Genome-edited plant production method and genome-edited plant
Patent Information
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Filing Date
- 2025-02-12
- Publication Date
- 2026-06-22
Abstract
Description
Method for producing genome-edited plants and genome-edited plants
[0001] The present invention relates to genome-edited plants in which mutations have been introduced into the genes of plants, mainly legumes, and methods for producing such plants.
[0002] Technologies have been developed that allow for the production of genome-edited plants that have been edited, such as by introducing mutations into the genetic genome of a plant, to obtain plants useful for research purposes, agriculture, etc. As a method for obtaining genome-edited plants, for example, a system using Cas9 has been developed. Furthermore, as a means for introducing an expression gene containing Cas9 into a plant, a method has been developed in which a plant is infected with a microorganism containing Agrobacterium to introduce a mutation. These methods typically involve tissue culture, followed by the regeneration of shoots and roots to obtain the plant's morphology and obtain the next generation of seeds.
[0003] Patent Document 1 discloses a method for modifying genomic material in a plant cell, the method comprising: (a) introducing into the cell a nucleic acid comprising crRNA and tracrRNA, or a chimeric cr / tracrRNA hybrid, wherein the crRNA and tracrRNA, or the cr / tracrRNA hybrid, target a sequence endogenous to the plant cell; and (b) introducing into the cell a Cas9 endonuclease molecule that induces a double-stranded break at or near the sequence targeted by the crRNA and tracrRNA, or at or near the sequence targeted by the cr / tracrRNA hybrid. The method also includes the step of delivering a T-DNA comprising the nucleic acid sequence, the delivery being mediated by Agrobacterium or Ensifera. This method also includes targeting plants such as wheat, corn, rice, Setaria, tomato, soybean, tobacco, potato, cassava, or Arabidopsis.This technology can use the CRISPR / Cas system to generate targeted DSBs or single-strand breaks, and can be used for, but not limited to, targeted mutagenesis, gene targeting, gene replacement, targeted deletion, targeted inversion, targeted translocation, targeted insertion, and multiple genome modifications via multiple DSBs in single cells induced by the co-expression of multiple target RNAs.This technology aims to accelerate the speed of functional gene testing in plants and provide a method for engineering plants with improved properties, including high nutritional value, high resistance to diseases and stress, and increased production of commercially useful compounds.
[0004] Meanwhile, research has also been conducted into methods for introducing mutations into plants, such as cutting a plant and inducing new shoots from the cut surface. For example, one method involves administering a cell division promoting factor or the plant hormone cytokinin to the cut surface while leaving only one leaf. This has mainly been performed on tobacco, where research on transformation is being conducted. Non-Patent Document 1 describes the production of genome-edited tobacco and tomatoes using a method for inducing new shoots. This method uses transformed tobacco or transformed tomatoes with Cas9 integrated into the genome, transiently expressing a gRNA that serves as a target for Cas9 and a cell division promoting factor for bud development.
[0005] JP 2016-512048 A
[0006] Maher et al. 2020, Nat. Biotechnol 38, 84-89.
[0007] Conventional genome editing methods require transformation to introduce mutations into tissues, followed by tissue culture and subsequent regeneration of plants using the tissues. This process is difficult and time-consuming, and it is particularly difficult to produce genome-edited individuals in plant species for which tissue culture protocols are not yet established.
[0008] For example, techniques for introducing new shoots into plants of the Solanaceae family, such as tobacco and tomato, have been developed, and Patent Document 1 also discloses the use of cereals and other Solanaceae plants. Research into transformation has been particularly advanced in the Solanaceae family, with many examples of research being conducted on tobacco, as well as on tomatoes and potatoes. However, there are insufficient protocols for other plant species, such as legumes. Among legumes, soybeans have a particularly wide range of industrial applications, including as food ingredients, but have been considered particularly difficult to transform. While there have been examples of transformation in specific uncultivated soybean varieties, it has generally been thought that many cultivated soybean varieties used in industry cannot be transformed.
