Antitumor agent, screening method for antitumor agent, and prognosis test drug

Abstract

An antitumor agent according to the present disclosure contains, as an active ingredient, at least one component selected from the group consisting of ribozyme nucleic acids, antisense nucleic acids, RNAi-inducing nucleic acids, dominant negative variants, and aptamers, and vectors that express the same.

Description

Antitumor agent, method for screening antitumor agent, and prognostic test agent

[0001] The present invention relates to anti-tumor agents, methods for screening anti-tumor agents, and prognostic agents for subjects suffering from cancer.

[0002] Cancer is the leading cause of death among Japanese people, and the main treatment options for cancer are surgical removal of the primary tumor or elimination of residual tumor cells with drugs or radiation. However, these treatments are extremely difficult to apply when tumor cells are not localized but infiltrate widely beyond the resectable area. Currently, there is a lack of development of drugs that inhibit cancer cell invasion or metastasis. For example, there have been attempts to develop drugs that inhibit cancer cell invasion or metastasis by targeting integrins (e.g., cilengitide), but these have not yet been put to practical use.

[0003] The present inventors have previously reported that Shootin1a is involved in the formation or elongation of nerve axons (Patent Document 1, Non-Patent Documents 1 to 5).

[0004] Japanese Patent Publication No. 2006-50980

[0005] M. Toriyama et al., The Journal of Cell Biology, Vol. 175, No. 1, October 9, 2006 147-157Y. Kubo et al., The Journal of Cell Biology, Vol. 210, No. 4, 663-676Y. Higashiguchi et al., Cell Tissue Research, 366(1), 75-87, 2016K. Abe et al., Proc Natl Acad Sci USA, Vol. 115, No. 11, 2764-2769, 2018K. Baba et al., eLife, 7, e34593, 2018

[0006] Rapid cancer cell invasion promotes the progression of cancer. However, if high expression of molecules that cause cancer invasion, metastasis, and / or proliferation is confirmed through biopsy or surgery, administering inhibitors of these molecules may be able to suppress further invasion of residual tumor cells, thereby potentially improving patient survival and prognosis.

[0007] An object of one aspect of the present invention is to provide a novel antitumor agent capable of suppressing cancer invasion, metastasis and / or proliferation.

[0008] The present inventors have conducted extensive research to achieve the above-mentioned objectives. As a result, they have found that Shootin1b, a splicing variant of Shootin1a, is expressed in various cancer cells. They have also found that knocking down the expression of Shootin1b in cancer cells or suppressing the function of Shootin1b with a dominant-negative mutant inhibits the invasion or proliferation of cancer cells into organoid tissue. Furthermore, they have found that patients with high Shootin1b expression have a worse prognosis than patients with low Shootin1b expression, which led to the present invention.

[0009] An antitumor agent according to one embodiment of the present invention is an antitumor agent comprising, as an active ingredient, at least one component selected from the group consisting of ribozyme nucleic acids, antisense nucleic acids, RNAi-inducing nucleic acids against Shootin1b, and vectors that express these, as well as dominant-negative mutants of Shootin1b and vectors that express the dominant-negative mutants.

[0010] Furthermore, one embodiment of the present invention is a method for screening for antitumor agents, comprising: a contacting step of bringing Shootin1b into contact with a test substance; a measuring step of measuring the activity of Shootin1b after contact with the test substance; and a selection step of selecting the test substance as a candidate active ingredient of an antitumor agent when the activity of Shootin1b after contact with the test substance is reduced compared to the activity of Shootin1b before contact with the test substance.

[0011] Furthermore, a prognostic test agent according to one embodiment of the present invention is a prognostic test agent for a subject suffering from cancer, which comprises a reagent for detecting Shootin1b.

[0012] According to one aspect of the present invention, a novel antitumor agent can be provided.

[0013] FIG. 1 shows the results of Evaluation Example 1. FIG. 2 is a schematic diagram showing the mechanism by which Shootin1b generates a propulsive force for cell migration. FIG. 3 shows the results of Evaluation Example 2. FIG. 4 shows the results of Evaluation Example 2. FIG. 5 shows the results of Evaluation Example 3. FIG. 6 shows the results of Evaluation Example 4. FIG. 7 shows the results of Evaluation Example 5. FIG. 8 shows the results of Evaluation Example 6. FIG. 9 is a schematic diagram of the glioma infiltration assay used in Evaluation Example 7. FIG. 10 shows the results of Evaluation Example 10. FIG. 11 shows the results of Evaluation Example 11. FIG. 12 shows the results of Evaluation Example 13. FIG. 14 shows the results of Evaluation Example 14. FIG. 15 shows the results of Evaluation Example 16. FIG. 16 shows the results of Evaluation Example 16.

[0014] [Definition of Terms, etc.] In this specification, "polynucleotide" can be alternatively referred to as "nucleic acid" or "nucleic acid molecule," and refers to a polymer of nucleotides. Furthermore, "base sequence" can be alternatively referred to as "nucleic acid sequence" or "nucleotide sequence," and unless otherwise specified, polynucleotides can exist in the form of RNA or DNA. An example of the RNA form is mRNA. An example of the DNA form is cDNA or genomic DNA. DNA may be double-stranded or single-stranded.

[0015] As used herein, the term "protein" can also be referred to as "polypeptide."

[0016] The protein described herein may be a polypeptide formed by peptide bonds between amino acids, but is not limited thereto, and may also include structures other than polypeptides. Examples of structures other than polypeptides referred to here include, but are not limited to, sugar chains and isoprenoid groups.

[0017] In this specification, "A and / or B" is a concept that includes both A and B and A or B, and can be rephrased as "at least one of A and B." Furthermore, in this specification, the symbol "to" means a range that includes both the numerical values ​​at both ends.

[0018] [Anti-tumor agent] An anti-tumor agent according to one embodiment of the present invention comprises, as an active ingredient, at least one component selected from the group consisting of ribozyme nucleic acids, antisense nucleic acids, RNAi-inducing nucleic acids, dominant-negative mutants and aptamers against Shootin1b, and vectors expressing these.

[0019] (Shootin1b) The Shootin1b protein is composed of 631 amino acids and contains three coiled-coil regions and one protein-rich region. An example of the amino acid sequence that constitutes the Shootin1b protein is the amino acid sequence of human Shootin1b shown in SEQ ID NO: 1 (NCBI Reference Sequence NP_001120683.1). An example of the nucleotide sequence of the Shootin1b gene that encodes the human Shootin1b protein is the nucleotide sequence shown in SEQ ID NO: 2.

[0020] Shootin1b proteins include Shootin1b protein variants that have anti-tumor activity. Examples of Shootin1b protein variants include proteins consisting of the amino acid sequence shown in SEQ ID NO: 1 in which one or several (e.g., 2 to 10) amino acids have been deleted, substituted, or added. Examples of Shootin1b protein variants also include proteins that have 80% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more sequence identity to the amino acid sequence shown in SEQ ID NO: 1.

[0021] (Ribozyme nucleic acid) As used herein, a ribozyme nucleic acid against Shootin1b refers to a nucleic acid that has the enzymatic activity of cleaving the DNA sequence or mRNA sequence of the Shootin1b gene. By cleaving the DNA sequence or mRNA sequence of the Shootin1b gene, the ribozyme nucleic acid suppresses or inhibits the expression or function of the Shootin1b protein.

[0022] (Antisense nucleic acid) As used herein, an antisense nucleic acid against Shootin1b refers to a nucleic acid that binds to the DNA sequence or mRNA sequence of the Shootin1b gene, or a partial sequence thereof. By binding to the DNA sequence or mRNA sequence of the Shootin1b gene, or a partial sequence thereof, the antisense nucleic acid suppresses or inhibits the transcription or translation of the Shootin1b gene.

