Prophylactic agent and / or therapeutic agent for heart diseases and laminopathy

Abstract

The present invention provides a mechanosignaling inhibitor containing a substance capable of suppressing the expression or function of LSMEM2 as an active ingredient.

Description

Preventive and / or therapeutic agent for heart disease and laminopathies

[0001] The present invention relates to mechano-signaling inhibitors, anti-inflammatory agents, preventive and / or therapeutic agents for heart disease, preventive and / or therapeutic agents for laminopathies, etc., which contain substances that suppress the expression or function of LSMEM2.

[0002] Dilated cardiomyopathy (DCM), the most common cause of heart transplant cases in Japan, is known to have a particularly poor prognosis in patients with a pathogenic variant in the lamin gene (LMNA) (lamin cardiomyopathy) (Non-Patent Document 1). LMNA gene variants are found in approximately 10% of dilated cardiomyopathy patients, and lamin cardiomyopathy is a highly penetrant, intractable disease complicated with severe heart failure and fatal arrhythmias (Non-Patent Document 2). The Japanese Circulation Society's guidelines for the treatment of cardiomyopathy recommend LMNA gene screening in familial dilated cardiomyopathy complicated with conduction disorders, but no disease-specific treatment for lamin cardiomyopathy has been established.

[0003] Lamin, a nuclear membrane lining protein, is known to control gene expression by transmitting extracellular mechanostress to the nucleus via the LINC (Linker of Nucleoskeleton and Cytoskeleton) complex. Since SUN1 KO mice, which lack SUN1, a LINC complex component protein, improve the prognosis of lamin-induced cardiomyopathy model mice (Non-Patent Document 3), it is believed that mechanostress induced from extracellular sources in the nucleus is important for the development of lamin-induced cardiomyopathy. However, SUN1 expression is ubiquitous, and KO mice exhibit infertility and hearing loss, making it difficult to use as a therapeutic target.

[0004] Recently, it has been reported that cardiomyocyte-specific expression of the dominant-negative SUN1 protein, which disrupts the function of the LINC complex, using an AAV vector improves the prognosis of lamin-associated cardiomyopathy model mice (Non-Patent Document 4). While no significant side effects were observed in mice, concerns remain regarding its application to humans, given that SUN1 KO mice exhibit infertility and hearing loss, and that the original function of the LINC complex is disrupted. Furthermore, p38 MAPK signaling is known to be enhanced in lamin-associated cardiomyopathy, and p38α inhibitors have been reported to improve cardiac function in lamin-associated cardiomyopathy model mice (Non-Patent Document 5). Phase 3 clinical trials of p38α inhibitors for lamin-associated cardiomyopathy are currently underway, but p38α KO mice are embryonic lethal, raising concerns about their safety in humans.

[0005] Therefore, there is a significant unmet medical need to develop effective treatments for lamin cardiomyopathy.

[0006] Sci Rep. 2018;8:1998Eur Heart J. 2018;39(10):853Cell. 2012;149(3):565. Nat Commun. 2021;12(1):4722. Hum Mol Genet. 2012;21(19):4325

[0007] An object of the present invention is to provide an agent for preventing and / or treating heart disease and laminopathies, and in particular to provide an effective agent for preventing and / or treating lamin cardiomyopathy.

[0008] The present inventors discovered that intercalated discs are receptors for mechanostress and independently identified LSMEM2, a membrane protein localized in intercalated discs and involved in mechanosignaling. LSMEM2 knockout mice exhibited normal cardiac function at rest. Furthermore, they found that mice resulting from crossbreeding of LSMEM2 knockout mice with lamin cardiomyopathy model mice exhibited improved cardiac function, leading to the completion of the present invention. Furthermore, they found that LSMEM2 knockout mice suppressed immune cell infiltration in a pressure-overload heart failure model induced by aortic coarctation, and that mice resulting from crossbreeding with lamin cardiomyopathy model mice exhibited improved lower limb muscle strength, demonstrating that LSMEM2-targeted therapy can be applied not only to lamin cardiomyopathy but also to severe heart failure and laminopathies caused by other etiologies.

[0009] That is, the present invention is as follows. [1] A mechano-signaling inhibitor comprising, as an active ingredient, a substance that suppresses the expression or function of LSMEM2. [2] The agent according to [1], wherein the substance that suppresses the expression of LSMEM2 is: (a) a nucleic acid or a precursor thereof having RNAi activity against a transcript of the LSMEM2 gene, (b) an antisense nucleic acid against a transcript of the LSMEM2 gene, (c) a ribozyme nucleic acid against a transcript of the LSMEM2 gene, or (d) a nucleic acid sequence recognition module that specifically binds to a target nucleotide sequence in the LSMEM2 gene. [3] The agent according to [1], wherein the substance that suppresses the function of LSMEM2 is an antibody or an aptamer against LSMEM2. [4] The agent according to any of [1] to [3], wherein the substance is provided in the form of one or more expression vectors encoding it. [5] The agent according to any of [1] to [4], wherein the agent is an anti-inflammatory agent. [6] The agent according to any of [1] to [5], wherein the agent is an agent for preventing and / or treating heart disease. [7] The agent according to [6], wherein the cardiac disease is dilated cardiomyopathy. [8] An inhibitor of abnormal vesicle transport, comprising as an active ingredient a substance that suppresses the expression or function of LSMEM2. [8-1] A mechano-signaling inhibitor, which is an inhibitor of abnormal vesicle transport, comprising as an active ingredient a substance that suppresses the expression or function of LSMEM2. [9] A preventive and / or therapeutic agent for laminopathies, comprising as an active ingredient a substance that suppresses the expression or function of LSMEM2. [9-1] A mechano-signaling inhibitor, which is a preventive and / or therapeutic agent for laminopathies, comprising as an active ingredient a substance that suppresses the expression or function of LSMEM2.

[10] The agent according to [9], wherein the laminopathies are selected from muscular dystrophy, lamin-induced cardiomyopathy, lipodystrophy, and leukodystrophy. [10-1] A mechano-signaling inhibitor, which is a preventive and / or therapeutic agent for laminopathies, comprising as an active ingredient a substance that suppresses the expression or function of LSMEM2.