[0009] On the other hand, Non-Patent Document 1 describes the creation of genome-edited tobacco and other plants using a method for inducing new buds. Inducing new buds can shorten the time required for tissue culture. However, the plants used here are transformed tobacco or tomato plants in which Cas9 has already been integrated into the genome. This method can only be used for tobacco or tomato, for which transformation protocols have already been developed, and cannot be applied to plants for which transformation methods have not been established.
[0010] The present invention has been made in consideration of the above-mentioned circumstances, and aims to provide a method for producing genome-edited plants that can be applied to plants, including legumes, which are difficult to transform, without undergoing the transformation and time-consuming tissue culture processes, and a genome-edited plant obtained thereby.
[0011] In order to solve the above problems, the present invention has the following aspects: A first aspect of the present invention is a method for producing a genome-edited plant, comprising making an incision in a part of a plant capable of growing autonomously, injecting a solution containing Agrobacterium for genome editing into the incision to introduce a mutation into the plant without leaving any foreign genes in the plant, and collecting seeds from the plant into which the mutation has been introduced without going through a regeneration step to obtain a genome-edited plant.
[0012] A second aspect of the present invention is the method for producing a genome-edited plant according to aspect 1, wherein the plant is a legume.
[0013] A third aspect of the present invention is the method for producing a genome-edited plant according to Aspect 2, wherein the legume is soybean.
[0014] A fourth aspect of the present invention is the method for producing a genome-edited plant according to any one of aspects 1 to 3, wherein the Agrobacterium for genome editing has Cas9 and gRNA.
[0015] A fifth aspect of the present invention is the method for producing a genome-edited plant according to Aspect 4, wherein the Agrobacterium for genome editing comprises a promoter and a terminator region in a T-DNA region so as to express the Cas9 and gRNA.
[0016] A sixth aspect of the present invention is the method for producing a genome-edited plant according to any one of aspects 1 to 5, wherein the Agrobacterium for genome editing further contains a cell division promoting factor.
[0017] A seventh aspect of the present invention is the method for producing a genome-edited plant according to any one of aspects 1 to 6, wherein the legume plant is 18 to 24 days old when the incision is made in the part of the legume plant.
[0018] An eighth aspect of the present invention is a genome-edited plant obtained by the method for producing a genome-edited plant according to any one of aspects 1 to 7.
[0019] According to the present invention, a method for producing a genome-edited plant that can be applied to plants, including those of the Leguminosae family, which are difficult to transform, without undergoing the transformation and time-consuming tissue culture processes, and a genome-edited plant obtained thereby are provided.
[0020]
[0023] Figure 1 is a schematic diagram showing the structure of a vector introduced into Agrobacterium for genome editing in this example. Figure 2 is a schematic diagram showing the structure of a vector for expressing the mitogenic factor ipt gene in this example. Figure 3 is a schematic diagram of a method for producing a genome-edited plant in this example. Figure 4 is a photograph of fluorescent staining of GFP expression in this example. Figure 5 is a schematic diagram showing the positions of primers for confirming the vector in this example. Figure 6 is a diagram showing a portion of the genome sequence near the target in genome-edited plant samples (16-1-1, 16-2-7, 29-1-1-15) in this example. Figure 7 is another diagram showing the genome sequence near the target in genome-edited plant samples (16-1-1, 16-2-7, 29-1-1-15) in this example. Figure 8 is a photograph of a leaf of a genome-edited plant in this example. Figure 9 is a graph of quantitative data regarding leaf area in genome-edited plants in this example. Figure 10 is a graph of quantitative data regarding leaf weight in genome-edited plants in this example. Figure 11 is a graph of quantitative data regarding GmPPD in genome-edited plants in this example. １FIG. 1 is a graph of quantitative data regarding the expression level of a gene. FIG. 2 is a photograph showing the genome-edited plant of this example after confirmation that it does not contain a foreign gene. FIG. 3 is another photograph showing the genome-edited plant of this example after confirmation that it does not contain a foreign gene. FIG. 4 is a further photograph showing the genome-edited plant of this example after confirmation that it does not contain a foreign gene.
