CELL PENETRATING PEPTIDES
Patent Information
- Application Number
- MX2021001545
- Authority / Receiving Office
- MX · MX
- Patent Type
- Patents
- Current Assignee / Owner
- Priority Date
- 2018-08-09
- Filing Date
- 2021-02-08
- Publication Date
- 2026-02-25
- Estimated Expiration
- 2039-08-09
AI Technical Summary
Current cell penetrating peptides (CPPs) used for delivering antisense oligonucleotides to treat muscular dystrophies like DMD face challenges of inefficiency and toxicity, limiting their therapeutic application in humans.
Development of short peptides with a specific structure containing two or more cationic domains and one hydrophobic domain, devoid of artificial amino acids, which are covalently linked to therapeutic molecules to enhance cell penetration and reduce toxicity.
The peptides demonstrate improved efficacy in delivering therapeutic molecules to muscle tissues, achieving higher exon skipping and dystrophin production with reduced toxicity, making them suitable for human treatment.
Abstract
Description
CELL PENETRATING PEPTIDES Technical field of the invention The present invention relates to peptides, in particular cell-penetrating peptides, and to conjugates of such cell-penetrating peptides with a therapeutic molecule. The present invention further relates to the use of such peptides or conjugates in treatment methods or as a medicament, especially in the treatment of genetic disorders and in particular muscular dystrophies, such as Duchenne muscular dystrophy. Background of the invention Nucleic acid drugs are genomic medicines with the potential to transform human healthcare. Research has indicated that such therapeutic agents could have applications across a wide range of disease areas, including neuromuscular disease. The application of antisense oligonucleotide-based methods to modulate pre-mRNA splicing in Duchenne muscular dystrophy (DMD) has placed this monogenic disorder at the forefront of precision medicine advances. However, the therapeutic development of these antisense therapeutic agents has been hampered by their characteristics of insufficient cell penetration and poor distribution, a challenge that is further emphasized by the large volume and dispersed nature of the muscle tissue substrate in DMD. DMD affects one in every 3,500 newborn boys. This severe, X-linked recessive disease results from mutations in the DMD gene, which encodes the dystrophin protein. The disorder is characterized by progressive muscle wasting and degeneration, along with the development of respiratory failure and cardiac complications, ultimately leading to premature death. Most mutations that cause DMD are out-of-frame deletions, which induce premature truncation of the open reading frame, resulting in the absence of the dystrophin protein. Exon skipping therapy uses splice-switching antisense oligonucleotides (SSOs) to target specific regions of the DMD transcript, inducing the exclusion of individual exons, restoring aberrant reading frames, and resulting in the production of an internally deleted, yet still partially functional, dystrophin protein. Despite the undeniable potential of antisense oligonucleotide exon skipping therapy for DMD, the successful application of this strategy is currently limited by relatively inefficient targeting of skeletal muscle, as well as by the inadequate targeting of single-stranded oligonucleotides to other affected tissues, such as the heart. In September 2016, the Food and Drug Administration (FDA) granted accelerated approval to 'eteplirsen', a single-stranded oligonucleotide for ML / E / ZuZ / UO Z O í modulates exon 51 splicing. Although this was proclaimed in the United States as the first approved oligonucleotide modulating splicing, the restoration of dystrophin levels was disappointing, with only approximately 1% of normal dystrophin levels. Comparisons with the allelic disorder Becker muscular dystrophy and experiments in the mdx mouse have indicated that homogeneous sarcolemmal dystrophin expression of at least -15% of the wild type is required to protect muscle against exercise-induced damage. Therefore, there is an urgent and strong need to improve the supply of antisense oligonucleotides to provide more effective therapy for devastating genetic diseases such as DMD. The use of viruses as delivery vehicles has been suggested; however, their use is limited due to the immunotoxicity of the viral envelope protein and potential oncogenic effects. Alternatively, a range of non-viral delivery vectors has been developed, among which peptides have shown the most promise due to their small size, targeting specificity, and ability to deliver large biopayloads transcapillary. Several peptides have been reported to have the ability to penetrate cells, either alone or with a biopayload. For several years, cell-penetrating peptides (CPPs) have been conjugated with SSOs (particularly neutral-charge morpholino phosphorodiamidate (PMO) oligomers and peptidonucleic acids (PNAs)) to increase the delivery of such oligonucleotide analogs to cells, efficiently transporting them across cell membranes to reach their premRNA target sites in the cell nucleus. PMO therapeutics conjugated with certain arginine-rich CPPs (known as P-PMOs or peptide-PMOs) have been shown to increase dystrophin production in skeletal muscle following systemic administration in an mdx mouse model of DMD. In particular, PNA / PMO internment peptides (Pips) have been developed. These are arginine-rich CPPs comprised of two arginine-rich sequences separated by a short hydrophobic core sequence. These “Pip” peptides were designed to improve serum stability while maintaining a high degree of exon skipping, initially by binding to a PNA cargo. Further derivatives of these peptides were designed as PMO conjugates, which were shown to result in whole-body skeletal muscle dystrophin production, including, importantly, the heart, following systemic administration in mice. Although these peptides are effective, their therapeutic application has been hampered by their associated toxicity. Alternative cell-penetrating peptides (CPPs) with a single arginine-rich domain, such as ReGly, have also been produced. These CPPs have been used to produce peptide conjugates with reduced toxicity, but these conjugates exhibit low efficacy compared to Pip peptides. Therefore, the CPPs currently available have not yet been shown to be suitable for use in human treatments for diseases such as DMD. The challenge in the field of cell-penetrating peptide technology has been to separate efficacy from toxicity. Now, the present inventors have identified, synthesized, and tested several improved CPPs that have a particular structure according to the present invention, which addresses at least this challenge. ΜΛ / Ε / ΖυΖΊ / UO Z Ί O í problem. These peptides maintain good levels of efficacy in skeletal muscle when tested in vitro and in vivo with a therapeutic molecule load. Furthermore, these peptides show improved efficacy compared to previously available CPPs when used in the same conjugate. Simultaneously, these peptides act effectively in vivo with reduced clinical signs after systemic injection and lower toxicity, as observed by measuring biochemical markers. Significantly, the present peptides have shown remarkably reduced toxicity after similar systemic injection in mice, compared to previous CPPs. Therefore, the peptides of the invention offer improved stability for use as a therapy in humans compared to previously available peptides and can be used in therapeutic conjugates for the safe and effective treatment of human subjects. Brief description of the invention According to a first aspect of the present invention, a peptide is provided having a total length of 40 amino acid residues or less, the peptide comprising: two or more cationic domains, each comprising at least 4 amino acid residues; and one or more hydrophobic domains, each comprising at least 3 amino acid residues; where the peptide does not contain artificial amino acid residues. According to a second aspect of the present invention, a conjugate is provided comprising the peptide of the first aspect covalently linked to a therapeutic molecule. According to a third aspect of the present invention, a conjugate is provided comprising the peptide of the first aspect covalently linked to an image molecule. According to a fourth aspect of the present invention, a pharmaceutical