Method for High-Level Production of Heparosan Using Recombinant Escherichia coli Nissle and Heparosan Produced Thereby

Abstract

The present invention relates to a method for high production of heparic acid using a recombinant E. coli strain and to the heparic acid produced thereby. The E. coli strain according to the present invention has the advantage of efficiently increasing the flux of the entire heparic acid biosynthetic pathway through the optimization of the dual plasmid system, promoter combination, and culture medium, thereby increasing the heparic acid production compared to the wild-type strain and enabling the securing of high-purity heparic acid even through a simple purification process.

Description

Technology Field

[0001] The present invention relates to a method for high production of heparous acid using a recombinant Escherichia coli strain and to heparous acid produced thereby. Background Technology

[0003] Heparin is a negatively charged glycosaminoglycan that exhibits potent anticoagulant activity through interactions with antithrombin III and is essential in various clinical settings, including the prevention and treatment of cardiovascular diseases, hemodialysis, cardiopulmonary bypass, and the prevention of venous thromboembolism. Currently, most commercial heparin is extracted and purified from animal tissues, such as the small intestinal mucosa of pigs. However, this animal-derived production method entails ethical and social issues related to animal welfare and religious / cultural taboos, as well as raw material supply being concentrated in specific countries and regions, quality variability depending on rearing and slaughtering environments, the risk of contamination by animal pathogens (viruses, prions, etc.), and quality variations between batches (lots). In fact, following past incidents involving contaminated heparin, regulatory agencies and the industry have strongly emphasized the need for alternative technologies capable of simultaneously ensuring raw material traceability, quality consistency, and process reproducibility. Consequently, establishing a production platform for non-animal heparin and its precursors that does not rely on animal-derived raw materials is recognized as a critical technological challenge.

[0004] Heparosan is a non-sulfated polysaccharide composed of repeating units of 4-β-D-glucuronic acid (GlcA)-(1→4)-α-DN-acetylglucosamine (GlcNAc), and structurally corresponds to the non-sulfated precursors of heparin and heparan sulfate. Heparosan can be converted into heparin or heparin analogs with various structures and biological activities through appropriate chemical and enzymatic processes, undergoing modifications such as N-deacetylation, N-sulfation, O-sulfation, and epimerization. Due to its characteristic as a designable precursor, if heparosan can be stably supplied as a homogeneous starting material, there is an advantage in being able to more precisely control the activity, molecular weight distribution, and sulfation pattern of the final heparin formulation. Therefore, the technology to produce high-purity and high-yield heparic acid from microbial fermentation instead of animal tissue, and to manufacture heparin and related glycosaminoglycans of consistent quality based on this, is considered a key foundational technology for stabilizing the heparin supply chain and meeting regulatory requirements in the long term.

[0005] In this context, fermentation production strategies using non-pathogenic strains that naturally produce heparic acid are attracting attention as a promising approach that can replace or complement animal-derived processes. Escherichia coli Nissle 1917 (EcN) is a strain that has been used for a long time as a probiotic for humans, and its clinical safety has been accumulated. In particular, it is known to naturally produce heparic acid, making it suitable as a starting platform for the production of non-animal heparic acid. However, the amount of heparic acid produced by the wild-type EcN strain does not meet industrial requirements, and there is a problem that productivity is limited in terms of ensuring process economics.

[0006] Accordingly, the inventors completed the present invention by confirming that high concentrations of recombinant heparous acid can be produced by manufacturing a recombinant strain in which the heparous acid biosynthetic pathway (kfiACD gene group, etc.) is metabolically engineered while maintaining the inherent safety and fermentation suitability of EcN. Prior art literature

[0008] Korean Registered Patent No. 2857796 (September 5, 2025) discloses a method for producing heparous acid and bacteria of the genus Escherichia having the ability to produce heparous acid. Korean Published Patent No. 2024-0007134 (January 16, 2024) discloses a heparous acid-producing recombinant cell. The problem to be solved

[0009] The present invention provides a basis for establishing a stable supply of non-animal heparin precursors and related glycosaminoglycan materials by securing high-purity recombinant heparic acid dried product through high production of heparic acid using a recombinant strain according to the present invention and a simplified separation and purification process. means of solving the problem

[0011] The present invention glmS Genes and kpsS A first vector into which a gene is inserted to be overexpressed; and kfiA gene, kfiC Genes and kfiD Recombinant E. coli simultaneously transformed with a second vector inserted to overexpress a gene ( Escherichia coli Provides a strain.

[0012] As a preferred embodiment, the above-mentioned E. coli ( Escherichia coli The ) strain is, Escherichia coli It is Nissle 1917.

[0013] In a preferred embodiment, the first vector and the second vector are simultaneously expressed.

[0014] The present invention provides a method for producing heparosic acid comprising: step a of culturing a strain according to the present invention in a medium in which glycerol and glucose are mixed as carbon sources and obtaining a culture solution; and step b of purifying heparosic acid from the culture solution recovered in step a.

[0015] In the production method according to the present invention, the culture medium is more preferably made of high-protein plant powder or peptone as a nitrogen source.

[0016] In a more preferred embodiment, the medium is composed of glycerol; glucose; high-protein vegetable powder or peptone; and diammonium phosphate ((NH4)2HPO4).

[0017] In the present invention, the high-protein plant may be one or more selected from the group consisting of, for example, soybean, cottonseed, soy, canola / rapeseed, sunflower seed, peanut, sesame, safflower, linseed / flaxseed, palm kernel, and coconut copra.

[0018] In a production method according to the present invention, the purification comprises: a step 1 of centrifuging the culture medium to recover a supernatant containing heparic acid; a step 2 of adding a proteolytic enzyme to the supernatant containing heparic acid from step 1) to induce a protein hydrolysis reaction for the removal of protein; a step 3 of adding an acid solution to adjust the pH to 3.5 to 4.5 after the protein hydrolysis reaction of step 2) is completed; a step 4 of loading the supernatant containing heparic acid with the pH adjusted to 3.5 to 4.5 from step 3) into an anion exchange column and using a buffer solution to elute heparic acid from the column to obtain a heparic acid-containing solution; and a step 5 of performing TFF (Tangential flow filtration) on the heparic acid-containing solution obtained in step 4) to remove low molecular weight impurities. The process includes step 6, concentrating and freeze-drying the heparoic acid-containing solution after the TFF of step 5) above. Effects of the invention

[0020] The E. coli strain according to the present invention has the advantage of efficiently increasing the flux of the entire heparic acid biosynthetic pathway through the optimization of the dual plasmid system and promoter combination and the medium, thereby increasing the heparic acid production compared to the wild-type strain and enabling the securing of high-purity heparic acid even through a simple purification process. Brief explanation of the drawing