[0021] Hereinafter, the method for producing a genome-edited plant according to the present invention and the genome-edited plant obtained thereby will be described with reference to embodiments, although the present invention is not limited to the following embodiments.
[0022] (Method for producing genome-edited plants) In this embodiment, genome-edited plants broadly refer to plants whose genomes have been edited, particularly plants into which mutations have been introduced into genomic genes.
[0023] The plant in this embodiment is not particularly limited, and is preferably a plant that can be used in the mode of leaving the leaves when making a partial incision, as described below, with legumes being more preferred. Legumes such as soybeans and common beans can be used, with soybeans being particularly preferred. Since genome editing can be applied in this embodiment without undergoing transformation and the time-consuming tissue culture process, it can be applied to plants for which transformation methods have not been established or for which transformation is difficult. Legumes, particularly soybeans, are known as plants for which transformation methods have not been established or for which transformation is difficult, with the exception of a very few varieties. In this embodiment, by selecting legumes, particularly soybeans, genome-edited plants can be obtained from these plants.
[0024] In the method for producing a genome-edited plant of this embodiment, an incision is made in a part of a plant, a solution containing Agrobacterium for genome editing is injected into the incision to introduce a mutation into the plant, seeds are collected from the plant into which the mutation has been introduced, and a genome-edited plant is obtained. Each step is described in detail below.
[0025] First, an incision is made in a part of a plant capable of growing autonomously. The autonomously growing plant is a plant that will be used as the source of editing for the genome-edited plant of this embodiment, and it is intended to use a growing or growable plant rather than an excised plant body. The incision is intended to be used as a site for infection with Agrobacterium for genome editing, which will be described later. This incision is also used as a site for forming buds through infection. The incision may be made by any means or form as long as it can be used for these purposes; however, for example, in the case of legumes, it is preferable to cut a part of the stem. Furthermore, as will be described later, it is preferable to cut seedlings that have grown to have a certain number of true leaves, leaving one true leaf.
[0026] Furthermore, when making a cut in a part of the legume, it is preferable to perform the cut on the legume that has been grown as a seedling and is 18 to 24 days old. In the case of soybean, it is more preferable to perform the cut on a plant that is 21 days old (about 3 weeks old).
[0027] Next, a solution containing genome-editing Agrobacterium is injected into the incision to introduce a mutation into the plant without leaving any foreign genes behind. In this embodiment, genome editing is performed by directly introducing a genome editing enzyme or a cell division promoter into the plant, so no foreign genes are introduced and the plant can be used for the production of food or food ingredients. The genome-editing Agrobacterium and the solution containing it are prepared before making the incision.
[0028] Agrobacterium is a bacterium of the genus Rhizobium that infects plants. It contains a Ti plasmid containing T-DNA, and can insert the T-DNA into the plant genome by homologous recombination, making it suitable for use in plant genome editing. In this embodiment, the Agrobacterium and the method using it can be selected as appropriate. When using the Agrobacterium method, constructs that can be used include, for example, the Ti plasmid of Agrobacterium tumefaciens, the Ri plasmid of Agrobacterium rhizogenes, and vectors derived therefrom (e.g., binary vectors).
[0029] It is preferable to use Agrobacterium for genome editing that has Cas9 and gRNA. Having Cas9 and gRNA means that when infected (introduced) into the plant, Cas9 and gRNA are preferably in an expressible state. Having Cas9 and gRNA in an expressible state means that they are preferably present as part of the T-DNA within the Ti plasmid of Agrobacterium.
[0030] Furthermore, the genome editing Agrobacterium preferably includes a promoter and terminator region in the T-DNA region so that the Cas9 and gRNA can be expressed. Conventionally known promoter and terminator region genes can be used as appropriate. Specifically, the promoter can be incorporated into the T-DNA upstream of Cas9 or gRNA, and the terminator region downstream. Conventionally known promoters and terminators can be used, such as CaMV 35S, HSP, and NOS. In this embodiment, a cauliflower mosaic virus (CaMV) 35S promoter is located upstream of Cas9, and a heat shock protein (HSP) terminator is located downstream.