composition comprising the conjugate of the second aspect is provided. According to a fifth aspect of the present invention, a conjugate according to the second aspect is provided for use as a medicament. In one modality of the fifth aspect, a pharmaceutical composition is provided in accordance with the fourth aspect for use as a drug. According to a sixth aspect of the present invention, a method of treating a disease in a subject is provided, comprising administering to the subject the conjugate of the second aspect in a therapeutically effective amount. In one modality of the sixth aspect, a method of treating a disease in a subject is provided, comprising administering to the subject the pharmaceutical composition according to the fourth aspect in a therapeutically effective amount. According to a seventh aspect of the present invention, an isolated nucleic acid is provided that encodes the peptide of the first aspect or the conjugate of the second aspect or the conjugate of the third aspect. According to an eighth aspect of the present invention, an expression vector comprising the nucleic acid sequence of the seventh aspect is provided. According to a ninth aspect of the present invention, a host cell comprising the expression vector of the eighth aspect is provided. Detailed description of the invention The inventors have produced a number of peptides that are suitable for use as cell-penetrating peptides to deliver therapeutic molecules to cells. Surprisingly, the inventors have discovered a group of peptides with at least two cationic domains and at least one hydrophobic domain of defined lengths, without any artificial amino acids, that provide increased cell penetration in muscles compared to currently available cell-penetrating peptides. This effect is observed when delivered to cells as a conjugate with a therapeutic antisense oligonucleotide, or when administered in vivo. In the context of DMD, the increased cellular penetration by the peptides of the invention linked to a suitable therapeutic molecule can be demonstrated by the exclusion of a specific exon within the transcript. Directing an antisense oligonucleotide to an appropriate sequence results in the forced skipping of an exon, the correction of the open reading frame, and the restoration of the internally suppressed but still partially functional dystrophin isoform. It is shown here that the peptides of the present invention, when used as a conjugate with a therapeutic oligonucleotide designed to target the dystrophin gene, have a high level of exon exclusion and restoration of the dystrophin protein. In particular, the conjugates comprising the peptides of the invention exhibit significantly increased cell penetration compared to currently available peptides conjugated with the same therapeutic antisense oligonucleotide. This is demonstrated in the present invention by an increase in exon skipping in the dystrophin gene in several different muscle groups. The in vivo results described herein show exon skipping levels and functional dystrophin expression when using the peptide conjugates of the invention, which are approximately twice the levels resulting from the use of the same therapeutic antisense oligonucleotide conjugated with one of the previously available cell-penetrating peptides. This is a significant improvement in the effectiveness of such peptide carriers to penetrate muscle cells where neuromuscular diseases have an effect. Without wishing to be limited by theory, the inventors believe that removing artificial amino acids, such as 6-aminohexanoic acid residues typically used in cell-penetrating peptides, and replacing them, for example, with natural beta-alanine residues, has the beneficial effect of reducing overall toxicity and increasing cell penetration of the peptides. However, it was completely unexpected that such a peptide structure that does not contain The addition of artificial amino acid residues would enhance the delivery properties of previously reported cell-penetrating peptides to transport a therapeutic molecule payload, such as an oligonucleotide, to muscle. The effectiveness of a peptide depends primarily on its ability to remain stable in serum for the time required for it to enter cells. It was expected that peptides formed without artificial amino acids would also be unstable and vulnerable to protease degradation in vivo, thus preventing a sufficient amount from penetrating cells and muscle tissue and enhancing the therapeutic effect.Contrary to this expectation, the inventors found that peptides with a particular structure like the one claimed are stable enough to enter cells and maintain good, even improved, efficacy, and still have the advantage of a reduced toxicity profile due to the lack of artificial amino acids. It was unexpected that such transport could be enhanced to result in a therapeutic molecule, such as an antisense oligonucleotide, that successfully increases exon skipping and the production of functional dystrophin protein in several different muscles, as demonstrated herein. Furthermore, it was unexpected that such a peptide structure would significantly reduce the toxicity of the cell-penetrating peptide when carrying a therapeutic payload in vivo, to the point that human treatment with this conjugate is viable. The in vivo results described here show a reduction in nephrotoxicity, as determined by biological markers. To avoid any doubt and to clarify how this disclosure should be interpreted, certain terms used in accordance with the present invention will now be further defined. The invention includes any combination of the aspects and features described, except where such combination is clearly inadmissible or expressly avoided. The section headings used herein are for organizational purposes only and should not be interpreted as limiting the subject matter described. References to “X” throughout this document denote any form of the artificial, synthetically produced amino acid, aminohexanoic acid. References to “B” throughout this document denote the naturally occurring but non-genetically encoded amino acid beta-alanine. References to “Ac” throughout this document denote the acetylation of the relevant peptide. References to “Hyp” throughout this document denote the naturally occurring, but not genetically encoded, amino acid hydroxyproline. References to other capital letters throughout this document denote the relevant amino acid residue genetically encoded according to the accepted amino acid alphabetic code. Artificial amino acids The present invention relates to short cell-penetrating peptides having a particular structure in which there are no artificial amino acid residues. References to an “artificial” amino acid or residue here denote any amino acid that is not ML / E / ZuZ / UO Z O í occurs in nature and includes synthetic amino acids, modified amino acids (such as modified with sugars), non-natural amino acids, man-made amino acids, spacers and non-peptide-linked spacers. Synthetic amino acids can be those that are chemically synthesized by humans. To avoid any doubt, aminohexanoic acid (X) is an artificial amino acid in the context of the present invention. To avoid any doubt, beta-alanine (B) and hydroxyproline (Hyp) occur in nature and are therefore not artificial amino acids in the context of the present invention, but rather naturally occurring amino acids. Artificial amino acids may include, for example, 6-aminohexanoic acid (X), tetrahydroisoquinolin-3-carboxylic acid (TIC), 1-(amino)cyclohexanecarboxylic acid (Cy) and 3-azetidinecarboxylic acid (Az), 11-aminoundecanoic acid. The peptide does not contain aminohexanoic acid residues. The peptide does not contain any form of aminohexanoic acid residues. The peptide does not contain 6-aminohexanoic acid residues. Properly formulated, the peptide contains only natural amino acid residues and therefore consists of natural amino acid residues. Appropriately, artificial amino acids, such as 6-aminohexanoic acid, which are typically used in cell-penetrating peptides, are replaced with natural amino acids. Specifically, these artificial amino acids, such as 6-aminohexanoic acid, are replaced with selected amino acids from beta-alanine, serine, proline, arginine, and histidine or hydroxyproline. In one embodiment, aminohexanoic acid is replaced by beta-alanine. In another embodiment, 6-aminohexanoic acid is replaced by beta-alanine. In