[0023] The number of bases contained in the antisense nucleic acid is not particularly limited as long as it exerts the effect of suppressing or inhibiting the expression of Shootin1b protein, and may be, for example, 10 to 40 bases, 12 to 30 bases, or 15 to 25 bases. Antisense nucleic acids can be designed by methods known in the art.

[0024] (RNAi-inducing nucleic acid) In this specification, the RNAi-inducing nucleic acid against Shootin1b refers to a nucleic acid that induces RNA interference by being introduced into cells and suppresses or inhibits the expression or function of Shootin1b protein. Examples of RNAi-inducing nucleic acids include miRNA (microRNA), siRNA (short interference RNA), shRNA (short hairpin RNA), etc.

[0025] The number of bases contained in the RNAi-inducing nucleic acid is not particularly limited as long as it exerts the effect of suppressing or inhibiting the expression of the Shootin1b gene, and may be, for example, 10 to 30 bases, 12 to 27 bases, or 15 to 25 bases. miRNAs can be designed by methods known in the art.

[0026] The RNAi-inducing nucleic acid may be a single-stranded RNA, or may be a double-stranded RNA consisting of a sense RNA and an antisense RNA that is substantially complementary to a portion of the mRNA sequence of the Shootin1b gene. The RNAi-inducing nucleic acid may have overhanging ends of 2 to 5 nucleotides at the ends of the sense RNA and antisense RNA for insertion into a vector, as described below, or the like.

[0027] Examples of combinations of sense RNA and antisense RNA of siRNA against Shootin1b include the combination of the sequences shown in SEQ ID NOs: 3 and 4, and the combination of the sequences shown in SEQ ID NOs: 5 and 6. SEQ ID NOs: 3 and 4 are single-stranded oligo DNAs containing a base sequence other than the target sequence against Shootin1b. ・TATTACATCTGGTCCCAGCTTGTTTTGGCCACTGACTGACAAGCTGGGCAGATGTAATA (SEQ ID NO: 3) ・TATTACATCTGCCCAGCTTGTCAGTCAGTGGCCAAAACAAGCTGGGACCAGATGTAATA (SEQ ID NO: 4) ・ACUUAAUACAGUAACUAGGAA (SEQ ID NO: 5) ・CCUAGUUACUGUAUUAAGUAU (SEQ ID NO: 6)

[0028] Examples of shRNA against Shootin1b include the sequences shown in SEQ ID NOs: 7 and 8 below: TGGTCATAGAGGAAGTTAATT (SEQ ID NO: 7) AAGACTTGTCGAGAAAGTGCT (SEQ ID NO: 8)

[0029] (Dominant-negative mutants) Dominant-negative mutants of Shootin1b suppress or inhibit the function (e.g., activity) of the Shootin1b protein by inhibiting the binding of the Shootin1b protein to other molecules. An example of a dominant-negative mutant of Shootin1b is a protein consisting of the amino acid sequence of the LI-CAM-binding region of Shootin1b. Such an example includes a protein consisting of the amino acid sequence from positions 1 to 125 of the amino acid sequence of SEQ ID NO: 1.

[0030] (Aptamers) Aptamers against Shootin1b bind to Shootin1b protein, thereby suppressing or inhibiting the function (e.g., activity) of Shootin1b protein. Examples of aptamers include nucleic acid aptamers such as DNA aptamers or RNA aptamers, or peptide aptamers. The length of a nucleic acid aptamer is not particularly limited as long as it has the number of bases that can specifically bind to Shootin1b protein, but is typically 10 to 100 bases, preferably 15 to 70 bases, and more preferably 20 to 50 bases. The length of a peptide aptamer is not particularly limited as long as it has the number of amino acids that can specifically bind to Shootin1b protein, but is typically 2 to 500, preferably 3 to 300, and more preferably 5 to 200.

[0031] Nucleic acid or peptide aptamers against Shootin1b can be obtained by known methods, for example, by screening a library composed of random sequences (e.g., SELEX, nucleic acid display, or ribosome display).

[0032] The nucleic acid molecule contained as an active ingredient in the antitumor agent according to one embodiment of the present invention may be modified by a method known in the art (e.g., chemical modifications such as 2'-O-methylation, phosphorothioate modification, and LNA (Locked Nucleic Acid) modification) for the purpose of improving the stability of the molecular structure, improving enzyme resistance, and improving ease of uptake into cells.

[0033] An antitumor agent according to one embodiment of the present invention may contain, as an active ingredient, a vector that expresses the ribozyme nucleic acid, antisense nucleic acid, RNAi-inducing nucleic acid, dominant-negative mutant, or aptamer. The type of vector may be, for example, an autonomously replicating vector (e.g., a plasmid), or may be a vector that, when introduced into a host cell, is integrated into the genome of the host cell and replicates together with the chromosome into which it has been integrated.

[0034] The vector is preferably an expression vector, in which elements necessary for transcription (e.g., promoter, enhancer, ribosome binding site, splice signal, terminator, etc.) are operably linked.

[0035] Examples of vectors include viral vectors such as retroviral vectors, adenoviral vectors, adeno-associated viral vectors, and lentiviral vectors; and non-viral vectors such as plasmid vectors, bacterial vectors, phage vectors, phagemid vectors, and cosmid vectors.

[0036] The vector can be constructed, for example, by using known genetic engineering techniques.

[0037] The antitumor agent according to one embodiment of the present invention may contain other ingredients in addition to the active ingredient. Examples of such other ingredients include, but are not limited to, pharmaceutically acceptable carriers, lubricants, preservatives, stabilizers, humectants, emulsifiers, salts for adjusting osmotic pressure, buffers, stabilizers, preservatives, excipients, antioxidants, viscosity adjusters, colorants, flavorings, and sweeteners. When the antitumor agent is formulated as an aqueous solution, pure water (sterile water), physiological saline, phosphate-buffered physiological saline, or the like may be used as the carrier. When the antitumor agent is formulated as another suitable solution, organic esters that can be introduced into the body, such as glycol, glycerol, or olive oil, may be used as the carrier.

[0038] The antitumor agent according to one embodiment of the present invention may be in any form, such as a solid (powder, granules, etc.), a liquid (solution, suspension, etc.), or a paste. The dosage form of the antitumor agent may be any form. Examples of dosage forms include powders, pills, granules, tablets, coated tablets, capsules, troches, liquids, suspensions, emulsions, syrups, infusions, decoctions, tinctures, injections, ointments, creams, gels, patches, topical liquids, topical powders, suppositories, inhalants, and eye drops.

[0039] The antitumor agent according to one aspect of the present invention may be housed in a container, pack, dispenser, or the like together with instructions for use.

[0040] An antitumor agent according to one embodiment of the present invention exerts an antitumor effect by suppressing the expression or function of Shootin1b. Suppression or inhibition of Shootin1b expression can be confirmed by, for example, a decrease in transcripts produced from the Shootin1b gene, degradation of transcripts produced from the Shootin1b gene, or a decrease in polypeptides translated from the Shootin1b gene, compared to a control. Suppression of Shootin1b function can be confirmed by, for example, suppression or inhibition of Shootin1b activity or a decrease in the interaction between Shootin1b and other molecules.

[0041] Examples of the antitumor effect of the antitumor agent according to one embodiment of the present invention include the inhibition of cancer cell proliferation, the inhibition of cancer cell invasion, and the inhibition of cancer cell metastasis. As used herein, the term "inhibition of cancer cell proliferation" refers to the prevention, reduction, or cessation of cancer cell proliferation. Furthermore, the term "inhibition of cancer cell invasion" refers to the prevention, reduction, or cessation of cancer cell invasion. Furthermore, the term "inhibition of cancer cell metastasis" refers to the prevention, reduction, or cessation of cancer cell metastasis.