[0031] Preferably, the Agrobacterium for genome editing further contains a cell division promoting factor. The Agrobacterium contains a cell division promoting factor, i.e., the plant expresses the cell division promoting factor, which can promote the formation of new shoots at the cut surface. Therefore, after infection of a plant with the Agrobacterium, shoots with edited genomes are preferably formed.
[0032] Examples of the cell division promoting factor that can be used include the ipt gene and the wus gene. The cell division promoting factor may be introduced into Agrobacterium separately from the Cas9 or gRNA. For example, the cell division promoting factor may be introduced into a plasmid or T-DNA separate from the Ti plasmid or T-DNA expressing the Cas9 and gRNA, and then introduced into Agrobacterium.
[0033] Furthermore, when the Agrobacterium for genome editing contains a promoter and terminator region in the T-DNA region so that the Cas9 or gRNA can be expressed, it is preferable that the Agrobacterium also contains a promoter and terminator region so that the cell division promoting factor can be expressed together.
[0034] Alternatively, instead of or in combination with the expression of the cell division promoting factor, the plant hormone cytokinin may be introduced to the cut surface, which can promote the formation of new shoots at the cut surface, similar to the case where the cell division promoting factor is expressed.
[0035] Next, seeds are collected from the plant into which the mutation has been introduced without going through a regeneration process to obtain a genome-edited plant. The regeneration process refers to a process in which differentiated tissue is recultured to return it to its pre-differentiation state and differentiate into the desired tissue. The regeneration process may include, for example, callus formation (pre-differentiation cell mass formation) through tissue culture, shoot regeneration, root regeneration, acclimatization (potting), and obtaining next-generation seeds. In this embodiment, seeds can be collected from the plant into which the mutation has been introduced, and a genome-edited plant can be obtained without going through a regeneration process. The steps from the plant into which the mutation has been introduced to seed collection can be performed as appropriate, but it is preferable to first confirm whether the mutation has been introduced by examining the buds that have appeared at the cut end of the plant into which the mutation has been introduced. That is, new buds will appear at the cut end of the plant when the plant is cut, leaving one true leaf intact. The co-expression of the cell division-promoting factor or the introduction of a plant hormone promotes the generation of new buds.
[0036] Whether or not a mutation has been introduced into the new shoots can be confirmed by any method that can confirm the mutation, but it is preferable to confirm this genetically, for example, by extracting DNA from a portion of the new shoots and determining the sequence.
[0037] Seeds can be collected from a plant into which a mutation has been introduced by growing the plant and harvesting the seeds produced from the buds into which the mutation has been introduced. When the plant is a soybean, it is preferable to collect the seeds at least three months after the mutation has been introduced.
[0038] The collected seeds are grown as plants, i.e., the next generation plants of the plants into which the mutations have been introduced, become genome-edited plants.
[0039] Genome-edited plants may be further examined for the nature of the introduced mutation. For example, DNA may be extracted from the genome-edited plant and sequenced to confirm that the genome has been edited. RNA may also be extracted from the genome-edited plant to confirm the expression level of each protein.
[0040] (Genome-edited plant) The genome-edited plant of this embodiment is a genome-edited plant obtained by the method for producing a genome-edited plant. The genome-edited plant can be selected from the various plants described above.
[0041] The genome-edited plants of this embodiment are plants in which mutations have been introduced by genome editing, even in plant species or varieties for which genome editing has been difficult or required a long time in the past. According to this embodiment, such plants can be easily obtained.
[0042] (Another aspect of this embodiment) This embodiment also includes the following aspects as other aspects. Another aspect of this embodiment is use of the method for producing a genome-edited plant of this embodiment for testing genome editing. Another aspect of this embodiment is use of the genome-edited plant of this embodiment for testing genome editing. Another aspect of this embodiment is use of the genome-edited plant of this embodiment for producing food or food ingredients.
[0043] (Effects of this embodiment) According to this embodiment, a method for producing a genome-edited plant that can be applied to plants, including those of the Leguminosae family, which are difficult to transform, without undergoing the transformation and time-consuming tissue culture processes, and a genome-edited plant obtained thereby are provided.