[0022] Figure 1 is a 3D graph showing the interaction of independent variables with respect to the response variable using response surface analysis, and the independent variables in each graph are as follows: (A) Glucose-Glycerol (B) Glucose-Diammonium Phosphate (C) Glucose-Peptone (D) Glycerol-Diammonium Phosphate (E) Glycerol-Peptone (F) Diammonium Phosphate-Peptone. Figure 2 shows the results of evaluating heparous acid production capacity in an optimized fermentation medium using recombinant strains EcN / Lac2_ACD and EcN / Lac1_GS with a single plasmid inserted, and an EcN / prayer strain that simultaneously expresses both plasmids. Figure 3 shows the results of evaluating heparic acid production capacity through the operation of a 5L fermenter using an EcN / prayer strain simultaneously expressing two plasmids and an optimized medium. Figure 4 shows recombinant heparic acid. 1 H-NMR and 13 C-NMR results are ((a) of K5 13 C-NMR, (b) of K5 1 H-NMR, (c) of recombinant heparosic acid 13 C-NMR, (b) of recombinant heparic acid 1 H-NMR). Specific details for implementing the invention

[0023] In the following, redundant content has been omitted to prevent clutter. In other words, the content of the invention is not limited solely to the following, and should be interpreted in accordance with the overall context of the invention.

[0024] Escherichia coli Nissle 1917(EcN) is known to naturally produce heparous acid, but the amount of heparous acid produced by wild-type EcN strains does not meet industrial requirements, and there is a problem that productivity is limited in terms of ensuring process economics.

[0025] To resolve these conventional problems, the inventors derived a recombinant strain and an optimal medium composition in which the heparic acid biosynthetic pathway (kfiACD gene group, etc.) was metabolically engineered while maintaining the inherent safety and fermentation suitability of EcN, and confirmed that high-concentration recombinant heparic acid can be produced and effectively isolated through a simple purification process.

[0026] That is, the strain according to the present invention can exhibit productivity improved by more than 6 times compared to the heparous acid production of the wild-type strain (EcN) by efficiently increasing the flux of the entire heparous acid biosynthetic pathway through the optimization of the dual plasmid system and promoter combination (trc and LacUV5) and by optimizing the medium for high heparous acid production.

[0027] Recombinant strain

[0028] Accordingly, the present invention glmS Genes and kpsS A first vector into which a gene is inserted to be overexpressed; and kfiA gene, kfiC Genes and kfiD Recombinant E. coli simultaneously transformed with a second vector inserted to overexpress a gene ( Escherichia coli ) provides a strain.

[0029] At this time, the above glmS gene, kpsS gene, kfiA gene, kfiC Genes and kfiD The gene is E. coli ( Escherichia coli It is preferable that it be of strain origin.

[0030] In a preferred embodiment, the first vector and the second vector are simultaneously expressed.

[0031] In the present invention, the first vector and the second vector are, glmS Genes and kpsSInserted to cause gene overexpression and kfiA gene, kfiC Genes and kfiD Except for the insertion of the gene to be overexpressed, the remaining structures may be identical or different. More preferably, the plasmid, copy site, and promoter may be composed of different elements, while other elements may have the same structure. As an example, the first vector may have the structure 'pLacUV5-glmS-kpsS-RSF_ori-kanR', and the second vector may have the composition 'pTrc-KfiA-KfiB-KfiC-AmpR-ColE1 ori.' As a more preferred example, the first vector may have the structure 'pLacUV5-RBS-glmS-RBS-kpsS-RSF_ori-kanR', and the second vector may have the composition 'pTrc-RBS-KfiA-RBS-KfiB-RBS-KfiC-AmpR-ColE1 ori.'

[0032] The term "vector" as used in the present invention refers to a recombinant vector capable of expressing a target protein in a suitable host cell, and means a peptide construct comprising an essential regulatory element operably linked to express the expression cassette (peptide insert).

[0033] As a preferred example, the vector may be any one selected from the group consisting of viral vectors, DNA or RNA expression vectors, plasmids, cosmids or phage vectors, DNA or RNA expression vectors linked with CCA (cationic condensing agents), and DNA or RNA expression vectors packed into liposomes.

[0034] For the purposes of the present invention, it is preferable to use a plasmid vector. A typical plasmid vector that can be used for this purpose may have a structure comprising (a) a replication initiation site that enables efficient replication to include tens to hundreds of plasmid vectors per host cell, (b) an antibiotic resistance gene that enables selection of host cells transformed with the plasmid vector, and (c) a restriction enzyme cleavage site that enables insertion of foreign DNA fragments.

[0035] As a desirable example, the expression plasmid in E. coli should have an inducible promoter, and an example is It may be one or more selected from the group consisting of pTrc systems (pTrc99a, pTrc99b, pTrc99c, etc.), pET systems (pET-series: pET3a, pET11a, pET15b, pET23b, etc.), pGEX systems (pGEX-series), pBAD systems (pBAD-series), and pCold systems (pCold-series). A more preferred example may be pTrc99a.

[0036] The pTrc system induces powerful warriors trc Using a promoter, lac Expression is regulated by the repressor LacI, and can be induced by the addition of IPTG (isopropyl-β-D-thiogalactoside). The pET system utilizes the bacteriophage T7 promoter and operates only in the presence of T7 RNA polymerase, and T7 RNA polymerase expression is induced by IPTG. The pGEX system (pGEX-series) is tac promoter or PIt uses promoters such as the inc. and expresses the target protein in the form of a GST (Glutathione S-Transferase) fusion protein, enabling easy separation and purification using affinity chromatography. The pBAD system (pBAD-series) is araBAD It uses an operon-derived arabinose inducible promoter, and expression levels can be controlled by using L-arabinose instead of IPTG as the inducer. The pCold system (pCold-series) uses an E. coli cold shock inducible promoter ( cspA It uses a promoter.

[0037] Even if a suitable restriction enzyme cleavage site is not present, the vector and foreign DNA can be easily ligated using a synthetic oligonucleotide adapter or linker according to conventional methods.

[0038] In addition, the above gene (a gene encoding the target protein to be expressed, i.e. glmS gene, kpsS gene, kfiA gene, kfiC Genes and kfiDA gene is operably linked when positioned in a functional relationship with another nucleic acid sequence. This may be a gene and a regulatory sequence(s) linked in such a way that gene expression is enabled when an appropriate molecule (e.g., a transcription-activating protein) binds to the regulatory sequence(s). For example, DNA for a pre-sequence or secretion leader is operably linked to DNA for a polypeptide when expressed as a pre-sequence protein participating in the secretion of a polypeptide; a promoter or enhancer is operably linked to a coding sequence when it influences the transcription of a sequence; or a ribosome binding site is operably linked to a coding sequence when it influences the transcription of a sequence; or a ribosome binding site is operably linked to a coding sequence when positioned to facilitate translation.