[0042] The antitumor agent according to one aspect of the present invention may be an agent for inhibiting cancer cell proliferation, cancer cell invasion, or cancer cell metastasis.

[0043] Examples of cancer cells that can be targeted by the antitumor agent according to one embodiment of the present invention include pancreatic cancer cells, squamous cell carcinoma cells, lung cancer cells, cervical cancer cells, fibrosarcoma cells, breast cancer cells, glioma cells (glioma cells such as malignant glioma cells, glioblastoma cells, etc.), ependymoma cells, medulloblastoma cells, and glioblastoma cells.

[0044] (Subjects and Administration of Antitumor Agents) Subjects to which the antitumor agents according to one embodiment of the present invention are administered include, for example, humans and non-human animals, more specifically, vertebrates such as birds and mammals. Mammals include laboratory animals such as mice, rats, rabbits, guinea pigs, and primates other than humans; pets such as dogs and cats; livestock such as pigs, cows, goats, sheep, and horses; and humans.

[0045] The administration route or method is not particularly limited, and may be administered directly or indirectly to the target cancer cells or tissues containing cancer cells or their surroundings. Examples of administration routes include oral, intravenous, intramuscular, subcutaneous, intraventricular, intraperitoneal, and transdermal routes, as well as local administration and methods using a gene gun.

[0046] The antitumor agent according to one embodiment of the present invention can be introduced into cells by, for example, electroporation, calcium phosphate, lipofection, microinjection, liposome-based introduction, gene gun-based introduction, or cationic polymer (e.g., DEAE dextran, polyethyleneimine, polyethylene glycol).

[0047] The dose and frequency of administration can be appropriately selected depending on the severity of symptoms, age, sex, body weight, administration form, etc.

[0048] The antitumor agent according to one embodiment of the present invention may be used alone or in combination with one or more other antitumor agents. Furthermore, the antitumor agent according to one embodiment of the present invention may be used in combination with other cancer treatment methods (e.g., radiation treatment).

[0049] Another aspect of the present invention is a method for treating cancer, comprising administering a therapeutically effective amount of an antitumor agent according to one aspect of the present invention to a subject suffering from cancer. As used herein, "treating cancer" also includes preventing cancer, delaying or halting cancer progression, regression or elimination of lesions, preventing or suppressing cancer metastasis, and preventing cancer recurrence. Furthermore, as used herein, a "therapeutically effective amount" refers to an amount of the active ingredient of the antitumor agent that can be administered to a subject to suppress the proliferation, invasion, or metastasis of cancer cells.

[0050] Another aspect of the present invention is a method for improving the prognosis of a subject or a method for preventing metastasis of cancer in a subject, the method comprising administering an effective amount of an antitumor agent according to an aspect of the present invention to a subject suffering from cancer. As used herein, "prognosis" refers to the predicted course of cancer after treatment (e.g., recurrence rate, time until recurrence, survival rate, etc.).

[0051] [Screening Method] A screening method for an antitumor agent according to one embodiment of the present invention comprises a contacting step, a measuring step, and a selecting step.

[0052] (Contacting Step) In the contacting step, the test substance is brought into contact with Shootin1b. For example, the test substance can be brought into contact with Shootin1b by adding the test substance to a solution containing Shootin1b, or by mixing Shootin1b and the test substance.

[0053] (Measurement step) In the measurement step, the activity of Shootin1b after contact with a test substance is measured. Methods for measuring Shootin1b activity include known methods such as co-immunoprecipitation, methods utilizing surface plasmon resonance, enzyme-linked immunosorbent assay (ELISA), and methods utilizing fluorescence resonance energy transfer (FRET).

[0054] (Selection step) In the selection step, if the activity of Shootin1b after contact with the test substance is reduced compared to the activity of Shootin1b before contact with the test substance, the test substance is selected as a candidate active ingredient of an antitumor agent.

[0055] (Example of a method for screening antitumor agents using ELISA) An example of a method for screening antitumor agents using ELISA is shown below. (1) GST-tagged Shootin1b is coated onto a glutathione-coated plate (e.g., a plate manufactured by Thermo Fisher Scientific). (2) A Flag-tagged Shootin1b binding molecule (e.g., Flag-L1 cytosol domain) is allowed to bind to Shootin1b. (3) The test substance is added to the plate. (4) A Flag antibody is used as the primary antibody and allowed to bind to the Flag tag. (5) A secondary antibody (e.g., an HRP (horseradish peroxidase)-labeled secondary antibody) is allowed to bind to the primary antibody. (6) The secondary antibody label is allowed to react. For example, in the case of an HRP-labeled secondary antibody, an HRP substrate is added to the plate. (7) After the labeling reaction, the results of the labeling reaction are detected. For example, in the case of an HRP-labeled secondary antibody, enzyme activity is detected by measuring absorbance at 450 nm. If the absorbance decreases upon addition of the test substance, the test substance is selected as a candidate for the active ingredient of an antitumor agent.

[0056] In one example of a method for screening antitumor agents using the above-mentioned ELISA method, the test substance may be added to the plate simultaneously with the above-mentioned step (2), or between the above-mentioned steps (1) or (2).

[0057] (Method for screening antitumor agents using FRET) One aspect of the present invention also includes a method for screening antitumor agents using FRET. An example of the method for screening antitumor agents using FRET is shown below.

[0058] (Example of a method for screening antitumor agents using FRET) (A) Preparation of a Shootin1b-FRET sensor Shootin1b peptide 1 (e.g., a protein consisting of amino acids 1 to 136 of the amino acid sequence shown in SEQ ID NO: 1) is prepared, which includes serine at position 101 of the amino acid sequence shown in SEQ ID NO: 1. Shootin1b peptide 2 (e.g., a protein consisting of amino acids 376 to 456 of the amino acid sequence shown in SEQ ID NO: 1) is also prepared, which consists of an amino acid sequence different from that of Shootin1b peptide 1. Shootin1b peptide 1 and Shootin1b peptide 2 are prepared to be linked via a linker (e.g., a peptide linker). Shootin1b peptide 1 is also prepared to be linked to a first fluorescent molecule (acceptor fluorescent molecule, e.g., YFP (yellow fluorescent protein)) at its N-terminus. Shootin1b peptide 2 is also prepared to be linked to a second fluorescent molecule (donor fluorescent molecule, e.g., CFP (cyan fluorescent protein)) different from the first fluorescent molecule at its C-terminus.

[0059] (B) Coating of Shootin1b-FRET Sensor A GST-tagged Shootin1b-FRET sensor is coated onto a glutathione-coated plate (for example, a plate manufactured by Thermo Fisher Scientific).

[0060] (C) Activation of the Shootin1b-FRET sensor Shootin1b is activated by phosphorylating serine 101 of peptide 1 of the Shootin1b-FRET sensor. For example, this serine is phosphorylated by the kinase Pak1. Serine phosphorylation reduces the fluorescence intensity of the first fluorescent molecule and decreases FRET efficiency.

[0061] (D) Addition of test substance: A test substance is added to the plate and its fluorescence intensity is measured. If the fluorescence intensity of the first fluorescent molecule increases and the FRET efficiency increases, the test substance is selected as a candidate active ingredient for an antitumor agent.