[0044] In this embodiment, the in planta genome editing method involves growing soybeans, cutting the top so that one true leaf remains, and infecting the cut surface with Agrobacterium harboring Cas9 and gRNA. The Agrobacterium-mediated T-DNA delivery mechanism delivers the T-DNA into the nucleus of the plant cell. A promoter and terminator are introduced into the T-DNA region to enable expression of Cas9 and gRNA. In conventional transformation, the T-DNA region delivered into the nucleus must be inserted into the plant genome; however, in this embodiment, Cas9 and gRNA are expressed in the nucleus, so insertion into the plant genome is not necessary. Genome editing is performed within the genome by Cas9 and gRNA expressed in the nucleus.
[0045] In this embodiment, simultaneous expression of a cell division promoter such as the ipt gene activates cell division at the cut surface, promoting the formation of new shoots. Next, new shoots with mutations introduced by genome editing are selected, grown, and seeds are obtained, and the mutations are fixed in the next generation.
[0046] Conventional techniques for producing genome-edited plants require transformation and regeneration of the plant through tissue culture. These methods make it difficult to produce genome-edited plants for plants for which tissue culture protocols are not yet established. Furthermore, the process of callus formation through tissue culture, shoot regeneration, root regeneration, acclimatization (potting), and subsequent seed production takes anywhere from six months to a year or more.
[0047] In the method for producing genome-edited plants of this embodiment, new shoots are induced from the cut surface of the plant and mutations are introduced into the shoots. Therefore, the shoots can be grown as is, and genome-edited soybeans can be obtained without tissue culture. Therefore, the operator does not need experience in tissue culture, and sterilization conditions are not required, making the process easy. Furthermore, tissue culture typically takes six months to a year, but this period can be significantly shortened.
[0048] As mentioned above, techniques for introducing new shoots into Solanaceae species such as tobacco and tomato have been developed in the past, but protocols for the Leguminosae family have not been fully established, and soybeans have been considered difficult to transform. In this embodiment, to overcome this bottleneck, genome-edited individuals can be obtained by transiently expressing a genome-editing enzyme and a cell division promoter directly in the plant body. This provides a method that does not require cell culture or transformation.
[0049] The present invention is believed to enable genome editing of plant species that are considered difficult to transform, particularly legumes, and more particularly various varieties of soybean within the legume family. Until now, transformation has only been possible in certain soybean varieties, but research into transformation has not necessarily progressed for varieties commonly used industrially. This embodiment is applicable to varieties that are difficult to transform or for which no established transformation protocols have been established, and therefore has a high potential for application to a variety of varieties.
[0050] This embodiment can be applied to various varieties of soybean, for example. Soybeans are very important plants in agriculture and other industries and are widely cultivated worldwide. They have particularly attracted attention as an alternative protein source to meat and are used as raw materials for meat substitutes. If a method for easily editing genomes in such industrially important plants is established, it is expected that it will be widely used in the agriculture and industry related to grains.
[0051] This embodiment can also be applied to other plants. Basically, plants often produce new shoots when one leaf is left on the cut surface and a cell division promoting factor or plant hormone is applied to the cut surface. The method of this embodiment is highly likely to be applicable to such plants, and therefore may be applicable to various plant species and varieties.
[0052] Examples are shown below, but the present invention is not limited to these examples.
[0053] (Test Example) (Production of Genome-Edited Plants) In this embodiment, the GmPPD gene was used as the gRNA to verify the effect. It has been known that reduced expression of the PPD gene in soybeans leads to larger leaves. This effect has traditionally been verified by reducing expression through RNAi, but in this study, Cas9 and GmPPD were expressed in genome-editing Agrobacterium, and genome-edited plants were produced to verify the effect.
[0054] As the GmPPD gene, two PPD gene homologs in soybean genes, Glyma. 10G244400 (GmPPD1) and Glyma. 20G150000 (GmPPD2), were selected. The gRNA sequences of the two PPDs were designed using CRISPR RGEN Tools Cas Designer. It was confirmed using CRISPR RGEN Tools Cas-OFFinder that this sequence does not cause other mutations.