[0039] The linkage of these sequences is performed by ligation at a convenient restriction enzyme site. If such a site is not present, a synthetic oligonucleotide adapter or linker according to conventional methods may be used.

[0040] As used in the present invention, the term "operably connected" may refer to a gene (peptide) and an expression regulator connected in a manner that enables gene expression when a suitable molecule is bound to the expression regulator.

[0041] In addition, it may further include a tag gene for increasing the production of recombinant protein, a tag gene for maintaining the structural stability of recombinant protein, a tag gene for easily isolating recombinant protein, and a selection marker gene such as an antibiotic resistance gene for selecting transformants, and tags for easy isolation may include, but are not limited to, Avi tag, Calmodulin tag, polyglutamate tag, E tag, FLAG tag, HA tag, His tag, Myc tag, S tag, SBP tag, IgG-Fc tag, CTB tag, Softag 1 tag, Softag 3 tag, Strep tag, TC tag, V5 tag, VSV tag, Xpress tag, etc.

[0042] More preferably, an inducible promoter may be used as a promoter that can be introduced in one embodiment of the present invention. A preferred example of an inductive promoter may be any one selected from the group consisting of Tac promoter, lac promoter, lacUV5 promoter, 1pp promoter, pLλ promoter, prλ promoter, rac5 promoter, amp promoter, recA promoter, pepT promoter, sulA promoter, T7 promoter, pBAD promoter, Tet promoter, trc promoter, SP6 promoter, T3 promoter, T5 promoter, mg1 promoter, phoA promoter, lexA promoter, uvrA promoter, uvrB promoter, uvrD promoter, umuDC promoter, cea promoter, caa promoter, recN promoter, and pagC promoter. As a more desirable example, the above-mentioned inductive promoter may be a trc promoter or a lacUV5 promoter.

[0043] In a preferred embodiment, the present invention may position a ribosome binding sequence (RBS) before the start codon of each structural gene to increase the expression rate.

[0044] In the present invention, "RBS (ribosome binding site)," or "ribosome binding site," may refer to an RNA sequence found in mRNA to which a ribosome can bind to initiate translation. Ribosome holoenzymes bind to both the RBS and the start codon, and the start codon and all downstream elements can be translated by the ribosome, but are not limited thereto. In bacteria, both the RBS sequence and the start codon are almost always required for translation initiation, and in a registry, the protein-coding sequence can start with the start codon. Therefore, to construct a BioBrick system for producing proteins, the RBS portion must be selected and placed upstream of the protein-coding sequence to be translated; while the RBS is often defined as the part of the mRNA sequence that binds to the ribosome, surrounding sequences may also influence the rate of translation initiation, but are not limited thereto.

[0045] In the present invention, "antibiotic" refers to a compound having properties that have a negative effect on bacteria, such as lethality or reduced growth. Antibiotics may have a negative effect on Gram-positive bacteria, Gram-negative bacteria, or both. For example, antibiotics may affect cell wall peptidoglycan biosynthesis, cell membrane integrity, or DNA or protein synthesis in bacteria. Antibiotics active against Gram-positive bacteria may include, but are not limited to, methicillin, vancomycin, daptomycin, mupirocin, sozorapin, penicillin, cloxacillin, erythromycin, carbapenem, cephalosporin, glycopeptide, lincosamide, azithromycin, clarithromycin, roxithromycin, telithromycin, spiramycin, and fidaxomycin.

[0046] In the present invention, "KanR" refers to the Kanamycin resistance protein gene.

[0047] In the present invention, "antibiotic resistance gene" may be used as a marker for selecting a transformed host, and the type of antibiotic may refer to any antibiotic generally used in the art; in one embodiment of the present invention, a cannamycin resistance gene was used, but is not limited thereto.

[0048] In the present invention, the above-mentioned E. coli ( Escherichia coli The ) strain is preferably Escherichia coli It may be the Nissle 1917 strain. This strain has been used for a long time as a human agent, and its clinical safety has been accumulated. In particular, it is known to naturally produce heparic acid, making it suitable as a starting platform for the production of non-animal heparic acid.

[0049] According to one embodiment of the present invention, the present invention is a probiotic strain whose human safety has been verified. E. coli Based on Nissle 1917(EcN), a recombinant strain and manufacturing process for the high-efficiency production of heparic acid, a next-generation biomaterial, were established. By systematically overexpressing a gene cluster key to heparic acid biosynthesis, a production strain was constructed that achieves a heparic acid productivity of over 13.14 g / L in a 5 L fermenter. The produced recombinant heparic acid is 1 H-NMR, 13Structural characteristics were verified through C-NMR and LC-ESI-MS analysis, and it was confirmed that it is structurally consistent with a reference material. Consequently, this supports the fact that this technology has practical value as a probiotic-based heparous acid biomanufacturing platform and provides a supply base for high-purity heparous acid applicable to various biomaterial fields, including cosmetic raw materials.

[0050] Heparo acid production method

[0051] Meanwhile, the present invention provides a method for producing heparous acid comprising: step a of culturing a strain according to the present invention in a medium in which glycerol and glucose are mixed and used as carbon sources, and obtaining a culture solution; and step b of purifying heparous acid from the culture solution recovered in step a.

[0052] In the production method according to the present invention, the culture medium is more preferably made of high-protein plant powder or peptone as a nitrogen source.

[0053] In a more desirable embodiment, the high-protein plant powder is 'powder obtained by grinding defatted residue of a high-protein plant.' In the present invention, the term 'defatted residue' refers to a solid residue remaining after removing oil from a vegetable oil-containing raw material, which has an increased protein content relative to the raw material and can serve as an excellent nitrogen source.

[0054] In a more preferred embodiment, the medium is composed of glycerol; glucose; high-protein vegetable powder or peptone; and diammonium phosphate ((NH4)2HPO4).

[0055] In the present invention, the high-protein plant may be one or more selected from the group consisting of, for example, soybean, cottonseed, soy, canola / rapeseed, sunflower seed, peanut, sesame, safflower, linseed / flaxseed, palm kernel, and coconut copra.

[0056] In a more preferred embodiment, the medium may comprise 2.5–5.0 g / L glucose, 6.0–10.0 g / L glycerol, 8.0–10.0 g / L peptone (or soybean flour), and 3.5–8.0 g / L (NH4)2HPO4; more preferably, it may comprise 2.71–3.24 g / L glucose, 8.00–8.01 g / L glycerol, 9.00 g / L peptone (or soybean flour), and 4.09–7.84 g / L (NH4)2HPO4; and most preferably, 3.11 g / L glucose, 8.00 g / L glycerol, 9.00 g / L peptone (or soybean flour), and 7.07 g / L It may contain (NH4)2HPO4.

[0057] The above purification can be performed using an anion exchange column and / or a TFF system.

