuged (113,000 g, 20 minutes, 25°C) to collect the precipitate. An appropriate amount of saline was added to the mixture, and the mixture was sonicated. Appropriate aliquots were placed in 1.5 mL Eppendorf tubes, and each aliquot was centrifuged (113,000 g, 20 minutes, 25°C) to collect the precipitate (patient brain insoluble fraction). 50 μL of saline was added to one of the insoluble fractions, and the mixture was sonicated (Taitec, VP-050). 5 μL of this suspension was used as a seed to inoculate the right hemisphere and striatum of a mouse brain.

[0184] One month after inoculation, mouse brains were removed, fixed, and vibratome-sectioned. The sections were stained with a phosphorylated aS-specific antibody (anti-pS129, Abcam, Cat. #ab51253) and observed under an all-in-one microscope (KEYENCE: BZ-X710). The area of ​​the anti-pS129-positive structures (phosphorylated aS aggregates) that appeared in the mouse brain was calculated, and this was used as the aggregate mass.

[0185] Generation of mutant aS aggregates by addition of wild-type aS aggregates. Wild-type aS monomer (6.1 mg / mL, 200 μL), K43&45A monomer (7.2 mg / mL, 200 μL), K43&45R monomer (6.3 mg / mL, 200 μL), and K43&45delta monomer (6.7 mg / mL, 200 μL) were mixed with wild-type aS aggregates (1 μg), and sodium azide was added to a final concentration of 0.1%. This mixture was incubated at 37°C for 12 days. The samples were centrifuged at 135,000 g for 20 minutes at 25°C, and the aS aggregates were collected as a precipitate. 200 μL of saline was added to the mixture, and the remaining monomers were removed by similar centrifugation. The precipitated aS aggregates were resuspended in 200 μL of saline and sonicated (Taitec VP-050 and Branson Sonifier SFX). A 5 μL aliquot was mixed with 15 μL of 6 M guanidine hydrochloride, and the protein concentration of the aS aggregates was measured using RP-HPLC.

[0186] <Results> 1. Novel vaccine therapy using mutant aS aggregates. The three-dimensional structures of aS aggregates derived from the brains of MSA patients and recombinant aggregates (Figure 1) published in 2020 by cryo-electron microscopy revealed that the three-dimensional structure is based on a core structure consisting of two molecules of aS protofilaments (PFs: precursors of amyloid fibrils) (1, 2). The central region of the interaction between these two PF molecules contains basic amino acids, such as Lys43, Lys45, and His50, which we hypothesized may be important for aS polymerization. We therefore focused on Lys43 and Lys45, created mutants with amino acid substitutions in these regions, and investigated their properties. The mutants prepared include the K43&45A mutant, in which both Lys at Lys43 and Lys45 are substituted with Ala; the K43&45R mutant, in which both Lys at Lys43 and Lys45 are substituted with Arg; the K43&45E mutant, in which both Lys at Lys43 and Lys45 are substituted with Glu; and the K43&45delta mutant, in which both Lys at Lys43 and Lys45 are deleted.

[0187] We prepared recombinant wild-type and mutant (K43&45A and K43&45R) monomers and monitored their in vitro aggregation (Fig. 2). A 1 mg / mL monomer solution was shaken at 37°C, and after a set time, the solution was reacted with thioflavin T (ThT) and the fluorescence intensity was measured. ThT does not react with monomeric proteins, but reacts with amyloid fibril-like aggregates rich in β-sheet structures, resulting in fluorescence. Both mutants exhibited an increase in ThT fluorescence intensity over time, demonstrating that they aggregated upon shaking at 37°C, similar to wild-type aS. Electron microscopy revealed fibrillar structures in both samples (Fig. 3). These mutant aS aggregates, like those of the wild-type, possessed a fibrillar structure.

[0188] aS monomers aggregate when shaken at 37°C, but not when left stationary without shaking. However, when a small amount of preformed aS fibrils is added to a stationary monomer solution, the monomers aggregate. This suggests that the added aS aggregates act as aggregation nuclei (seeds), and the aS monomers aggregate in a seed-dependent manner. To examine the seeding activity of these aggregates, we next added 1 μg of the aggregates to a wild-type monomer solution (1 mg / mL, 100 μL) and measured the ThT fluorescence intensity (Figure 4). Wild-type aS monomers without added aggregates (none: no seed) showed no increase in ThT fluorescence intensity even when incubated at 37°C.

[0189] When wild-type or K43&45R aggregates were added as seeds to wild-type aS monomers, a time-dependent increase in ThT fluorescence intensity was observed, demonstrating that these aggregates have a seed effect on wild-type aS monomers. In particular, the seed effect of the K43&45R aggregates was extremely high, approximately four times higher than that of the wild-type aggregates. On the other hand, when the K43&45A aggregates were added to wild-type aS monomers, no increase in ThT fluorescence intensity was observed. This suggests that the mutant K43&45A aggregates have almost no seed effect.

[0190] Next, we similarly analyzed mutants with single mutations at K43 and K45. Specifically, we generated K43R, K45R, K43A, and K45A mutant monomers and shook them at 37°C for one week to obtain their respective aggregates. To examine the seeding activity of these aggregates, we added 1 μg of each aggregate to a wild-type monomer solution (1 mg / mL, 100 μL) and measured the ThT fluorescence intensity (Figures 5 and 6). As shown in Figure 5, the K45R aggregates possessed the strongest seeding activity, followed by the K43&45R aggregates, K43R aggregates, and wild-type aggregates. On the other hand, the seeding activity of all the Ala-substituted mutant aggregates was lower than that of the wild-type aggregate, with the order being wild-type > K43A > K45A > K43&45A (Figure 6).

[0191] We also analyzed mutants in which both K43 and K45 were replaced with Glu (K43&45E) and those lacking both amino acids (K43&45delta). Monomers of the K43&45E and K43&45delta mutants were prepared and shaken at 37°C for one week to obtain their respective aggregates. To assess the seeding activity of these aggregates, we added 1 μg of each aggregate to a 100 μL solution of wild-type monomer (1 mg / mL) and measured the ThT fluorescence intensity (Fig. 7). The seeding activity of both the K43&45E and K43&45delta aggregates was found to be significantly lower than that of the wild-type aggregate. Similar to the K43&45A aggregate, the K43&45E and K43&45delta aggregates had almost no seeding effect.