[0055] Figures 1A and 1B show the vectors introduced into Agrobacterium for genome editing. Figure 1A shows an outline of pPcUfcoCas9-GmPPD. Figure 1B shows an outline of PTKB3-IPT, a vector that expresses the mitogenic factor ipt gene.
[0056] pTKB3-eGFP was used as a GFP expression vector for infection confirmation. This vector was constructed according to the description in Nosaki et al. 2021, Plant Biotechnol 38, 297-304. A stable expression for Cas9-GmPPD vector was designed to express Cas9 and GmPPD-gRNA (pPcUfcoCas9-GmPPD, Figure 1A). This vector contains the target GmPPD1 and GmPPD2 sequences and contains the CaMV 35S promoter (35sCaMV3'UTR in the figure) and terminator (T35S in the figure) upstream and downstream of Cas9. PTKB3-IPT was designed as a vector to express the mitogen ipt. A Nos promoter (Nos-p in the figure) was placed upstream of ipt (ITP in the figure), and a heat shock protein terminator and an extensin terminator (HSPter and Ext3' in the figure) were placed downstream.
[0057] These vectors were introduced into Agrobacterium A. tumefaciens strain GV2260 by electroporation. To increase the introduction rate, the pBBRacdSgabT vector (Nonaka et al., 2019) was simultaneously introduced. The Agrobacterium was cultured in 5 mL of LB selection medium (50 mg / L kanamycin, 30 mg / L gentamicin, 30 mg / L rifampicin) at 28°C for 2 days, and 1 mL of the medium was cultured in 200 mL of the same medium at 28°C overnight. The mixture was centrifuged at 4,500 rpm for 15 minutes, and the precipitate was suspended in infiltration buffer (10 mM MgCl, 10 mM MES (pH 5.6), 200 μM acetosyringone, 0.05% transformation reagent Silwet-77, 800 mg / L L-cysteine, 1 mM dithiothreitol, and 1 mM sodium thiosulfate). The concentration of the suspension was adjusted to an OD of 0.2.
[0058] Figure 2 shows a photographic outline of the procedure performed. As shown in (a), the top of a 21-day-old soybean stem was removed and cut, leaving only one true leaf, to create an incision. As shown in (b), the Agrobacterium suspension described above was injected into this incision using a 31G syringe needle (0.25 mm x 12 mm). The soybeans were then grown at 26°C, alternating between approximately 16 hours in light and 8 hours in darkness. As shown in (c), 10 days after injection, a new bud formed at the incision (the area indicated by the white circle in the figure).
[0059] The cut sections were first examined to determine whether GFP mutations had been introduced by Agrobacterium infection. Images of the infected soybeans were observed under a 5 cm scanning transmission electron microscope (STEM) using a parallel-type fluorescence microscope (MZ FL III; Leica Microsystems). Figure 3 shows photographs of fluorescent staining of GFP expression. PTKB3 represents the control, and PTKB3.EGFP represents the Agrobacterium-infected plant. The upper and lower panels show bright-field and fluorescence microscope observations, respectively. The observation conditions were as follows: a fluorescence microscope (Leica Microsystems, MZ FL III) was used; observations were performed 3 days after cutting and injection. GFP expression was observed in the PTKB3.EGFP, indicating that GFP had been transmitted to the plant via the introduction of the pTKB3-eGFP vector.
[0060] Next, a portion of the new bud shown in the figure was collected, DNA extracted, and sequenced. Leaves growing from the bud shown in the figure were collected, suspended in 100 μL of buffer A (100 mM Tris, pH 9.5, 1 M KCl, 10 mM EDTA), and manually crushed with a pestle and mortar. The mixture was centrifuged at 15,000 rpm for 5 minutes, and the supernatant was collected. The DNA contained in the supernatant was amplified by PCR using the KOD FX Neo (Toyobo) enzyme. The GmPPD1 and GmPPD2 genes were amplified using the same primers used for amplification when producing the vector. The amplified DNA fragments were adenine-added using Go Taq DNA polymerase enzyme (Promega). Positive clones were treated with AmpliTaq Gold 360 Master Mix kit (manufactured by ThermFisher Scientific), and PCR products were treated with illustra ExoProStar (GE Healthcare) enzymes to obtain sequence sequences. The introduction of mutations (GFP and GmPPD) into new shoots was confirmed.