[0010] In another aspect, the present invention is as follows. [A1] A mechano-signaling inhibitor comprising, as an active ingredient, a substance that suppresses the expression or function of LSMEM2. [A2] The agent according to [A1], wherein the substance that suppresses the expression of LSMEM2 is: (a) a nucleic acid or a precursor thereof having RNAi activity against a transcript of the LSMEM2 gene, (b) an antisense nucleic acid against a transcript of the LSMEM2 gene, (c) a ribozyme nucleic acid against a transcript of the LSMEM2 gene, or (d) a nucleic acid sequence recognition module that specifically binds to a target nucleotide sequence in the LSMEM2 gene. [A3] The agent according to [A1], wherein the substance that suppresses the function of LSMEM2 is an antibody, degrader, or aptamer against LSMEM2. [A4] The agent according to any of [A1] to [A3], wherein the substance is provided in the form of one or more expression vectors encoding it. [A5] An anti-inflammatory agent comprising, as an active ingredient, a substance that suppresses the expression or function of LSMEM2. [A6] The agent according to [A5], wherein the substance that suppresses the expression of LSMEM2 is: (a) a nucleic acid or a precursor thereof having RNAi activity against a transcript of the LSMEM2 gene, (b) an antisense nucleic acid against a transcript of the LSMEM2 gene, (c) a ribozyme nucleic acid against a transcript of the LSMEM2 gene, or (d) a nucleic acid sequence recognition module that specifically binds to a target nucleotide sequence in the LSMEM2 gene. [A7] The agent according to [A5], wherein the substance that suppresses the function of LSMEM2 is an antibody, degrader, or aptamer against LSMEM2. [A8] The agent according to any of [A5] to [A7], wherein the substance is provided in the form of one or more expression vectors encoding it. [A9] An agent for preventing and / or treating heart disease, comprising as an active ingredient a substance that suppresses the expression or function of LSMEM2. [A10] The agent according to [A9], wherein the substance that suppresses the expression of LSMEM2 is: (a) a nucleic acid or a precursor thereof having RNAi activity against a transcription product of the LSMEM2 gene; (b) an antisense nucleic acid against a transcription product of the LSMEM2 gene; (c) a ribozyme nucleic acid against a transcription product of the LSMEM2 gene; or (d) a nucleic acid sequence recognition module that specifically binds to a target nucleotide sequence in the LSMEM2 gene.[A11] The agent according to [A9], wherein the substance that suppresses the function of LSMEM2 is an antibody, degrader, or aptamer against LSMEM2. [A12] The agent according to any of [A9] to [A11], wherein the substance is provided in the form of one or more expression vectors encoding it. [A13] The agent according to any of [A9] to [A12], wherein the cardiac disease is dilated cardiomyopathy. [A14] An inhibitor of vesicle transport abnormalities, comprising as an active ingredient a substance that suppresses the expression or function of LSMEM2. [A15] The agent according to [A14], wherein the substance that suppresses the expression of LSMEM2 is: (a) a nucleic acid or a precursor thereof having RNAi activity against a transcript of the LSMEM2 gene, (b) an antisense nucleic acid against a transcript of the LSMEM2 gene, (c) a ribozyme nucleic acid against a transcript of the LSMEM2 gene, or (d) a nucleic acid sequence recognition module that specifically binds to a target nucleotide sequence in the LSMEM2 gene. [A16] The agent according to [A14], wherein the substance that suppresses the function of LSMEM2 is an antibody, degrader, or aptamer against LSMEM2. [A17] The agent according to any of [A14] to [A16], wherein the substance is provided in the form of one or more expression vectors encoding it. [A18] An agent for preventing and / or treating laminopathies, comprising as an active ingredient a substance that suppresses the expression or function of LSMEM2. [A19] The agent according to [A18], wherein the substance that suppresses the expression of LSMEM2 is: (a) a nucleic acid or a precursor thereof having RNAi activity against a transcript of the LSMEM2 gene, (b) an antisense nucleic acid against a transcript of the LSMEM2 gene, (c) a ribozyme nucleic acid against a transcript of the LSMEM2 gene, or (d) a nucleic acid sequence recognition module that specifically binds to a target nucleotide sequence in the LSMEM2 gene. [A20] The agent according to [A18], wherein the substance that suppresses the function of LSMEM2 is an antibody, degrader, or aptamer against LSMEM2. [A21] The agent according to any of [A18] to [A20], wherein the substance is provided in the form of one or more expression vectors encoding the substance. [A22] The agent according to any of [A18] to [A21], wherein the laminopathies are selected from muscular dystrophy, lamin cardiomyopathy, lipodystrophy, and leukodystrophy.[B1] A method for inhibiting mechano-signaling in a subject, comprising administering to the subject a substance that suppresses LSMEM2 expression or function. [B2] The method according to [B1], wherein the substance that suppresses LSMEM2 expression is: (a) a nucleic acid or a precursor thereof having RNAi activity against a transcript of the LSMEM2 gene, (b) an antisense nucleic acid against a transcript of the LSMEM2 gene, (c) a ribozyme nucleic acid against a transcript of the LSMEM2 gene, or (d) a nucleic acid sequence recognition module that specifically binds to a target nucleotide sequence in the LSMEM2 gene. [B3] The method according to [B1], wherein the substance that suppresses LSMEM2 function is an antibody, degrader, or aptamer against LSMEM2. [B4] The method according to any one of [B1] to [B3], wherein the substance is provided in the form of one or more expression vectors encoding it. [B5] A method for suppressing inflammation in a subject, comprising administering to the subject a substance that suppresses LSMEM2 expression or function. [B6] The method of [B5], wherein the substance that suppresses LSMEM2 expression is: (a) a nucleic acid or a precursor thereof having RNAi activity against a transcript of the LSMEM2 gene, (b) an antisense nucleic acid against a transcript of the LSMEM2 gene, (c) a ribozyme nucleic acid against a transcript of the LSMEM2 gene, or (d) a nucleic acid sequence recognition module that specifically binds to a target nucleotide sequence in the LSMEM2 gene. [B7] The method of [B5], wherein the substance that suppresses LSMEM2 function is an antibody, degrader, or aptamer against LSMEM2. [B8] The method of any of [B5] to [B7], wherein the substance is provided in the form of one or more expression vectors encoding it. [B9] A method for preventing and / or treating heart disease in a subject, comprising administering to the subject a substance that suppresses LSMEM2 expression or function.[B10] The method according to [B9], wherein the substance that suppresses LSMEM2 expression is: (a) a nucleic acid or a precursor thereof having RNAi activity against a transcript of the LSMEM2 gene, (b) an antisense nucleic acid against a transcript of the LSMEM2 gene, (c) a ribozyme nucleic acid against a transcript of the LSMEM2 gene, or (d) a nucleic acid sequence recognition module that specifically binds to a target nucleotide sequence in the LSMEM2 gene. [B11] The method according to [B9], wherein the substance that suppresses LSMEM2 function is an antibody, degrader, or aptamer against LSMEM2. [B12] The method according to any one of [B9] to [B11], wherein the substance is provided in the form of one or more expression vectors encoding the substance. [B13] The method according to any one of [B9] to [B12], wherein the cardiac disease is dilated cardiomyopathy. [B14] A method for suppressing vesicle transport abnormalities in a subject, comprising administering to the subject a substance that suppresses LSMEM2 expression or function. [B15] The method according to [B14], wherein the substance that suppresses LSMEM2 expression is: (a) a nucleic acid or a precursor thereof having RNAi activity against a transcript of the LSMEM2 gene, (b) an antisense nucleic acid against a transcript of the LSMEM2 gene, (c) a ribozyme nucleic acid against a transcript of the LSMEM2 gene, or (d) a nucleic acid sequence recognition module that specifically binds to a target nucleotide sequence in the LSMEM2 gene. [B16] The method according to [B14], wherein the substance that suppresses LSMEM2 function is an antibody, degrader, or aptamer against LSMEM2. [B17] The method according to any one of [B14] to [B16], wherein the substance is provided in the form of one or more expression vectors encoding it. [B18] A method for preventing and / or treating laminopathies, comprising administering to a subject a substance that suppresses LSMEM2 expression or function.[B19] The method according to [B18], wherein the substance that suppresses LSMEM2 expression is: (a) a nucleic acid or a precursor thereof having RNAi activity against a transcript of the LSMEM2 gene, (b) an antisense nucleic acid against a transcript of the LSMEM2 gene, (c) a ribozyme nucleic acid against a transcript of the LSMEM2 gene, or (d) a nucleic acid sequence recognition module that specifically binds to a target nucleotide sequence in the LSMEM2 gene. [B20] The method according to [B18], wherein the substance that suppresses LSMEM2 function is an antibody, degrader, or aptamer against LSMEM2. [B21] The method according to any one of [B18] to [B20], wherein the substance is provided in the form of one or more expression vectors encoding it. [B22] The method according to any one of [B18] to [B21], wherein the laminopathies are selected from muscular dystrophy, lamin cardiomyopathy, lipodystrophy, and leukodystrophy. [C1] A composition comprising a substance that suppresses the expression or function of LSMEM2, for use in inhibiting mechano-signaling. [C2] The composition according to [C1], wherein the substance that suppresses the expression of LSMEM2 is: (a) a nucleic acid or a precursor thereof having RNAi activity against a transcript of the LSMEM2 gene, (b) an antisense nucleic acid against a transcript of the LSMEM2 gene, (c) a ribozyme nucleic acid against a transcript of the LSMEM2 gene, or (d) a nucleic acid sequence recognition module that specifically binds to a target nucleotide sequence in the LSMEM2 gene. [C3] The composition according to [C1], wherein the substance that suppresses the function of LSMEM2 is an antibody, degrader, or aptamer against LSMEM2. [C4] The composition according to any of [C1] to [C3], wherein the substance is provided in the form of one or more expression vectors encoding it. [C5] A composition comprising a substance that suppresses the expression or function of LSMEM2, for use in suppressing inflammation.[C6] The composition according to [C5], wherein the substance that suppresses LSMEM2 expression is: (a) a nucleic acid or a precursor thereof having RNAi activity against a transcript of the LSMEM2 gene, (b) an antisense nucleic acid against a transcript of the LSMEM2 gene, (c) a ribozyme nucleic acid against a transcript of the LSMEM2 gene, or (d) a nucleic acid sequence recognition module that specifically binds to a target nucleotide sequence in the LSMEM2 gene. [C7] The composition according to [C5], wherein the substance that suppresses LSMEM2 function is an antibody, degrader, or aptamer against LSMEM2. [C8] The composition according to any of [C5] to [C7], wherein the substance is provided in the form of one or more expression vectors encoding it. [C9] A composition comprising a substance that suppresses LSMEM2 expression or function, for use in the prevention and / or treatment of heart disease. [C10] The composition according to [C9], wherein the substance that suppresses LSMEM2 expression is: (a) a nucleic acid or a precursor thereof having RNAi activity against a transcript of the LSMEM2 gene, (b) an antisense nucleic acid against a transcript of the LSMEM2 gene, (c) a ribozyme nucleic acid against a transcript of the LSMEM2 gene, or (d) a nucleic acid sequence recognition module that specifically binds to a target nucleotide sequence in the LSMEM2 gene. [C11] The composition according to [C9], wherein the substance that suppresses LSMEM2 function is an antibody, degrader, or aptamer against LSMEM2. [C12] The composition according to any of [C9] to [C11], wherein the substance is provided in the form of one or more expression vectors encoding it. [C13] The composition according to any of [C9] to [C12], wherein the cardiac disease is dilated cardiomyopathy. [C14] A composition comprising a substance that suppresses LSMEM2 expression or function, for use in suppressing vesicle transport abnormalities. [C15] The composition described in [C14], wherein the substance that suppresses the expression of LSMEM2 is: (a) a nucleic acid or a precursor thereof having RNAi activity against a transcription product of the LSMEM2 gene; (b) an antisense nucleic acid against a transcription product of the LSMEM2 gene; (c) a ribozyme nucleic acid against a transcription product of the LSMEM2 gene; or (d) a nucleic acid sequence recognition module that specifically binds to a target nucleotide sequence in the LSMEM2 gene.[C16] The composition according to [C14], wherein the substance that suppresses the function of LSMEM2 is an antibody, degrader, or aptamer against LSMEM2. [C17] The composition according to any of [C14] to [C16], wherein the substance is provided in the form of one or more expression vectors encoding it. [C18] A composition comprising a substance that suppresses the expression or function of LSMEM2, for use in the prevention and / or treatment of laminopathies. [C19] The composition according to [C18], wherein the substance that suppresses the expression of LSMEM2 is: (a) a nucleic acid or a precursor thereof having RNAi activity against a transcript of the LSMEM2 gene, (b) an antisense nucleic acid against a transcript of the LSMEM2 gene, (c) a ribozyme nucleic acid against a transcript of the LSMEM2 gene, or (d) a nucleic acid sequence recognition module that specifically binds to a target nucleotide sequence in the LSMEM2 gene. [C20] The composition according to [C18], wherein the substance that inhibits the function of LSMEM2 is an antibody, degrader, or aptamer against LSMEM2. [C21] The composition according to any of [C18] to [C20], wherein the substance is provided in the form of one or more expression vectors encoding it. [C22] The composition according to any of [C18] to [C21], wherein the laminopathies are selected from muscular dystrophy, lamin cardiomyopathy, lipodystrophy, and leukodystrophy. [D1] Use of a substance that inhibits the expression or function of LSMEM2 in the manufacture of a medicament for inhibiting mechanosignaling. [D2] The use according to [D1], wherein the substance that suppresses the expression of LSMEM2 is (a) a nucleic acid or a precursor thereof having RNAi activity against a transcript of the LSMEM2 gene, (b) an antisense nucleic acid against a transcript of the LSMEM2 gene, (c) a ribozyme nucleic acid against a transcript of the LSMEM2 gene, or (d) a nucleic acid sequence recognition module that specifically binds to a target nucleotide sequence in the LSMEM2 gene. [D3] The use according to [D1], wherein the substance that suppresses the function of LSMEM2 is an antibody, degrader, or aptamer against LSMEM2. [D4] The use according to any of [D1] to [D3], wherein the substance is provided in the form of one or more expression vectors encoding it.[D5] Use of a substance that suppresses the expression or function of LSMEM2 in the manufacture of a medicament for suppressing inflammation. [D6] The use according to [D5], wherein the substance that suppresses the expression of LSMEM2 is: (a) a nucleic acid or a precursor thereof having RNAi activity against a transcript of the LSMEM2 gene, (b) an antisense nucleic acid against a transcript of the LSMEM2 gene, (c) a ribozyme nucleic acid against a transcript of the LSMEM2 gene, or (d) a nucleic acid sequence recognition module that specifically binds to a target nucleotide sequence in the LSMEM2 gene. [D7] The use according to [D5], wherein the substance that suppresses the function of LSMEM2 is an antibody, degrader, or aptamer against LSMEM2. [D8] The use according to any of [D5] to [D7], wherein the substance is provided in the form of one or more expression vectors encoding it. [D9] Use of a substance that suppresses the expression or function of LSMEM2 in the manufacture of a medicament for the prevention and / or treatment of heart disease. [D10] The use according to [D9], wherein the substance that suppresses LSMEM2 expression is: (a) a nucleic acid or a precursor thereof having RNAi activity against a transcript of the LSMEM2 gene, (b) an antisense nucleic acid against a transcript of the LSMEM2 gene, (c) a ribozyme nucleic acid against a transcript of the LSMEM2 gene, or (d) a nucleic acid sequence recognition module that specifically binds to a target nucleotide sequence in the LSMEM2 gene. [D11] The use according to [D9], wherein the substance that suppresses LSMEM2 function is an antibody, degrader, or aptamer against LSMEM2. [D12] The use according to any of [D9] to [D11], wherein the substance is provided in the form of one or more expression vectors encoding it. [D13] The use according to any of [D9] to [D12], wherein the cardiac disease is dilated cardiomyopathy. [D14] Use of a substance that suppresses LSMEM2 expression or function in the manufacture of a medicament for suppressing vesicular transport abnormalities.[D15] The use according to [D14], wherein the substance that suppresses LSMEM2 expression is: (a) a nucleic acid or a precursor thereof having RNAi activity against a transcript of the LSMEM2 gene, (b) an antisense nucleic acid against a transcript of the LSMEM2 gene, (c) a ribozyme nucleic acid against a transcript of the LSMEM2 gene, or (d) a nucleic acid sequence recognition module that specifically binds to a target nucleotide sequence in the LSMEM2 gene. [D16] The use according to [D14], wherein the substance that suppresses LSMEM2 function is an antibody, degrader, or aptamer against LSMEM2. [D17] The use according to any of [D14] to [D16], wherein the substance is provided in the form of one or more expression vectors encoding it. [D18] Use of a substance that suppresses LSMEM2 expression or function in the manufacture of a medicament for the prevention and / or treatment of laminopathies. [D19] The use according to [D18], wherein the substance that suppresses LSMEM2 expression is: (a) a nucleic acid or a precursor thereof having RNAi activity against a transcript of the LSMEM2 gene, (b) an antisense nucleic acid against a transcript of the LSMEM2 gene, (c) a ribozyme nucleic acid against a transcript of the LSMEM2 gene, or (d) a nucleic acid sequence recognition module that specifically binds to a target nucleotide sequence in the LSMEM2 gene. [D20] The use according to [D18], wherein the substance that suppresses LSMEM2 function is an antibody, degrader, or aptamer against LSMEM2. [D21] The use according to any of [D18] to [D20], wherein the substance is provided in the form of one or more expression vectors encoding it. [D22] The use according to any of [D18] to [D21], wherein the laminopathies are selected from muscular dystrophy, lamin cardiomyopathy, lipodystrophy, and leukodystrophy.

[0011] According to the present invention, mechano-signaling inhibitors including substances that suppress the expression or function of LSMEM2 can be provided, enabling effective treatment of lamin cardiomyopathy, severe heart failure due to other causes, and laminopathies.

[0012] Figure 1 shows the organ specificity of LSMEM2 expression as determined by RT-PCR. Figure 2 shows the results of RNA-seq of cardiomyocytes overexpressing LSMEM2. Figure 3 shows that LSMEM2 is essential for mechanostress (progression stimulus)-dependent inflammatory signaling. Figure 4 shows the generation and analysis of LSMEM2 knockout mice. Figure 5 shows that LSMEM2 knockout improves survival rate, cardiac function, cardiac inflammatory signaling, and skeletal muscle strength in a laminopathic model (LMNA H222P KI / KI). Figure 6 shows the cardiac function-improving effect of knockdown by MyoAAV2 shRNA LSMEM2. Figure 7 shows the analysis of LSMEM2 knockout in a pressure overload heart failure model.

[0013] LSMEM2, the target molecule of the mechanosignaling inhibitor of the present invention, is a single-pass transmembrane protein localized in intercalated discs, which are receptors for mechanostress. In humans, it exists in isoform 1 (NP_694947.1) and isoform 2 (NP_001291314.1). Isoform 1 has the amino acid sequence of 164 amino acids represented by SEQ ID NO: 2, translated from the mRNA represented by SEQ ID NO: 1, of which positions 1 to 99 constitute the intracellular domain, positions 100 to 122 the transmembrane domain, and positions 123 to 164 the extracellular domain. The serine at position 50 is a phosphorylation site, and the asparagine at position 156 is a glycosylation site. Isoform 2 (SEQ ID NO: 4), translated from the mRNA represented by SEQ ID NO: 3, is one amino acid shorter than isoform 1 and consists of 163 amino acids.

[0014] As used herein, "LSMEM2" refers to a protein comprising an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 2 (isoform 1) or SEQ ID NO: 4 (isoform 2). In this specification, proteins and peptides are written in accordance with the convention of peptide notation, with the N-terminus (amino terminus) at the left end and the C-terminus (carboxyl terminus) at the right end. "Substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 2 or SEQ ID NO: 4" means: (a) an amino acid sequence of an ortholog in another warm-blooded animal (e.g., guinea pig, rat, mouse, chicken, rabbit, dog, pig, sheep, cow, monkey, etc.) of human LSMEM2 consisting of the amino acid sequence represented by SEQ ID NO: 2 or SEQ ID NO: 4; or (b) an amino acid sequence of a natural allelic variant or genetic polymorphism of human LSMEM2 consisting of the amino acid sequence represented by SEQ ID NO: 2 or SEQ ID NO: 4 or the ortholog of (a) above. Preferably, LSMEM2 is human LSMEM2 consisting of the amino acid sequence shown in SEQ ID NO: 2 or SEQ ID NO: 4, or a natural allelic variant or genetic polymorphism thereof.