[0058] More preferably, the purification process comprises: step 1, centrifuging the culture medium to recover a supernatant containing heparic acid; step 2, adding a proteolytic enzyme to the supernatant containing heparic acid from step 1) to induce a protein hydrolysis reaction for the removal of protein; step 3, adding an acid solution to adjust the pH to 3.5 to 4.5 after the protein hydrolysis reaction of step 2) is completed; step 4, loading the supernatant containing heparic acid with the pH adjusted to 3.5 to 4.5 from step 3) onto an anion exchange column and using a buffer solution to elute heparic acid from the column to obtain a heparic acid-containing solution; step 5, performing tangential flow filtration (TFF) on the heparic acid-containing solution obtained from step 4) to remove low molecular weight impurities; and step 6, concentrating and freeze-drying the heparic acid-containing solution after the TFF of step 5) is completed.

[0059] The purification process is explained in more detail as follows.

[0061] <Step 1): Recovery of Heparic Acid-Containing Supernatant>

[0062] This step is a process of recovering a supernatant containing heparosan by centrifuging a culture obtained by culturing the strain according to the present invention in a medium in which glycerol and glucose are mixed as carbon sources.

[0063] In a more preferred embodiment, the centrifugation is preferably performed at 8,000 to 15,000 × g for 15 to 50 minutes, more preferably at 10,000 to 13,000 × g for 25 to 45 minutes, and most preferably at 12,000 × g for 30 minutes. Through this process, bacterial cells and other insoluble cell debris in the culture medium can be removed.

[0065] <Step 2): Induction of Protein Hydrolysis Reaction>

[0066] This step is a process of adding a protease to the supernatant containing heparous acid from step 1) to induce a protein hydrolysis reaction for the removal of protein.

[0067] At this time, the above-mentioned protease can be applied without limitation as long as it is a protease capable of achieving the purpose of removing protein impurities during heparic acid purification, such as trypsin, chymotrypsin, and various commercial protease products derived from animal tissue extracts or microorganisms (bacteria, fungi, etc.). These enzymes are added to the supernatant containing heparic acid to hydrolyze proteins into smaller peptides or amino acids, and then remove protein components through additional purification processes such as filtration or precipitation, thereby facilitating the additional purification process.

[0069] <Step 3): pH Adjustment>

[0070] This step is a process of adjusting the pH to 3.5 to 4.5 by adding an acid solution after the protein hydrolysis reaction of step 2) above is completed.

[0071] At this time, the acid solution may be a hydrochloric acid (HCl) or acetic acid solution. Through this process, the stability of heparo acid can be maintained, the efficiency of impurity removal maximized, and the efficiency of subsequent processes improved.

[0072] When culturing microorganisms that produce heparic acid, the pH must be maintained within a certain range to ensure optimal growth and production conditions. Generally, the pH is maintained between 6 and 8, and when the pH drops, ammonium hydroxide (NH4OH) is added to adjust it. However, since polysaccharides such as heparic acid are separated from impurities (such as proteins) by utilizing the characteristic that they precipitate or have different solubility within a specific pH range, heparic acid can be separated by adjusting the pH to 3.5 to 4.5, more preferably to pH 4, in order to increase the recovery rate of heparic acid and precipitate it.

[0074] <Step 4): Anion Exchange Column Loading and Heparo Acid Elution>

[0075] This step is a process of loading the supernatant containing heparic acid, with the pH of the above step 3) adjusted to 3.5 to 4.5, into an anion exchange column, and using a buffer solution to elute heparic acid from the column to obtain a heparic acid-containing solution.

[0076] In a more preferred embodiment, the resin that can be packed into the available anion exchange column is a basic anion exchange resin selected from the group consisting of DEAE resin, D204 resin, AmberLite FPA98 Cl, D254 or D208 resin, Dowex and Duolite series resins and Ionex. In a most preferred embodiment, the anion exchange column is a column packed with DEAE resin.

[0077] DEAE resin is a weakly basic anion exchange resin such as DEAE (Diethylaminoethyl) Sepharose. D204 resin is a macroporous adsorption resin based on styrene-divinylbenzene with quaternary ammonium functional groups, AmberLite FPA98 Cl is a product manufactured by DuPont that has a macroporous matrix with a cross-linked acrylic structure, and D254 or D208 resins are strongly basic amido organic polymer porous resins used in the separation and purification process of sodium heparin. Dowex and Duolite series resins are various commercial ion exchange resins such as Dowex-1, Dowex-2, Amberlite CG-45, and Duolite A-4 that have been designed and tested for heparin recovery, and ionex is a product in the form of anion exchange resin fibers used as a heparin adsorbent.

[0078] The aforementioned resins are effective for separating impurities by utilizing the high negative charge characteristics of heparic acid.

[0079] In addition, the above buffer solution can be appropriately selected by considering the characteristics of anion exchange chromatography performed by taking into account the isoelectric point and pH conditions of the target molecule, and more appropriately, heparic acid can be eluted from the resin using a gradient that gradually increases the concentration of a salt such as sodium chloride (NaCl).

[0081] <Step 5): Perform TFF (Tangential Flow Filtration)>

[0082] This step is a process of performing TFF (Tangential flow filtration) on the heparoic acid-containing solution obtained in step 4) to remove low molecular weight impurities.

[0083] TFF (Tangential flow filtration) is a method in which fluid is flowed parallel to the membrane surface (cross-flow) to allow solvents or low-molecular-weight substances to pass through fine pores, while target substances (proteins, viruses, cells, etc.) are separated from the membrane surface to concentrate, purify, and desalt. Unlike general filtration (dead-end), it is efficient as it reduces clogging on the membrane surface, and the size of the substances being separated can be controlled depending on the type of membrane (microfiltration / ultrafiltration).

[0084] In a more preferred embodiment, the process may be performed by repeatedly dialysis filtration using an MWCO 3 kDa membrane on the heparoic acid-containing solution obtained in step 4) above, and by measuring the electrical conductivity of the filtrate during the repeated dialysis filtration and terminating the dialysis filtration in the cycle where the conductivity becomes 0.1 mS / cm or less.

[0086] <Step 6): Concentration and Drying>

[0087] This process involves concentrating and freeze-drying the heparoic acid-containing solution after the completion of the TFF in step 5) above. Through this process, a high content of heparoic acid can be obtained, ensuring long-term stability of the product, preventing quality degradation, and facilitating storage and transportation.

[0089] That is, by performing the process as described above, the present invention allows for the cultivation of the strain according to the present invention in a medium optimized for high heparous acid production, thereby enabling the production of a purified product with a heparous acid purity of approximately 89.2% through a simple purification process.

[0091] The contents of the present invention will be explained in more detail below through the following examples or experimental examples. However, the scope of the present invention is not limited to the following examples or experimental examples, but includes variations of equivalent technical concepts.