one embodiment, aminohexanoic acid is replaced by histidine. Specifically, 6-aminohexanoic acid is replaced by histidine. In one embodiment, aminohexanoic acid is replaced by hydroxyproline. In another embodiment, 6-aminohexanoic acid is replaced by hydroxyproline. Appropriately, artificial amino acids, such as 6-aminohexanoic acid typically used in cell-penetrating peptides, can be replaced by a combination of any of beta-alanine, serine, proline, arginine, and histidine or hydroxyproline, conveniently a combination of any of beta-alanine, histidine, and hydroxyproline. In one embodiment, a peptide is provided having a total length of 40 amino acid residues or less; the peptide comprises: two or more cationic domains, each comprising at least 4 amino acid residues; and one or more hydrophobic domains, each comprising at least 3 amino acid residues; where at least one cationic domain comprises histidine residues. ML / E / ZuZ / UO Z O í Appropriately, where at least one cationic domain is rich in histidine. Appropriately, what is meant by histidine rich is defined here with respect to the cationic domains. cationic domain The present invention relates to short cell-penetrating peptides having a particular structure in which there are at least two cationic domains of a certain length. References to “cationic” here denote an amino acid or domain of amino acids that have an overall positive charge at physiological pH. Appropriately, the peptide comprises up to 4 cationic domains, up to 3 cationic domains. Appropriately, the peptide comprises 2 cationic domains. As defined above, the peptide comprises two or more cationic domains, each with a length of at least 4 amino acid residues. Ideally, each cationic domain has a length of between 4 and 12 amino acid residues, conveniently a length of between 4 and 7 amino acid residues. Appropriately, each hydrophobic domain has a length of 4, 5, 6, or 7 amino acid residues. Appropriately, each cationic domain is of similar length; conveniently, each cationic domain is of the same length. Appropriately, each cationic domain comprises cationic amino acids and may also contain polar and nonpolar amino acids. Nonpolar amino acids can be selected from: alanine, beta-alanine, proline, glycine, cysteine, valine, leucine, isoleucine, methionine, tryptophan, and phenylalanine. As such, nonpolar amino acids are uncharged. Polar amino acids can be selected from: serine, asparagine, hydroxyproline, histidine, arginine, threonine, tyrosine, and glutamine. Appropriately, the selected polar amino acids do not have a negative charge. Cationic amino acids can be selected from arginine, histidine, and lysine. At physiological pH, cationic amino acids carry a positive charge. Appropriately, each cationic domain does not comprise anionic or negatively charged amino acid residues. Appropriately, each cationic domain comprises residues of arginine, histidine, beta-alanine, hydroxyproline and / or serine. Appropriately, each cationic domain consists of residues of arginine, histidine, beta-alanine, hydroxyproline and / or serine. Appropriately, each cationic domain comprises at least 40%, at least 45%, or at least 50% cationic amino acids. Appropriately, each cationic domain comprises a larger proportion of amino acids MX / E / ZUZI / UO1101 cationic. Appropriately, each cationic domain comprises at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% cationic amino acids. Appropriately, each cationic domain comprises an isoelectric point (pl) of at least 7.5, at least 8.0, at least 8.5, at least 9.0, at least 9.5, at least 10.0, at least 10.5, at least 11.0, at least 11.5, at least 12.0. Appropriately, each cationic domain comprises an isoelectric point (pl) of at least 10.0. Appropriately, each cationic domain comprises an isoelectric point (pl) of between 10.0 and 13.0. In one modality, each cationic domain comprises an isoelectric point (pl) of between 10.4 and 12.5. The isoelectric point of a cationic domain is appropriately calculated at physiological pH using any suitable method available in the technique. Appropriately, this can be done using the IPC (www.isoelectric.org), a web-based algorithm developed by Lukasz Kozlowski, Biol Direct. 2016; 11: 55. DOI: 10.1186 / s13062-016-0159-9. Each cationic domain appropriately comprises at least one cationic amino acid, conveniently between one and five cationic amino acids. Alternatively, each cationic domain appropriately comprises at least two cationic amino acids, conveniently between two and five cationic amino acids. Appropriately, each cationic domain is either arginine-rich and / or histidine-rich. Appropriately, a cationic domain can contain both histidine and arginine. "Arginine-rich" or "histidine-rich" means that at least 40% of the cationic domain is made up of these residues. Appropriately, each cationic domain comprises a larger proportion of arginine and / or histidine residues. Appropriately, each cationic domain comprises at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70% arginine and / or histidine residues. Appropriately, a cationic domain may comprise at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70% arginine residues. Appropriately, a cationic domain can comprise at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70% histidine residues. Suitablely, a cationic domain may comprise a total of 1 to 5 histidine residues and 1 to 5 arginine residues. Suitablely, a cationic domain may comprise 1 to 5 arginine residues. Suitablely, a cationic domain may comprise 1 to 5 histidine residues. Suitablely, a cationic domain may comprise a total of 2 to 5 histidine residues and 3 to 5 arginine residues. Suitablely, a cationic domain may comprise 3 to 5 arginine residues. Suitablely, a cationic domain may comprise 2 to 5 histidine residues. Each cationic domain comprises one or more beta-alanine residues. Each cationic domain can comprise a total of 2 to 5 beta-alanine residues, or a total of 2 or 3 beta-alanine residues. Appropriately, a cationic domain may comprise one or more hydroxyproline or serine residues. Suitablely, a cationic domain can comprise between 1 and 2 hydroxyproline residues. Suitablely, a cationic domain can comprise between 1 and 2 serine residues. Appropriately, all cationic amino acids in a given cationic domain can be histidine; alternatively, appropriately, all cationic amino acids in a given cationic domain can be arginine. The peptide may appropriately comprise at least one histidine-rich cationic domain. The peptide may appropriately comprise at least one arginine-rich cationic domain. Appropriately, the peptide may comprise at least one arginine-rich cationic domain and at least one histidine-rich cationic domain. In one embodiment, the peptide comprises two arginine-rich cationic domains. In one embodiment, the peptide comprises two histidine-rich cationic domains. In one embodiment, the peptide comprises two cationic domains rich in arginine and histidine. In one embodiment, the peptide comprises an arginine-rich cationic domain and a histidine-rich cationic domain. Appropriately, each cationic domain comprises no more than 3 contiguous arginine residues, conveniently no more than 2 contiguous arginine residues. Appropriately, each cationic domain comprises non-contiguous histidine residues. Each cationic domain appropriately comprises arginine, histidine, and / or beta-alanine residues. Each cationic domain appropriately comprises a major proportion of arginine, histidine, and / or beta-alanine residues. Appropriately, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% of the amino acid residues in each cationic domain are arginine, histidine, and / or beta-alanine residues. Appropriately, each cationic domain consists of arginine, histidine, and / or beta-alanine residues. In one embodiment, the peptide comprises a first cationic domain comprising arginine and beta-alanine residues, and a second cationic domain comprising arginine and beta-alanine residues. In one embodiment, the peptide comprises a first cationic domain comprising arginine and beta-alanine residues, and a second cationic domain comprising histidine, beta-alanine, and optionally arginine residues. In one embodiment, the peptide comprises a first cationic domain comprising arginine and beta-alanine residues, and a second cationic domain comprising histidine and beta-alanine residues. In one embodiment, the peptide comprises a first