[0015] LSMEM2 KO mice develop normally, have completely normal cardiac function, and show no problems with reproductive function. This means that LSMEM2 is a promising drug discovery target for novel therapeutic approaches, regardless of the modality, including gene therapy, genome editing, antibody drugs, nucleic acid drugs (including but not limited to antisense, siRNA, miRNA, aptamers), and small molecule compounds, and the inhibition of mRNA, protein, or downstream signals.

[0016] One aspect of the present invention is a mechano-signaling inhibitor containing, as an active ingredient, a substance that suppresses the expression or function of LSMEM2. In the present invention, the term "substance that suppresses LSMEM2 expression" refers to a substance that acts at any stage, such as by editing the LSMEM2 gene at the genome level, or at the transcription level, post-transcriptional regulation level, protein translation level, or post-translational modification level. Therefore, examples of substances that suppress LSMEM2 expression include substances that inhibit the transcription of the LSMEM2 gene (e.g., antigene), substances that inhibit the processing of initial transcription products into mRNA, substances that inhibit the transport of mRNA into the cytoplasm, substances that inhibit the translation of mRNA into protein (e.g., antisense nucleic acid, miRNA) or that degrade mRNA (e.g., siRNA, ribozyme, miRNA), substances that inhibit the post-translational modification of initial translation products, and substances that induce the degradation of LSMEM2. While substances that act at any stage can be used, substances that bind complementarily to mRNA to inhibit translation into protein or degrade mRNA are preferred.

[0017] A preferred example of a substance that specifically inhibits translation of the LSMEM2 gene mRNA into protein (or degrades the mRNA) is a nucleic acid containing a nucleotide sequence complementary to the nucleotide sequence of the mRNA or a part thereof. A nucleotide sequence complementary to the nucleotide sequence of the LSMEM2 gene mRNA means a nucleotide sequence that has such complementarity that it can bind to a target sequence of the mRNA and inhibit its translation (or cleave the target sequence) under physiological conditions. Specifically, it is a nucleotide sequence that has 90% or more, preferably 95% or more, more preferably 97% or more, and particularly preferably 98% or more homology with a nucleotide sequence that is completely complementary to the nucleotide sequence of the mRNA (i.e., the nucleotide sequence of the complementary strand of the mRNA) in the overlapping region. The "nucleotide sequence homology" in the present invention can be calculated using the homology calculation algorithm NCBI BLAST (National Center for Biotechnology Information Basic Local Alignment Search Tool) under the following conditions (expectation value = 10; gaps allowed; filtering = ON; match score = 1; mismatch score = -3).

[0018] More specifically, a nucleotide sequence complementary to the nucleotide sequence of the mRNA of the LSMEM2 gene is a nucleotide sequence that hybridizes under stringent conditions with the nucleotide sequence represented by SEQ ID NO: 1 or SEQ ID NO: 3. Here, "stringent conditions" refers to, for example, the conditions described in *Current Protocols in Molecular Biology*, John Wiley & Sons, 6.3.1-6.3.6, 1999, such as hybridization at 6xSSC (sodium chloride / sodium citrate) / 45°C, followed by one or more washes at 0.2xSSC / 0.1% SDS / 50-65°C, and the like; however, a person skilled in the art can appropriately select hybridization conditions that provide equivalent stringency.

[0019] Preferred examples of the mRNA of the LSMEM2 gene include the mRNA of human LSMEM2 (RefSeq Accession No. NM_153215.3 or NM_001304385.2) comprising the nucleotide sequence shown in SEQ ID NO: 1 or SEQ ID NO: 3, or its orthologs in other warm-blooded animals, as well as natural allelic variants or genetic polymorphisms thereof.

[0020] A "portion of a nucleotide sequence complementary to the nucleotide sequence of the mRNA of the LSMEM2 gene" is not particularly limited in length or position, as long as it can specifically bind to the mRNA of the LSMEM2 gene and inhibit protein translation from the mRNA (or degrade the mRNA), but from the standpoint of sequence specificity, it should contain a portion complementary to the target sequence that is at least 10 bases or more, preferably 15 bases or more, and more preferably 19 bases or more.

[0021] Specifically, preferred examples of nucleic acids containing a portion of a nucleotide sequence complementary to the nucleotide sequence of the mRNA of the LSMEM2 gene include the following (a) to (c): (a) a nucleic acid having RNAi activity against the mRNA of the LSMEM2 gene or a precursor thereof, (b) an antisense nucleic acid against the mRNA of the LSMEM2 gene, or (c) a ribozyme nucleic acid against the mRNA of the LSMEM2 gene.

[0022] In the present invention, the "substance that suppresses the expression of LSMEM2" may be a substance that suppresses the expression of LSMEM2 by modifying the sequence of the LSMEM2 gene in the genome using genome editing technology. Preferred examples of such substances include the following (d): (d) a nucleic acid sequence recognition module that specifically binds to a target region in the LSMEM2 gene

[0023] The substance that suppresses the expression of LSMEM2 in the present invention is not limited to a nucleic acid or nucleic acid sequence recognition module containing a nucleotide sequence complementary to the nucleotide sequence of the mRNA of the LSMEM2 gene or a part thereof as described above, but may also be other substances such as low molecular weight compounds, peptides, cyclic peptides, proteins, medium molecules, and polymers, as long as they directly or indirectly inhibit the production of LSMEM2 protein.

[0024] The substance that inhibits the expression of LSMEM2 in the present invention is not limited to the above-mentioned antisense nucleic acid, siRNA, ribozyme, etc., and may be other substances (low molecular weight compounds, peptides, cyclic peptides, proteins, medium molecules, high molecules, etc.) as long as they directly or indirectly inhibit the expression of LSMEM2. Examples of such low molecular weight compounds include low molecular weight phosphorylation inhibitors that inhibit the phosphorylation of serine at position 50 of LSMEM2.

[0025] Specific embodiments of the above-mentioned (a) to (d) are shown below.

[0026] (a) Nucleic acid or precursor thereof having RNAi activity against mRNA of LSMEM2 gene In this specification, double-stranded RNA consisting of an oligoRNA complementary to the mRNA of LSMEM2 gene and its complementary strand, so-called siRNA, is defined as being included in nucleic acids containing a nucleotide sequence complementary to the nucleotide sequence of the mRNA of LSMEM2 gene or a part thereof.

[0027] siRNA can be designed based on the cDNA sequence information of the target gene, for example, according to the rules proposed by Elbashir et al. (Genes Dev., 15, 188-200 (2001)). The target sequence of siRNA can be, for example, AA+(N) １９ , AA+(N) ２１ or NA+(N) ２１(N is any base), but is not limited thereto. The position of the target sequence is also not particularly limited. For the selected group of candidate target sequences, whether there is any homology in the consecutive 16-17 base sequence in mRNA other than the target is checked using homology search software such as BLAST, and the specificity of the selected target sequence is confirmed. For example, AA+(N) １９ , AA+(N) ２１ or NA+(N) ２１ When the target sequence is a nucleotide sequence (N is any base), siRNA may be designed as a double-stranded RNA consisting of a sense strand having a 3'-terminal overhang of TT or UU at 19-21 bases after AA (or NA), and an antisense strand having a sequence complementary to the 19-21 bases and a 3'-terminal overhang of TT or UU for the target sequence whose specificity has been confirmed. Furthermore, short hairpin RNA (shRNA), which is a precursor of siRNA, can be designed by appropriately selecting any linker sequence (e.g., approximately 5-25 bases) capable of forming a loop structure and linking the sense strand and antisense strand via the linker sequence.

[0028] The sequences of siRNA and / or shRNA can be searched using search software provided free of charge on various websites. Examples of such websites include, but are not limited to, the siDESIGN Center provided by Dharmacon and the siRNA Target Finder provided by GenScript. Whether siRNA or shRNA synthesized based on the hit siRNA sequence information can actually suppress LSMEM2 expression in cardiomyocytes to a therapeutically effective extent can be verified, for example, by measuring the expression level of LSMEM2 mRNA in cardiomyocytes into which the nucleic acid has been introduced. Furthermore, if a nucleotide sequence inherently possesses RNAi activity but its inhibitory effect on LSMEM2 mRNA expression is attenuated after introduction, various modifications to the constituent nucleotides of the siRNA or shRNA, as described below, can be added to improve its in vivo stability, thereby prolonging the inhibitory effect on LSMEM2 expression and achieving the desired therapeutic effect.

[0029] In a preferred embodiment, the siRNA and shRNA of the present invention comprise a nucleotide sequence complementary to a sequence consisting of at least 15 consecutive nucleotides within the region represented by nucleotide numbers 1 to 1434 in the nucleotide sequence represented by SEQ ID NO: 1 or SEQ ID NO: 3. In a particularly preferred embodiment, the siRNA of the present invention is Silencer® Select siRNA (LSMEM2 siRNA ID: s189327, sense (5'→3'): GCACAGUGGAGGCUCACUATT (SEQ ID NO: 9), antisense (5'→3'): UAGUGAGCCUCCACUGUGCAG (SEQ ID NO: 10) (Thermo Fisher Scientific, Waltham, MA), and the shRNA is 5'-CTCTCACTGATGGCTTCATTT-3' (SEQ ID NO: 11).

[0030] In this specification, microRNA (miRNA) targeting the mRNA of the LSMEM2 gene is also defined as being encompassed by nucleic acids containing a nucleotide sequence complementary to the nucleotide sequence of the mRNA of the LSMEM2 gene or a part thereof. The miRNA is involved in post-transcriptional control of gene expression by binding complementarily to the target mRNA and suppressing the translation of the mRNA or by degrading the mRNA.

[0031] miRNAs are first transcribed from the gene that encodes them as primary-microRNAs (pri-miRNAs), which are then processed by Drosha into precursor-microRNAs (pre-miRNAs) of approximately 70 bases in length with a characteristic hairpin structure, which are then transported from the nucleus to the cytoplasm, where they are further processed by Dicer to become mature miRNAs, which are then incorporated into RISC and act on target mRNAs. Therefore, pre-miRNAs and pri-miRNAs, preferably pre-miRNAs, can also be used as miRNA precursors.

[0032] MiRNAs can be searched for using target prediction software provided free of charge on various websites. Examples of such websites include, but are not limited to, TargetScan, published by the Whitehead Institute in the United States, and DIANA-micro-T-CDS, published by the Alexander Fleming Center for Biomedical Sciences in Greece. Alternatively, miRNAs targeting LSMEM2 mRNA can be searched for using TarBase, a database of miRNAs experimentally proven to act on target mRNAs, published by the Institut Pasteur at the University of Thessali. Sequence information for these miRNAs and / or pre-miRNAs can be obtained, for example, using miRBase, published by the University of Manchester in the United Kingdom.

[0033] The nucleotide molecules constituting siRNA and / or shRNA, or miRNA and / or pre-miRNA may be natural RNA or DNA, but may contain various chemical modifications to improve stability (chemical and / or enzymatic) and specific activity (affinity with RNA). For example, to prevent degradation by hydrolases such as nucleases, the phosphate residues of each nucleotide constituting the antisense nucleic acid can be substituted with chemically modified phosphate residues such as phosphorothioate (PS), methylphosphonate, and phosphorodithioate. In addition, the hydroxyl group at the 2'-position of the sugar (ribose) of each nucleotide can be substituted with -OR (R=CH ３ (2'-O-Me), CH ２ CH ２ OCH ３ (2'-O-MOE), CH ２ CH ２ NHC (NH) NH ２ , C.H. ２ CONHCH ３ , C.H. ２ CH ２ Furthermore, the base moiety (pyrimidine, purine) may be chemically modified, for example, by introducing a methyl group or a cationic functional group into the 5-position of the pyrimidine base, or by substituting a thiocarbonyl group for the carbonyl group at the 2-position.

[0034] The sugar moiety of RNA has two predominant conformations: C2'-endo (S-type) and C3'-endo (N-type). In single-stranded RNA, these two conformations exist in equilibrium, but when double-stranded RNA is formed, it is fixed in the N-type. Therefore, in order to confer strong binding ability to target RNA, BNA (LNA) (Imanishi, T. et al., Chem. Commun., 1653-9, 2002; Jepsen, J.S. et al., Oligonucleotides, 14, 130-46, 2004) and ENA (Morita, K. et al., Nucleosides Nucleic Acids, 22, 1619-21, 2003), which are RNA derivatives in which the conformation of the sugar moiety is fixed to N-type by bridging the 2' oxygen and 4' carbon, may also be preferably used.

[0035] siRNA can be prepared by synthesizing the sense and antisense strands of the target sequence on mRNA using an automated DNA / RNA synthesizer, denaturing them in an appropriate annealing buffer at about 90 to about 95°C for about 1 minute, and then annealing them at about 30 to about 70°C for about 1 to about 8 hours. Alternatively, siRNA can be prepared by synthesizing shRNA, which serves as a precursor to siRNA, and cleaving it using a dicer. miRNA and pre-miRNA can be synthesized using an automated DNA / RNA synthesizer based on their sequence information.