[0093] [ Examples 1: Heparo acid Production of high-production recombinant strains]

[0094] To overexpress the key gene involved in heparous acid biosynthesis, two expression plasmids were constructed. The expression vector used was the pTrc99A (Novo pro, V012683) vector.

[0095] The target genes for overexpression are key genes corresponding to region 2 of the heparic acid biosynthetic gene cluster (kps gene cluster), and are KfiACD, the polymerase of heparic acid. Additionally, the glmS gene, which is reported as a bottleneck step in the N-acetyl-glucosamine (GlcNAc) biosynthetic pathway, a precursor of heparic acid, and the kpsS gene, known as a bottleneck step in the capsule polysaccharide transport gene cluster (region 1) of the kps gene cluster, were additionally overexpressed.

[0096] As for the inserted gene E. coli Nissle The endogenous genes of 1917, kfiA (UDP-N-acetylglucosamine transferase), kfiC (UDP-glucuronic acid transferase), kfiD (UDP-glucose 6-dehydrogenase), glmS (L-glutamine-D-fructose-6-phosphate aminotransferase) and kpsS (Group II capsule polymerase), were used, and these genes were divided and inserted into two expression plasmids.

[0097] In addition, ribosome binding sequences (RBS) were placed before the start codons of each structural gene to increase expression rates. Since plasmids must be simultaneously expressed within a single strain, the antibiotic resistance gene, replication origin, and promoter were replaced with the kanamycin resistance gene (KanR), the RSF replication origin, and the LacUV5 promoter, respectively. PCR products were obtained for the promoter and replication origin using the pRSFDuet-1 plasmid as a template.

[0098] Specifically, the LAC1_GS vector has the composition 'pLacUV5-RBS-glmS-RBS-kpsS-RSF_ori-kanR', and the LAC2_ACD vector has the composition 'pTrc-RBS-KfiA-RBS-KfiB-RBS-KfiC-AmpR-ColE1 ori.'. In this case, the sequence of RBS is shown in SEQ ID NO. 6 (5'-AGGAGG-3'). The specific sequences of the primers used to prepare the corresponding vectors are shown in Table 1 and Table 2 below, respectively.

[0099] After assembling the gene PCR fragment and backbone vector (trc99a) into a recombinant plasmid using homologous recombination Escherichia coli It was introduced into DH5α and used as a recombinant plasmid clone strain.

[0100] It was confirmed by NGS sequencing that the two recombinant plasmids matched the reference sequence 100%. Accordingly, after transforming the expression strain EcN, it was confirmed through Colony PCR that both plasmids were inserted.

[0101] Primers used when creating AC1_GS vectors Primer name nucleotide sequence (5'→3') Sequence number glmS_F AGACCATGGAATTCGAGCTAGGAggCAGCGTATGATTGTTGCAAATATGTCATCA 1 glmS_R TCTGCGTTCATACGCTGCCTCCTTTCTAGATTACCCTTCCACATTATACACT 2 kpsS_F CTAGAAAGGAGGCAGCGTATGAACGCAGAATATATAAATTTAG 3 kpsS_R CGCTGccTCCTATAGCCCCAAAAATCTATTGTTCAATTATTCCTGATACA 4 RSF_ori_F TTTGCGTTTCTACAAACTCTAACGGAATAGCTGTTCGTT 5 KanR_R GGTGTTGGCGGGTGTCGGGGTTAGAAAAACTCATCGAGCATCAAAT 7 V2_F CCCCGACACCCGCCAACACC 8 V2_R AGAGTTTGTAGAAACGCAAA 9

[0102] Primers used when creating LAC2_ACD vectors Primer name nucleotide sequence (5'→3') Sequence number kfiA_F AGACCATGGAATTCGAGCTAGGAggCAGCGTATGATTGTTGCAAATATGTCATCA 10 kfiA_R TCTGCGTTCATACGCTGCCTCCTTTCTAGATTACCCTTCCACATTATACACT 11 kfiC_F CTAGAAAGGAGGCAGCGTATGAACGCAGAATATATAAATTTAG 12 kfiC_R CGCTGccTCCTATAGCCCCAAAAATCTATTGTTCAATTATTCCTGATACA 13 kfiD_F ATAGATTTTTGGGGCTATAGGAGGCAGCGTATGTTCGGAACACTAAAAATAACT 14 kfiD_R GTCGACTCTAGAGGATCCCCGGGTACCTTAGTCACATTTAAACAAATCGCG 15 Trc99a_F TAAATGTGACTAAGGTACCCGGGGATCCTCT 16 Trc99a_R AACAATCATACGCTGccTCCTAGCTCGAATTCCATGGTCT 17

[0104] [ Examples 2: Recombination Heparo acid [Production Media Optimization]

[0105] 1. Fermentation medium Optimization

[0106] Using statistical methods (response surface analysis), E. coli Nissle The aim was to determine the optimal medium point for high-concentration heparic acid production in the (EcN) 1917 strain. A Central Composite Design (CCD) experiment was utilized; Glucose (A), Glycerol (B), (NH4)2HPO4 (C), and Peptone (D) were used as independent variables, and heparic acid concentration was set as the response variable. To reach the optimal region, response surface analysis was performed a total of three times, and statistically significant ( p A second-order model equation was derived (Table 1, Equation 1). The R-Squared value was 0.772, statistically confirming the explanatory power of the model equation. The interactions between independent variables were identified using a 3D interaction graph, and it was confirmed that there is an optimal region within the range of investigated experimental points. However, in the case of peptone, the response variable increased as the concentration increased, showing a linear trend, so an optimal region was not identified. This was interpreted as a phenomenon where the demand for nitrogen sources relatively increases due to the reduced efficiency of carbon source utilization caused by low oxygen transfer in flasks. Therefore, while a clear evaluation of the medium effect will be further verified in a fermenter where oxygen transfer is controlled, the corresponding point was set as the optimal region at the flask level.

[0107] Since it was confirmed that a statistically significant optimal model had been established and that the experimental point was near the optimal region, the optimal point was secured based on the derived quadratic equation (Fig. 1). Fig. 1 is a 3D graph showing the interaction of independent variables with respect to the response variable using response surface analysis, and the independent variables in each graph are as follows: (A) Glucose-Glycerol (B) Glucose-Diammonium Phosphate (C) Glucose-Peptone (D) Glycerol-Diammonium Phosphate (E) Glycerol-Peptone (F) Diammonium Phosphate-Peptone.

[0108] Since the yield was maintained at a high level even when peptone was replaced with soybean flour (defatted soybean meal powder), a nitrogen source derived from by-products, in medium combination 1, it was confirmed that peptone or soybean flour can be used as the nitrogen source alone in the optimal medium combination.