[0061] The soybean plants that were confirmed to have undergone mutation were grown and seeds were harvested after three months. The harvested seeds were then grown to obtain next-generation plants. DNA was extracted from the resulting next-generation plants and sequenced to confirm genome editing. RNA was also extracted and analyzed for protein expression levels.
[0062] (Verification of mutation introduction in genome-edited plants) 132 soybean plants were incised and infected with Agrobacterium. 96 of the soybeans (72.2%) sprouted from the incision. 67 soybeans (69%) were able to produce seeds from the sprouts.
[0063] DNA sequencing was performed on the buds to determine whether mutations were introduced by the Cas9 gene. 56 bud samples were investigated, and 16 samples (37%) had gRNA target mutations. 38% had mutations introduced into 10 bases, and 25% had no mutations.
[0064] To confirm that the vector had not been integrated, PCR primers were designed for the sequence on the pPcUfcoCas9-GmPPD vector. If these primers did not amplify, the vector had not been integrated. Figure 4 shows the positions of the primers. The areas surrounded by arrows (on the outermost and innermost circles) are the sequences amplified by the primers.
[0065] Of the next-generation plants grown from the buds, mutations were confirmed in the target and its surrounding area for three samples. Figure 5A shows a portion of the genome sequence near the target for the resulting genome-edited plant samples (16-1-1, 16-2-7, 29-1-1-15). Figure 5B shows the sequences near the target for the resulting genome-edited plant samples (16-1-1, 16-2-7, 29-1-1-15), along with the sequences and mutation types for both the target genes GmPPD1 and GmPPD2.
[0066] The effect of introducing the GmPPD gene, i.e., the reduction in PPD expression, was confirmed by observing leaf size. Figure 6 shows photographs of genome-edited plant leaves. Compared to WT (non-mutation-introduced) plants, the genome-edited plants (16-1-1, 16-2-7, 29-1-1-15) had larger leaves, indicating the possibility of an effect due to the reduction in PPD gene expression.
[0067] Figure 7 shows a graph of quantitative data regarding the leaf area of genome-edited plants. Leaf area was measured by analyzing images of leaves taken with a camera using ImageJ Image analysis software. A Tukey test (P≦0.05) revealed that the leaf area of each genome-edited plant was, on average, 1.5 times larger than that of the WT.
[0068] Figure 8 shows a graph of quantitative data regarding leaf weight of genome-edited plants. Leaf weight was measured by collecting the same leaf from each sample plant and weighing it immediately afterwards. Tukey's test (P≦0.05) revealed that the leaf weight of each genome-edited plant was significantly greater than that of the WT.
[0069] (Verification of PPD expression level in genome-edited plants) Figure 9 shows the GmPPD expression level in genome-edited plants. １ A graph of quantitative data on the expression level of GMPPD is shown. １ is known to be related to leaf size. Expression levels were measured using qRT-PCR. WT (non-mutated) plants and genome-edited plants were treated with Trizol Reagent (Thermo Fisher Scientific, Waltham, MA), and the extracted RNA was reverse transcribed using a high-throughput cDNA reverse transcription kit (Thermo Fisher Scientific, Waltham, MA). RT-PCR was performed using the THUNDERBIRD SYBR qPCR Mix kit (Toyobo) on a 7900HT real-time PCR system (Applied Biosystems / Thermo Fisher Scientific, Waltham, MA). The expression level of soybean β-actin was used as a control. Relative expression levels were measured using the ΔΔCT method (Livak and Schmittgen). According to the Tukey test (P ≦ 0.05), the GmPPD expression levels of each genome-edited plant were significantly higher than those of the control plants. １ It was revealed that the expression levels of all of these genes were significantly lower than those of the WT gene.