[0062] (Another Example of a Screening Method for Antitumor Agents) The following screening method for antitumor agents is also included in one embodiment of the present invention. A screening method for antitumor agents comprising: a contacting step of contacting a test substance with cells, a measuring step of measuring the expression level or activity of Shootin1b in the cells after the contacting step, and a selection step of selecting the test substance as a candidate active ingredient of an antitumor agent when the expression level or activity measured in the measuring step is reduced or decreased compared to the expression level or activity of Shootin1b in the cells before contacting them with the test substance.

[0063] One embodiment of the present invention also includes a screening kit for antitumor agents, which comprises Shootin1b protein or a polypeptide portion thereof, or a polynucleotide encoding the same. The screening kit may include reagents (e.g., labeling reagents, buffers, primers, probes) or equipment (e.g., plates) necessary for screening. The screening kit may also include instructions describing procedures for screening antitumor agents. These instructions may be written or printed on paper or other media, or may be attached to electronic media such as magnetic tape, computer-readable disks, or CD-ROMs.

[0064] The Shootin1b protein or a polypeptide portion thereof, or a polynucleotide encoding the same, included in the screening kit may be the Shootin1b-FRET sensor or a vector for expressing the sensor.

[0065] [Prognostic Test Agent for Subjects Suffering from Cancer] A prognostic test agent according to one embodiment of the present invention is a prognostic test agent for subjects suffering from cancer, comprising a reagent for detecting Shootin1b.

[0066] Examples of reagents for detecting Shootin1b include antibodies or antibody fragments that bind to the Shootin1b protein or a partial polypeptide thereof, and transcription products of the Shootin1b gene (eg, mRNA).

[0067] Another embodiment of the present invention also includes a prognosis test kit for a subject suffering from cancer, which comprises a prognosis test agent according to one embodiment of the present invention. The prognosis test kit may include reagents necessary for detecting Shootin1b (e.g., labeling reagents, buffer solutions, primers, probes). The prognosis test kit may also include instructions describing procedures for detecting Shootin1b. These instructions may be written or printed on paper or other media, or may be attached to electronic media such as magnetic tape, computer-readable disks, or CD-ROMs.

[0068] [Prognosis prediction method] A method for predicting the prognosis of a subject according to one embodiment of the present invention (hereinafter sometimes abbreviated as "prognosis prediction method") comprises the step of detecting the expression level of Shootin1b in a biological sample collected from a subject suffering from cancer using the above-mentioned prognosis test agent.

[0069] The subject suffering from cancer can be a mammal, preferably a human.

[0070] Examples of biological samples include parts of organs or tissues, cells derived from cancer patients, cultured cells thereof, etc. Examples of biological samples also include body fluids such as peripheral blood, blood such as serum or plasma, lymph, and tissue fluid.

[0071] The expression level of Shootin1b can be detected using known methods, including protein expression analysis methods such as immunostaining using an antibody that binds to Shootin1b, Western blotting, ELISA, and radioimmunoassay (RIA), and gene expression analysis methods such as Northern blotting, PCR (e.g., RT-PCR and real-time PCR), in situ hybridization, and microarray.

[0072] The expression level of Shootin1b may also be determined based on the proportion of Shootin1b-positive cells in a biological sample.

[0073] A prognosis prediction method according to one embodiment of the present invention may include a step of comparing the expression level of Shootin1b with a reference expression level of Shootin1b. Examples of reference expression levels of Shootin1b include the expression level of Shootin1b in a biological sample from an individual not suffering from cancer, the expression level of Shootin1b in a biological sample from an individual judged to have a good prognosis, and the expression level of Shootin1b in a biological sample from an individual judged to have a poor prognosis.

[0074] When the expression level of Shootin1b in a subject's biological sample is equal to or greater than the reference expression level of Shootin1b, it can be predicted that the subject's prognosis is poor or likely to be poor.When the expression level of Shootin1b in a subject's biological sample is less than the reference expression level of Shootin1b, it can be predicted that the subject's prognosis is good or likely to be good.

[0075] Examples of cancers that may be targeted in the prognostic test agent or prognosis prediction method according to one embodiment of the present invention include pancreatic cancer, squamous cell carcinoma, lung cancer, cervical cancer, fibrosarcoma, breast cancer, glioma (gliomas such as malignant glioma, glioblastoma, etc.), ependymoma, medulloblastoma, glioblastoma, etc.

[0076] By using a prognostic test agent or a method for predicting a subject's prognosis according to one embodiment of the present invention, the expression level of Shootin1b in a subject suffering from cancer can be determined, and the malignancy of the cancer can be evaluated, for example, to determine whether Shootin1b is involved in the malignancy of the cancer.By evaluating the malignancy of the cancer, a treatment plan such as the type, dose, and frequency of administration of an antitumor agent can be determined, and more appropriate treatment can be implemented for the subject.

[0077] Another embodiment of the present invention includes a method for determining the stage of cancer, which comprises the step of detecting the expression level of Shootin1b in a biological sample collected from a subject suffering from cancer.

[0078] [Summary] The antitumor agent according to aspect 1 of the present invention comprises, as an active ingredient, at least one component selected from the group consisting of ribozyme nucleic acids, antisense nucleic acids, RNAi-inducing nucleic acids, dominant-negative mutants and aptamers against Shootin1b, and vectors expressing these.

[0079] The antitumor agent according to aspect 2 of the present invention may be the antitumor agent according to aspect 1 of the present invention, wherein the antitumor agent is at least one selected from the group consisting of cancer cell proliferation inhibitors, cancer cell infiltration inhibitors, and cancer cell metastasis inhibitors.

[0080] The antitumor agent according to aspect 3 of the present invention may be an antitumor agent according to aspect 2 of the present invention, wherein the cancer cells are at least one type of cancer cells selected from the group consisting of pancreatic cancer cells, squamous cell carcinoma cells, lung cancer cells, cervical cancer cells, fibrosarcoma cells, breast cancer cells, glioma cells, ependymoma cells, medulloblastoma cells, and glioblastoma cells.

[0081] A screening method according to aspect 4 of the present invention is a method for screening antitumor agents, comprising: a contacting step of contacting Shootin1b with a test substance; a measuring step of measuring the activity of Shootin1b after contact with the test substance; and a selection step of selecting the test substance as a candidate active ingredient of an antitumor agent when the activity of Shootin1b after contact with the test substance is reduced compared to the activity of Shootin1b before contact with the test substance.

[0082] A screening method according to aspect 5 of the present invention is the same as that according to aspect 4 of the present invention, wherein the Shootin1b is Shootin1b linked to a first fluorescent molecule and a second fluorescent molecule, and the measuring step may involve evaluating the efficiency of fluorescence resonance energy transfer (FRET) between the first fluorescent molecule and the second fluorescent molecule.

[0083] In the screening method according to aspect 6 of the present invention, in aspect 4 of the present invention, the activity of Shootin1b may be measured by enzyme-linked immunosorbent assay (ELISA) in the measuring step.

[0084] In the screening method according to aspect 7 of the present invention, in any one of aspects 4 to 7 of the present invention, the antitumor agent may be at least one selected from the group consisting of cancer cell proliferation inhibitors, cancer cell infiltration inhibitors, and cancer cell metastasis inhibitors.

[0085] A screening method according to aspect 8 of the present invention, in any one of aspects 4 to 8 of the present invention, may be such that the cancer cells are at least one type of cancer cells selected from the group consisting of pancreatic cancer cells, squamous cell carcinoma cells, lung cancer cells, cervical cancer cells, fibrosarcoma cells, breast cancer cells, glioma cells, ependymoma cells, medulloblastoma cells, and glioblastoma cells.

[0086] A prognostic test agent according to embodiment 9 of the present invention is a prognostic test agent for a subject suffering from cancer, comprising a reagent for detecting Shootin1b.