[0109] ANOVA analysis results Response: HP ANOVA for Response Surface Quadratic Model Analysis of variance table [Partial sum of squares] Source SS DF MS F value Prob > F Model 9114.02 14 651.00 3.39 0.0146 significant A 1308.33 1 1308.33 6.82 0.0205 B 233.13 1 233.13 1.22 0.2889 C 62.73 1 62.73 0.33 0.5765 D 5174.41 1 5174.41 26.97 0.0001 A2 1059.70 1 1059.70 5.52 0.0339 B2 204.75 1 204.75 1.07 0.3191 C2 69.86 1 69.86 0.36 0.5559 D2 0.31 1 0.31 0.00 0.9685 AB 53.29 1 53.29 0.28 0.6064 AC 90.25 1 90.25 0.47 0.5040 AD 30.25 1 30.25 0.16 0.6973 BC 0.09 1 0.09 0.00 0.9830 BD 590.49 1 590.49 3.08 0.1012 CD 26.01 1 26.01 0.14 0.7182 Residual 2685.79 14 191.84 Lack of Fit 1496.87 10 149.69 0.5036021 0.8272 not significant Pure Error 1188.93 4 297.232 Cor Total 11799.81 28

[0110] [Mathematical Formula 1]

[0111]

[0112] Number Glc Gly (NH4)2HPO4 peptone HP Desirability 1 3.11 8.00 7.07 9.00 106.217 0.870 2 2.98 8.00 6.69 9.00 106.212 0.870 3 2.96 8.00 6.74 9.00 106.211 0.870 4 3.08 8.00 6.85 9.00 106.196 0.870 5 3.10 8.00 6.45 9.00 106.179 0.869 6 3.23 8.00 6.57 9.00 106.16 0.869 7 2.97 8.01 7.06 9.00 106.139 0.869 8 3.22 8.00 6.40 9.00 106.119 0.869 9 3.24 8.00 7.84 9.00 106.08 0.868 10 2.71 8.00 4.09 9.00 104.968 0.855

[0114] The following medium combination was completed by adding a combination of inorganic salts necessary for E. coli culture to the optimal point (No. 1).

[0115] Production medium: 3.11 g / L glucose, 8.0 g / L glycerol, 9 g / L peptone (or soybean flour), 7.69 g / L KH2PO4, 7.07 g / L (NH4)2HPO4, 1.4 g / L MgSO4 4·7H2O, 1.7 g / L citric acid, 0.1 g / L thiamine, 10.0 mL trace metal solution (per liter of 5 M HCl) 10.0 g / L FeSO4 · 7H2O, 2.0 g / L CaCl2, 2.2 g / L ZnSO 4· 7H2O, 0.5 g / L MnSO4 · 4H2O, 1.0 g / L CuSO4 · 5H2O, 0.1 g / L (NH4)6Mo7O 24 · 4H2O, and 0.02 g / L Na2B4O 7· 10H2O).

[0117] [ Examples 3: By Recombinant Strain Heparo acid [Production Comparison]

[0118] 1. 5L fermentation tank operation

[0119] To compare the heparic acid production of three recombinant strains, fermentation was performed in a 5-liter fermenter using the optimal medium combination. Glycerol stock was inoculated into 15 ml of LB broth at a ratio of 1% (v / v), followed by primary liquid culture for 10 hours at 220 rpm and 37°C. Subsequently, 100 ml of working volume medium was inoculated at 10% (v / v), and secondary shaking culture was carried out for 10 hours under the same conditions; a portion of this secondary culture was used as an inoculum for production culture in a 5-liter fermenter. For the recombinant strains EcN / Lac1_GS, EcN / Lac2_ACD, and EcN / prayer, Kanamycin 50 ppm and Ampicillin 100 ppm, and Kanamycin 50 ppm + Ampicillin 100 ppm were added to all cultures to maintain the plasmids.

[0120] Initial culture was performed in a 5 L fermenter (Centrion, Korea) with a working volume of 2.0 L, and air injection and stirring speed were controlled at 1 vvm to maintain DO above 30% during culture. To induce gene expression during culture, IPTG was added at a concentration of 0.2 mM when the OD reached 20 or higher. Concentrated medium was supplied from the point when dissolved oxygen (DO) reached above 30% to maintain culture for 80 to 100 hours.

[0121] Fermentation medium: 20 g / L glucose, 13.5 g / L KH2PO4, 4.0 g / L (NH4)2HPO4, 1.4 g / L MgSO4 4· 7H2O, 1.7 g / L citric acid, 0.1 g / L thiamine, 10.0 mL trace metal solution (per liter of 5 M HCl) 10.0 g / L FeSO4 · 7H2O, 2.0 g / L CaCl2, 2.2 g / L ZnSO 4· 7H2O, 0.5 g / L MnSO4 · 4H2O, 1.0 g / L CuSO4 · 5H2O, 0.1 g / L (NH4)6Mo7O 24 · 4H2O and 0.02 g / L Na2B4O 7· 10H2O), Tryptone 4 g / L, Yeast extract 6 g / L

[0122] Supply medium: 600 g / L glucose, 0.1 g / L thiamine, 6.02 g / L MgSO4 · 7H2O, Tryptone 4 g / L, Yeast extract 6 g / L

[0123] pH Alkali solution: 30% Ammonium hydroxide

[0125] 2. Heparo acid production capacity evaluation

[0126] To investigate the increase in heparous acid production capacity of recombinant strains EcN / Lac2_ACD and EcN / Lac1_GS, each inserted with a single plasmid, and the EcN / prayer strain simultaneously expressing both plasmids, fed-batch culture was performed in a 5-liter fermenter, and the results were compared. In a 5-liter fermenter (Centrion, Korea), initial culture was carried out with a working volume of 2.0 L, and air injection and stirring speed were controlled at 1 vvm to maintain DO above 30% during culture. To induce gene expression during culture, IPTG was added at a concentration of 0.2 mM when the OD reached 20 or higher. Concentrated medium was supplied from the point when dissolved oxygen (DO) reached above 30%, and culture was maintained for 80 to 100 hours.

[0127] To this end, the three types of EcN cultures mentioned above were each centrifuged at 12,000 rpm for 20 minutes to obtain the supernatant, and then 4 times the volume of ethanol was added to precipitate heparic acid. After leaving the mixture at -20°C for 4 hours, the heparic acid pellet was recovered by centrifuging at 4,000 rpm for 20 minutes at 4°C. The pellet was air-dried and redissolved in a 0.15 M NaCl solution. The heparic acid content was quantified using the carbazole method as reported in the existing literature [Bitter T, Muir HM. (1962) "A Modified Uronic Acid Carbazole Reaction." Analytical Biochemistry 4(4):330].