[0036] As used herein, nucleic acids designed to produce siRNA or miRNA against the mRNA of the LSMEM2 gene in vivo are also defined as being encompassed by nucleic acids containing a nucleotide sequence complementary to the nucleotide sequence of the mRNA of the LSMEM2 gene, or a portion thereof. Examples of such nucleic acids include expression vectors constructed to express the above-mentioned shRNA or siRNA, or miRNA or pre-miRNA. shRNA can be prepared by designing an oligo-RNA containing a nucleotide sequence in which the sense and antisense strands of a target sequence on the mRNA are linked together, with a spacer sequence of a length (e.g., approximately 5 to 25 bases) sufficient to form an appropriate loop structure, and synthesizing this oligo-RNA using an automated DNA / RNA synthesizer. Vectors that express shRNA are classified into tandem and stem-loop (hairpin) types. The former contains an siRNA sense strand expression cassette and an siRNA antisense strand expression cassette linked in tandem, and the respective strands are expressed and annealed in cells to form a double-stranded siRNA (dsRNA). On the other hand, the latter involves inserting an shRNA expression cassette into a vector, where the shRNA is expressed in the cell and processed by dicer to form dsRNA. Although Pol II promoters (e.g., CMV immediate early promoters) can also be used as promoters, Pol III promoters are generally used to ensure accurate transcription of short RNAs. Pol III promoters include mouse and human U6-snRNA promoters, human H1-RNase P RNA promoters, and human valine-tRNA promoters. Furthermore, a sequence of four or more consecutive Ts is used as a transcription termination signal. Expression cassettes for miRNA and pre-miRNA can also be prepared in the same manner as for shRNA. The siRNA or shRNA, or miRNA or pre-miRNA expression cassette constructed in this manner is then inserted into a plasmid vector or viral vector.Such vectors include viral vectors such as retrovirus, lentivirus, adenovirus, adeno-associated virus, herpes virus, and Sendai virus, as well as animal cell expression plasmids.

[0037] For example, when preparing an adeno-associated virus (AAV) vector, a vector plasmid is first prepared by retaining the ITRs at both ends of the wild-type AAV genome sequence and inserting a desired nucleic acid in place of the DNA encoding the remaining Rep and capsid proteins. Meanwhile, the DNA encoding the Rep and capsid proteins required for viral particle formation is inserted into a separate plasmid. Furthermore, a plasmid containing genes (E1A, E1B, E2A, VA, and E4orf6) responsible for the adenovirus helper function required for AAV propagation is prepared as an adenovirus helper plasmid. By cotransfecting these three plasmids into host cells, recombinant AAV (i.e., AAV vector) is produced in the cells. It is preferable to use host cells (e.g., 293 cells) capable of supplying some of the gene products (proteins) of the genes responsible for the helper function. When such cells are used, it is not necessary to incorporate genes encoding proteins that can be supplied by the host cells into the adenovirus helper plasmid. Since the produced AAV vector is present in the nucleus, the host cells are frozen and thawed to recover the vector, and the desired AAV vector is prepared by separating and purifying the vector by density gradient ultracentrifugation using cesium chloride, a column method, or the like.

[0038] (b) Antisense Nucleic Acid Against LSMEM2 Gene mRNA In the present invention, an "antisense nucleic acid against LSMEM2 gene mRNA" refers to a nucleic acid containing a nucleotide sequence complementary to the nucleotide sequence of the mRNA or a portion thereof, which binds to the target mRNA to form a specific and stable duplex, thereby inhibiting protein synthesis. Examples of antisense nucleic acids include polydeoxyribonucleotides containing 2-deoxy-D-ribose, polyribonucleotides containing D-ribose, other types of polynucleotides that are N-glycosides of purine or pyrimidine bases, other polymers with non-nucleotide backbones (e.g., commercially available protein nucleic acids and synthetic sequence-specific nucleic acid polymers), and other polymers containing special bonds (provided that the polymers contain nucleotides with configurations that allow base pairing or base attachment, such as those found in DNA or RNA). They may be double-stranded DNA, single-stranded DNA, double-stranded RNA, single-stranded RNA, DNA:RNA hybrids, and may also be unmodified polynucleotides (or unmodified oligonucleotides), those containing known modifications, such as those labeled as known in the art, capped, methylated, those with one or more natural nucleotides substituted with an analogue, those with intramolecular nucleotide modifications, such as those containing uncharged bonds (e.g., methylphosphonates, phosphotriesters, phosphoramidates, carbamates, etc.), charged bonds, or sulfur-containing bonds. The nucleic acid may have a bond (e.g., phosphorothioate, phosphorodithioate, etc.), a side chain group such as a protein (e.g., nuclease, nuclease inhibitor, toxin, antibody, signal peptide, poly-L-lysine, etc.) or a sugar (e.g., monosaccharide, etc.), an intercurrent compound (e.g., acridine, psoralen, etc.), a chelating compound (e.g., metal, radioactive metal, boron, oxidizing metal, etc.), an alkylating agent, or a modified bond (e.g., α-anomeric nucleic acid, etc.).As used herein, the terms "nucleoside," "nucleotide," and "nucleic acid" refer not only to those containing purine and pyrimidine bases, but also to those containing other modified heterocyclic bases. Such modifications may include methylated purines and pyrimidines, acylated purines and pyrimidines, or other heterocycles. Modified nucleosides and nucleotides may also have modifications on the sugar moiety, e.g., one or more hydroxyl groups may be replaced with halogens, aliphatic groups, or converted to functional groups such as ethers or amines.

[0039] As described above, antisense nucleic acids may be DNA or RNA, or may be DNA / RNA chimeras. When the antisense nucleic acid is DNA, the RNA:DNA hybrid formed by the target RNA and the antisense DNA can be recognized by endogenous RNase H, causing selective degradation of the target RNA. Therefore, in the case of antisense DNA directed to degradation by RNase H, the target sequence may be not only a sequence in mRNA, but also a sequence of an intron region in the initial translation product of the LSMEM2 gene. The intron sequence can be determined by comparing the genomic sequence with the cDNA nucleotide sequence of the LSMEM2 gene using a homology search program such as BLAST or FASTA.

[0040] The target region of the antisense nucleic acid of the present invention is not particularly limited in length, as long as hybridization of the antisense nucleic acid results in inhibition of protein translation. It may be the entire sequence or a partial sequence of the mRNA encoding the protein, and may be as short as about 10 bases or as long as the entire sequence of the mRNA or initial transcription product. Considering ease of synthesis, antigenicity, intracellular internalization, and other issues, oligonucleotides consisting of about 10 to about 40 bases, particularly about 15 to about 30 bases, are preferred, but are not limited to these. Specifically, preferred target regions of the LSMEM2 gene include, but are not limited to, the 5'-end hairpin loop, 5'-end 6-base pair repeat, 5'-end untranslated region, translation initiation codon, protein-coding region, ORF translation termination codon, 3'-end untranslated region, 3'-end palindrome region, and 3'-end hairpin loop.

[0041] In one embodiment, the target region of the antisense nucleic acid of the present invention, similar to the above-mentioned siRNA, can be a sequence consisting of at least 15 consecutive nucleotides within the region represented by nucleotide numbers 1 to 1434 in the nucleotide sequence represented by SEQ ID NO: 1 or SEQ ID NO: 3.

[0042] Furthermore, the antisense nucleic acid of the present invention may not only hybridize with the mRNA or initial transcription product of the LSMEM2 gene and inhibit translation into protein, but may also bind to these genes, which are double-stranded DNA, to form a triplex and inhibit transcription into RNA (antigene).

[0043] The nucleotide molecules constituting the antisense nucleic acid may also be modified in the same manner as in the above-mentioned siRNA, etc., in order to improve stability, specific activity, etc.

[0044] The antisense oligonucleotide of the present invention can be prepared by determining the target sequence of mRNA or an initial transcription product based on the cDNA sequence or genomic DNA sequence of the LSMEM2 gene, and synthesizing a sequence complementary to the target sequence using a commercially available automated DNA / RNA synthesizer (Applied Biosystems, Beckman, etc.). In addition, the antisense nucleic acids containing the various modifications described above can also be chemically synthesized by known methods.

[0045] (c) Ribozyme Nucleic Acid for LSMEM2 Gene mRNA Another example of a nucleic acid containing a nucleotide sequence complementary to the nucleotide sequence of the LSMEM2 gene mRNA or a portion thereof includes a ribozyme nucleic acid capable of specifically cleaving the mRNA within the coding region. In a narrow sense, the term "ribozyme" refers to RNA with enzymatic activity that cleaves nucleic acids. However, in this specification, the term is used to encompass DNA as long as it has sequence-specific nucleic acid cleavage activity. The most versatile ribozyme nucleic acid is the self-splicing RNA found in infectious RNA such as viroids and viruses, and is known to include hammerhead and hairpin types. Hammerhead types exert their enzymatic activity with approximately 40 bases. By arranging several bases (totaling approximately 10 bases) adjacent to the hammerhead structure at both ends to be complementary to the desired cleavage site in the mRNA, it is possible to specifically cleave only the target mRNA. This type of ribozyme nucleic acid has the additional advantage that it uses only RNA as a substrate and therefore does not attack genomic DNA. When the mRNA of the LSMEM2 gene itself has a double-stranded structure, the target sequence can be made single-stranded by using a hybrid ribozyme linked to an RNA motif derived from a viral nucleic acid that can specifically bind to an RNA helicase [Proc. Natl. Acad. Sci. USA, 98(10):5572-5577(2001)]. Furthermore, when a ribozyme is used in the form of an expression vector containing DNA encoding it, a hybrid ribozyme can also be formed by further linking a sequence of modified tRNA to promote the translocation of the transcript into the cytoplasm [Nucleic Acids Res., 29(13):2780-2788(2001)].

[0046] Nucleic acids containing a nucleotide sequence complementary to the nucleotide sequence of the mRNA of the LSMEM2 gene, or a portion thereof, can be provided in special forms such as liposomes or microspheres, used in gene therapy, or in adducted forms. Examples of adducts include hydrophobic groups such as polycations, such as polylysine, which neutralize the charge of the phosphate backbone, and lipids (e.g., phospholipids, cholesterol, etc.), which enhance interaction with cell membranes and increase nucleic acid uptake. Preferred lipids for adducts include cholesterol and its derivatives (e.g., cholesteryl chloroformate, cholic acid, etc.). These can be attached to the 3' or 5' end of the nucleic acid, and can be attached via the base, sugar, or intramolecular nucleoside bond. Other groups include capping groups specifically placed at the 3' or 5' end of the nucleic acid to prevent degradation by nucleases such as exonucleases and RNases. Such capping groups include, but are not limited to, hydroxyl protecting groups known in the art, including glycols such as polyethylene glycol, tetraethylene glycol, and the like.

[0047] The activity of these nucleic acids to inhibit LSMEM2 protein expression can be examined using a transformant into which the LSMEM2 gene has been introduced, an in vivo or ex vivo LSMEM2 gene expression system, or an in vivo or ex vivo LSMEM2 protein translation system.

[0048] (d) A nucleic acid sequence recognition module that specifically binds to a target region in the LSMEM2 gene. (d-1) A substance that does not involve modification of the genome sequence. A well-known conventional genome editing method is to use an artificial nuclease that combines a molecule with sequence-independent DNA cleavage ability and a molecule with sequence recognition ability. For example, methods that have been reported include zinc finger nucleases (ZFNs) that link a zinc finger DNA binding domain with a nonspecific DNA cleavage domain, TALENs that link a transcription activator-like (TAL) effector, which is a DNA binding module found in the plant pathogenic bacterium Xanthomonas genus, with a DNA endonuclease, and the CRISPR-Cas9 system, which combines CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats), a nucleic acid sequence that functions in the adaptive immune systems of eubacteria and archaea, with the nuclease Cas (CRISPR-associated) protein family that functions together with CRISPR. Furthermore, an artificial nuclease has been reported in which a PPR protein, which is configured to recognize a specific nucleotide sequence through a series of PPR motifs consisting of 35 amino acids and recognizing a single nucleic acid base, is linked to a nuclease.

[0049] In all of these genome editing technologies, specific target nucleotide sequences are recognized by proteins (ZF, TAL effector, PPR) or RNA-protein complexes (CRISPR-Cas9). Therefore, by using these substances (nucleic acid sequence recognition modules) that confer sequence specificity to artificial nucleases and binding them to target regions in the LSMEM2 gene, LSMEM2 expression can be suppressed.

[0050] In the present invention, the term "nucleic acid sequence recognition module" refers to a molecule or molecular complex that has the ability to specifically recognize and bind to a specific nucleotide sequence on a DNA strand (i.e., a target nucleotide sequence). The binding of the nucleic acid sequence recognition module to the target nucleotide sequence enables an effector linked to the module to act specifically on the targeted site of DNA.

[0051] In one embodiment of the present invention, the nucleic acid sequence recognition module may be a CRISPR-Cas system. The CRISPR-Cas system recognizes a target DNA sequence using a complex of a short CRISPR RNA (crRNA) complementary to the target nucleotide sequence and a transactivating crRNA (tracrRNA), or a single synthetic RNA (guide RNA, gRNA) combining a crRNA and a tracrRNA. Therefore, any sequence can be targeted simply by synthesizing an oligo-DNA that can specifically hybridize with the complementary sequence of the target nucleotide sequence.

[0052] The nucleic acid sequence recognition module using CRISPR-Cas is provided as a complex of a Cas protein and an RNA molecule (guide RNA) consisting of a nucleotide sequence complementary to a target nucleotide sequence and tracrRNA required for recruiting the Cas protein. In another embodiment, the nucleic acid sequence recognition module using CRISPR-Cas is provided as a complex of crRNA containing an RNA sequence complementary to the target nucleotide sequence, tracrRNA, and Cas.