[0087] A prognostic test agent according to aspect 10 of the present invention may be the same as in aspect 9 of the present invention, wherein the cancer is at least one type of cancer selected from the group consisting of pancreatic cancer, squamous cell carcinoma, lung cancer, cervical cancer, fibrosarcoma, breast cancer, glioma, ependymoma, medulloblastoma, and glioblastoma.

[0088] A method for predicting the prognosis of a subject according to aspect 11 of the present invention comprises detecting the expression level of Shootin1b in a biological sample collected from a subject suffering from cancer using the prognostic test agent according to aspect 9 or 10 of the present invention.

[0089] The following examples are provided to further explain the embodiments of the present invention. It goes without saying that the present invention is not limited to the following examples, and various modifications are possible in detail. Furthermore, the present invention is not limited to the above-described embodiments, and various modifications are possible within the scope of the claims. Embodiments obtained by appropriately combining the technical means disclosed herein are also included in the technical scope of the present invention. Furthermore, all of the documents cited in this specification are incorporated by reference.

[0090] In the following examples, % means % by mass unless otherwise specified.

[0091] Evaluation Example 1: Shootin1b Expression in Cancer Cells RNA was extracted from cancer cells using TriPure Isolation Reagent (Sigma) or FastGene RNA Basic / Premium Kit (Nippon Genetics). cDNA was then prepared using ReverTra Ace qPCR RT Master Mix (Toyobo). qPCR was performed using the cDNA using the KAPA SYBR Fast qPCR Kit (Nippon Genetics). ACTB (β-actin) was used as an internal control. To distinguish between the three types of Shootin1a, Shootin1b, and Shootin1-v3, a primer set that detects only Shootin1a (SHTN1-a), a primer set that detects only Shootin1-v3 (SHTN1-v3), and a primer set that simultaneously detects Shootin1b and Shootin1-v3 (SHTN1-b+v3) were used to compare approximate expression levels based on differences in Cq values.

[0092] The results are shown in Figure 1. As shown in Figure 1, the relative expression level of Shootin1b was lower in SHTN1-v3 than in SHTN1-b+v3 in pancreatic cancer cells (KP4, AsPC1), lung cancer cells (A549), cervical cancer cells (HeLa), fibrosarcoma cells (HT1080), squamous cell carcinoma cells (A431-6), and breast cancer cells (SKBR3-luc), confirming the expression of Shootin1b.

[0093] [Evaluation Example 2] Expression of Shootin1b in malignant glioma cells and ependymoma cells The mechanism by which Shootin1b generates the driving force for cell migration, discovered from previous research on Shootin1b in nerve cells, is shown in Figure 2. Shootin1b links actin filaments to the cell adhesion molecule L1 (L1-CAM), thereby transmitting the driving force of actin filaments to the extracellular matrix and generating the driving force for cell migration.

[0094] Next, we analyzed the expression of Shootin1b and L1-CAM in human patient-derived malignant glioma cells (GDC-KNBTG-8) and human patient-derived ependymoma cells (EP1NS).We examined the presence or absence of Shootin1b and L1-CAM expression in malignant glioma and ependymoma cells by Western blotting using antibodies to Shootin1b and L1-CAM.

[0095] Lysates of malignant glioma cells (GDC-KNBTG-8), ependymoma cells (EP1NS), mouse brain tissue, and rat brain tissue were each subjected to SDS-cleavage. 20 μL of this SDS-cleaved sample was loaded onto an 8% polyacrylamide gel and electrophoresed. The separated proteins in the gel were transferred to a PVDF membrane. After transfer, the PVDF membrane was blocked with 3% skim milk. Shootin1b antibody (1:2000 dilution) or L1-CAM antibody (1:1000 dilution) was added as the primary antibody, and HRP-conjugated rabbit IgG antibody (1:2000 dilution) or HRP-conjugated mouse IgG antibody (1:2000 dilution) was added as the secondary antibody. Shootin1b and L1-CAM bands were then detected using ECL reagent.

[0096] The results of an analysis of Shootin1b and L1-CAM expression in malignant glioma cells are shown in Figure 3. Western blot analysis of mouse brain tissue was performed as a positive control. As shown in Figure 3, Shootin1b and L1-CAM were found to be expressed in malignant glioma cells. In contrast, Shootin1b was not expressed in normal glial cells (not shown). Furthermore, human gliomas vary widely, and some cases were observed in which Shootin1b or L1-CAM was not highly expressed.

[0097] The results of the analysis of Shootin1b and L1-CAM expression in ependymoma cells are shown in Figure 5. Western blot analysis of rat brain tissue was performed as a positive control. As shown in Figure 5, Shootin1b and L1-CAM were found to be expressed in ependymoma cells.

[0098] Next, we analyzed the localization of Shootin1b in malignant glioma cells (GDC-KNBTG-8).The presence or absence of Shootin1b expression and its localization in malignant glioma cells were examined by immunostaining with an antibody to Shootin1b.

[0099] Malignant glioma cells were cultured on circular glass plates (13 mm diameter) coated with the extracellular matrix laminin. Formalin (final concentration: 3.7%) was added and fixed by leaving the plates at room temperature for 10 minutes and then on ice for 20 minutes. After fixation, the formalin solution was removed, and the plates were immersed in PBS and left on ice for 20 minutes to wash the fixative. The PBS was removed, and 0.05% Triton solution diluted in PBS was added and left on ice for 15 minutes to perform permeabilization. After permeabilization, the Triton solution was removed, and 10% FBS diluted in PBS was added as a blocking solution for blocking (left at room temperature for 60 minutes). After blocking, the solution was removed, and a primary antibody solution diluted in the blocking solution was added and incubated overnight at 4°C. After primary antibody incubation, the antibody solution was removed, the plates were immersed in PBS, and left on ice for 20 minutes to wash. After washing, the PBS was removed, and the plates were incubated with a secondary antibody solution diluted in PBS for 60 minutes at room temperature in the dark for secondary antibody incubation. After the secondary antibody reaction, the antibody solution was removed, and the sample was immersed in PBS and left to stand at room temperature for 20 minutes in the dark to wash the antibody. The circular glass was placed on a glass slide and filled with a 50% glycerol solution diluted with PBS. A cover glass (24 x 60 mm) was placed on top and the edges were coated with nail polish to seal. Shootin1b antibody (2000-fold dilution) was used as the primary antibody, and Alexa488-labeled rabbit IgG antibody was used as the secondary antibody. Fluorescent signals were observed and photographed using a fluorescence microscope.

[0100] The results of the analysis of the presence or absence of Shootin1b expression and its localization in malignant glioma cells are shown in Figure 4. As shown in Figure 4, it was found that Shootin1b is expressed in malignant glioma cells and localized at the leading edge of migration (arrowhead).

[0101] [Evaluation Example 3] Preparation of knockdown vector that suppresses expression of human Shootin1b Candidate RNAi vectors that knock down human Shootin1b or control vectors were transfected into HEK293T cells, and endogenous Shootin1b was detected by Western blotting.

[0102] Gene transfer into HEK293T cells was performed using the polyethyleneimine (PEI) method. Each Shootin1b knockdown candidate RNAi vector and PEI were mixed in 500 μL of cell culture medium and left to stand at room temperature for 20 minutes. This mixture was added to an HEK293T cell culture dish and cultured. After approximately 24 hours, the medium was replaced with fresh cell culture medium and the cells were cultured for another 24 hours. Gene transfer was confirmed by observing the GFP fluorescence of the cells under a fluorescence microscope.