[0192] H50, a similarly positively charged amino acid, is located near K43 and K45. Next, we investigated the influence of H50 on the seeding activity of α-synuclein aggregates. H50A mutant monomers were prepared by substituting H50 with Ala and shaking at 37°C for one week to obtain H50A aggregates. To examine the seeding activity of these aggregates, H50A aggregates (1 μg) were added to a wild-type monomer solution (1 mg / mL, 100 μL) and the ThT fluorescence intensity was measured (Figure 8). The seeding activity of H50A aggregates was lower than that of wild-type aggregates, but higher than that of K43&45A aggregates.

[0193] The seed effect of recombinant aS aggregates was investigated using cultured cells. When an aS expression plasmid was transiently expressed in cultured SH-SY5Y cells, the plasmid-derived aS was expressed mainly as a soluble protein in the cytoplasm, with little insolubilization. It has been reported that when pre-prepared aS aggregates were added to the culture medium of the aS plasmid-expressing cells, the aS aggregates were taken up into the cells, functioning as seeds in the cytoplasm and resulting in the intracellular accumulation of soluble aS derived from the plasmid (3). Therefore, using this method, the seed effect of two mutant aggregates was investigated using cultured cells.

[0194] SH-SY5Y cells transiently expressing wild-type aS were seeded with 0.24 μg of various aggregates. After 2 days of culture, the cells were harvested and homogenized in a buffer containing the detergent sarkosyl. The supernatant (sarkosyl-soluble fraction: Sar-sup) and precipitate (sarkosyl-insoluble fraction: Sar-ppt) were obtained by ultracentrifugation. These were immunoblotted with anti-131-140 (an antibody recognizing the C-terminus of aS) and anti-64 (an antibody specific to phosphorylated aS), and the resulting anti-64-positive bands were quantified (Fig. 9).

[0195] Although aS accumulated in the patient's brain was phosphorylated at Ser 129, soluble aS was largely unphosphorylated (4). Phosphorylation of aS is thought to be a post-translational modification that occurs after aggregation and is a sensitive marker for detecting intracellular aS aggregation. Immunoblotting with anti-64 revealed that in cells expressing only the plasmid, a faint band was detected in the soluble fraction, while almost no band was observed in the insoluble fraction. In other words, in cultured cells, most of the aS derived from the plasmid was solubilized and unphosphorylated. However, when wild-type aggregates were introduced into the cells as seeds, multiple bands strongly positive for phosphorylated aS-specific antibodies were detected in the insoluble fraction.

[0196] The smallest band (approximately 15 kDa) represents a phosphorylated aS monomer; the band at approximately 25 kDa represents a single ubiquitin-linked aS; the band at approximately 30 kDa represents an aS dimer; and the band at approximately 45 kDa represents aS with two ubiquitin-linked aS or aS trimer. These multiple bands were also observed in immunoblots of aS accumulated in patient brains using a phosphorylated aS-specific antibody (5, 6), suggesting that the abnormal aS observed in patient brains can be easily reproduced in cultured cells. On the other hand, when the two mutant aggregates were introduced as seeds, the K43&45R aggregate strongly detected an anti-64 antibody-reactive band, whereas the K43&45A aggregate barely detected a phosphorylated aS band. These results demonstrate that the K43&45R mutant aggregate functions as a seed in cells similar to the wild-type aggregate, whereas the K43&45A aggregate barely functions as a seed.

[0197] We analyzed the seeding effect of aS aggregates in vivo. When recombinant aS aggregates were inoculated into wild-type mouse brains, they functioned as seeds, leading to the intracellular accumulation of endogenous mouse aS in a seed-dependent manner. This means that it is possible to reproduce the aS aggregates seen in patient brains in mouse brains (6). We also inoculated the mutant aS aggregates we created into wild-type mouse brains to examine their in vivo seeding activity. Inoculation of wild-type aggregates into mouse brains led to the accumulation of endogenous mouse aS in a seed-dependent manner within approximately 3 months, resulting in the appearance of numerous phosphorylated aS aggregates in the brain. Similarly, inoculation of K43&45R aggregates revealed approximately six-fold higher levels of phosphorylated aS aggregates in the brain than inoculation of wild-type aggregates (Figure 10). In contrast, inoculation of K43&45A aggregates into mouse brains resulted in almost no phosphorylated aS aggregates. These results suggest that, similar to the in vitro results shown in Figure 4, K43&45R aggregates have a stronger seeding effect than WT aggregates in vivo, whereas K43&45A aggregates show almost no seeding effect.

[0198] Mutant aS that forms aggregates in this way but lacks seed activity (prion-like activity) has never been reported before. We focused on the lack of seed activity in the K43&45A aggregate and thought that it might be possible to use it as a vaccine. This is because "almost no seed activity" suggests that, unlike wild-type aggregates, the aggregates are "less pathogenic (i.e., attenuated)" to the body.

[0199] Currently, three preparations have been reported by overseas pharmaceutical groups as vaccine therapies for aS, all of which involve modifying the aS monomer or its peptides to enhance immunogenicity. From a vaccine perspective, it would be preferable to use aggregates as antigens, which are thought to be more immunogenic than the monomer (because aS monomers are present in the bodies of healthy individuals, but aggregates are not).

[0200] However, wild-type aS aggregates possess seed activity (prion-like activity), and when inoculated into mouse brains, they exert prion-like activity, leading to the intracellular accumulation of endogenous aS in a seed-dependent manner. Therefore, because wild-type aS aggregates are pathogenic to the body, even when administered peripherally as a vaccine, their safety cannot be fully guaranteed. In general, vaccinations against diseases such as measles involve administering attenuated or non-virulent bacteria or virus fragments to healthy individuals to promote the production of antibodies against the antigen and ultimately prevent disease. In a similar vein, K43&45A aggregates are attenuated aggregates, and their use as vaccines may potentially prevent neurodegenerative diseases associated with aS accumulation.