[0053] The Cas protein used in the present invention is not particularly limited as long as it belongs to the CRISPR system, but is preferably Cas9. Examples of Cas9 include, but are not limited to, Cas9 (SpCas9) derived from Streptococcus pyogenes and Cas9 (StCas9) derived from Streptococcus thermophilus. SpCas9 is preferred. Considering the use in human clinical trials, it is not desirable to generate DSB, so Cas with inactivated DNA cleavage activity (dCas) is preferred. For example, in the case of SpCas9, a double mutant of the D10A mutant, in which the 10th Asp residue is converted to an Ala residue and which lacks the ability to cleave the strand opposite to the strand that forms a complementary strand with the guide RNA, and the H840A mutant, in which the 840th His residue is converted to an Ala residue and which lacks the ability to cleave the strand complementary to the guide RNA, can be used, but other mutant Cass can also be used in a similar manner.

[0054] When CRISPR-Cas is used as the nucleic acid sequence recognition module, the target nucleotide sequence is not particularly limited as long as, when a complex of guide RNA and Cas binds to the sequence, the LSMEM2 gene is blocked by the complex and the LSMEM2 gene cannot be expressed, and examples of target nucleotide sequences for the LSMEM2 gene include the target nucleotide sequence for the guide RNA (ACTGGCTCCTAACCACGTGCAGG) (SEQ ID NO: 5) used in the Examples described below. Meanwhile, in the case of the LSMEM2 gene, crRNA can be designed, for example, by using CGG in the sequence as PAM and the reverse strand sequence 20 nucleotides upstream from just before it as the target nucleotide sequence.

[0055] In another aspect of the present invention, the nucleic acid sequence recognition module may be a zinc finger motif, a TAL effector, a PPR motif, or the like, or a fragment that contains the DNA-binding domain of a protein capable of specifically binding to DNA, such as a restriction enzyme, a transcription factor, or an RNA polymerase, and does not have the ability to cleave DNA double strands.

[0056] For details on the preparation of zinc finger motifs, reference may be made to Japanese Patent No. 4968498. For details on the preparation of TAL effectors, reference may be made to Japanese Patent Publication No. 2013-513389. For details on the preparation of PPR motifs, reference may be made to Japanese Patent Application Laid-Open No. 2013-128413.

[0057] Furthermore, when using fragments of restriction enzymes, transcription factors, RNA polymerases, etc., the DNA-binding domains of these proteins are well known, so fragments that contain the domains but do not have the ability to cleave DNA double strands can be easily designed and constructed.

[0058] Alternatively, as in the case of dCas of the CRISPR-Cas, an inactivated nuclease (e.g., FokI) can be combined with a nucleic acid sequence recognition module such as a zinc finger motif, a TAL effector, or a PPR motif, so that the nuclease sterically blocks the LSMEM2 gene, thereby suppressing expression of LSMEM2. In this case, for example, two nucleic acid sequence recognition modules that specifically recognize a positive-strand nucleotide sequence upstream of the target region and a reverse-strand nucleotide sequence downstream of the target region can be designed, and the modules can be made to form a complex with an inactivated nuclease at their ends (e.g., C-terminus).

[0059] Nucleic acid sequence recognition modules such as zinc finger motifs, TAL effectors, and PPR motifs can be provided as fusion proteins with the above-mentioned nucleases, or protein binding domains such as SH3 domains, PDZ domains, GK domains, and GB domains and their binding partners can be fused to the nucleic acid sequence recognition module and nuclease, respectively, and provided as a protein complex via the interaction between the protein binding domain and its binding partner. Alternatively, the nucleic acid sequence recognition module and nuclease can each be fused to an intein, and the two can be linked by ligation after the synthesis of each protein.

[0060] The nucleic acid sequence recognition module of the present invention can form a complex with a transcription repressor instead of a nuclease and target a sequence containing a cis element in the transcription regulatory region of the LSMEM2 gene as a target nucleotide sequence, thereby blocking the binding of the transcription factor to the cis element of the LSMEM2 gene and further repressing the transcription of the LSMEM2 gene. In the present invention, the term "transcription repressor" refers to a protein or protein domain that has transcription repression activity of a target gene.

[0061] The transcriptional repressor used in the present invention is not particularly limited as long as it can repress the transcriptional activation of the LSMEM2 gene, and examples thereof include KRAB, MBD2B, v-ErbA, SID (including a concatemer of SID (SID4X)), MBD2, MBD3, the DNMT family (e.g., DNMT1, DNMT3A, DNMT3B), Rb, MeCP2, ROM2, and AtHD2A, with KRAB being preferred. When KRAB is used as the transcriptional repressor, the protein from which it is derived is not particularly limited, and examples thereof include KOX-1 (ZNF10), KOX8 (ZNF708), ZNF43, ZNF184, ZNF91, HPF4, HTF10, and HTF34.

[0062] The nucleic acid sequence recognition module is contacted with the LSMEM2 gene by introducing a nucleic acid encoding the module (and, when used in combination with an effector such as a nuclease or transcription repressor, the effector protein) into cells of a target mammal (e.g., human, mouse, rat, bovine, dog, cat, monkey, etc., preferably human or mouse, more preferably human). Therefore, the nucleic acid sequence recognition module, or the nucleic acid sequence recognition module and the effector, are preferably prepared as nucleic acids encoding their fusion proteins, or as nucleic acids encoding each component in a form capable of forming a complex in a host cell after translation into protein. The nucleic acid may be DNA or RNA. In the case of DNA, it is preferably double-stranded DNA, and is provided in the form of an expression vector capable of expressing each component under the control of a functional promoter in mammalian cells. In the case of RNA, it is preferably single-stranded RNA.

[0063] When CRISPR-Cas is used as a nucleic acid sequence recognition module, an expression vector encoding a guide RNA and a Cas protein is introduced into a cell, and the guide RNA and the Cas protein are expressed to form a complex between the guide RNA and the Cas protein within the cell. The guide RNA and the Cas protein may be encoded on the same expression vector, or may be encoded on different expression vectors.

[0064] DNA encoding Cas can be cloned from cells that produce Cas by methods well known in the art, and the resulting DNA encoding Cas can be inserted downstream of a promoter in an expression vector for mammalian cells.

[0065] On the other hand, DNA encoding the guide RNA can be chemically synthesized using a DNA / RNA synthesizer by designing an oligo DNA sequence linking an RNA sequence complementary to the target nucleotide sequence with a known tracrRNA sequence (e.g., gttttagagctagaaatagcaagttaaaataaaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtggtgcttt; SEQ ID NO: 6). In this specification, nucleotide sequences are described as DNA sequences unless otherwise specified, but when the polynucleotide is RNA, thymine (T) is appropriately replaced with uracil (U).

[0066] DNA encoding the guide RNA can also be inserted into an expression vector for mammalian cells. The guide RNA and Cas may be encoded on the same expression vector or on different expression vectors. Preferably, the DNA encoding Cas and the DNA encoding the guide RNA are inserted downstream of separate promoters in the same expression vector.

[0067] Cas-encoding RNA can also be prepared, for example, by using the above-described Cas-encoding DNA as a template and transcribing it into mRNA in a known in vitro transcription system. Guide RNA can also be chemically synthesized using a DNA / RNA synthesizer by designing an oligo-RNA sequence in which an RNA sequence complementary to a target nucleotide sequence is linked to a known tracrRNA sequence. In this case, various modifications can be added to the ribonucleotides constituting the guide RNA to improve stability and membrane permeability. Alternatively, crRNA and tracrRNA can be synthesized separately and annealed before use.

[0068] DNA encoding a nucleic acid sequence recognition module such as a zinc finger motif, a TAL effector, a PPR motif, etc. can be obtained by any of the methods described above for each module. DNA encoding a sequence recognition module such as a restriction enzyme, a transcription factor, or an RNA polymerase can be cloned, for example, by synthesizing an oligo-DNA primer based on the cDNA sequence information thereof so as to cover a region encoding a desired portion of the protein (a portion including a DNA-binding domain), and amplifying the primer by RT-PCR using total RNA or an mRNA fraction prepared from cells that produce the protein as a template.

[0069] DNA encoding effectors such as nucleases and transcriptional repressors can also be cloned by synthesizing oligo DNA primers based on the cDNA sequence information of the effector to be used, and amplifying the DNA by RT-PCR using total RNA or an mRNA fraction prepared from cells that produce the effector as a template. For example, DNA encoding FokI can be cloned by RT-PCR from mRNA derived from Flavobacterium okeanokoites (IFO 12536) by designing appropriate primers upstream and downstream of the CDS based on the cDNA sequence.

[0070] The DNA encoding the cloned nucleic acid sequence recognition module can be used as is, or optionally digested with a restriction enzyme, or an appropriate linker and / or nuclear localization signal can be added. When used in combination with an effector such as a nuclease or transcription repressor, the DNA encoding the cloned nucleic acid sequence recognition module can be ligated with the DNA encoding the cloned nucleic acid sequence recognition module to prepare a DNA encoding a fusion protein. Alternatively, the DNA encoding the nucleic acid sequence recognition module and the DNA encoding the effector can each be fused with DNA encoding a binding domain or its binding partner, or both DNAs can be fused with DNA encoding a separate intein, allowing the nucleic acid sequence recognition module and the effector to form a complex after translation in the host cell. In these cases, a linker and / or nuclear localization signal can be attached to an appropriate position in one or both DNAs, as desired.

[0071] DNA encoding the nucleic acid sequence recognition module and DNA encoding the effector can be constructed by chemically synthesizing the DNA strand or by connecting synthesized, partially overlapping short oligo DNA strands using PCR or Gibson Assembly. The advantage of constructing full-length DNA using chemical synthesis or a combination of PCR and Gibson Assembly is that the codon usage can be designed across the entire CDS to suit the host into which the DNA will be introduced. When expressing heterologous DNA, converting the DNA sequence to codons frequently used in the host organism can be expected to increase protein expression levels. Data on codon usage in the host can be obtained, for example, from the genetic code usage database published on the website of the Kazusa DNA Research Institute (Public Interest Incorporated Foundation), or by referring to literature listing codon usage in each host. By referring to the obtained data and the DNA sequence to be introduced, codons used in the DNA sequence that are less frequently used in the host can be converted to frequently used codons that encode the same amino acid.

[0072] The expression vector into which DNA encoding the nucleic acid sequence recognition module and / or effector is inserted may be an animal virus vector such as a retrovirus, vaccinia virus, or adenovirus. The promoter may be a promoter that can function in mammalian cells, such as an SRα promoter, SV40 promoter, LTR promoter, CMV (cytomegalovirus) promoter, RSV (Rous sarcoma virus) promoter, MoMuLV (Moloney murine leukemia virus) LTR, or HSV-TK (herpes simplex virus thymidine kinase) promoter, but is not limited to these.

[0073] In addition to the above, the expression vector may contain, if desired, an enhancer, a splicing signal, a terminator, a polyA addition signal, a selection marker such as a drug resistance gene, a replication origin, and the like.

[0074] By introducing an expression vector encoding a nucleic acid sequence recognition module (and, if desired, an effector) into a target cell of a mammal, the nucleic acid sequence recognition module or a complex of the module and the effector is expressed and formed in the cell, and can be brought into contact with the target nucleotide sequence on the LSMEM2 gene.

[0075] (d-2) Binding inhibitors accompanied by modification of genome sequence In the above (d), by using a wild-type enzyme having DSB activity as the nuclease, DSB is generated within the LSMEM2 gene, resulting in the deletion of one or more nucleotides of the LSMEM2 gene or their substitution with other nucleotides, or the insertion of one or more nucleotides into the gene, thereby disrupting the LSMEM2 gene.

[0076] After the LSMEM2 gene is cleaved within the target nucleotide sequence, it is repaired by non-homologous end joining (NHEJ), but a repair error during this process can result in the deletion or substitution of one or more nucleotides in the gene with other nucleotides, or the insertion of one or more nucleotides into the gene, which can result in a mutation (e.g., a frameshift mutation) in the LSMEM2 gene, thereby suppressing the expression of LSMEM2 mRNA that is translated correctly.

[0077] Another method for introducing a mutation into the LSMEM2 gene involves introducing DNA (donor DNA) containing sequences homologous to the upstream and downstream sequences flanking the target region in the LSMEM2 gene and into which a mutation has been introduced in the target region, together with DNA encoding a complex of a nucleic acid sequence recognition module and a nuclease, into a target mammalian cell. This induces homologous recombination between the donor DNA and a region containing the target region of the present invention. The sequences homologous to the upstream and downstream sequences flanking the target region contained in the donor DNA are not particularly limited as long as they are long enough to induce homologous recombination. They may each be relatively short sequences of approximately 50-100 mer, or long homology arms spanning several kb. In the latter case, the donor DNA may be provided in the form of a targeting vector into which it has been inserted. The term "targeting vector into which donor DNA has been inserted" does not simply refer to a targeting vector into which the same sequence as the donor DNA has been inserted, but also includes vectors containing a selection marker and / or a recombinase target sequence within or outside the donor DNA. The vector that serves as the backbone of the targeting vector is not particularly limited, as long as it is self-replicable in the cells to be transformed (e.g., Escherichia coli). For example, commercially available vectors such as pBluescript (Stratagene), pZErO1.1 (Invitrogen), and pGEM-1 (Promega) can be used.

[0078] Donor DNA can be introduced into cells in the form of either double-stranded DNA (circular double-stranded DNA or linear double-stranded DNA) or single-stranded DNA.