[0103] Western blotting was performed as follows. Lysates from HEK293T cells transfected with an RNAi vector were diluted with SDS. 20 μL of the SDS-treated sample was loaded onto an 8% polyacrylamide gel and electrophoresed. Proteins separated in the gel were transferred to a PVDF membrane. After transfer, the PVDF membrane was blocked with 3% skim milk. Shootin1b antibody (1:2000 dilution) or Actin antibody (1:10,000 dilution) was added as the primary antibody, and HRP-labeled rabbit IgG antibody (1:2000 dilution) or HRP-labeled mouse IgG antibody (1:2000 dilution) was added as the secondary antibody. Shootin1b and Actin bands were then detected using ECL reagent. Actin was detected as a loading control to indicate the amount of each sample. Western blotting was also performed on mouse brain tissue as a positive control. The results are shown in Figure 6.

[0104] Next, quantitative analysis of the expression levels obtained by Western blotting in Figure 6 was performed. The brightness of the Shootin1b band and the Actin band were measured using ImageJ software. To compare the Shootin1b expression levels in each sample, the brightness of the Shootin1b band was divided by the brightness of the Actin band to calculate the value. The Shootin1b expression level in cells transfected with the control vector was set to 100%, and the Shootin1b expression level for each sample is shown in the graph.

[0105] The results of the quantitative analysis are shown in Figure 7. The values ​​in the graph in Figure 7 are average values, and the error bars indicate standard errors. Student's t-test (significance test) was performed for statistical analysis (*: p<0.05).

[0106] In Figures 6 and 7, 56, 229, 319, 618, 666, and 1653 indicate the names of the target sequences. As shown in Figures 6 and 7, RNAi vectors 229, 319, and 1653 significantly reduced the expression level of Shootin1b compared to the control vector. In Evaluation Examples 4 and 5 described below, RNAi vector 319 was used.

[0107] The single-stranded oligo DNA1 and single-stranded oligo DNA2 of RNAi vector 319, which contains the target sequence of Shootin1b, are shown below. Single-stranded oligo DNA1 and single-stranded oligo DNA2 are oligo DNAs containing the target sequence and a base sequence for insertion into a vector. <Single-stranded oligo DNA1> 5'-TGCTGTATTACATCTGGTCCCAGCTTGTTTTGGCCACTGACTGACAAGCTGGGCAGATGTAATA-3' (SEQ ID NO: 9) The "TGCTG" at the 5' end is the sequence for insertion into a vector. <Single-stranded oligo DNA2> 5'-CCTGTATTACATCTGCCCAGCTTGTCAGTCAGTGGCCAAAACAAGCTGGGACCAGATGTAATAC-3' (SEQ ID NO: 10) The "CCTG" at the 5' end and the "C" at the 3' end are the sequences for insertion into a vector.

[0108] The single-stranded oligo DNA1 and single-stranded oligo DNA2 are complementary to each other, and are annealed to form a double-stranded DNA. TM 6.2-GW / EmGFP-miR (BLOCK-iT TM The miRNA was inserted into a Pol II miR RNAi Expression Vector Kit (Invitrogen). After insertion, this vector was used as the RNAi vector. The pcDNA 6.2-GW / EmGFP-miRNA-neg vector was also used as a control vector. Since cells transfected with these vectors express GFP, GFP-positive cells transfected with the control vector were used as control cells, and GFP-positive cells transfected with the RNAi vector were used as Shootin1b knockdown cells.

[0109] [Evaluation Example 4] Decreased migration speed of human patient-derived malignant glioma cells (GDC-KNBTG-8) by Shootin1b knockdown The RNAi vector 319 from Evaluation Example 3 was transfected into malignant glioma cells (GDC-KNBTG-8) by electroporation. 6 The cells were added to and suspended in 100 μL of Amaxa Mouse NSC Nucleofector solution (Lonza). This suspension was transferred to a dedicated cuvette and electroporated using Program "A-033" of Nucleofector 2b (Lonza). The cells were then recovered from the cuvette to obtain malignant glioma cells transfected with the RNAi vector 319.

[0110] Malignant glioma cells transfected with the RNAi vector 319 were suspended in a solution consisting of equal parts L-15 culture medium (Gibco) and Matrigel (Corning). This suspension was added to a glass-bottom dish and incubated for 5 minutes at 37°C and 5% CO2 to allow the Matrigel to solidify. The glass-bottom dish was then placed in a 37°C incubator, and GFP-positive cells were identified and photographed using a fluorescent microscope. Time-lapse photography was then performed at 10-minute intervals. Cell migration in the captured image data was tracked using ImageJ, and the migration speed was calculated.

[0111] Figure 8 shows the results of observing cell migration within Matrigel (3D space), and Figure 9 shows the results of analyzing the migration speed of malignant glioma cells. The values ​​in the graph in Figure 9 represent the mean values, and the error bars represent the standard error. Statistical analysis was performed using a Student's t-test (significance test) (***: p<0.01). As shown in Figure 9, the migration speed of Shootin1b knockdown cells was significantly reduced compared to control cells.

[0112] [Evaluation Example 5] Decreased migration rate of ependymoma cells (EP1NS) derived from a human patient due to Shootin1b knockdown The RNAi vector 319 of Evaluation Example 3 was transfected into ependymoma cells (EP1NS) by electroporation. 6 The cells were added to and suspended in 100 μL of Amaxa Mouse NSC Nucleofector solution (Lonza). This suspension was transferred to a dedicated cuvette and electroporated using Program "A-033" of Nucleofector 2b (Lonza). The cells were recovered from the cuvette to obtain ependymoma cells transfected with RNAi vector 319.

[0113] Ependymoma cells transfected with RNAi vector 319 were suspended in a solution consisting of equal parts L-15 medium (Gibco) and Matrigel (Corning). This suspension was added to a glass-bottom dish and incubated for 5 minutes at 37°C and 5% CO2 to allow the Matrigel to solidify. The glass-bottom dish was then placed in a 37°C incubator, and GFP-positive cells were identified and photographed under a fluorescent microscope. Time-lapse photography was then performed at 10-minute intervals. Cell migration in the captured image data was tracked using ImageJ, and the migration speed was calculated.

[0114] The results of observing cell migration within Matrigel (3D space) are shown in Figure 10, and the analysis results of the migration speed of ependymoma cells are shown in Figure 11. The values ​​in the graph in Figure 11 indicate the mean value, and the error bars indicate the standard error. Statistical analysis was performed using Student's t-test (significance test) (*: p<0.05). As shown in Figure 11, the migration speed of Shootin1b knockdown cells was significantly reduced compared to control cells.

[0115] Evaluation Example 6: Decreased Migration Speed ​​of KP4 and HeLa Cells Due to Shootin1b Knockdown KP4 and HeLa cells were transfected with siShootin1 to knockdown Shootin1b. Non-targeting RNA was used as a control. Lipofectamine RNAiMAX Reagent (Thermo Fisher Scientific) was used for transfection. After transfection, cells were seeded onto 24-well plastic plates coated with a 1 / 20 diluted solution of Corning® Matrigel® Growth Factor Reduced. At the same time, cells were seeded onto 35 mm dishes, followed by qRT-PCR to confirm Shootin1b knockdown. Time-lapse observations were performed using a phase-contrast microscope for approximately 24 hours, starting one day after seeding. Motility speed was then analyzed using ImageJ software.

[0116] The sequences of siShootin1 used in Evaluation Example 6 are as follows: Antisense strand: 5'-ACUUAAUACAGUAACUAGGAA-3' (SEQ ID NO: 5) Antisense strand: 5'-CCUAGUUACUGUAUUAAGUAU-3' (SEQ ID NO: 6)

[0117] The results of Evaluation Example 6 are shown in Figure 12. In KP4 and HeLa cells, the motility speed was significantly reduced in siShootin1 compared to the control.