[0070] (Verification of foreign genes in genome-edited plants) Next, the genome-edited plants were confirmed to contain no foreign genes. PCR was performed using each primer of a part of the vector, and it was confirmed that no bands were present (no other genes were inserted). DNA amplification by PCR was performed under the same conditions as for the sequencing described above, except for the primers.
[0071] The primers used in the PCR of each figure and their sizes (total length of the amplified portion) are shown below. Figure 10(a): ttccatgccgcctcctttagctggcgtaatagcgaagagg Size: 2379pb (SEQ ID NO: 1) Figure 10(b): ttcaggctgcgcaactgttggtgtccttggagagctggag Size: 3500pb (SEQ ID NO: 2) Figure 11(a): tcagatcccctcttccttcagtgtccttggagagctggag Size: 1650pb (SEQ ID NO: 3) Figure 11(b): gaagctcaagtccgtcaaggctcgatgttgtggcggatct Size: 1273pb (SEQ ID NO: 4) Figure 11(c): gtactccatcggcctcgataagcttctcgttctggagctg Size: 2420pb (SEQ ID NO: 5) Figure 11(d): agatccgccacaacatcgagatcagagcagccgattgtct Size: 2030pb (SEQ ID NO: 6) Figure 12(a): agacaatcggctgctctgatactcttccgagcaaaggacg Size: 3050pb (SEQ ID NO: 7) Figure 12(b): cgtcctttgctcggaagagtgcttcctcgctcactgactc Size: 1362pb (SEQ ID NO: 8) Figure 12(c): gagtcagtgagcgaggaagcgattggatgtaccgcgagat Size: 1109pb (SEQ ID NO: 9) Figure 12(d): ccactgcgttcgtagatcgtgagctgcccattcttgagtc Size: 1592pb (SEQ ID NO: 10)
[0072] In all cases, there was no band at the corresponding size other than the positive control, and it was revealed that the genome-edited plants (16-1-1, 16-2-7, 29-1-1-15) did not contain a foreign gene. In other words, it was revealed that the method for producing genome-edited plants of this embodiment can produce genome-edited plants in which a mutation in the target gRNA site has been introduced into a legume that can grow autonomously.
[0073] Although several embodiments of the present invention have been described above, these embodiments are presented as examples and are not intended to limit the scope of the invention. These embodiments can be implemented in various other forms, and various omissions, substitutions, and modifications can be made without departing from the spirit of the invention. These embodiments and their modifications are included within the scope and spirit of the invention, as well as within the scope of the invention and its equivalents as defined in the claims.
[0074] According to the present invention, a method for producing a genome-edited plant that can be applied to plants, including those of the Leguminosae family, which are difficult to transform, without undergoing the transformation and time-consuming tissue culture processes, and a genome-edited plant obtained thereby are provided.
Claims
1. A cut is made in a part of the plant, and a solution containing Agrobacterium for genome editing is injected into the cut to introduce a mutation into the plant. A bud is formed from the cut surface into which the mutation was introduced. A method for producing a genome-edited plant, comprising growing the plant into which the mutation has been introduced, collecting seeds from the buds into which the mutation has been introduced, and obtaining a genome-edited plant.
2. The method for producing a genome-edited plant according to claim 1, wherein the plant is a legume.
3. The method for producing a genome-edited plant according to claim 2, wherein the leguminous plant is soybean.
4. The method for producing a genome-edited plant according to claim 1 or 2, wherein the Agrobacterium for genome editing is one having Cas9 and gRNA.
5. The method for producing a genome-edited plant according to claim 4, wherein the Agrobacterium for genome editing includes a promoter and a terminator region in the T-DNA region that can express the Cas9 and gRNA.
6. The method for producing a genome-edited plant according to claim 1 or 2, wherein the Agrobacterium for genome editing further comprises a cell division promoting factor.
7. The method for producing genome-edited plants according to claim 2, wherein the cut surface is made on a part of the leguminous plant when the leguminous plant is 18 to 24 days old.
8. A genome-edited plant obtained by the method for producing a genome-edited plant according to claim 1 or 2.