[0079] DSBs involve unexpected genome modification, which can cause side effects such as strong cytotoxicity and chromosomal rearrangements, potentially undermining the reliability of gene therapy. Therefore, instead of nucleases, enzymes capable of genome modification without DSBs can be used as effectors in combination with nucleic acid sequence recognition modules. Examples of such enzymes include, but are not limited to, enzymes that convert a nucleic acid base substituent into another substituent, thereby substituting a different base (e.g., deaminases, etc.), and enzymes that catalyze abasic reactions and introduce mutations into abasic sites by utilizing errors in the endogenous repair mechanism (e.g., DNA glycosylases, etc.). In this case, if the nucleic acid sequence recognition module is CRISPR-Cas, a mutant (nCas) in which at least one DNA cleavage ability is inactivated, preferably a mutant (dCas) in which both DNA cleavage abilities are inactivated, is used as Cas. Details of the use of deaminase as an effector are described, for example, in WO 2015 / 133554, and details of the use of DNA glycosylase are described, for example, in WO 2016 / 072399.

[0080] Without being bound by theory, myocardium subjected to stretch stress expresses inflammatory cytokines in a mechanostress-dependent manner, inducing intramyocardial inflammation. This creates a vicious cycle, further worsening cardiac function and prognosis. It is believed that LSMEM2 inhibition breaks this vicious cycle and exerts a therapeutic effect. Furthermore, in laminopathies, LSMEM2 has been found to interact with VPS35, a component of the retromer complex that plays a central role in vesicle transport. VPS35 is a central molecule in vesicle transport that controls the destination of vesicles through interacting molecules. Meanwhile, in laminopathies model cells, it has been reported that SUN1, a nuclear membrane protein associated with mechanotransduction, mislocalizes to the Golgi apparatus (Cell. 2012; 149(3):565-77), strongly suggesting that abnormalities in vesicle transport are involved in the pathogenesis of laminopathies. Since LSMEM2 deficiency improves the phenotype of laminopathies, it is thought that the altered vesicle transport involved in the pathogenesis of laminopathies overlaps with the LSMEM2-dependent altered vesicle transport in the presence of mechanostress. In the present invention, the term "substance that suppresses the function of LSMEM2" refers to any substance that suppresses the function of LSMEM2 that contributes to mechanotransduction once functionally produced, and examples thereof include substances that bind to LSMEM2 and suppress the function, and substances that inhibit the migration of LSMEM2 to the cell membrane.

[0081] Specifically, an example of a substance that inhibits the function of LSMEM2 is an antibody against LSMEM2. The antibody may be either a polyclonal antibody or a monoclonal antibody. These antibodies can be produced according to publicly known methods for producing antibodies or antisera. The isotype of the antibody is not particularly limited, but is preferably IgG, IgM, or IgA, and particularly preferably IgG. Furthermore, the antibody is not particularly limited as long as it has at least a complementarity-determining region (CDR) for specifically recognizing and binding to LSMEM2, and may be a complete antibody molecule or, for example, Fab, Fab', F(ab') ２or a genetically engineered conjugate molecule such as scFv, scFv-Fc, minibody, or diabody, or a derivative thereof modified with a molecule having a protein stabilizing effect, such as polyethylene glycol (PEG).

[0082] In a preferred embodiment, an antibody against LSMEM2 is used as a pharmaceutical intended for administration to humans, and therefore the antibody (preferably a monoclonal antibody) is an antibody with a reduced risk of exhibiting antigenicity when administered to humans, specifically a fully human antibody, a humanized antibody, a mouse-human chimeric antibody, or the like, with fully human antibodies being particularly preferred. Humanized antibodies and chimeric antibodies can be produced by genetic engineering using standard methods. Furthermore, fully human antibodies can also be produced from human-human (or mouse) hybridomas, but in order to provide large quantities of antibodies stably and at low cost, it is desirable to produce them using human antibody-producing mice or phage display methods.

[0083] The substance that inhibits the function of LSMEM2 may also be, for example, an aptamer (peptide aptamer or nucleic acid aptamer). As used herein, aptamer refers to a nucleic acid or peptide that can specifically bind to a specific molecule. When the aptamer is a nucleic acid, the nucleic acid may be DNA, RNA, or a chimera of DNA and RNA. Aptamers can be screened or produced according to well-known methods (e.g., Ellington et al., (1990), Nature, 346, 818-822; Tuerk et al., (1990) Science, 249, 505-510).

[0084] A substance that inhibits the function of LSMEM2 may also be, for example, a substance that induces the degradation of LSMEM2. Examples of substances that induce the degradation of LSMEM2 include LSMEM2 degraders produced using targeted protein degradation techniques. As used herein, a targeted protein degrader refers to a molecule that can promote the degradation of a target protein through the intracellular proteolytic mechanism. Such targeted protein degraders can be produced according to well-known methods (e.g., Mohammadsharif Tabeboldbar et al., Cell. 2021 Sep 16; 184(19):4919-4938.e22.). In one embodiment utilizing a target protein degrader, the target protein degrader may comprise two moieties: one that specifically binds to a target protein and another that binds to an E3 ubiquitin ligase, which promotes ubiquitination of the target protein, thereby promoting degradation of the target protein by the proteasome system.

[0085] As used herein, "mechano-signaling" means that when a cell is subjected to a mechanical stimulus (e.g., hydraulic pressure, stretching stimulus, etc.), a structural change is induced in a sensor molecule (PIEZO), which is a component of the cell, and the information of the mechanical stimulus is converted into a biochemical signal, which is then transmitted by other intermediary signal molecules so that the cell can sense, interpret, and respond to it.

[0086] As shown in the Examples below, LSMEM2 is necessary and sufficient for mechanosignaling (mechanostress (stretch stimulus)-dependent inflammatory signaling). Therefore, substances that inhibit the expression or function of LSMEM2 have the effect of inhibiting mechanosignaling and can be used as targeted therapeutic agents for cardiomyocytes, etc., as preventive and / or therapeutic agents for dilated cardiomyopathy. Furthermore, mice produced by crossbreeding LSMEM2 knockout mice with lamin cardiomyopathy model mice have improved cardiac function and lower limb muscle strength. Therefore, substances that inhibit the expression or function of LSMEM2 can also be used as preventive and / or therapeutic agents for laminopathies. LSMEM2 KO mice develop normally, have completely normal cardiac function, and have no problems with reproductive function. Therefore, substances that inhibit the expression or function of LSMEM2 have the additional advantageous effect of being less toxic to normal cells and having a low risk of side effects. Therefore, a pharmaceutical containing a substance that suppresses the expression or function of LSMEM2 is useful as a mechano-signaling inhibitor, and therefore as a preventive and / or therapeutic agent for heart disease, as well as a preventive and / or therapeutic agent for laminopathies. Here, "treatment" is used to mean both amelioration of disease and improvement of prognosis. "Prevention" is used to mean delay of disease onset.

[0087] A single substance that inhibits the expression or function of LSMEM2 may be used, or two or more may be used in combination. Two or more substances that inhibit the expression or function of LSMEM2 may be formulated as separate pharmaceuticals, or may be combined in the same pharmaceutical composition. When two or more substances that inhibit the expression or function of LSMEM2 are formulated as separate pharmaceuticals, the formulations may be administered simultaneously or at different times. The administration routes may be the same or different. The dosages described below refer to the dosage of one substance that inhibits the expression or function of LSMEM2. However, even when two or more substances are used in combination, similar dosages can be used for each substance as long as they do not adversely affect the subject.

[0088] (1) Pharmaceuticals containing siRNA and its precursors, antisense nucleic acids, and ribozyme nucleic acids Antisense nucleic acids (or miRNAs) that can bind complementarily to transcripts of the LSMEM2 gene and inhibit protein translation from the transcripts, siRNAs (or ribozymes, miRNAs) that can target homologous (or complementary) base sequences in transcripts of the LSMEM2 gene and cleave the transcripts, and further shRNAs and pre-miRNAs that are precursors of the siRNAs and miRNAs (hereinafter collectively referred to as "nucleic acids of the present invention") can be used as anti-inflammatory agents and / or inhibitors of abnormal vesicle transport, and thus as preventive and / or therapeutic agents for heart disease and / or laminopathies. The pharmaceutical containing the nucleic acid of the present invention can be administered orally or parenterally (e.g., intravascular administration, subcutaneous administration, etc.) to subjects such as humans or non-human warm-blooded animals (e.g., rats, rabbits, sheep, pigs, cows, cats, dogs, monkeys, chickens, etc.) as a liquid preparation or as a pharmaceutical composition in an appropriate dosage form.

[0089] When the nucleic acids of the present invention are used as anti-inflammatory agents and / or inhibitors of abnormal vesicle transport, and thus as preventive and / or therapeutic agents for heart disease and / or laminopathies, they can be formulated and administered according to methods known per se. That is, the nucleic acids of the present invention may be used alone, or they may be functionally inserted into an expression vector for mammalian cells, such as a retroviral vector, an adenoviral vector, or an adenovirus-associated viral vector. The nucleic acids may be administered directly or together with an adjuvant to promote uptake, using a gene gun or a catheter such as a hydrogel catheter. Alternatively, they may be aerosolized and administered locally into the trachea as an inhalant. Furthermore, for the purposes of improving pharmacokinetics, prolonging half-life, and improving cellular uptake efficiency, the nucleic acids may be formulated (injectable) alone or together with a carrier such as liposomes, and administered intravenously, subcutaneously, or the like.

[0090] The nucleic acid of the present invention may be administered as it is, or may be administered as an appropriate pharmaceutical composition. The pharmaceutical composition used for administration may contain the nucleic acid of the present invention and a pharmacologically acceptable carrier, diluent, or excipient. Such a pharmaceutical composition is provided in a dosage form suitable for oral or parenteral administration.

[0091] Compositions for parenteral administration include, for example, injections, suppositories, intranasal preparations, etc., and injections may include dosage forms such as intravenous injections, subcutaneous injections, intradermal injections, intramuscular injections, and drip infusion injections. Such injections can be prepared according to known methods. For example, injections can be prepared by dissolving, suspending, or emulsifying the nucleic acid of the present invention in a sterile aqueous or oily liquid typically used for injections. Examples of aqueous solutions for injection include physiological saline, isotonic solutions containing glucose and other adjuvants, and the like, which may be used in combination with an appropriate solubilizing agent, such as alcohol (e.g., ethanol), polyalcohol (e.g., propylene glycol, polyethylene glycol), or nonionic surfactant (e.g., polysorbate 80, HCO-50 (polyoxyethylene (50 mol) adduct of hydrogenated castor oil)), etc. As the oily liquid, for example, sesame oil, soybean oil, etc. are used, and solubilizing agents such as benzyl benzoate, benzyl alcohol, etc. may be used in combination. The prepared injection solution is preferably filled into an appropriate ampule. Suppositories for rectal administration may be prepared by mixing the above nucleic acid with a conventional suppository base.

[0092] Compositions for oral administration include solid or liquid dosage forms, specifically tablets (including sugar-coated tablets and film-coated tablets), pills, granules, powders, capsules (including soft capsules), syrups, emulsions, suspensions, etc. Such compositions are produced by known methods and may contain carriers, diluents, or excipients commonly used in the pharmaceutical field. Examples of carriers and excipients for tablets include lactose, starch, sucrose, and magnesium stearate.

[0093] The above-mentioned parenteral or oral pharmaceutical compositions are conveniently prepared in dosage unit forms that correspond to the dosage of the active ingredient. Examples of such dosage unit forms include tablets, pills, capsules, injections (ampoules), and suppositories. The nucleic acid of the present invention is preferably contained in an amount of, for example, about 0.01 to 500 mg per dosage unit.

[0094] The dosage of the pharmaceutical containing the nucleic acid of the present invention varies depending on the subject, target disease, symptoms, administration route, etc., but when used for the treatment or prevention of heart disease or laminopathies, for example, it is convenient to administer a single dose of the nucleic acid of the present invention by intravenous injection, typically at about 0.0001 to 20 mg / kg body weight, approximately once every day to once every six months. Similar amounts can also be administered in other parenteral and oral administrations. When symptoms are particularly severe, the dosage may be increased depending on the symptoms.

[0095] (2) Pharmaceuticals Containing a Nucleic Acid Sequence Recognition Module When the binding inhibitor of the present invention is a nucleic acid sequence recognition module (and an effector that forms a complex with the module) used in genome editing technology, the binding inhibitor is preferably formulated in the form of an expression vector containing DNA encoding it (hereinafter also referred to as the "vector of the present invention"). Examples of the vector of the present invention that can be used include viral vectors such as detoxified retroviruses, adenoviruses, adeno-associated viruses, herpes viruses, vaccinia viruses, pox viruses, polio viruses, Sindbis viruses, Sendai viruses, SV40, and immunodeficiency viruses (HIV). Adenovirus or adeno-associated virus vectors are preferred.

[0096] Examples of pharmaceutically acceptable carriers include, but are not limited to, excipients such as sucrose and starch, binders such as cellulose and methylcellulose, disintegrants such as starch and carboxymethylcellulose, lubricants such as magnesium stearate and aerosil, flavorings such as citric acid and menthol, preservatives such as sodium benzoate and sodium bisulfite, stabilizers such as citric acid and sodium citrate, suspending agents such as methylcellulose and polyvinylpyrrolide, dispersing agents such as surfactants, diluents such as water and physiological saline, and base waxes.