cationic domain consisting of arginine and beta-alanine residues, and a second cationic domain consisting of arginine and beta-alanine residues. In one embodiment, the peptide comprises a first cationic domain consisting of arginine and beta-alanine residues, and a second cationic domain consisting of arginine, histidine, and beta-alanine residues. The peptide appropriately comprises at least two cationic domains, which conveniently form the arms of the peptide. Specifically, the cationic domains are located at the N and C ends of the peptide. Therefore, these cationic domains can be referred to as the cationic arm domains. In one embodiment, the peptide comprises two cationic domains, one located at the N-terminus and the other at the C-terminus. No additional amino acids or domains are present at the N-terminus or C-terminus of the peptide, except for other groups such as a terminal modification, linker, and / or therapeutic molecule. For the avoidance of doubt, these other groups may be present in addition to the peptide described and claimed herein. Each cationic domain thus forms the end of the peptide. This does not preclude the presence of an additional linker group as described herein. The peptide can appropriately comprise up to 4 cationic domains. The peptide appropriately comprises two cationic domains. In one embodiment, the peptide comprises two cationic domains that are both rich in arginine. In one embodiment, the peptide comprises a cationic domain that is rich in arginine. In one embodiment, the peptide comprises two cationic domains that are both rich in arginine and histidine. In one embodiment, the peptide comprises a cationic domain that is rich in arginine and a cationic domain that is rich in histidine. Appropriately, the cationic domains comprise amino acid units selected from the following: R, H, B, RR, HH, BB, RH, HR, RB, BR, HB, BH, RBR, RBB, BRR, BBR, BRB, RBH, RHB, HRB, BRH, HRR, RRH, HRH, HBB, BBH, RHR, BHB, HBH, or any combination thereof. Appropriately, a cationic domain may also include serine, proline, and / or hydroxyproline residues. Appropriately, cationic domains may further comprise amino acid units selected from the following: RP, PR, RPR, RRP, PRR, PRP, Hyp; R[Hyp]R, RR[Hyp], [Hyp]RR, [Hyp]R[Hyp], [Hyp][Hyp]R, R[Hyp][Hyp], SB, BS, or any combination thereof, or any combination with the amino acid units listed above. Appropriately, each cationic domain comprises any of the following sequences: RBRRBRR (SEQ ID NO:1), RBRBR (SEQ ID NO:2), RBRR (SEQ ID NO:3), RBRRBR (SEQ ID NO:4), RRBRBR (SEQ ID NO:5), RBRRB (SEQ ID NO:6), BRBR (SEQ ID NO:7), RBHBH (SEQ ID NO:8), HBHBR (SEQ ID NO:9), RBRHBHR (SEQ ID NO:10), RBRBBHR (SEQ ID NO:11), RBRRBH (SEQ ID NO:12), HBRRBR (SEQ ID NO:13), HBHBH (SEQ ID NO:14), BHBH (SEQ ID NO:15), BRBSB (SEQ ID NO:16), BRB[Hyp]B (SEQ ID NO:17), R[Hyp]H[Hyp]HB (SEQ ID NO:18), R[Hyp]RR[Hyp]R (SEQ ID NO:19) or IVIA / t / ZUZ I / UD / lo / any combination of the same. Appropriately, each cationic domain consists of any of the following sequences: RBRRBRR (SEQ ID NO:1), RBRBR (SEQ ID NO:2), RBRR (SEQ ID NO:3), RBRRBR (SEQ ID NO:4), RRBRBR (SEQ ID NO:5), RBRRB (SEQ ID NO:6), BRBR (SEQ ID NO:7), RBHBH (SEQ ID NO:8), HBHBR (SEQ ID NO:9), RBRHBHR (SEQ ID NO:10), RBRBBHR (SEQ ID NO:11), RBRRBH (SEQ ID NO:12), HBRRBR (SEQ ID NO:13), HBHBH (SEQ ID NO:14), BHBH (SEQ ID NO:15), BRBSB (SEQ ID NO:16), BRB[Hyp]B, R[Hyp]H[Hyp]HB, R[Hyp]RR[Hyp]R (SEQ ID NO:19) or any combination thereof. Appropriately, each cationic domain consists of one of the following sequences: RBRRBRR (SEQ ID NO:1), RBRBR (SEQ ID NO:2), RBRRBR (SEQ ID NO:4), BRBR (SEQ ID NO:7), RBHBH (SEQ ID NO:8), HBHBR (SEQ ID NO:9). Each cationic domain in the peptide can be either identical or different. Hydrophobic domain The present invention relates to short cell-penetrating peptides having a particular structure in which there is at least one hydrophobic domain having a certain length. References here to “hydrophobic” denote an amino acid or domain of amino acids that has the ability to repel water or that does not mix with water. Appropriately, the peptide comprises up to 3 hydrophobic domains, up to 2 hydrophobic domains. Appropriately, the peptide comprises 1 hydrophobic domain. As defined above, the peptide comprises one or more hydrophobic domains, each with a length of at least 3 amino acid residues. Ideally, each hydrophobic domain is between 3 and 6 amino acids long. Ideally, each hydrophobic domain is 5 amino acids long. Appropriately, each hydrophobic domain can comprise nonpolar, polar, and hydrophobic amino acid residues. Hydrophobic amino acid residues can be selected from: alanine, valine, leucine, isoleucine, phenylalanine, tyrosine, methionine, and tryptophan. Nonpolar amino acid residues can be selected from: proline, glycine, cysteine, alanine, valine, leucine, isoleucine, tryptophan, phenylalanine, methionine. Polar amino acid residues can be selected from: Serine, asparagine, hydroxyproline, histidine, arginine, threonine, tyrosine, glutamine Properly, hydrophobic domains do not comprise hydrophilic amino acid residues. Appropriately, each hydrophobic domain comprises a majority of hydrophobic amino acid residues. Appropriately, each hydrophobic domain comprises at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% hydrophobic amino acids. Appropriately, each hydrophobic domain consists of hydrophobic amino acid residues. Appropriately, each hydrophobic domain comprises a hydrophobicity of at least 0.3, at least 0.4, at least 0.5, at least 0.6, at least 0.7, at least 0.8, at least 1.0, at least 1.1, at least 1.2, at least 1.3. Appropriately, each hydrophobic domain comprises a hydrophobicity of at least 0.3, at least 0.35, at least 0.4, at least 0.45. Appropriately, each hydrophobic domain comprises a hydrophobicity of at least 1.2, at least 1.25, at least 1.3, at least 1.35. Appropriately, each hydrophobic domain comprises a hydrophobicity of between 0.4 and 1.4. In one modality, each hydrophobic domain comprises a hydrophobicity of between 0.45 and 0.48. In one modality, each hydrophobic domain comprises a hydrophobicity of between 1.27 and 1.39. Properly, hydrophobicity is as measured according to White and Wimley: WC Wimley and SH White, Experimentally determined hydrophobicity scale for proteins at membrane interfaces Nature Struct Biol 3:842 (1996). Appropriately, each hydrophobic domain comprises at least 3, at least 4 hydrophobic amino acid residues. Suitably, each hydrophobic domain comprises phenylalanine, leucine, isoleucine, tyrosine, tryptophan, proline and glutamine residues. Suitably, each hydrophobic domain consists of phenylalanine, leucine, isoleucine, tyrosine, tryptophan, proline, and / or glutamine residues. In one form, each hydrophobic domain consists of residues of phenylalanine, leucine, isoleucine, tyrosine and / or glutamine. In one modality, each hydrophobic domain consists of tryptophan and / or proline residues. Appropriately, the peptide comprises a hydrophobic domain. Appropriately, the hydrophobic domain is located in the center of the peptide. Appropriately, therefore, the hydrophobic domain may be known as the central hydrophobic domain. Appropriately, the central hydrophobic domain is flanked on either side by an arm domain. Appropriately, the arm domains may comprise one or more cationic domains and one or more additional hydrophobic domains. Appropriately, each arm domain comprises a cationic domain. In one embodiment, the peptide comprises two arm domains flanking a central hydrophobic domain, wherein each arm domain comprises a cationic domain. In one embodiment, the peptide consists of two cationic arm domains flanking a central hydrophobic domain. Appropriately, the or each hydrophobic domain comprises one of the following sequences: YQFLI (SEQ ID NO:20), FQILY (SEQ ID NO:21), ILFQY (SEQ ID NO:22), FQIY (SEQ ID NO:23), WWW, WWPWW (SEQ ID NO:24), WPWW (SEQ ID NO:25), WWPW (SEQ ID NO:26) or any combination thereof. Appropriately, the or each hydrophobic domain consists of one of the following sequences: YQFLI (SEQ ID NO:20), FQILY (SEQ ID NO:21), ILFQY (SEQ ID NO:22), FQIY (SEQ ID NO:23), WWW, WWPWW (SEQ ID NO:24), WPWW (SEQ ID NO:25), WWPW (SEQ ID NO:26) or any combination thereof. Appropriately, the or each hydrophobic domain consists of one of the following sequences: FQILY (SEQ ID NO:21), YQFLI (SEQ ID NO:20), ILFQY (SEQ ID NO:22). Appropriately, the or each