[0201] We therefore investigated whether K43&45A aggregates function as a vaccine (Fig. 11). K43&45A aggregates (20-100 μg) were mixed with Freund's complete adjuvant (only for the first immunization) or incomplete adjuvant (for subsequent immunizations) and sonicated to form emulsions. Six- to eight-week-old mice were immunized with these emulsions subcutaneously (three times every two weeks). Blood samples were collected before and after the three immunizations, and the production of target antibodies was confirmed by ELISA. Both mice vaccinated with 20 mg and 100 mg of K43&45A aggregates produced antibodies against the K43&45A aggregates used as the immunogen (Fig. 12). In contrast, no such antibodies were produced in the saline-immunized group.

[0202] After three immunizations, mouse brains were seeded with either wild-type mouse aS aggregates (2.5 μg) or a detergent-insoluble fraction (containing aS aggregates) prepared from the brains of patients with multiple system atrophy (MSA). The brains were then excised one month later. As a control, the brains of mice immunized with saline instead of mutant aggregates were also inoculated with each seed and excised in the same manner. The excised brains were fixed with 4% paraformaldehyde and immunohistochemically analyzed using a phosphorylated aS-specific antibody to analyze the seed-dependent accumulation of endogenous mouse aS.

[0203] The results for the group in which mouse wild-type aS aggregates were inoculated into the brains of immunized mice are shown in Figure 13. Numerous seed-dependent phosphorylated aS aggregates were observed in the brains of mice immunized with saline, whereas aggregate formation was significantly suppressed in the group immunized with K43&45A aggregates. Similarly, when immunized mice were inoculated with insolubilized aS derived from the brains of MSA patients, numerous phosphorylated aS aggregates were observed in the brains of the group immunized with saline, whereas aggregate formation was significantly suppressed in the group pre-immunized with K43&45A aggregates (Figure 14).

[0204] These results demonstrate that K43&45A aggregates function as a vaccine in an in vivo mouse model. Furthermore, aggregates derived from aS mutants that show little seed activity, such as K43&45E, K43&45delta, and H50A aggregates, which showed little seed activity like K43&45A aggregates, may also function as vaccines.

[0205] 2. Inhibition of aS aggregate formation by expressing aS mutants using adeno-associated virus (AAV) or delivering aS mutants into the brain. As described above, the K43&45A, K43&45E, and K43&45delta aggregates showed almost no seed activity, suggesting their lower pathogenicity compared to wild-type aggregates. Based on these findings, we investigated the possibility of using these mutant aggregates as vaccines against α-synucleinopathy and demonstrated their usefulness. These mutant aggregates can be produced by shaking the respective monomer solutions at 37°C (shaking-induced aggregates), whereas aS monomers exhibit seed-dependent aggregation under static conditions without shaking (seed-dependent aggregates).

[0206] We therefore investigated whether these mutant monomers aggregate in a seed-dependent manner. Specifically, we investigated whether mutant aS monomers aggregate when shaking-induced wild-type aS aggregates (FWT) were added as seeds to the mutant aS monomer solution. Wild-type aS and mutant monomer solutions (1 mg / mL, 100 μL) were mixed with shaking-induced wild-type aS aggregates (FWT: 1 μg each) and incubated at 37°C. As shown in Figure 15, the addition of FWT as a seed for the wild-type and three mutant monomers resulted in a time-dependent increase in ThT fluorescence intensity.

[0207] On the other hand, no increase in ThT fluorescence intensity was observed without the addition of seeds. Therefore, it was found that not only wild-type aS monomers but also K43&45A, K43&45R, and K43&45delta monomers aggregated in a seed-dependent manner in the presence of wild-type aS aggregates induced by shaking.

[0208] As shown in Figure 4, the shaking-induced mutant K43&45A aggregates showed almost no seeding activity. However, we investigated whether the mutant aggregates that aggregated in a seed-dependent manner as shown in Figure 15 possessed seeding activity. First, seed-dependent aggregates were prepared from wild-type and mutant monomers as follows. Wild-type aS (WT) monomer (6.1 mg / mL, 200 μL), K43&45A (KA) monomer (7.2 mg / mL, 200 μL), K43&45R (KR) monomer (6.3 mg / mL, 200 μL), and K43&45delta (Kdelta) monomer (6.7 mg / mL, 200 μL) were mixed with shaking-induced wild-type aS aggregates (FWT: 1 μg) and incubated at 37°C for 12 days.

[0209] The samples were then centrifuged to recover the seed-dependent aggregates (WT+FWT, KA+FWT, KR+FWT, and Kdelta+FWT). The seeding activity of these aggregates was then compared. These aggregates were added to wild-type aS monomer, and the ThT fluorescence intensity was measured over time. As shown in Figure 16, FWT (aggregates induced by shaking) and seed-dependent aggregates (WT+FWT, KR+FWT, Kdelta+FWT, and KA+FWT) were added to WT monomer and incubated at 37°C. The fluorescence intensity was measured over time. The seeding activity of the seed-dependent aggregates (WT+FWT and KR+FWT) was slightly lower than that of the seed-dependent aggregates (FWT), whereas the seeding activity of the seed-dependent aggregates (Kdelta+FWT and KA+FWT) was significantly lower than that of the others.

[0210] These results demonstrate that the seeding effect of seed-dependent aggregates obtained by adding FWT to K43&45A monomers (KA+FWT) and seed-dependent aggregates obtained by adding FWT to K43&45delta monomers (Kdelta+FWT) is quite low. These results suggest that the expression of K43&45A monomers or K43&45delta monomers in the brain suppresses aS aggregate formation (Fig. 17). Although wild-type (endogenous) aS monomers are constitutively expressed in the human brain, if aS aggregates appear in the brain for some reason, they function as seeds to induce the seed-dependent aggregation of endogenous aS monomers, which then further promote the aggregation of endogenous aS monomers, ultimately leading to the onset of α-synucleinopathy (Fig. 17-A).

[0211] If K43&45A (KA) monomers could be expressed or delivered into the brain, endogenous aS and KA monomers would coexist in the brain. Under these conditions, if aS aggregates were to appear in the brain, both endogenous and KA monomers would aggregate in a seed-dependent manner (Fig. 17-i and ii). The resulting aggregates derived from endogenous monomers (WT+FWT) would function as seeds and promote the aggregation of endogenous and KA monomers (Fig. 17-A and B). On the other hand, aggregates derived from KA monomers (KA+FWT: Fig. 17-ii) have significantly lower seeding activity as shown in Fig. 16, making them unlikely to promote the aggregation of endogenous monomers.