[0097] To promote the introduction of the vector into target cells, the agent of the present invention may further contain a nucleic acid transfer reagent, such as atelocollagen, liposomes, nanoparticles, lipofectin, lipofectamine, DOGS (transfectam), DOPE, DOTAP, DDAB, DHDEAB, HDEAB, polybrene, or cationic lipids such as poly(ethyleneimine) (PEI).

[0098] In a preferred embodiment, the agent of the present invention may be a pharmaceutical composition comprising the vector encapsulated in a liposome. Liposomes are minute, closed vesicles having an internal phase surrounded by one or more lipid bilayers, and can typically hold a water-soluble substance in the internal phase and a lipid-soluble substance within the lipid bilayer. As used herein, the term "encapsulated" refers to the vector being held in the liposomal internal phase or within the lipid bilayer. The liposomes used in the present invention may be monolayer or multilayer membranes, and the particle size can be appropriately selected, for example, within the range of 10 to 1,000 nm, preferably 50 to 300 nm. In consideration of delivery to target tissues, the particle size may be, for example, 200 nm or less, preferably 100 nm or less.

[0099] Methods for encapsulating the above-mentioned vector into liposomes include, but are not limited to, the lipid film method (vortex method), reverse phase evaporation, surfactant removal method, freeze-thaw method, and remote loading method, and any known method can be appropriately selected.

[0100] The agent of the present invention can be administered orally or parenterally to mammals (e.g., humans, rats, mice, guinea pigs, rabbits, sheep, horses, pigs, cattle, and monkeys), but parenteral administration is preferred.

[0101] It is also possible to prepare a sustained-release formulation (such as a mini-pellet formulation) and implant it near the affected area, or to administer the agent continuously and gradually to the affected area using an osmotic pump or the like.

[0102] Suitable formulations for parenteral administration (e.g., subcutaneous injection, intramuscular injection, local injection, intraperitoneal administration, etc.) include aqueous and non-aqueous isotonic sterile injection solutions, which may contain antioxidants, buffers, bacteriostats, isotonicity agents, etc. Also included are aqueous and non-aqueous sterile suspensions, which may contain suspending agents, solubilizers, thickeners, stabilizers, preservatives, etc. Such formulations can be packaged in unit-dose or multi-dose containers such as ampoules or vials. Alternatively, the active ingredient and a pharmaceutically acceptable carrier can be lyophilized and stored in a state that only requires dissolving or suspending in an appropriate sterile vehicle immediately before use.

[0103] The content of the vector in the pharmaceutical composition is, for example, about 0.1 to 100% by weight of the total pharmaceutical composition.

[0104] The dosage of the agent of the present invention varies depending on the administration method, the type and severity of the target disease, and the condition of the recipient (sex, age, body weight, etc.). For example, when administered systemically to an adult, the dosage is usually about 1×10 as a viral titer per administration when the vector is administered as a viral vector particle. ３ pfu ~ 1 x 10 １５ The range of pfu may be administered.

[0105] When the above-mentioned substance is provided in the form of an expression vector containing DNA encoding it, the agent of the present invention may be an ex vivo preparation, which is added to cells or tissues (e.g., cardiomyocytes) collected from a recipient to introduce the expression vector into the cells, and then returned to the recipient's body, preferably to the affected area of ​​the heart. In this case, methods for gene transfer into cells include lipofection, calcium phosphate coprecipitation, and direct injection using microglass tubes. Furthermore, methods for gene transfer into tissue include gene transfer using encapsulated liposomes, gene transfer using electrostatic liposomes, HVJ-liposome method, improved HVJ-liposome method (HVJ-AVE liposome method), receptor-mediated gene transfer, a method of transferring an active ingredient into cells together with a carrier (metal particles) using a particle gun, direct transfer of naked DNA, and transfer using a positively charged polymer.

[0106] (3) Pharmaceuticals containing antibodies against LSMEM2, small molecules that inhibit the expression or function of LSMEM2, or LSMEM2 degraders. Antibodies against LSMEM2, LSMEM2 degraders, or small molecules that inhibit the expression or function of LSMEM2 can inhibit the production of LSMEM2 or its functions that contribute to mechano-signaling. Therefore, these substances can be used as mechano-signaling inhibitors, and therefore as preventive and / or therapeutic agents for heart disease and / or laminopathies. Pharmaceuticals containing the above-mentioned antibodies, degraders, or small molecules can be administered orally or parenterally (e.g., intravascularly or subcutaneously) to humans or other warm-blooded animals (e.g., rats, rabbits, sheep, pigs, cows, cats, dogs, monkeys, chickens, etc.) as liquid preparations or as pharmaceutical compositions in an appropriate dosage form.

[0107] The above-mentioned antibody, degrader, or low molecular weight compound may be administered per se, or may be administered as a suitable pharmaceutical composition. The pharmaceutical composition used for administration may contain the above-mentioned antibody or low molecular weight compound or a salt thereof and a pharmacologically acceptable carrier, diluent, or excipient. Such a pharmaceutical composition is provided in a dosage form suitable for oral or parenteral administration.

[0108] Compositions for parenteral administration include, for example, injections, suppositories, intranasal preparations, etc., and injections may include dosage forms such as intravenous injections, subcutaneous injections, intradermal injections, intramuscular injections, and drip infusion injections. Such injections can be prepared according to known methods. For example, injections can be prepared by dissolving, suspending, or emulsifying the antibody or low molecular weight compound of the present invention, or a salt thereof, in a sterile aqueous or oily liquid typically used for injections. Examples of aqueous solutions for injection include physiological saline, isotonic solutions containing glucose and other adjuvants, and the like, which may be used in combination with an appropriate solubilizing agent, such as alcohol (e.g., ethanol), polyalcohol (e.g., propylene glycol, polyethylene glycol), or nonionic surfactant (e.g., polysorbate 80, HCO-50 (polyoxyethylene (50 mol) adduct of hydrogenated castor oil)), etc. As the oily liquid, for example, sesame oil, soybean oil, etc. are used, and a solubilizing agent such as benzyl benzoate or benzyl alcohol may be used in combination. The prepared injection solution is preferably filled into an appropriate ampule. Suppositories for rectal administration may be prepared by mixing the above-mentioned antibody or a salt thereof with a conventional suppository base.

[0109] Compositions for oral administration include solid or liquid dosage forms, specifically tablets (including sugar-coated tablets and film-coated tablets), pills, granules, powders, capsules (including soft capsules), syrups, emulsions, suspensions, etc. Such compositions are produced by known methods and may contain carriers, diluents, or excipients commonly used in the pharmaceutical field. Examples of carriers and excipients for tablets include lactose, starch, sucrose, and magnesium stearate.

[0110] The above-mentioned parenteral or oral pharmaceutical compositions are conveniently prepared in dosage unit forms that correspond to the dosage of the active ingredient. Examples of such dosage unit forms include tablets, pills, capsules, injections (ampoules), and suppositories. The antibody or low-molecular-weight compound is typically contained in an amount of 0.1 to 500 mg per dosage unit, preferably 5 to 100 mg for injections and 10 to 250 mg for other dosage forms.

[0111] The dosage of the pharmaceutical containing the antibody or low molecular weight compound or a salt thereof varies depending on the subject, target disease, symptoms, administration route, etc., but for example, a single dose of an antibody or low molecular weight compound is typically about 0.0001 to 20 mg / kg body weight, and for low molecular weight compounds, it is convenient to administer the compound orally or parenterally about 1 to 5 times per day, or for antibodies, by intravenous injection once per day to once every several months. Similar amounts can also be administered for other parenteral and oral administrations. When symptoms are particularly severe, the dosage may be increased depending on the symptoms.

[0112] Each of the above-mentioned compositions may contain other active ingredients as long as they do not cause undesirable interactions when combined with the above-mentioned antibodies or low-molecular-weight compounds. For example, antibacterial agents, antifungal agents, nonsteroidal anti-inflammatory drugs, steroid drugs, anticoagulants, platelet aggregation inhibitors, thrombolytic drugs, immunomodulators, antiprotozoal drugs, antibiotics, antiviral drugs, antitussives / expectorants, sedatives, anesthetics, antiulcer drugs, antiarrhythmic drugs, antihypertensive diuretics, tranquilizers, antipsychotic drugs, antitumor drugs, antihyperlipidemic drugs, muscle relaxants, antiepileptic drugs, antidepressants, antiallergic drugs, cardiac stimulants, antiarrhythmic drugs, vasodilators, vasoconstrictors, antihypertensive diuretics, antidiabetic drugs, narcotic antagonists, vitamins, vitamin derivatives, arthritis drugs, antirheumatic drugs, antiasthmatic drugs, Examples of such drugs include drugs for treating frequent urination and urinary incontinence, drugs for treating atopic dermatitis, drugs for treating allergic rhinitis, hypertensive drugs, proteolytic drugs, protease inhibitors, anti-SIDS drugs, anti-sepsis drugs, anti-septic shock drugs, endotoxin antagonists or antibodies, signal transduction inhibitors, inflammatory mediator action inhibitors, inflammatory mediator action inhibitory antibodies, inflammatory mediator production inhibitors, anti-inflammatory mediator action inhibitors, anti-inflammatory mediator action inhibitory antibodies, anti-inflammatory mediator production inhibitors, α1 adrenergic agonists, etc. The above-mentioned antibodies or low molecular weight compounds and these other drugs may be administered to a patient at the same time or at different times.

[0113] The pharmaceuticals are used, for example, as anti-inflammatory agents or inhibitors of abnormal vesicle transport, for the treatment of various inflammatory diseases (e.g., Crohn's disease, rheumatoid arthritis, Behcet's disease (ophthalmic symptoms), ulcerative colitis, ankylosing spondylitis, psoriasis (including psoriatic arthritis), HIV infection, multiple myeloma, heart diseases (e.g., congestive heart failure, chronic heart failure, dilated cardiomyopathy, hypertrophic cardiomyopathy, myocardial ischemia, myocardial infarction, angina pectoris), GVHD, giant cell arteritis (GCA), polymyalgia rheumatica (PMR), pigmented purpuric lichenoid dermatitis, and the like. , sarcoidosis, Wegener's granulomatosis, pyoderma, Behcet's disease, TNF receptor-associated periodic syndrome (TRAPS), SAPHO syndrome, Takayasu's disease, myositis, Still's disease, periarteritis nodosa (PN), relapsing polychondritis, scleroderma polymyositis, hemophagocytic syndrome, pemphigus, Kawasaki disease, atopic dermatitis) and laminopathies (e.g., muscular dystrophy, lamin cardiomyopathy, lipodystrophy, leukodystrophy).

[0114] The present invention will be described in detail below with reference to examples, but the present invention is not limited to these.

[0115] Example 1 Mouse Tissue RT-PCR RT-PCR was performed to examine the expression dynamics of LSMEM2 in mouse and human tissues. Mouse MTC Panel I (636745) from Clontech Laboratories was used for cDNA, and the heart, brain, liver, skeletal muscle, testis, kidney, spleen, and lung were examined. TaKaRa Ex Taq (Takara Bio Inc., Shiga, Japan) was used for PCR. Primers and reaction solutions were prepared as follows. Primers used: Mouse_RT-PCR_L agcttctgggtgtcttaccaccatc (SEQ ID NO: 7) Mouse_RT-PCR_R caatttgagcagagtctcctcttgtgtgc (SEQ ID NO: 8)

[0116]

[0117] The PCR conditions were as follows:

[0118]

[0119] As a result, it was shown that LSMEM2 expression was localized to cardiac and skeletal muscles (Fig. 1).

[0120] Example 2 RNA-seq of LSMEM2-Expressed Cardiomyocytes Primary Culture of Neonatal Rat Cardiomyocytes Hearts were removed from neonatal rats, dissociated in Hank's balanced salt solution (Thermo Fisher Scientific, Waltham, MA), and the blood inside was washed away. The dissociated hearts were incubated overnight at 4°C in 0.25% Trypsin / EDTA (SIGMA, St. Louis, MO). The next day, D-MEM (in 10% FBS) was added, and the mixture was incubated at 37°C for 5 minutes. The supernatant was discarded, and collagenase was added and mixed by hand for 1 minute. The supernatant was discarded and the mixture was transferred to a flask. Collagenase (Worthington, type 2) was added and stirred for 15 minutes using a stirrer while maintaining the temperature at 37°C. After centrifugation at 3000g for 5 minutes, the supernatant was discarded. 30 ml of D-MEM was added to the mixture, which was then suspended. The mixture was then seeded onto a P10 dish and incubated at 37°C for 70 minutes (during this process, cardiac fibroblasts adhere to the dish, and cardiomyocytes are separated into the culture supernatant). The surface of the dish was washed with the supernatant, and the cardiomyocytes were recovered. The mixture was then centrifuged at 3000g for 5 minutes, the supernatant was discarded, and the mixture was suspended in an appropriate amount of D-MEM. A portion was taken and the number of cells was counted. Finally, the mixture was seeded at an appropriate cell concentration depending on the experimental conditions.