hydrophobic domain consists of FQILY (SEQ ID NO:21). Each hydrophobic domain in the peptide can have the same sequence or a different sequence. Peptide The present invention relates to short cell-penetrating peptides for use in transporting therapeutic molecules for the treatment of medical conditions. The peptide has a sequence that is a single contiguous molecule; therefore, the peptide domains are contiguous. The peptide comprises several domains in a linear arrangement between the N-terminus and the C-terminus. The domains are selected from the cationic and hydrophobic domains described above. The peptide consists of cationic and hydrophobic domains, as defined above. Each domain has common sequence characteristics as described in the relevant sections above, but the exact sequence of each domain is subject to variation and modification. Thus, a range of sequences is possible for each domain. The combination of each possible domain sequence produces a range of peptide structures, each of which is part of the present invention. The characteristics of the peptide structures are described below. Appropriately, a hydrophobic domain separates any two cationic domains. Appropriately, each hydrophobic domain is flanked by cationic domains on either side of it. Properly, there is no cationic domain contiguous with another cationic domain. In one embodiment, the peptide comprises a hydrophobic domain flanked by two cationic domains in the following arrangement: [cationic domain] - [hydrophobic domain] - [cationic domain] Therefore, appropriately, the hydrophobic domain can be referred to as the central domain, and each of the cationic domains can be referred to as an arm domain. Appropriately, the hydrophobic arm domains flank the central cationic domain on either side of it. In one form, the peptide consists of two cationic domains and one hydrophobic domain. In one embodiment, the peptide consists of a central hydrophobic domain flanked by two cationic arm domains. In one embodiment, the peptide consists of a central hydrophobic domain comprising a sequence selected from: YQFLI (SEQ ID NO:20), FQILY (SEQ ID NO:21), ILFQY (SEQ ID NO:22), FQIY (SEQ ID NO:23), WWW, WWPWW (SEQ ID NO:24), WPWW (SEQ ID NO:25), and WWPW (SEQ ID NO:26), flanked by two cationic arm domains each comprising a sequence selected from: RBRRBRR (SEQ ID NO:1), RBRBR (SEQ ID NO:2), RBRR (SEQ ID NO:3), RBRRBR (SEQ ID NO:4), RRBRBR (SEQ ID NO:5), RBRRB (SEQ ID NO:6), BRBR (SEQ ID NO:7), RBHBH (SEQ ID NO:8), HBHBR (SEQ ID NO:9), RBRHBHR (SEQ ID NO:10), RBRBBHR (SEQ ID NO:11), RBRRBH (SEQ ID NO:12), HBRRBR (SEQ ID NO:13), HBHBH (SEQ ID NO:14), BHBH (SEQ ID NO:15), BRBSB (SEQ ID NO:16), BRB[Hyp]B (SEQ ID NO: 17), R[Hyp]H[Hyp]HB (SEQ ID NO:18), and R[Hyp]RR[Hyp]R (SEQ ID NO:19). In one embodiment, the peptide consists of a central hydrophobic domain comprising a sequence selected from: FQILY (SEQ ID NO:21), YQFLI (SEQ ID NO:20), and ILFQY (SEQ ID NO:22), flanked by two cationic arm domains comprising a sequence selected from: RBRRBRR (SEQ ID NO:1), RBRBR (SEQ ID NO:2), RBRRBR (SEQ ID NO:4), BRBR (SEQ ID NO:7), RBHBH (SEQ ID NO:8), HBHBR (SEQ ID NO:9). In one embodiment, the peptide consists of a central hydrophobic domain comprising the sequence: FQILY (SEQ ID NO:21), flanked by two cationic arm domains comprising a sequence selected from: RBRRBRR (SEQ ID NO:1), RBRBR (SEQ ID NO:2), RBRRBR (SEQ ID NO:4), BRBR (SEQ ID NO:7), RBHBH (SEQ ID NO:8). In any of these modalities, additional groups may be present, such as a linker, terminal modification and / or therapeutic molecule. Appropriately, the peptide is N-terminally modified. The peptide is appropriately N-acetylated, N-methylated, N-trifluoroacetylated, N-trifluoromethylsulfonylated, or N-methylsulfonylated. The peptide is appropriately N-acetylated. Optionally, the N-terminus of the peptide may be unmodified. In one form, the peptide is N-acetylated. Appropriately, the peptide is modified at the C-terminal end. Suitablely, the peptide comprises a C-terminal modification selected from: carboxy-, thioacid-, aminooxy-, hydrazino-, thioester-, azide, stretched alkyne, stretched alkene, aldehyde, thiol- or halocethyl- group. Advantageously, the C-terminal modification provides a means for the peptide to bind to the therapeutic molecule. Therefore, the C-terminal modification may comprise the linker and vice versa. Appropriately, the C-terminal modification may consist of the linker or vice versa. Suitable linkers are described elsewhere herein. Appropriately, the peptide comprises a C-terminal carboxyl group. Appropriately, the C-terminal carboxyl group is provided by a glycine or beta-alanine residue. In one embodiment, the C-terminal carboxyl group is provided by a beta-alanine residue. Appropriately, the C-terminal beta-alanine residue is a linker. Suitablely, therefore, each cationic domain may further comprise an N- or C-terminal modification. Suitablely, the cationic domain at the C-terminus comprises a C-terminus modification. Suitablely, the cationic domain at the N-terminus comprises an N-terminus modification. Suitablely, the cationic domain at the C-terminus comprises a linker group; suitablely, the cationic domain at the C-terminus comprises a C-terminus beta-alanine. Suitablely, the cationic domain at the N-terminus is N-acetylated. The peptide of the present invention is defined as having a total length of 40 amino acid residues or less. Therefore, the peptide can be considered an oligopeptide. Appropriately, the peptide has a total length of between 3 and 30 amino acid residues, appropriately between 5 and 25 amino acid residues, between 10 and 25 amino acid residues, between 13 and 23 amino acid residues, between 15 and 20 amino acid residues. Appropriately, the peptide has a total length of at least 12, at least 13, at least 14, at least 15, at least 16, at least 17 amino acid residues. When properly formulated, the peptide is able to penetrate cells. Therefore, the peptide can be considered a cell-penetrating peptide. The peptide is appropriately designed to bind to a therapeutic molecule. The peptide is appropriately designed to transport a therapeutic molecule to a target cell. The peptide is appropriately designed to deliver a therapeutic molecule to a target cell. Therefore, the peptide can be considered a carrier peptide. ma / e / zuzi / uo i 1 ot When properly formulated, the peptide is able to penetrate cells and tissues, specifically the cell nucleus, and is particularly effective in muscle tissue. The peptide can be appropriately selected from any of the following sequences: RBRRBRRFQILYRBRBR (SEQ ID NO:27) RBRRBRRFQILYRBRR (SEQ ID NO:28) RBRRBRFQILYRRBRBR (SEQ ID NO:29) RBRBRFQILYRBRRBRR (SEQ ID NO:30) RBRRBRRYQFLIRBRBR (SEQ ID NO:31) RBRRBRRILFQYRBRBR (SEQ ID NO:32) RBRRBRFQILYRBRBR (SEQ ID NO:33) RBRRBFQILYRBRRBR (SEQ ID NO:34) RBRRBRFQILYBRBR (SEQ ID NO:35) RBRRBFQILYRBRBR (SEQ ID NO:36) RBRRBRRFQILYRBHBH (SEQ ID NO:37) RBRRBRRFQILYHBHBR (SEQ ID NO:38) RBRRBRRFQILYHBRBH (SEQ ID NO:39) RBRRBRRYQFLIRBHBH (SEQ ID NO:40) RBRRBRRILFQYRBHBH (SEQ ID NO:41) RBRHBHRFQILYRBRBR (SEQ ID NO:42) RBRBBHRFQILYRBHBH (SEQ ID NO:43) RBRRBRFQILYRBHBH (SEQ ID NO:44) RBRRBRFQILYHBHBH (SEQ ID NO:45) RBRRBHFQILYRBHBH (SEQ ID NO:46) HBRRBRFQILYRBHBH (SEQ ID NO:47) RBRRBFQILYRBHBH (SEQ ID NO:48) RBRRBRFQILYBHBH (SEQ ID NO:49) RBRRBRYQFLIHBHBH (SEQ ID NQ:50) RBRRBRILFQYHBHBH (SEQ ID NO:51) RBRRBRRFQILYHBHBH (SEQ ID NO:52) Appropriately, the peptide can be selected from any of the following additional sequences: RBRRBRFQILYBRBS (SEQ ID NO:53) RBRRBRFQILYBRB[Hyp] RBRRBRFQILYBR[Hyp]R RRBRRBRFQILYBRBR (SEQ ID NO:54) (SEQ ID NO:55) (SEQ ID NO:56) BRRBRRFQILYBRBR (SEQ ID NO:57) RBRRBRWWWBRBR (SEQ ID NO:58) RBRRBRWWPWWBRBR (SEQ ID NO:59) RBRRBRWPWWBRBR (SEQ ID NQ:60) RBRRBRWWPWBRBR (SEQ ID NO:61) RBRRBRRWWWRBRBR (SEQ ID NO:62) RBRRBRRWWPWWRBRBR (SEQ ID NO:63) RBRRBRRWPWWRBRBR (SEQ ID NO:64) RBRRBRRWWPWRBRBR (SEQ ID NO:65) RBRRBRRFQILYBRBR (SEQ ID NO:66) RBRRBRRFQILYRBR (SEQ ID NO:67) BRBRBWWPWWRBRRBR (SEQ ID NO:68) RBRRBRRFQILYBHBH (SEQ ID NO:69) RBRRBRRFQIYRBHBH (SEQ ID NQ:70) RBRRBRFQILYBRBH (SEQ ID NO:71) RBRRBRFQILYR[Hyp]H[Hyp]HR[Hyp]RR[Hyp]RFQILYR[Hyp]H[Hyp]H RBRRBRWWWRBHBH (SEQ ID NO:72) (SEQ ID NO:73) (SEQ ID NO:74) (SEQ ID NO:75) RBRRBRWWPRBHBH (SEQ ID NO:76) RBRRBRPWWRBHBH (SEQ ID NO:77) RBRRBRWWPWWRBHBH (SEQ ID NO:78) RBRRBRWWPWRBHBH (SEQ ID NO:79) RBRRBRWPWWRBHBH (SEQ ID NQ:80) RBRRBRRWWWRBHBH (SEQ ID NO:81) RBRRBRRWWPWWRBHBH (SEQ ID NO:82) RBRRBRRWPWWRBHBH (SEQID NO:83) RBRRBRRWWPWRBHBH RRBRRBRFQILYRBHBH BRRBRRFQILYRBHBH RRBRRBRFQILYBHBH BRRBRRFQILYBHBH RBRRBHRFQILYRBHBH RBRRBRFQILY[Hyp]R[Hyp]RR[Hyp]RR[Hyp]RFQILYBRBR R[Hyp]RR[Hyp]RFQILY[Hyp]R[Hyp]R RBRRBRWWWBRBR RBRRBRWWPWWBRBR Suitably, the peptide consists of RBRRBRRFQILYRBRBR RBRRBRRYQFLIRBRBR RBRRBRRILFQYRBRBR RBRRBRFQILYBRBR RBRRBRRFQILYRBHBH RBRRBRRFQILYHBHBR RBRRBRFQILYRBHBH (SEQ ID NO:84) (SEQ ID NO:85) (SEQ ID NO:86) (SEQ ID NO:87) (SEQ ID NO:88) (SEQ ID NO:89) (SEQ ID NO: 101) (SEQ ID NO: 102) (SEQ ID NO: 103) (SEQ ID NO: 104) (SEQ ID NO: 105) in one of the following sequences: (SEQ ID NO:27) (SEQ ID NO:31) (SEQ ID NO:32) (SEQ ID NO:35) (SEQ ID NO:37) (SEQ ID NO:38) (SEQ ID NO:44) In one modality, the peptide consists of the following sequence: RBRRBRFQILYBRBR (SEQ ID NO:35). In one modality, the peptide consists of the following sequence: RBRRBRRFQILYRBHBH (SEQ ID NO:37). In one modality, the peptide consists of the following sequence: RBRRBRFQILYRBHBH (SEQ ID NO:44). Conjugate The peptide of the invention can be covalently linked to a therapeutic molecule to provide a conjugate. A therapeutic molecule can be any molecule used to treat a disease. The therapeutic molecule can be selected from: a nucleic acid, peptidonucleic acid, antisense oligonucleotide (such as PNA, PMO), mRNA, gRNA (e.g., in the use of CRISPR / Cas9 technology), short interfering RNA, microRNA, antisense microRNA, peptide, cyclic peptide, protein, pharmaceutical agent, drug, or nanoparticle. In one modality, the therapeutic molecule is an antisense oligonucleotide. Appropriately, the antisense oligonucleotide is comprised of a phosphorodiamidate morpholino oligonucleotide (PMO). Alternatively, the oligonucleotide can be a modified PMO or any other charge-neutral oligonucleotide, such as a peptidonucleic acid (PNA), a chemically modified PNA such as gamma-PNA (Bahal, Nat. Comm. 2016), a phosphoramidate oligonucleotide (where the unbridged oxygen of the phosphate is substituted with an amine or alkylamine as described in WO2016028187A1), or any other partially or totally charge-neutralized oligonucleotide. The therapeutic antisense oligonucleotide sequence can be selected from any of those available; for example, antisense oligonucleotides for exon skipping in DMD are described at https: / / research-repository.uwa.edu.au / en / publications / antisense-oligonucleotide-induced-exonskipping-across-the-human-, or a therapeutic antisense oligonucleotide complementary to the ISSN1 or IN7 sequence for the treatment of SMA is described in Zhou, HGT, 2013; and Hammond et al, 2016; and Osman et al, HMG, 2014. Appropriately, the antisense oligonucleotide sequence is to induce exon skipping for use in the treatment of DMD. The antisense oligonucleotide sequence is designed to induce exon skipping in the dystrophin gene for use in the treatment of DMD. The antisense oligonucleotide sequence can induce exon skipping of one or more exons. In one modality, the antisense oligonucleotide sequence is designed to induce a single-exon exon skip in the dystrophin gene for use in the treatment of DMD. Appropriately, the single exon is selected from any exon implicated in DMD, which can be any exon of the dystrophin gene, such as exon 45, 51, or 53. PMO oligonucleotides of any sequence can be purchased (e.g., from Gene Tools Inc., USA). In one modality, the therapeutic molecule of the conjugate is an oligonucleotide complementary to the pre-mRNA of a target gene. Appropriately, the oligonucleotide complementary to the pre-mRNA of a target gene induces a steric blocking event that alters the pre-mRNA, producing an altered mRNA and therefore a protein with an altered sequence. Appropriately, the target gene is the dystrophin gene. Appropriately, the steric blocking event can be an exon inclusion or an exon skip. In one modality, the steric blocking event is an exon skip, specifically a skip of a single exon of the dystrophin gene. Optionally, lysine residues can be added to one or both ends of a therapeutic molecule (such as a PMO or PNA) before attaching it to the peptide, to improve water solubility. Ideally, the therapeutic molecule has a molecular weight of less than 5,000 Da, conveniently less than 3,000 Da, or conveniently less than 1,000 Da. Appropriately, the peptide is covalently linked to the therapeutic molecule at the C-terminal end. The peptide is appropriately covalently linked to the therapeutic molecule via a linker, if necessary. The linker can act as a spacer to separate the peptide sequence from the therapeutic molecule. The linker can be selected from any suitable sequence. The linker is appropriately present between the peptide and the therapeutic molecule. ML / E / ZuZ / UO Z Ί O í suitable, the linker is a separate group with respect to the peptide and the therapeutic molecule. Therefore, the linker may comprise artificial amino acids. In one embodiment, the conjugate comprises the peptide covalently linked by means of a linker to a therapeutic molecule. In one embodiment, the conjugate comprises the following structure: [peptide] - [linker] - [therapeutic molecule] In one modality, the conjugate consists of the following structure: [peptide] - [linker]-[therapeutic molecule] Appropriately, any of the peptides listed herein may be used in a conjugate according to the invention. In one embodiment, the conjugate comprises a peptide selected from one of the following sequences: RBRRBRFQILYBRBR (SEQ ID NO:35), RBRRBRRFQILYRBHBH (SEQ ID NO:37) and RBRRBRFQILYRBHBH (SEQ ID NO:44). Appropriately, in each case, the peptide may also comprise N-terminal modifications as described above. Suitable linkers include, for example, a C-terminal cysteine residue that allows the formation of a disulfide, thioether, or thiol-maleimide bond, a C-terminal aldehyde to form an oxime, a click reaction or morpholino bond formation with a basic amino acid on the peptide, or a carboxylic acid portion on the peptide, covalently conjugated with an amino group to form a carboxamide bond. Suitablely, the linker is between 1 and 5 amino acids in length. Suitablely, the linker may comprise any linker known in the art. Appropriately, the linker is selected from any of the following sequences: G, BC, XC, C, GGC, BBC, BXC, XBC, X, XX, B, BB, BX, and XB. Appropriately, where X is 6-aminohexanoic acid. Appropriately, the linker can be a polymer, such as PEG. In one form, the linker is beta-alanine. In one modality, the peptide is conjugated to the therapeutic molecule by means of a carboxamide bond. The linker of the conjugate may be part of the therapeutic molecule to which the peptide binds. Alternatively, the therapeutic molecule may bind directly to the C-terminus of the peptide. In such cases, a linker is not required. Alternatively, the peptide can be chemically conjugated to the therapeutic molecule. The chemical bond can be a disulfide, alkenyl, alkynyl, aryl, ether, thioether, triazole, amide, carboxamide, urea, thiourea, semicarbazide, carbazide, hydrazine, oxime, phosphate, phosphoramidate, thiophosphate, boranophosphate, iminophosphate, or thiol-maleimide bond, for example. Optionally, cysteine can be added to the N-terminus of a therapeutic molecule to allow the formation of a disulfide bond with the peptide, or the N-terminus can be subjected to bromoacetylation for thioether conjugation with the peptide. Similarly, the peptide of the invention can be covalently linked to an image molecule to provide a conjugate. Appropriately, the imaging molecule can be any molecule that allows visualization of the conjugate. Appropriately, the imaging molecule can indicate the location of the conjugate. Appropriately, the location of the conjugate in vitro or in vivo. Appropriately, a method is provided for monitoring the location of a conjugate comprising an imaging molecule, which comprises: administering the conjugate to the subject and acquiring images of the subject to locate the conjugate. Examples of imaging molecules include detection molecules, contrast molecules, or enhancer molecules. Suitable imaging molecules can be selected from radionuclides; fluorophores; nanoparticles (such as a nanocoating); nanocages; chromogenic agents (e.g., an enzyme); radioisotopes; dyes; radiopaque materials; fluorescent compounds; and combinations thereof. Appropriately, imaging molecules are visualized using imaging techniques; these can be cellular imaging