[0212] Therefore, it is possible to say that aggregates derived from KA monomers have lower seeding activity, i.e., lower pathogenicity, than aggregates derived from endogenous monomers, and therefore that the formation of aggregates derived from endogenous monomers (i.e., highly pathogenic aggregates) can be suppressed by expressing or delivering KA monomers into the brain (Fig. 17B, C, and D). Therefore, expression of K43&45A or K43&45delta monomers in the brain using viral expression systems such as adeno-associated viruses, mRNA, or plasmids, or administration of the monomers themselves, may be useful as a novel treatment for α-synucleinopathies.

[0213] References Fitzpatrick AWP et al. Cryo-EM structures of tau filaments from Alzheimer's disease. Nature 547: 185-190. 2017. Goedert M. Cryo-EM structures of tau filaments from human brain. Essays in Biochemistry. 65: 949-959. 2021. Masuda-Suzukake M. et al, Dextran sulphate-induced tau assemblies cause endogenous tau aggregation and propagation in wild-type mice. Brain Commun. 2: fcaa091. 2020. Zhang W. et al, Heparin-induced tau filaments are polymorphic and differ from those in Alzheimer's and Pick's diseases. Elife. 8:e43584, 2019.

[0214] Example 2 Tau Mutants 1. Methods Preparation of Deletion Mutant Tau Mutants Mutant tau was prepared using the KOD Plus Mutagenesis Kit (TOYOBO). To prepare the ΔKP mutant, which lacks Lys331 to Gln336 (amino acid residues of tau 4R2N), and the ΔPG mutant, which lacks Pro332 to Gly335 (amino acid residues of tau 4R2N), PCR was performed using pRK172-human tau4R1N (an expression vector in Escherichia coli) or pcDNA3-human tau4R1N (an expression vector in cultured cells), encoding wild-type tau (4R1N), as a template and the following primers:

[0215] ΔKP-FW GTGGAAGTAAAATCTGAGAAGCTTG (SEQ ID NO: 67) ΔKP-RV ATGATGGATGTTGCCTAATGAGCCA (SEQ ID NO: 68) ΔPG-FW CAGGTGGAAGTAAAATCTGAGAAGC (SEQ ID NO: 69) ΔPG-RV TTTATGATGGATGTTGCCTAATGAG (SEQ ID NO: 70)

[0216] The PCR conditions were as follows: 1: 94°C, 2 minutes 2: 98°C, 10 seconds 3: 68°C, 7 minutes The above cycles of 2 and 3 were repeated 10 times.

[0217] The amplified PCR product (50 μl) was added with 1 μl of DpnI (TOYOBO) and incubated at 37°C for 1 hour to digest the template plasmid. A 2 μl aliquot of this reaction mixture was mixed with 7 μl of distilled water, 5 μl of Ligation-high, and 1 μl of T4 polynucleotide kinase and incubated at 16°C for 1 hour. A 3 μl aliquot was then mixed with 15 μl of E. coli DH5 alpha competent cells and incubated at 42°C for 45 seconds for transformation. 100 μl of LB medium was added to the reaction mixture and incubated at 37°C for 1 hour. The entire mixture was then plated on carbenicillin-resistant LB plates, and mutant plasmids were isolated from the resulting colonies. The introduced mutations were confirmed by DNA sequencing of the resulting plasmids.

[0218] Purification of recombinant tau monomers. The pRK172 / human-4R1N tau plasmid (wild-type, ΔPG mutant, or ΔKP mutant) was transformed into E. coli BL21(DE3) for protein expression, plated on LB plates containing 50 μg / ml carbenicillin, and cultured overnight at 37°C. The cells were harvested and added to 500 ml of 2xYT medium supplemented with carbenicillin to a final concentration of 50 μg / ml. After 1 hour and 15 minutes of culture, IPTG was added to a final concentration of 0.1 mM and cultured again for 2 hours to induce expression. The culture was transferred to a centrifuge tube and centrifuged at 4000 rpm at 4°C for 10 minutes. The cells were then harvested and stored frozen at -80°C.

[0219] The cells were then thawed and suspended in 10 ml of tau purification buffer (50 mM Pipes-NaOH pH 6.9, 1 mM ethylenediaminetetraacetic acid (EDTA), 1 mM dithiothreitol (DTT), 0.5 mM phenylmethylsulfonyl fluoride (PMSF)), transferred to a centrifuge tube, and sonicated on ice. This suspension was centrifuged at 15,000 rpm for 15 minutes at 4°C, and the supernatant was collected. 50 μl of 2-mercaptoethanol was added and the mixture was heat-treated at 100°C for 5 minutes. The heat-treated sample was centrifuged again at 15,000 rpm for 15 minutes at 4°C. The supernatant was collected and transferred to SP Sepharose gel, which had been equilibrated with tau purification buffer. TM The supernatant was passed through a Fast Flow (Cytiva) column (column volume: 3 ml) to adsorb proteins, and then washed with 30 ml of tau purification buffer.

[0220] The column was then washed with 9 ml of tau purification buffer containing 0.1 M sodium chloride (NaCl), and the adsorbed protein was eluted with 9 ml of tau purification buffer containing 0.35 M NaCl. Ammonium sulfate was added to the eluate to 50% saturation and the protein was precipitated by leaving the column on ice overnight. The column was centrifuged at 15,000 rpm for 15 minutes at 4°C. The supernatant was removed and the resulting precipitate was dissolved in 1 ml of 30 mM Tris-HCl, pH 7.5, and then desalted by dialysis against the same buffer for 30 minutes (first dialysis) and then overnight (second dialysis). The sample was centrifuged at 50,000 rpm for 20 minutes at 4°C, and the resulting supernatant was used as the recombinant tau monomer fraction. A portion of this fraction was analyzed by reverse-phase high-performance liquid chromatography (RT-HPLC), and the protein concentration was calculated from the peak area obtained.