[0128] Experimental results showed a production yield of 1.94 g / L in the wild-type strain (WT), 2.8 g / L in the EcN / Lac1_GS strain, 9.24 g / L in the EcN / Lac2_ACD strain, and 13.66 g / L in the EcN / prayer strain. Among the strains with a single plasmid inserted, the EcN / Lac2_ACD strain, which overexpresses HP polymerase, showed a higher production yield than the EcN / Lac1_GS strain, and the EcN / prayer strain, which expresses both plasmids, showed the highest production yield compared to the strain expressing a single plasmid (Fig. 2). Fig. 2 shows the results of evaluating the heparic acid production capacity in an optimized fermentation medium using the recombinant strains EcN / Lac2_ACD and EcN / Lac1_GS with a single plasmid inserted, and the EcN / prayer strain, which simultaneously expresses both plasmids.

[0129] In the high-productivity EcN / Lac2_ACD and EcN / prayer strains, the heparic acid production yields (HP mg / OD) were 262 and 529, respectively, which were higher than the production yield of the parent strain, 48.7.

[0130] The above results suggested that the overexpression of the heparic acid biosynthesizing enzyme (KfiACD) is key to enhancing heparic acid production. Furthermore, by simultaneously inserting the Lac1_GS plasmid, which overexpresses glmS—a bottleneck step in the biosynthetic pathway of UDP-N-acetylglucosamine, a heparic acid precursor—which enhanced heparic acid production, it was confirmed that the simultaneous expression of the two recombinant plasmids exhibits a synergistic effect in enhancing heparic acid biosynthesis.

[0132] [ Examples 4: Recombination using the optimal point of the fermentation medium Heparo acid Production culture ]

[0133] 1. 5L fermentation tank operation

[0134] In this study, culture was performed in a 5-liter fermenter using EcN / prayer, a high-productivity strain with optimal medium characteristics developed in this study. Glycerol stock of the EcN / prayer strain was inoculated into 15 ml of LB broth (kanamycin 50 ppm, ampicillin 100 ppm) at a ratio of 1% (v / v), and primary liquid culture was performed for 10 hours at 220 rpm and 37°C. Subsequently, a secondary shaking culture was carried out for 10 hours under the same conditions after inoculating 100 ml of working volume medium at a ratio of 10% (v / v), and a portion of this secondary culture was used as an inoculum for production culture in a 5 L fermenter.

[0135] Initial culture was performed in a 5 L fermenter (Centrion, Korea) with a working volume of 2.0 L, and air injection and stirring speed were controlled at 1 vvm to maintain DO above 30% during culture. To induce gene expression during culture, IPTG was added at a concentration of 0.2 mM when the OD reached 20 or higher. Concentrated medium was supplied from the point when dissolved oxygen (DO) reached above 30% to maintain culture for up to 70 hours.

[0136] Fermentation medium: 3.11 g / L glucose, 8.0 g / L glycerol, 9 g / L peptone (or soybean), 7.69 g / L KH2PO4, 7.07 g / L (NH4)2HPO4, 1.4 g / L MgSO4 · 7H2O, 1.7 g / L citric acid, 0.1 g / L thiamine, 10.0 mL trace metal solution (per liter of 5 M HCl) 10.0 g / L FeSO4 · 7H2O, 2.0 g / L CaCl2, 2.2 g / L ZnSO4 · 7H2O, 0.5 g / L MnSO4 · 4H2O, 1.0 g / L CuSO 4·5H2O, 0.1 g / L (NH4)6Mo7O 24· 4H2O, and 0.02 g / L Na2B4O 7· 10H2O).

[0137] Supply medium: 167.96 g / L glucose, 432.05 g / L glycerol, 0.1 g / L thiamine, 6.02 g / L MgSO₄ 4· 7H2O, 9 g / L Soybean flour

[0138] pH Alkali solution: 30% Ammonium hydroxide

[0140] 2. Heparo acid production capacity evaluation

[0141] As a result of evaluating heparic acid production capacity, the lag phase grew rapidly at a short level, and the OD value reached a maximum of 122 at 62 hours of culture. Heparic acid increased rapidly from 21 hours to 69 hours of culture, reaching a final concentration of 13.14 g / L. Concentrated medium was supplied from the point when the carbon source in the culture vessel was depleted and continued until the end of the culture, and all supplied carbon sources were depleted at the end of the culture.

[0142] The efficiency of heparic acid in the corresponding culture was 116.28 HP mg·L -1 ·OD600 -1 , 56.37 HP mg·C-source g -1 , and a productivity of 0.188 g / L / h was derived (0.34 HP g·DCW g according to the OD-cell mass regression curve (Y(OD)=2.918X(DCW)+0.18)). -1(Calculated based on the yield of the dry weight of the cells). It induced an increase in productivity of more than 40% and a reduction in culture time of more than 30 hours compared to the media presented in existing literature (Fig. 3). Fig. 3 shows the results of evaluating the heparic acid production capacity through the operation of a 5L fermenter using an EcN / prayer strain that simultaneously expresses two plasmids.

[0143] The use of a mixed carbon source of glucose and glycerin played a key role in the shortening of culture time and the short lag phase observed in the culture. Since glucose induces catabolite repression to suppress the expression of the kps gene cluster, when used as a single carbon source, the initiation of expression of the target product biosynthetic gene is delayed due to cAMP-CRP-mediated transcriptional repression; consequently, an extension of the lag phase was observed, in which the transition to target product production lagged behind cell growth.

[0144] In order to overcome these limitations, the present invention designed and applied a culture medium strategy in which glycerol is induced as the primary carbon source for cell growth and biomass accumulation, and glucose is supplied at a low concentration so that it functions only in the heparous acid biosynthesis step. Through this strategy, a positive effect was achieved in reducing the culture time by 30 hours compared to existing literature. Furthermore, in the culture medium used in the present invention, soybean flour and glycerol are byproduct-derived medium sources with low production costs, so they can be considered as base media that can be utilized during scale-up.

[0146] [ Examples 5: Recombination Heparo acid [Separation and Purification]

[0147] 1. Separation and Purification

[0148] The culture medium in a 5 L fermentation tank was centrifuged at 12,000 × g for 30 minutes to recover the supernatant (containing heparic acid). To remove high-molecular-weight proteins from the complex medium, a protease was treated at 48°C for 6 hours, and after the reaction was finished, glacial acetic acid was added to adjust the pH to 3.5–4.5.

[0149] DEAE Sepharose Fast Flow resin was packed into the column in a volume corresponding to 20 mg / mL heparoic acid, and then buffer A (pH 4, 20 mM sodium acetate buffer, 50 mM NaCl) was equilibrated to a volume of 3 CV (column volume). Subsequently, the fermentation supernatant was loaded into the column and washed with buffer A at 5 times the column volume. Then, heparoic acid was eluted from the column using buffer B (pH 4, 20 mM sodium acetate buffer, 1 M NaCl).