techniques or medical imaging techniques. Appropriate cellular imaging techniques include image cytometry, fluorescence microscopy, phase-contrast microscopy, SEM, and TEM, for example. Appropriate medical imaging techniques include X-ray, fluoroscopy, MRI, scintigraphy, SPECT, PET, CT, CAT, and FNRI, for example. In some cases, the imaging molecule can be considered a diagnostic molecule. Appropriately, the diagnostic molecule allows for the diagnosis of a disease using the conjugate. Appropriately, the diagnosis of a disease can be achieved by determining the localization of the conjugate using an imaging molecule. Appropriately, a method for diagnosing a disease is provided, comprising administering an effective amount of a conjugate comprising an imaging molecule to a subject and monitoring the localization of the conjugate. Appropriately, additional details such as the linkage of a conjugate comprising an imaging molecule are the same as previously described with respect to a conjugate comprising a therapeutic molecule. Appropriately, the peptide of the invention can be covalently linked to a therapeutic molecule and an imaging molecule to provide a conjugate. When properly formulated, the conjugate is able to penetrate cells and tissues, specifically the cell nucleus, and is particularly effective in muscle tissue. Pharmaceutical composition The conjugate of the invention can be formulated in a pharmaceutical composition. Appropriately, the pharmaceutical composition comprises a conjugate of the invention. The pharmaceutical composition may appropriately further comprise a pharmaceutically acceptable diluent, adjuvant, or vehicle. Suitable pharmaceutically acceptable diluents, adjuvants, and vehicles are well known in the art. As used herein, the term pharmaceutically acceptable refers to those ligands, materials, formulations and / or dosage forms that, within the scope of medical judgment, ML / E / ZuZ / UO Z O í reasonable, are suitable for use in contact with the tissues of humans and animals without excessive toxicity, irritation, allergic response or other problem or complication, in accordance with a reasonable benefit / risk ratio. The term “pharmaceutically acceptable vehicle” as used herein refers to a pharmaceutically acceptable material, formulation, or vehicle, such as a liquid or solid filler, diluent, excipient, solvent, or encapsulating material, involved in the delivery or transport of the conjugate from one organ or body part to another organ or body part. Each cell-penetrating peptide must be “acceptable” in the sense of being compatible with the other components of the composition, for example, the peptide and the therapeutic molecule, and not harmful to the individual. Lyophilized compositions, which can be reconstituted and administered, are also within the scope of this composition. Pharmaceutically acceptable vehicles may include, for example, excipients, carriers, diluents, and combinations thereof. For instance, compositions intended for oral administration may be formulated as tablets, capsules, granules, powders, or syrups; or for parenteral administration, they may be formulated as injections, drip infusion preparations, or suppositories. These compositions may be prepared by conventional means, and, if desired, the active compound (i.e., the conjugate) may be mixed with any conventional additive, such as an excipient, binder, disintegrant, lubricant, corrector, solubilizer, suspension aid, emulsifying agent, coating agent, or combinations thereof. It should be understood that the pharmaceutical compositions in this disclosure may also include other known therapeutic agents and drugs, modifications of compounds to prodrugs, etc., for the relief, mediation, prevention, and treatment of the diseases, disorders, and conditions described herein under medical use. The pharmaceutical composition is appropriately intended for use as a medicinal product. It is appropriately intended for use as a medicinal product in the same manner as described herein for the conjugate. All characteristics described herein with respect to medical treatment using the conjugate apply to the pharmaceutical composition. Accordingly, in a further aspect of the invention, a pharmaceutical composition according to the fourth aspect is provided for use as a medicament. In a further aspect, a method of treating a subject with a disease is provided, comprising administering to the subject an effective amount of a pharmaceutical composition according to the fourth aspect. Medical use The conjugate comprising the peptide of the invention can be used as a drug for the treatment of a disease. The drug may be in the form of a pharmaceutical composition as defined above. A method of treatment is also provided for a patient or subject in need of treatment for a disease; the method comprises the step of administering to the patient or subject a quantity ΜΛ / Ε / ΖυΖΊ / UO Z Ί O í therapeutically effective conjugate. Properly, medical treatment requires the delivery of the therapeutic molecule to a cell, conveniently to the cell nucleus. The diseases to be treated may include any disease where enhanced penetration of the cell or nuclear membrane by a therapeutic molecule can improve the therapeutic effect. Appropriately, the conjugate is for use in the treatment of diseases of the neuromuscular system. The conjugates comprising the peptides of the invention are suitable for the treatment of genetic diseases of the neuromuscular system. In a suitable embodiment, a conjugate according to the second aspect is provided for use in the treatment of genetic diseases of the neuromuscular system. The conjugate is suitable for use in the treatment of inherited genetic diseases. The conjugate is suitable for use in the treatment of inherited genetic diseases of the neuromuscular system. The conjugate is suitable for use in the treatment of inherited genetic neuromuscular diseases. The conjugate is suitable for use in the treatment of X-linked inherited genetic diseases of the neuromuscular system.Appropriately, the conjugate is for use in the treatment of X-linked hereditary neuromuscular diseases. Appropriately, the conjugate is used in the treatment of diseases caused by splicing defects. In such modalities, the therapeutic molecule may comprise an oligonucleotide capable of preventing or correcting the splicing defect or increasing the production of correctly spliced mRNA molecules. Appropriately, the conjugate is for use in the treatment of any of the following diseases: Duchenne muscular dystrophy (DMD), Bucher muscular dystrophy (BMD), Menkes disease, beta-thalassemia, dementia, Parkinson's disease, spinal muscular atrophy (SMA), myotonic dystrophy (DM), Huntington's disease, Hutchinson-Gilford progeria syndrome, ataxia telangiectasia, or cancer. In one modality, the conjugate is for use in the treatment of DMD. In one modality, a conjugate is provided according to the second aspect for use in the treatment of DMD. Appropriately, in such modality, the therapeutic molecule of the conjugate is operable to increase the expression of the dystrophin protein. Appropriately, in such modality, the therapeutic molecule of the conjugate is operable to increase the expression of the functional dystrophin protein. When administered appropriately, the conjugate increases dystrophin expression by 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, and 70%. When administered appropriately, the conjugate increases dystrophin expression by up to 50%. IVIA / t / ZUZ I / UD / IO / When administered appropriately, the conjugate restores dystrophin protein expression to 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, and 70%. When administered appropriately, the conjugate restores dystrophin protein expression to up to 50%. When administered appropriately, the conjugate restores dystrophin protein function by 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, and 70%. When administered appropriately, the conjugate restores dystrophin protein function by up to 50%. Appropriately, the conjugate therapeutic molecule is operable to do so by causing the skipping of one or more exons during dystrophin transcription. Under appropriate dosage, the conjugate therapeutic molecule causes 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, or 85% skipping of one or more exons in the dystrophin gene. Under appropriate dosage, the conjugate therapeutic molecule