[0221] Tau fibril formation. 5 mM dithiothreitol (DTT) (allowed to stand for 10 minutes after addition), 0.2% sodium azide (NaN3), and 200 μg / ml dextran sulfate were added to the purified recombinant tau monomer solution, in that order, and the mixture was shaken at 200 rpm at 37°C for 3–4 days to aggregate the tau monomer. The sample was centrifuged at 50,000 rpm for 20 minutes at 25°C to recover the precipitated tau fibrils. 500 μl of saline (Otsuka Pharmaceutical) was added to the mixture, and the mixture was centrifuged under the same conditions to remove any remaining monomer. The precipitated tau fibrils were resuspended in 150 μl of saline and sonicated. 10 μl of this mixture was mixed with 89 μl of 6 M guanidine hydrochloride and 1 μl of 0.1 M DTT, and the protein concentration of the tau fibrils was measured by RT-HPLC.

[0222] Measurement of tau monomer fibrillization using thioflavin T (ThT). Wild-type or mutant tau monomer solutions (3 mg / ml, 100 μl) were placed in a 96-well plate and mixed with 10 mM DTT (allowed to stand for 10 min after addition), 50 mM Tris-HCl buffer, pH 7.5, 0.2% NaN3, 200 μg / ml dextran sulfate, and 40 μM thioflavin T (ThT), in that order. Each sample was shaken at 200 rpm at 37°C, and the ThT fluorescence intensity was measured over time using a FLUOstar Omega plate reader (BMG LABTECH) at an excitation wavelength of 450 nm and an emission wavelength of 480 nm.

[0223] Electron microscopy: 2 μl of wild-type or mutant tau fibrils (0.2 mg / ml) were added to the collodion membrane-attached mesh. Once evenly distributed, the sample was removed with a pipette and the remaining moisture was removed with a Kimwipe. 10 μl of 2% sodium phosphotungstate solution was added and the mesh was left to stand at room temperature for several minutes. The moisture was then removed with a Kimwipe, and the mesh was left to stand at room temperature for several minutes and then air-dried. The dried mesh was then used to observe the fibrillar structure of each aggregate using a JEM-1400 electron microscope (JEOL).

[0224] Measurement of seeding activity of tau aggregates using ThT. A 100 μl solution of wild-type tau monomer (1 mg / ml) was placed in a 96-well plate. 6.5 mM DTT (allowed to stand for 10 min after addition), 30 mM Tris-HCl buffer (pH 7.5), 0.2% NaN3, and 40 μM ThT were added in that order. Finally, 2 μl of each aggregate (1 mg / ml) was added and mixed. The fluorescence intensity of ThT was measured over time using an infinite M200 PRO / infinite M NANO+ plate reader (TECAN) at 37°C with an excitation wavelength of 442 nm and an emission wavelength of 485 nm.

[0225] Seeding activity of tau aggregates using cultured cells. Human neuroblastoma cell line SH-SY5Y was used as the cultured cells. 8 x 10 cells were cultured per well in a 6-well plate. 5 Cells were seeded and cultured overnight. The next day, a wild-type tau expression plasmid (pcDNA3-human 4R1N tau) was transfected into the cells using X-treamGENE9 (Roche). Specifically, Opti-MEM, the plasmid, and X-treamGENE9 were gently mixed in a ratio of 100 μl:1 μg:3 μl, and the mixture was left at room temperature for 15 minutes before being added to the culture medium in each well. Approximately 3 hours later, 2 μl of recombinant tau aggregates were transfected into the cells. Specifically, tau aggregates (1 mg / ml, 2 μl) were mixed with 60 μl of Multifectam Reagent (Promega), left to stand for 15 minutes, and then the entire mixture was added dropwise to each well. The treated cells were incubated in a CO2 incubator for 3 days.

[0226] Detection of insolubilized tau by immunoblotting. Cells treated with tau expression plasmids and aggregates were harvested and prepared for immunoblotting as follows: The culture medium from each well was removed using an aspirator, and 1 ml of sterile phosphate-buffered saline (PBS) was added. The cells were then detached and collected by pipetting. The cells were harvested by centrifugation at 4500 rpm for 5 minutes at 25°C. 300 μl of A68 buffer (10 mM Tris-HCl buffer, pH 7.5, 10% sucrose, 0.8 M NaCl, 1 mM EGTA) containing 1% sarkosyl was added, and the cells were disrupted by sonication for approximately 1 minute.

[0227] After that, 300 μl of 1% sarkosyl in A68 buffer was added, and the mixture was centrifuged at 50,000 rpm at 25°C for 20 minutes. The resulting supernatant (300 μl) was collected, and 75 μl of 5% 2-mercaptoethanol in 5x SDS buffer was added, followed by heat treatment at 100°C for 5 minutes. This was designated the sarkosyl supernatant fraction (Sar-sup). Meanwhile, 55 μl of 5% 2-mercaptoethanol in 2x SDS buffer was added to the precipitate fraction, followed by sonication and heat treatment at 100°C for 5 minutes. This was designated the sarkosyl-insoluble fraction (Sar-ppt).

[0228] These samples (Sar-sup and Sar-ppt) were electrophoresed on a 7.5% polyacrylamide gel and then transferred to a polyvinylidene fluoride (PVDF) membrane (Millipore) at 200 mA for 1 hour. The PVDF membrane was blocked with 3% gelatin (Wako) in PBS for 10 minutes and then incubated overnight with primary antibodies (T46: antibody recognizing the C-terminus of tau; 2000-fold dilution; Cat# 13-6400, ThermoFisher; pS396: antibody recognizing phosphorylation of Ser at residue 396; 2000-fold dilution; Cat# 44-752G, ThermoFisher; AT8: antibody recognizing phosphorylation of Ser at residue 202 and Thr at residue 205; 1000-fold dilution; Cat# MN1020, ThermoFisher) diluted in PBS containing 10% bovine serum.

[0229] The PVDF membrane was then washed with Tris-buffered saline (TS) and incubated with secondary antibodies (Biotin-Goat anti-mouse IgG (Cat# BA-2000-1.5) or Biotin-Goat anti-rabbit IgG (Cat# BA-1000-1.5): 500x dilution, Vector) diluted in PBS containing 10% bovine serum for 2 hours, followed by rinsing with TS. The PVDF membrane was then incubated with avidin-biotin-labeled enzyme complex for 1 hour, washed with PBS, and treated with PBS containing 40 mg / ml 3,3'-diaminobenzidine (DAB: 100x dilution, Sigma-Aldrich), 80 mg / ml nickel chloride (50x dilution), and 30% hydrogen peroxide (1000x dilution) to develop the protein bands on the membrane. The color development was stopped by rinsing with tap water.