[0118] Evaluation Example 7: Glioma invasion assay using human iPSC-derived cerebral organoids A schematic diagram of the glioma invasion assay using human iPSC-derived cerebral organoids is shown in Figure 13. 1.5 x 10 cells (knockdown cells) expressing shRNA (SHTN1 shRNA) to knock down GFP and Shootin1b in GDC-KNBTG-8 human adult glioma cells using lentivirus, and 1.5 x 10 control cells expressing only mCherry were used. 4 The cells were mixed in a V-bottom well and cultured for 3 days to form cell aggregates (GDC-KNBTG-8 spheroids). Furthermore, 10-week-old brain organoids, created in parallel with the culture, were co-cultured with GDC-KNBTG-8 spheroids to induce fusion tissue (assembloids) in culture, and the invasiveness of glioma cells was analyzed. Experimental results were evaluated by observing the fusion tissue over time using a fluorescent stereomicroscope and by observing and quantifying tissue sections using a fluorescent imaging microscope.

[0119] Figure 14 shows the analysis results of fused tissue sections obtained in the glioma invasion assay shown in Figure 13. Virus-infected cell clusters were co-cultured with brain organoids, fixed on day 7, and analyzed. Control cells and knockdown cells were labeled with different fluorescent proteins.

[0120] The shRNA sequences used in Evaluation Examples 7 to 9 are shown below. In Evaluation Examples 7 and 8, SHTN1-182 was used as the SHTN1 shRNA. SHTN1-182: TGGTCATAGAGGAAGTTAATT (SEQ ID NO: 7) SHTN1-229: AAGACTTGTCGAGAAAGTGCT (SEQ ID NO: 8) Negative control: CCTAAGGTTAAGTCGCCCTCG (SEQ ID NO: 11)

[0121] As shown in the lower left panel of Figure 14, control cells were observed to infiltrate into the brain organoid tissue (rectangled area and enlarged view), while knockdown cells remained within the GDC-KNBTG-8 spheroid.

[0122] To quantify the invasive potential of each cell, we measured the distance of each cell from the GDC-KNBTG-8 spheroid in three sections from three independent assebloids. A total of 130 control and 27 knockdown cells were counted, and the percentage was quantified by dividing the number of cells counted at 100-micrometer intervals by the total number of cells counted. The quantitative results are shown in the right panel of Figure 14. Compared to the control, the knockdown cells showed reduced invasive potential.

[0123] [Evaluation Example 8] Analysis of the effect of Shootin1b knockdown on tumor progression GDC-KNBTG-8 cells expressing SHTN1 shRNA / GFP (knockdown cells) and GDC-KNBTG-8 cells expressing mCherry alone (control cells) were cultured at 1x10 5 Mix them one by one to make 2 x 10 5 The cells were transplanted into the cerebral cortex ventricles of immunodeficient mice. Photographs of brain samples taken 3 months after transplantation are shown in Figure 15. As shown in the upper panel of Figure 15, control cells formed tumor masses, while GFP-positive SHTN1 knockdown cells were hardly observed. Similar results were also observed in organoid transplantation experiments, as shown in the lower panel of Figure 15. The enlarged images show infiltrating control and knockdown cells, respectively.

[0124] Evaluation Example 9: Analysis of Brain Tumor Growth Rate by Shootin1b Knockdown Human ZFTA ependymoma cells were infected with lentivirus encoding two types of SHTN1 shRNA (SHTN1-182, SHTN1-229) and a control shRNA using scrambled oligonucleotides. Three days after infection, proliferating cells were labeled by administering 10 μM EdU for 6 hours, and EdU-positive cells were counted by FACS analysis. The analysis results are shown in Figure 16. The vertical axis of the graph in Figure 16 represents the relative reduction in proliferation ability, calculated by setting the percentage of dividing cells in the control as 1 in three independent experiments. This evaluation example demonstrated that Shootin1b knockdown suppresses the growth rate of brain tumors.

[0125] Evaluation Example 10: Decreased Migration Speed ​​of Glioma Cells Due to Inhibition of Shootin1b Function Induced by a Dominant-Negative Mutant. A peptide consisting of amino acids 1 to 125 of the amino acid sequence shown in SEQ ID NO: 1 was used as the dominant-negative mutant. Glioma cells transfected with the Shootin1-DN vector (pCAGGS-EGFP-shootin1a(1-125) vector described in Non-Patent Document 5) were suspended in a solution containing equal volumes of L-15 culture medium (Gibco) and Matrigel (Corning). This suspension was added to a glass-bottom dish and incubated for 5 minutes (37°C, 5% CO2) to solidify the Matrigel. The glass-bottom dish was then fixed in a 37°C incubator, and GFP-positive cells were confirmed and photographed under a fluorescent microscope. Time-lapse photography was then performed at 10-minute intervals. Cell migration in the captured image data was tracked using ImageJ, and migration speed was calculated.

[0126] The observation results are shown in Figure 17, and the analysis results of the migration speed are shown in Figure 18. In Figure 17, "Control" indicates the results for GFP-positive cells into which the control vector of Evaluation Example 3 was introduced, and "DN" indicates the results for GFP-positive cells into which the Shootin1-DN vector was introduced. The values ​​in the graph in Figure 18 indicate the average value, and the error bars indicate the standard error. Statistical analysis was performed using a Student's t-test (a test for significant difference) (***: p<0.01). As shown in Figure 18, the migration speed of Shootin1-DN-expressing cells in Matrigel (three-dimensional space) was significantly reduced compared to control cells.

[0127] Evaluation Example 11: Reduced proliferation of glioma U251 line due to Shootin1b knockout. Shootin1b was knocked out in the glioma U251 line using the CRISPR / Cas9 system. Specifically, px330-sgRNA containing the Shootin1b target sequence (nucleotide sequence) was transfected into cells using the CRISPR / Cas9 system and cultured for 48 hours. After culture, the cells were seeded at 0.65 cells / well in a 96-well microplate (TPP) and cultured for 24 hours. After culture, single-cell wells were selected and cultured until confluence was reached. The cells were then harvested and Shootin1b expression was confirmed by Western blotting to select a Shootin1b knockout cell line.

[0128] A solution of EdU (Invitrogen), an indicator of cell proliferation, was added to the culture medium of wild-type glioma U251 cells or Shootin1b knockout glioma U251 cells and incubated for 3 hours (37°C, 5% CO2). After incubation, the culture medium was fixed with formalin (final concentration 3.7%). After permeabilization with 0.5% Triton diluted in PBS, Alexa488-azide was added to fluorescently label cells that had taken up EdU. In addition, cell nuclei were stained with DAPI, and the total number of cells was counted, and the percentage of EdU-positive cells was calculated.

[0129] The results of the cell proliferation analysis are shown in Figure 19. The values ​​in the graph in Figure 19 represent the mean values, and the error bars represent the standard error. Statistical analysis was performed using a Student's t-test (a test for significant difference) (**: p<0.02). As shown in Figure 19, cell proliferation was significantly reduced in Shootin1b knockout U251 cells (KO) compared to wild-type U251 cells (WT).

[0130] In addition, wild-type glioma U251 cells or Shootin1b knockout glioma U251 cells were cultured in dishes for 24, 48, 72, and 96 hours, and the cells were detached by trypsin treatment, stained with trypan blue, and the cell number was calculated using a hemocytometer.

[0131] The results of the cell count analysis are shown in Figure 20. The values ​​in the graph in Figure 20 represent average values, and the error bars represent standard errors. Statistical analysis was performed using a Student's t-test (a test for significant difference) (*: p<0.05). After 72 and 96 hours of culture, the cell number of Shootin1b knockout U251 cells (KO) was significantly reduced compared to wild-type U251 cells (WT).