[0121] RNA-seq analysis of cardiomyocytes Cultured cardiomyocytes 5.0 x 10 ６The cells were prepared in a 6 cm dish at 1000 x 1000 cells / well and seeded onto a 6 cm dish. After 24 hours, the medium was replaced and wild-type LSMEM2, S37A LSMEM2, and mock adenovirus vectors were added. After 48 hours, the medium was replaced with serum-free D-MEM, and after 16 hours, myocardial RNA was collected and purified using RNA Bee. Subsequently, RNA-seq data generation was outsourced to the Research Institute for Microbial Diseases, Osaka University, and was carried out as follows: First, RNA libraries were prepared from each group of RNA using the TruSeq Stranded mRNA Library Prep Kit (Illumina, San Diego, CA). In practice, mRNA was purified with polyA using dT beads, ribosomal RNA was removed using Ribo-zero beads, and then an adapter sequence was added to ensure unidirectional sequencing. Subsequently, RNA-seq data was generated by sequencing an average of 15 million reads using a 75-bp single read using an Illumina HiSeq 2500. The quality of the resulting reads was then confirmed using FASTQC. Next, the mRNA was mapped to the NCBI reference genome, Rnor6, using Tophat (Kim et al., 2013). The sequences of each sample were assembled using Cufflinks (Baren et al., 2010), and the files created from Cufflinks were used to detect differentially expressed genes (FPRKs). Furthermore, enrichment analysis was performed using DAVID (Huang, Sherman, & Lempicki, 2009b) (Huang, Sherman, & Lempicki, 2009a) to evaluate the functions and interactions of the gene lists created and extracted by Cuffdiff.

[0122] The results showed that forced expression of LSMEM2 in cardiomyocytes increased the expression of inflammation-related genes (Figure 2).

[0123] Example 3 Quantification of mRNA by Droplet Digital PCR (ddPCR) Method ddPCR was performed using reagents and equipment from Bio-Rad (Bio-Rad Laboratories, Hercules, CA). Specifically, the prepared sample and droplet generator oil were mixed in a QX200 Droplet Generator to produce droplets. The produced droplets were subjected to PCR using a thermal cycler, and signals were detected using a QX200 Droplet Reader. The following probes were used to detect the expression of rat IL6 and rat Tbp, and the expression of human IL6 and human Tbp. Il6: dRnoCPE5187348 (FAM), Tbp: dRnoCNS494181347 (HEX) Human IL6: dHsaCPE5036918, Human TBP: dHsaCPE5058363

[0124]

[0125] The PCR conditions were as follows:

[0126]

[0127] Cultured cardiomyocytes were seeded on a plate, and after 24 hours, the medium was replaced with 1% FBS DMEM, 25 mM HEPES-NaOH, pH 7.4 (Sigma-Aldrich, St. Louis, MO), 2 mM l-glutamine (Thermo Fisher Scientific, Waltham, MA), 1% P / S. The cardiomyocytes were placed in a pressure vessel and incubated at 37°C and 5% CO. ２ The cells were exposed to hydrostatic pressure conditions of 101 to 135 kPa at a cycle of 0.01 Hz for 12 hours. The pressure was applied to the cells by compressing the volume of the medium.

[0128] Quantification of IL6 mRNA expression in cardiomyocytes loaded with hydrostatic pressure showed that IL6 expression was not induced (Fig. 3A; expressed as relative expression to Tbp mRNA).

[0129] Cardiomyocyte and HeLa cell stretch stimulation stress Plasma treatment was performed on a stretch chamber STB-CH-04 (STREX, Osaka, Japan) using a desktop vacuum plasma treatment device PC-400T (STREX, Osaka, Japan). After that, 1 mL of a laminin solution containing iMatrix-511 (Nippi, Tokyo, Japan) at 4.8 μg / mL was added and the cells were incubated overnight at 37°C. The laminin solution was removed, and the cultured cardiomyocytes were cultured at 1.3 × 10 ６ Cultured cardiomyocytes were seeded onto the stretch chamber. 24 hours after seeding, the medium was replaced with serum-free DMEM, and the cells were placed in an automatic stretching device STB-1400 (STREX, Osaka, Japan) and stretched at 0.5 Hz and 20% for 24 hours under conditions of 37°C and 5% carbon dioxide.

[0130] Quantitation of IL6 mRNA in cardiomyocytes exposed to stretch showed that IL6 expression was induced (Fig. 3B).

[0131] LSMEM2 knockdown in neonatal rat cardiomyocytes using siRNA Silence® rSelect siRNA (LSMEM2 siRNA ID: s189327, sense (5'→3'): GCACAGUGGAGGCUCACUATT (SEQ ID NO: 9) antisense (5'→3'): UAGUGAGCCUCCACUGUGCAG (SEQ ID NO: 10) (Thermo Fisher Scientific, Waltham, MA) was used for LSMEM2 knockdown. The final concentration was adjusted to 5 nM, and the resulting siRNA was then transfected with Lipofectamine. ＴＭ RNAiMAX Transfection Reagent (Thermo Fisher Scientific, Waltham, MA) was used to transfect neonatal rat cardiomyocytes 3 hours after seeding.

[0132] IL6 mRNA was quantified in rat cardiomyocytes transfected with control siRNA (siCtrl) and LSMEM2 knockdown siRNA (siAIPID) after stretch stimulation. IL6 expression was not induced by control siRNA, but was induced by LSMEM2 siRNA (expressed relative to Tbp mRNA; Figure 3C).

[0133] Example 4: Generation of Lsmem2 knockout mice. The generation of knockout mice was requested from the Reproductive Engineering Unit at the Animal Experimental Facility, Osaka University. Lsmem2 knockout mice were generated using the CRSPR / Cas9 system. Guide RNA was designed in exon 2 (Guide RNA sequence: ACTGGCTCCTAACCACGTGCAGG) (SEQ ID NO: 5) (Figure 4A). A vector incorporating the designed guide RNA was created in pX330 (Wyman et al., 2013), which is capable of simultaneously expressing Cas9 and the target guide RNA. This vector was then injected into fertilized mouse eggs, which were then transplanted into pseudopregnant mice. The resulting F0 mice were checked for in-dels in the LSMEM2 gene region by Sanger sequencing, and a mouse line with a 14-base deletion was established and maintained in a C57BL6J background. LSMEM2 was detected by standard Western blotting using mouse heart tissue, confirming that the LSMEM2 protein was absent in the knockout mice, i.e., that LSMEM2 knockout mice had been created (Figure 4B).

[0134] Preparation of Mouse Heart Tissue Frozen Sections Mouse hearts were excised, washed with PBS, embedded in O.C.T. Compound, and left to stand for 5 minutes. The hearts were then frozen in isopentane cooled with liquid nitrogen. The embedded hearts were then sliced ​​into 8 μm-thick samples using a cryostat (Leica, Wenzler, Germany), attached to slides, air-dried, and stored at −80°C.

[0135] Immunostaining using mouse tissue frozen sections: The prepared frozen sections were fixed in acetone at 4°C for 20 minutes, dried, and then washed with PBS. Subsequently, to block the tissue specimens, they were washed with PBS, and 5% goat serum / PBS was added and left to stand at room temperature for 30 minutes. To block endogenous IgG, anti-mouse IgG Fab fragment (0.1 mg / ml in PBS) was added and left to stand at room temperature for 1 hour. LSMEM2 monoclonal antibody diluted 2000-fold with 5% goat serum / PBS was added, placed in a humidified box, and left to stand at 4°C overnight. Subsequently, to perform the secondary antibody reaction, the specimens were washed with PBS, and then the secondary antibody was diluted 500-fold. Hoechst 33342 was added to stain the cell nuclei. The specimens were then left to stand at room temperature for 45 minutes and observed under a fluorescent microscope. As a result, it was confirmed that the protein was absent in LSMEM2 knockout mice (FIG. 4B).

[0136] Morphological observation of mouse heart tissue sections stained with hematoxylin and eosin revealed no obvious phenotype in LSMEM2 knockout mice (FIG. 4C).

[0137] Example 5: Mating experiment with laminopathic model mice LMNA H222P knock-in (KI) mice (Hum Mol Genet. 2005; 14(1):155) were used as laminopathic model mice. LMNA H222P KI mice were crossed with LSMEM2 KO mice to generate LMNA H222P KI / KI, LSMEM2- / - mice. LMNA H222P KI / KI, LSMEM2+ / + mice and LMNA H222P KI / KI, LSMEM2- / - mice were analyzed for survival time, cardiac function, and lower limb muscle strength. Cardiac function analysis was performed at 3, 6, and 9 months of age using a Vevo 3100 imaging system, and LVEF (left ventricular ejection fraction) was evaluated. The number of individuals used is as indicated in the figure. Lower limb muscle strength measurements were performed at 7 months of age. Lower limb muscle strength measurements were performed at 29 weeks of age using a 1300A 3-in-1 Whole Animal Muscle System (Aurora Scientific), and twitch force, tetanic force, and force-frequency of the gastrocnemius muscle were evaluated. Analysis was performed using DMA software (Aurora Scientific). Statistical comparisons between the two groups were performed using a t-test.

[0138] The results also showed that LSMEM2 KO mice improved the survival rate, cardiac function, cardiac inflammatory signaling, and skeletal muscle strength in a laminopathic model (LMNA H222P KI / KI) (Figure 5).

[0139] Example 6: Preparation of AAV Vectors MyoAAV2 vectors (Tabebordbar M. et al. Cell 2021) were prepared by cotransfecting HEK293T cells with a transfer plasmid, a Rep-cap plasmid, and a helper plasmid. Viral particles were concentrated and purified by cesium chloride density gradient ultracentrifugation. MyoAAV2 U6-shRNA (LSMEM2) was prepared to knockdown LSMEM2 specifically in skeletal muscle cells. shRNA was designed to target mouse LSMEM2, shLSMEM2 (5'-CTCTCACTGATGGCTTCATTT-3' (SEQ ID NO: 11)). As a control, shControl (5'-CCTAAGGTTAAGTCGCCCCTCG-3' (SEQ ID NO: 12)) was designed, which does not target the mouse gene.

[0140] AAV administration experiment MyoAAV2 U6-shRNA (LSMEM2) (hereinafter sometimes referred to as shLSMEM2) and MyoAAV2 shControl were administered at 7 × 10 １１ Genome copy (GC) was intravenously injected into the orbital plexus of 10-week-old LMNA KI mice, and cardiac function was evaluated.

[0141] As a result, the MyoAAV2 shControl group showed a time-dependent decline in cardiac function at 8, 16, and 24 weeks after administration, whereas the shLSMEM2 group suppressed this decline (Figure 6, Cardiac Function). Furthermore, in terms of skeletal muscle function at 24 weeks after administration, the shLSMEM2 group showed an improvement in twitch force (Figure 6, Skeletal Muscle Function at post 24 weeks). These results demonstrate that acquired suppression of LSMEM2 expression has a therapeutic effect in a laminopathic model.

[0142] Example 7 Mouse Aortic Arch Coarctation Model The aortic arches of wild-type and LSMEM2 knockout mice were ligated to create a model in which high pressure was applied to the left ventricle. This model is a common model of pressure-overload heart failure used in cardiovascular research. Cardiac tissue was examined one week after surgery, and cardiac function was assessed by echocardiography over time at one and four weeks after surgery.

[0143] Heart tissue was excised one week after surgery and immunostained using a CD45 antibody, a mouse leukocyte surface marker, as described in Figure 4 to examine inflammatory cell infiltration into the myocardial tissue. Significant intramyocardial inflammatory cell infiltration was observed in wild-type mice one week after surgery, whereas this was significantly suppressed in LSMEM2 knockout mice (Figure 7A). Furthermore, RNA-seq analysis was performed using heart tissue one week after surgery using the same method as in Figure 2. Consistent with the CD45 staining results, significant increases in the expression of inflammation-related genes were observed one week after surgery in wild-type mice, whereas these increases were significantly suppressed in LSMEM2 knockout mice (Figure 7B). Cardiac function was assessed by echocardiography at one and four weeks after surgery. While a time-dependent decline in cardiac function was observed in wild-type mice, this decline was suppressed in LSMEM2 knockout mice (Figure 7C).

[0144] According to the present invention, mechano-signaling inhibitors including substances that suppress the expression or function of LSMEM2 can be provided, enabling effective treatment of lamin cardiomyopathy, severe heart failure due to other causes, and laminopathies.

[0145] This application is based on patent application No. 2022-136279 filed in Japan (filing date: August 29, 2022), the contents of which are incorporated in their entirety herein.

Claims

1. A mechano-signaling inhibitor containing, as an active ingredient, a substance that suppresses the expression or function of LSMEM2.

2. The agent according to claim 1, wherein the substance that suppresses the expression of LSMEM2 is: (a) a nucleic acid or a precursor thereof having RNAi activity against a transcription product of the LSMEM2 gene; (b) an antisense nucleic acid against a transcription product of the LSMEM2 gene; (c) a ribozyme nucleic acid against a transcription product of the LSMEM2 gene; or (d) a nucleic acid sequence recognition module that specifically binds to a target nucleotide sequence in the LSMEM2 gene.

3. The agent according to claim 1, wherein the substance that inhibits the function of LSMEM2 is an antibody, degrader or aptamer against LSMEM2.

4. The agent according to any one of claims 1 to 3, wherein the substance is provided in the form of one or more expression vectors encoding it.

5. The agent according to claim 1, which is an anti-inflammatory agent.

6. The agent according to claim 1, which is an agent for preventing and / or treating heart disease.

7. The agent according to claim 6, wherein the heart disease is dilated cardiomyopathy.

8. A preventive and / or therapeutic agent for laminopathies, comprising as an active ingredient a substance that suppresses the expression or function of LSMEM2.

9. The agent according to claim 8, wherein the laminopathies are selected from muscular dystrophy, lamin cardiomyopathy, lipodystrophy, and leukodystrophy.

Images