[0230] 3. Results Purification of Recombinant Tau Monomer E. coli carrying plasmids encoding wild-type and mutant tau were cultured in 500 mL of 2xYT medium, after which the cells were harvested and disrupted in buffer. Because tau protein is heat-stable, the cell lysate was heat-treated at 100°C for 5 minutes to denature other contaminating proteins, followed by centrifugation. The supernatant was passed through an SP Sepharose column to adsorb tau and eluted with sodium chloride. The eluate was precipitated with ammonium sulfate and then dialyzed to obtain tau monomer. To confirm the degree of purification, samples from each purification step and the final product were analyzed by SDS-PAGE (Figure 18), confirming that tau monomer with the desired molecular weight was obtained.

[0231] Aggregation of tau monomers. Wild-type tau monomers are known to aggregate in the presence of dextran sulfate upon shaking at 37°C [3]. We investigated whether the two mutant tau forms we created aggregate in the presence of dextran sulfate at 37°C, similar to the wild-type form. Wild-type and mutant tau monomers (3 mg / ml), dextran sulfate, and ThT were added to a 96-well plate, and the fluorescence intensity of ThT was measured over time at an excitation wavelength of 450 nm and an emission wavelength of 480 nm while shaking at 37°C. ThT does not bind to monomeric protein, but specifically binds to and emits fluorescence with protein aggregates with amyloid fibril structures.

[0232] The fluorescence intensity of ThT was monitored over time, and not only wild-type but also ΔPG and ΔKP monomers showed an increase in fluorescence intensity upon shaking at 37°C in the presence of dextran sulfate, as shown in Figure 19. This indicates that these two mutant tau forms aggregate similarly to wild-type tau. Furthermore, the aggregation ability of these mutant monomers is slightly stronger than that of wild-type tau.

[0233] Electron microscopy of tau aggregates. Wild-type and mutant tau aggregates (0.2 mg / ml, 2 μl) were applied to a mesh and negatively stained with 2% phosphotungstic acid. Observation of these samples under an electron microscope revealed that both wild-type and mutant tau aggregates formed fibrillar structures with thicknesses of approximately 10–20 nm, as shown in Figure 20. Combined with the results of 4.2 above, these results demonstrate that the ΔPG and ΔKP mutant tau prepared in this study form aggregates consisting of fibrillar structures in the presence of dextran sulfate, similar to wild-type tau.

[0234] Seeding activity of tau aggregates. When wild-type tau monomers are left standing at 37°C without shaking, almost no aggregates form. However, it is known that when a small amount of wild-type aggregates is added to a stationary monomer solution, the added aggregates function as seeds, causing the tau monomers to aggregate. Therefore, we investigated whether the two types of ΔPG and ΔKP tau aggregates we prepared in this study have the same in vitro seeding activity as wild-type aggregates. Wild-type tau monomers (1 mg / ml, 100 μl) were mixed with each aggregate (1 mg / ml, 2 μl) and ThT, and incubated at 37°C.

[0235] The fluorescence intensity of ThT was measured over time for these samples at an excitation wavelength of 442 nm and an emission wavelength of 485 nm, and the results are shown in Figure 21. When wild-type tau monomers without added aggregates (+none) were incubated at 37°C, the fluorescence intensity of ThT did not increase. However, when wild-type aggregates were added (+WT), the fluorescence intensity of ThT increased, confirming that wild-type aggregates have seeding activity for wild-type tau monomers.

[0236] On the other hand, the fluorescence intensity of ThT was lower when the two mutant aggregates (+ΔPG and +ΔKP) were added than when the wild-type aggregate was added. These results indicate that these two mutant aggregates have lower seeding activity than the wild-type aggregate. In particular, the ΔKP aggregate showed an even lower seeding effect than the ΔPG aggregate.

[0237] 4. Discussion These results demonstrate that mutant tau monomers (ΔPG and ΔKP) aggregate and form fibrillar structures similar to wild-type tau when shaken at 37°C in the presence of dextran sulfate. Furthermore, it was confirmed that wild-type aggregates function as seeds for wild-type tau monomers, inducing their accumulation. On the other hand, the ΔPG and ΔKP mutants exhibited lower seeding activity than wild-type aggregates. These results suggest that the region of tau residues 331-336, which we focused on in this study, does not significantly affect its own aggregation and fibrillization in the presence of dextran sulfate, but plays an important role in seeding activity.

[0238] <References> 1. Schweighauser M. et al: Structures of α-synuclein filaments from multiple system atrophy. Nature, 585: 464-469 (2020). 2.Guerrero-Ferreira R. et al: New insights on the structure of alpha-synuclein fibrils using cryo-electron microscopy. Curr. Opin. Neurobiol., 61: 89-95 (2020). 3.Nonaka T. et al: Seeded aggregation and toxicity of α-synuclein and tau: cellular models of neurodegenerative diseases. J. Biol. Chem. 285(45): 34885-98 (2010). 4.Fujiwara H. et al: α-Synuclein is phosphorylated in synucleinopathy lesions. Nat Cell Biol 4:160-64 (2002). 5.Hasegawa M. et al: Phosphorylated α-synuclein is ubiquitinated in α-synucleinopathy lesions. J Biol Chem 277:49071-76 (2002). 6.Masuda-Suzukake M. et al: Prion-like spreading of pathological α-synuclein in brain. Brain, 136(Pt 4): 1128-1138 (2013).