[0132] Evaluation Example 12: Relationship between Shootin1 Expression Level and Survival Time of Brain Tumor Patients. Using public gene expression data GSE108474 (124 cases) and TCGA-GBM (The Cancer Genome Atlas Glioblastoma Multiforme; 164 cases) for glioblastoma (GBM), the most malignant brain tumor, registered in NCBI GEO (Gene Expression Omnibus), a gene expression information database provided and maintained by NCBI, a total of 288 cases were used. Shootin1 expression status was divided into high expression group (H) and low expression group (L) based on average expression level, and OS (overall survival) was analyzed using the Kaplan-Meier method (using statistical analysis software R). The analysis results are shown in Figure 21. A statistically significant difference (P value = 0.0124) was observed, with the survival time of the high Shootin1 expression group (H) being shorter than that of the low Shootin1 expression group (L).

[0133] The analysis results of Evaluation Example 12 suggested that Shootin1 may be used as a marker for predicting the prognosis of cancer patients.

[0134] [Evaluation Example 13] Analysis of Shootin1b expression in human normal glial cells and patient-derived glioma cells (GDC-KNBTG-8) Immunoblotting was performed using lysates of human normal glial cells and glioma cells (GDC-KNBTG-8) to detect the expression of Shootin1b. Actin expression was also detected as a loading control.

[0135] The results of the expression analysis are shown in Figure 22. Shootin1b expression was not detected in normal human glial cells, but it was found to be expressed in glioma cells (GDC-KNBTG-8).

[0136] [Evaluation Example 14] Analysis of migration speed in human normal glial cells and glioma cells (GDC-KNBTG-8) Human normal glial cells and glioma cells (GDC-KNBTG-8) were cultured in Matrigel, and their migration speed was analyzed. Time-lapse photography was performed at 10-minute intervals, and cell migration in the captured image data was tracked using ImageJ to calculate the migration speed.

[0137] The results of observing cell migration within Matrigel are shown in Figure 23, and the analysis results of the migration speed of malignant glioma cells are shown in Figure 24. It was found that the migration speed of glioma cells (GDC-KNBTG-8) was significantly increased compared to that of normal human glial cells.

[0138] [Evaluation Example 15] Analysis of Shootin1b expression in glioma cell line U251 and patient-derived glioma cells (GDC-KNBTG-8) Immunoblotting was performed using lysates of glioma cell line U251 and patient-derived glioma cells (GDC-KNBTG-8) to detect the expression of Shootin1b. Actin expression was also detected as a loading control.

[0139] The results of expression analysis are shown in Figure 25. It was found that Shootin1b expression was higher in patient-derived glioma cells (GDC-KNBTG-8) than in the glioma cell line U251.

[0140] Evaluation Example 16: Analysis of cell proliferation in glioblastoma cells in which Shootin1b expression was suppressed Next, cell proliferation was analyzed using patient-derived glioma cells (GDC-KNBTG-8) that showed high expression of Shootin1b in Evaluation Example 15. Glioma cells (GDC-KNBTG-8) transfected with a control vector or a Shootin1b expression suppression vector were cultured and allowed to incorporate the cell proliferation marker Edu, and Edu-positive cells were visualized using a fluorescent dye that binds to Edu. The RNAi vector 319 from Evaluation Example 3 was used as the Shootin1b expression suppression vector.

[0141] Glioma cells (GDC-KNBTG-8) transfected with a control vector or a Shootin1b expression suppression vector express GFP. The numbers of GFP-positive cells and Edu-positive cells were counted, and the percentage of Edu-positive cells (number of Edu-positive cells / number of GFP-positive cells) was calculated.

[0142] The observation results for glioma cells (GDC-KNBTG-8) transfected with a control vector or a Shootin1b expression-suppressing vector are shown in Figure 26, and the analysis results for the percentage of Edu-positive cells are shown in Figure 27. It was found that suppression of Shootin1b expression significantly reduced the percentage of Edu-positive cells.

[0143] Furthermore, when Shootin1b expression was suppressed in patient-derived glioma cells with high Shootin1b expression, the rate of decrease in cell proliferation was found to be higher compared to the results for U251 cells, which have low Shootin1b expression (Figure 19).

[0144] Summary of Examples: It has been demonstrated that suppressing or inhibiting the expression or function of Shootin1b suppresses or inhibits the invasion and proliferation of various cancer cells. These results demonstrate that components that suppress or inhibit the expression or function of Shootin1b (e.g., low-molecular-weight compounds, nucleic acids) are useful as active ingredients for antitumor agents. Furthermore, it has been demonstrated that screening for antitumor agents that target Shootin1b is possible by monitoring interactions with Shootin1b using known techniques. Furthermore, it has been suggested that Shootin1b may be used as a marker to predict the prognosis of cancer patients.

[0145] The present invention can be used for the treatment of various cancers.

Claims

1. An antitumor agent comprising as an active ingredient at least one component selected from the group consisting of ribozyme nucleic acids, antisense nucleic acids, RNAi-inducing nucleic acids, dominant negative mutants and aptamers against Shootin1b, and vectors expressing these.

2. The antitumor agent according to claim 1, which is at least one selected from the group consisting of cancer cell proliferation inhibitors, cancer cell infiltration inhibitors and cancer cell metastasis inhibitors.

3. The antitumor agent according to claim 2, wherein the cancer cells are at least one type of cancer cells selected from the group consisting of pancreatic cancer cells, squamous cell carcinoma cells, lung cancer cells, cervical cancer cells, fibrosarcoma cells, breast cancer cells, glioma cells, ependymoma cells, medulloblastoma cells and glioblastoma cells.

4. A method for screening an antitumor agent, comprising: a contacting step of contacting Shootin1b with a test substance; a measuring step of measuring the activity of Shootin1b after contact with the test substance; and a selection step of selecting the test substance as a candidate for an active ingredient of an antitumor agent when the activity of Shootin1b after contact with the test substance is reduced compared to the activity of Shootin1b before contact with the test substance.

5. The screening method according to claim 4, wherein the Shootin1b is Shootin1b linked to a first fluorescent molecule and a second fluorescent molecule, and in the measuring step, the efficiency of fluorescence resonance energy transfer (FRET) between the first fluorescent molecule and the second fluorescent molecule is evaluated.

6. The screening method according to claim 4, wherein in the measuring step, the activity of Shootin1b is measured by enzyme-linked immunosorbent assay (ELISA).

7. The screening method according to any one of claims 4 to 6, wherein the antitumor agent is at least one selected from the group consisting of cancer cell proliferation inhibitors, cancer cell infiltration inhibitors and cancer cell metastasis inhibitors.

8. The screening method according to any one of claims 4 to 6, wherein the cancer cells are at least one type of cancer cells selected from the group consisting of pancreatic cancer cells, squamous cell carcinoma cells, lung cancer cells, cervical cancer cells, fibrosarcoma cells, breast cancer cells, glioma cells, ependymoma cells, medulloblastoma cells and glioblastoma cells.

9. A prognostic test for a subject suffering from cancer, comprising a reagent for detecting Shootin1b.

10. The prognostic test agent according to claim 9, wherein the cancer is at least one type of cancer selected from the group consisting of pancreatic cancer, squamous cell carcinoma, lung cancer, cervical cancer, fibrosarcoma, breast cancer, glioma, ependymoma, medulloblastoma and glioblastoma.

11. A method for predicting the prognosis of a subject, comprising a step of detecting the expression level of Shootin1b in a biological sample collected from a subject suffering from cancer, using the prognostic test agent according to claim 9 or 10.