[0150] To remove low molecular weight impurities contained in the eluted heparic acid solution, dialysis filtration using a MWCO 3 kDa membrane was repeatedly performed, and the electrical conductivity of the filtrate was measured at each run, and the dialysis filtration was terminated at the run where it reached 0.1 mS / cm. After dialysis filtration, the heparic acid solution was concentrated three-fold and freeze-dried to obtain pure powder.

[0152] 2. Purity and Impurity Analysis

[0153] The heparic acid content in the purified powder was analyzed using the H-NMR internal quantification method (internal standard: disodium terephthalate). The analysis value was derived as purity using the following Equation 2. Protein content was measured using the Pierce Bradford Plus Protein Assay Kit (Thermo, 23236), and nucleic acid content was evaluated by absorbance at 260 nm.

[0154] [Mathematical Formula 2]

[0155]

[0156] C Analyte : Molar concentration of analyte

[0157] C IS : Internal standard molar concentration

[0158] I Analyte : Analyte peak integration

[0159] I IS : Internal standard peak integral

[0160] N Analyte , N IS : Number of protons contributing to each peak

[0162] As a result of the experiment, the integration ratio (Heparosan / ISTD) was analyzed to be 0.412. The molar concentration of heparosan was calculated using Equation 2, and the purity was confirmed to be 89.2%. The content of impurities (protein and nucleic acid) in the existing purified product was analyzed, and the nucleic acid content was measured to be 0.001% or less (0.024 μg / ml) relative to the dry matter content, and the protein content was 0.039% (3.5 μg / ml).

[0164] [ Experimental Example 1: Recombination Heparo acid [Structural Analysis]

[0165] 1. NMR Analysis

[0166] 1 H-NMR and 13 Chemical shifts to hydrogen and carbon in the recombinant heparic acid (Example 4) molecule were confirmed through C-NMR analysis. Heparic acid was dissolved in D2O (99.99+ atoms) at a concentration of 10 mg / mL, freeze-dried to remove exchangeable protons, redissolved in D2O, and transferred to a standard 5 mm NMR tube. NMR analysis was performed using a Bruker 600 MHz NMR spectrometer.

[0167] As a result of the experiment, the recombinant heparosic acid according to the present invention is a reference substance E. coli Since it showed the same chemical shift (ppm) as K5-derived heparosan (Yanying Yu et al. Biotechnol. Bioeng., 2023;120:1081-1096 "Chromosome evolution of Escherichia coli Nissle 1917 for high-level production of heparosan"), it was confirmed that recombinant heparosan is a non-sulfurized polymer composed of 4-β-D-GlcA(1→4)-α-D-GlcNAc repeating units (Table 5).

[0168] ¹H NMR Chemical Shifts (ppm) Assignment K5 (ppm) EcN / prayer (ppm) Methyl H of GlcNAc 1.95 1.97 H-2 atom of GlcA 3.28 3.29 H-4 atom of GlcNAc and H-3, H-4 atoms of GlcA 3.60 3.61 H-5 atoms of GlcA 3.66 3.67 H-2, H-3, H-5, and H-6 of GlcNAc 3.77 3.79 H-1 atom of GlcA 4.41 4.42 H-1 atom of GlcNAc 5.31 5.32 ¹³C NMR Chemical Shifts (ppm) Assignment K5 (ppm) EcN / prayer (ppm) Methyl C of GlcNAc 21.87 21.84 C-2 atom of GlcNAc 53.18 53.16 C-6 atom of GlcNAc 59.31 59.23 C-4 atom of GlcA 78.34 78.34 α-anomeric C-1 atom of GlcNAc 96.72 96.75 β-anomeric C-1 atom of GlcA 102.35 102.38 C atom of the carboxyl group of GlcA 174.92 174.68

[0170] Through this, the GlcA·GlcNAc composition, α / β anomer configuration, 1→4 bonding mode, and the presence of N-acetyl groups and glucuronic acid were all verified (Fig. 4). Fig. 4 shows the recombinant heparosic acid. 1 H-NMR and 13 C-NMR results are ((a) of K5 13 C-NMR, (b) of K5 1 H-NMR, (c) of recombinant heparosic acid 13 C-NMR, (b) of recombinant heparic acid 1 H-NMR).

Claims

Claim 1 Having high heparic acid production capacity under a medium containing 8.00 to 8.01 g / L glycerol and 2.71 to 3.24 g / L glucose as a carbon source, glmS Genes and kpsS A first vector into which a gene is inserted to be overexpressed; and kfiA gene, kfiC Genes and kfiD Recombinant E. coli simultaneously transformed with a second vector inserted to overexpress a gene ( Escherichia coli ) strain. Claim 2 In paragraph 1, the above E. coli ( Escherichia coli The ) strain is, Escherichia coli Nissle 1917, strain. Claim 3 A strain according to claim 1, wherein the first vector and the second vector are simultaneously expressed. Claim 4 A method for producing heparosic acid, comprising: step a of culturing a strain according to claim 1 in a medium containing 8.00 to 8.01 g / L glycerol and 2.71 to 3.24 g / L glucose as carbon sources, and obtaining a culture solution; and step b of purifying heparosic acid from the culture solution recovered in step a. Claim 5 A method for producing heparous acid according to claim 4, wherein the medium further uses high-protein plant powder or peptone as a nitrogen source. Claim 6 A method for producing heparous acid according to claim 5, wherein the medium is composed of 8.0 to 8.01 g / L glycerol; 2.71 to 3.24 g / L glucose; high-protein vegetable powder or peptone; and diammonium phosphate ((NH4)2HPO4). Claim 7 A method for producing heparous acid according to claim 5, wherein the high-protein plant is one or more selected from the group consisting of soybean, cottonseed, soy, canola / rapeseed, sunflower, peanut, sesame, safflower, linseed / flaxseed, palm kernel, and coconut copra. Claim 8 In claim 4, the purification comprises: step 1, centrifuging the culture medium to recover the supernatant containing heparic acid; step 2, adding a protease to the supernatant containing heparic acid from step 1) to induce a protein hydrolysis reaction for the removal of protein; step 3, adding an acid solution to adjust the pH to 3.5–4.5 after the protein hydrolysis reaction of step 2) is completed; step 4, loading the supernatant containing heparic acid with the pH adjusted to 3.5–4.5 from step 3) onto an anion exchange column and using a buffer solution to elute heparic acid from the column to obtain a heparic acid-containing solution; and step 5, performing TFF (Tangential flow filtration) on the heparic acid-containing solution obtained in step 4) to remove low molecular weight impurities. A method for producing heparosic acid, comprising a process including: concentrating and freeze-drying the heparosic acid-containing solution after the completion of the TFF in step 5); and step 6).

Images