[0239] SEQ ID NO: 17: n represents a, c, g, or t (positions: 127-129, 133-135, 148-150) SEQ ID NO: 18: Xaa represents any amino acid or a deletion (positions: 43, 45, 50) SEQ ID NO: 19: n represents a, c, g, or t, or a deletion (positions: 718-741) SEQ ID NO: 20: Xaa represents any amino acid (positions: 240-241) SEQ ID NO: 20: Xaa represents Lys or a deletion (position: 242) SEQ ID NO: 20: Xaa represents Pro or a deletion (position: 243) SEQ ID NO: 20: Xaa represents Gly or a deletion (position: 244) SEQ ID NO: 20: Xaa represents Gly or a deletion (position: 245) SEQ ID NO: 20: Xaa represents Gly or a deletion (position: 246) SEQ ID NO:20: Xaa represents Gln or a deletion (position: 247) SEQ ID NO:21: n represents a, c, g, or t, or a deletion (positions: 805 to 828) SEQ ID NO:22: Xaa represents any amino acid (positions: 269 to 270) SEQ ID NO:22: Xaa represents Lys or a deletion (position: 271) SEQ ID NO:22: Xaa represents Pro or a deletion (position: 272) SEQ ID NO:22: Xaa represents Gly or a deletion (position: 273) SEQ ID NO:22: Xaa represents Gly or a deletion (position: 274) SEQ ID NO:22: Xaa represents Gly or a deletion (position: 275) SEQ ID NO:22: Xaa represents Gln or a deletion (position: 276) SEQ ID NO:23: n is a, c, SEQ ID NO:24: Xaa represents any amino acid (positions: 298-299) SEQ ID NO:24: Xaa represents Lys or a deletion (position: 300) SEQ ID NO:24: Xaa represents Pro or a deletion (position: 301) SEQ ID NO:24: Xaa represents Gly or a deletion (position: 302) SEQ ID NO:24: Xaa represents Gly or a deletion (position: 303) SEQ ID NO:24: Xaa represents Gly or a deletion (position: 304) SEQ ID NO:24: Xaa represents Gln or a deletion (position: 305) SEQ ID NO:25: n is a, c, g,or t, or a deletion (location positions: 811-834) SEQ ID NO:26: Xaa represents any amino acid (location positions: 271-272) SEQ ID NO:26: Xaa represents Lys or a deletion (location position: 273) SEQ ID NO:26: Xaa represents Pro or a deletion (location position: 274) SEQ ID NO:26: Xaa represents Gly or a deletion (location position: 275) SEQ ID NO:26: Xaa represents Gly or a deletion (location position: 276) SEQ ID NO:26: Xaa represents Gly or a deletion (location position: 277) SEQ ID NO:26: Xaa represents Gln or a deletion (location position: 278) SEQ ID NO:27: n represents a, c, g, or t, or a deletion (location positions: 898-921) SEQ ID NO:28: Xaa represents any amino acid (location positions: 300-301) SEQ ID NO:28: Xaa represents Lys or a deletion (position: 302) SEQ ID NO:28: Xaa represents Pro or a deletion (position: 303) SEQ ID NO:28: Xaa represents Gly or a deletion (position: 304) SEQ ID NO:28: Xaa represents Gly or a deletion (position: 305) SEQ ID NO:28: Xaa represents Gly or a deletion (position: 306) SEQ ID NO:28: Xaa represents Gln or a deletion (position: 307) SEQ ID NO:29: n represents a, c, g, or t or a deletion (positions: 985 to 1008) SEQ ID NO:30: Xaa represents any amino acid (positions: 329 to 330) SEQ ID NO:30: Xaa represents Lys or a deletion (position: 331) SEQ ID NO:30: Xaa represents Pro or a deletion (position: 332) SEQ ID NO: 30: Xaa represents Gly or a deletion (position: 333) SEQ ID NO: 30: Xaa represents Gly or a deletion (position: 334) SEQ ID NO: 30: Xaa represents Gly or a deletion (position: 335) SEQ ID NO: 30: Xaa represents Gln or a deletion (position: 336) SEQ ID NO: 31: n represents a, c, g, or t or a deletion (positions: 82-84, 100-102, 106-108) SEQ ID NO: 32: Xaa represents any amino acid or a deletion (positions: 28, 34, 36) SEQ ID NO: 33: n represents a, c, g,or t (locations: 127-129, 133-135, 148-150) SEQ ID NO: 34: Xaa represents any amino acid (locations: 43, 45, 50) SEQ ID NO: 35: n represents a, c, g, or t (locations: 718-726) SEQ ID NO: 36: Xaa represents any amino acid (locations: 240-242) SEQ ID NO: 37: n represents a, c, g, or t (locations: 805-813) SEQ ID NO: 38: Xaa represents any amino acid (locations: 269-271) SEQ ID NO: 39: n represents a, c, g, or t (locations: 892-900) SEQ ID NO: 40: Xaa represents any amino acid (locations: 298-300) SEQ ID NO: 41: n represents a, c, g, or t (locations: 811-819) SEQ ID NO: 42: Xaa represents any amino acid (positions: 271-273) SEQ ID NO: 43: n represents a, c, g, or t (positions: 898-906) SEQ ID NO: 44: Xaa represents any amino acid (positions: 300-302) SEQ ID NO: 45: n represents a, c, g, or t (positions: 985-993) SEQ ID NO: 46: Xaa represents any amino acid (positions: 329-331) SEQ ID NO: 47: n represents a, c, g, or t or a deletion (positions: 82-84, 100-102, 106-108) SEQ ID NO: 48: Xaa represents any amino acid or a deletion (positions: 28, 34, 36) SEQ ID NOs: 49-70: synthetic DNA,

Claims

1. A mutant neurodegenerative disease-related protein, characterized in which, among the amino acid sequences of neurodegenerative disease-related proteins, one or more amino acids are deleted, substituted, or added in the amino acid sequence of the interaction region of two protofilaments (PFs), and the seed activity, which functions as the nucleus of the aggregate of the said protein, is reduced to 70% or less compared to the seed activity of the wild-type neurodegenerative disease-related protein.

2. The mutant neurodegenerative disease-related protein according to claim 1, wherein the neurodegenerative disease-related protein is any protein selected from alpha-synuclein, tau, and amyloid-beta.

3. The mutant neurodegenerative disease-related protein according to claim 2, wherein the neurodegenerative disease-related protein is alpha-synuclein, and one or more basic amino acids are deleted or substituted.

4. The mutant neurodegenerative disease-associated protein according to claim 3, wherein the basic amino acid is at least one selected from Lys43, Lys45, and His50.

5. The mutant neurodegenerative disease-related protein according to claim 3, wherein the amino acid sequence of alpha-synuclein is shown in Sequence ID No.

2.

6. The mutant neurodegenerative disease-related protein according to claim 2, wherein the neurodegenerative disease-related protein is tau, and an amino acid sequence containing one or more basic amino acids or an amino acid sequence represented by PGGG is deleted or substituted.

7. The mutant neurodegenerative disease-related protein according to claim 6, wherein the amino acid sequence containing the amino acid sequence represented by PGGG is represented by KPGGGQ.

8. The mutant neurodegenerative disease-associated protein according to claim 6, wherein the basic amino acid is a basic amino acid contained in any isoform selected from the 3R0N, 3R1N, 3R2N, 4R0N, 4R1N, and 4R2N isoforms of tau, and is at least one selected from His329, His330, and Lys331 in the 4R2N isoform, or at least one selected from the basic amino acids corresponding to His329, His330, and Lys331 in any other isoform other than the 4R2N type.

9. The mutant neurodegenerative disease-related protein according to claim 6, wherein the amino acid sequence of tau is shown in SEQ ID NOs: 4, 6, 8, 10, 12, or 14.

10. The mutant neurodegenerative disease-related protein according to claim 2, wherein the neurodegenerative disease-related protein is amyloid beta, and one or more hydrophobic amino acids or basic amino acids are deleted or substituted.

11. The mutant neurodegenerative disease-associated protein according to claim 10, wherein the hydrophobic amino acid or basic amino acid is at least one selected from Leu34, Val36, and Lys28.

12. The mutant neurodegenerative disease-related protein according to claim 10, wherein the amino acid sequence of amyloid beta is shown in SEQ ID NO:

16.

13. A nucleic acid encoding a mutant neurodegenerative disease-related protein according to any one of claims 1 to 12.

14. A recombinant vector comprising the nucleic acid described in claim 13.

15. An aggregate of a mutant neurodegenerative disease-related protein as described in any one of claims 1 to 12.

16. An antibody against the aggregates described in claim 15.

17. A pharmaceutical composition for neurodegenerative diseases comprising a mutant neurodegenerative disease-related protein according to any one of claims 1 to 12.

18. A pharmaceutical composition for neurodegenerative diseases comprising the nucleic acid described in claim 13.

19. A pharmaceutical composition for neurodegenerative diseases comprising the recombinant vector described in claim 14.

20. A vaccine for neurodegenerative diseases comprising the aggregate described in claim 15.

21. A mutant neurodegenerative disease-related protein having an amino acid sequence in which one or more hydrophobic amino acids or basic amino acids are substituted with basic amino acids in the amino acid sequence of the interaction region (PF interaction region) of two protofilaments (PF molecules) of a neurodegenerative disease-related protein (provided that when basic amino acids are substituted, they are substituted with other basic amino acids that have a higher charge than the original basic amino acid), or an amino acid sequence in which one or more basic amino acids are added to the PF interaction region, and having a seed activity that functions as the nucleus of the aggregate of the protein at 71% or more compared to the seed activity of a wild-type neurodegenerative disease-related protein.

22. The mutant neurodegenerative disease-related protein according to claim 21, wherein the neurodegenerative disease-related protein is any protein selected from alpha-synuclein, tau, and amyloid-beta.

23. The mutant neurodegenerative disease-related protein according to claim 22, wherein the neurodegenerative disease-related protein is alpha-synuclein.

24. The mutant neurodegenerative disease-associated protein according to claim 23, wherein one or more basic amino acids in the PF interaction region are at least one selected from Lys43, Lys45, and His50.

25. The mutant neurodegenerative disease-related protein according to claim 23, wherein the amino acid sequence of alpha-synuclein is shown in Sequence ID No.

2.

26. The mutant neurodegenerative disease-related protein according to claim 22, wherein the neurodegenerative disease-related protein is tau.

27. The mutant neurodegenerative disease-associated protein according to claim 26, wherein one or more basic amino acids in the PF interaction region are basic amino acids included in any isoform selected from the 3R0N, 3R1N, 3R2N, 4R0N, 4R1N, and 4R2N isoforms of tau, and are at least one selected from His329, His330, and Lys331 in the 4R2N isoform, or at least one selected from the basic amino acids corresponding to His329, His330, and Lys331 in any other isoform other than the 4R2N type.

28. The mutant neurodegenerative disease-associated protein according to claim 26, wherein the amino acid sequence of tau is shown in SEQ ID NOs: 4, 6, 8, 10, 12, or 14.

29. The mutant neurodegenerative disease-related protein according to claim 22, wherein the neurodegenerative disease-related protein is amyloid beta.

30. The mutant neurodegenerative disease-associated protein according to claim 29, wherein one or more hydrophobic or basic amino acids in the PF interaction region are at least one selected from Leu34, Val36, and Lys28.

31. The mutant neurodegenerative disease-related protein according to claim 29, wherein the amino acid sequence of amyloid beta is shown in SEQ ID NO:

16.

32. An aggregate of a mutant neurodegenerative disease-related protein as described in any one of claims 21 to 31.

33. Cells or non-human animals into which the aggregates described in claim 32 have been introduced.

34. A variant neurodegenerative disease model cell or non-human animal comprising the cell or non-human animal described in claim 33.

35. A nucleic acid encoding a mutant neurodegenerative disease-related protein according to any one of claims 21 to 31.

36. A recombinant vector comprising the nucleic acid described in claim 35.

37. A transformed cell or transformed non-human animal comprising the recombinant vector according to claim 36.

38. A neurodegenerative disease model cell or non-human animal comprising transformed cells or a transformed non-human animal as described in claim 37.

39. A method for screening therapeutic agents for neurodegenerative diseases, characterized by contacting or administering a candidate substance to mutant neurodegenerative disease model cells or non-human animals as described in claim 34.

40. A method for screening therapeutic agents for neurodegenerative diseases, characterized by contacting or administering a candidate substance to neurodegenerative disease model cells or non-human animals as described in claim 38.

41. A screening kit for therapeutic agents for neurodegenerative diseases, comprising the aggregate described in claim 32.

42. A screening kit for therapeutic agents for neurodegenerative diseases, comprising the nucleic acid described in claim 35.

43. A screening kit for therapeutic agents for neurodegenerative diseases, comprising the recombinant vector described in claim 36.

44. A screening kit for therapeutic agents for neurodegenerative diseases, comprising transformed cells or transformed non-human animals as described in claim 37.

45. A screening kit for therapeutic agents for neurodegenerative diseases, comprising neurodegenerative disease model cells or non-human animals as described in claim 38.