causes up to 50% skipping of one or more exons in the dystrophin gene. Appropriately, the patient or subject to be treated can be any animal or human. Appropriately, the patient or subject can be a non-human mammal. Appropriately, the patient or subject can be male or female. In one modality, the subject is male. Appropriately, the patient or subject to be treated can be of any age. Appropriately, the patient or subject to be treated is between 0 and 40 years old, appropriately between 0 and 30 years old, appropriately between 0 and 25 years old, appropriately between 0 and 20 years old. Appropriately, the conjugate is for systemic administration to a subject, for example, via intramedullary, intrathecal, intraventricular, intravitreal, enteral, parenteral, intravenous, intra-arterial, intramuscular, intratumoral, subcutaneous, oral, or nasal routes. In one modality, the conjugate is for administration to a subject intravenously. In one modality, the conjugate is for administration to a subject intravenously by injection. Properly formulated, the conjugate is intended for administration to a subject in a "therapeutically effective amount," meaning that the amount is sufficient to produce a benefit for the individual. The actual amount administered, as well as the rate and duration of administration, will depend on the nature and severity of the disease being treated. Dosage decisions are the responsibility of general practitioners and other healthcare professionals. Examples of techniques and protocols can be found in "Remington's Pharmaceutical Sciences," 20th edition, 2000, published by Lippincott, Williams & Wilkins. Example doses may be between 0.01 mg / kg and 50 mg / kg, 0.05 mg / kg and 40 mg / kg, 0.1 mg / kg and 30 mg / kg, 0.5 mg / kg and 18 mg / kg, 1 mg / kg and 16 mg / kg, 2 mg / kg and 15 mg / kg, 5 mg / kg and 10 mg / kg, 10 mg / kg and 20 mg / kg, 12 mg / kg and 18 mg / kg, 13 mg / kg and 17 mg / kg. Advantageously, the dose of the conjugates of the present invention is of an order or magnitude smaller than the dose required to observe any effect of the therapeutic molecule alone. Appropriately, after administration of the conjugates of the present invention, one or more toxicity markers are significantly reduced compared to the conjugates ΜΛ / Ε / ΖυΖΊ / UO Z Ί O í above using the currently available peptide carriers. Appropriate toxicity markers may be markers of nephrotoxicity. Appropriate toxicity markers include KIM-1, NGAL, BUN, creatinine, alkaline phosphatase, alanine transferase, and aspartate aminotransferase. Appropriately, the level of at least one of KIM-1, NGAL, and BUN is reduced after administration of the conjugates of the present invention, compared to prior conjugates using currently available peptide carriers. Appropriately, the levels of each of KIM-1, NGAL, and BUN are reduced after administration of the conjugates of the present invention, compared to prior conjugates using currently available peptide carriers. Appropriately, the levels of each marker are significantly reduced compared to previous conjugates using currently available peptide carriers. Appropriately, the levels of each marker are reduced to 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, after administration of the conjugates of the present invention, compared to the previous conjugates using the currently available peptide carriers. Advantageously, the toxicity of the peptides, and therefore the resulting conjugates, is significantly reduced compared to previous cell-penetrating peptides and conjugates. In particular, KIM-1 and NGAL-1 are toxicity markers, and their toxicity is reduced by up to 120 times compared to previous conjugates using currently available peptide carriers. Nucleic acids and hosts The peptides of the invention can be produced by any standard method of protein synthesis, e.g., chemical synthesis, semichemical synthesis, or using expression systems. Accordingly, the present invention also relates to nucleotide sequences comprising or consisting of DNA encoding peptides, expression systems, for example, vectors comprising such sequences, accompanied by sequences necessary for expression and expression control, and host cells and host organisms transformed by such expression systems. Accordingly, a nucleic acid encoding a peptide according to the present invention is also provided. Ideally, nucleic acids can be provided in isolated or purified form. An expression vector comprising a nucleic acid encoding a peptide according to the present invention is also provided. Properly speaking, the vector is a plasmid. Appropriately, the vector comprises a regulatory sequence, for example, a promoter, operatively linked to a nucleic acid encoding a peptide according to the present invention. Appropriately, the expression vector is capable of expressing the peptide when transfected into a suitable cell, for example, a mammalian, bacterial, or fungal cell. MX / E / ZUZI / uo i 1 ot A host cell comprising the expression vector of the invention is also provided. Expression vectors can be selected depending on the host cell into which the nucleic acids of the invention can be inserted. This host cell transformation includes conventional techniques such as those taught in Sambrook et al. [Sambrook, J., Russell, D. (2001) Molecular Cloning: A Laboratory Manual, Coid Spring Harbor Laboratory Press, NY, USA]. The selection of suitable vectors is within the scope of the skilled technician. Suitable vectors include plasmids, bacteriophages, cosmids, and viruses. The peptides produced can be isolated and purified from the host cell by any suitable method, e.g. precipitation or chromatographic separation, e.g., by affinity chromatography. The appropriate vectors, hosts, and recombinant techniques are well known in this field. In this specification, the term “operationally linked” may include the situation where a selected nucleotide sequence and a regulatory nucleotide sequence are covalently linked in such a way as to place the expression of a coding nucleotide sequence under the control of the regulatory sequence; thus, the regulatory sequence is able to effect the transcription of the coding nucleotide sequence, which forms part or all of the selected nucleotide sequence. When appropriate, the resulting transcript may then be translated into a desired peptide. Brief description of the figures Certain embodiments of the present invention will now be described with reference to the following figures and tables, in which: Figure 1: shows the in vitro exon 23 skipping efficiency of some of the DPEP1 series peptides conjugated with a therapeutic antisense PMO at 0.25 μM, 0.5 μM and 1 μM, in H2K-mdx cells, measured by nested RT-PCR densitometric analysis (error bars: standard deviation, n > 3); Figure 2: shows the in vitro exon 23 skipping efficiency of some of the DPEP3 series peptides conjugated with a therapeutic antisense PMO at 0.25 μM, 0.5 μM and 1 μM, in H2K-mdx cells, measured by nested RT-PCR densitometric analysis (error bars: standard deviation, n > 3); Figures 3A to 3B: show the in vivo efficacy of some of the DPEP1 series peptides conjugated with a therapeutic antisense PMO in (Figure 3A) anterior tibial muscle, (Figure 3B) diaphragm, and (Figure 3C) cardiac muscle, after a single intravenous dose at 10mg / kg in mdx mice, measured by Western blot and qRT-PCR (error bars: standard deviation, n= 3); Figures 4A to 4C: show the in vivo efficacy of some of the DPEP3 series peptides conjugated with a therapeutic antisense PMO in (Figure 4A) anterior tibial muscle, (Figure 4B) diaphragm, and (Figure 4C) cardiac muscle, after a single intravenous dose at 10mg / kg in mdx mice, measured by Western blot and qRT-PCR (error bars: standard deviation, n= 3); Figure 5: shows the relative levels of KIM-1 measured in the urine of C57BL / 6 mice two days ML / E / ZUZI / uo i 1 oty seven days after administration of a single 30 mg / kg dose of various DPEP peptides conjugated with a therapeutic antisense PMO, compared with currently available peptide carriers conjugated with the same therapeutic antisense PMO and saline solution (error bars: standard deviation, n= 6); Figure 6: shows the relative levels of NGAL measured in the urine of C57BL / 6 mice two days and seven days after administration of a single 30 mg / kg dose of various DPEP peptides conjugated with a therapeutic antisense PMO, compared to currently available peptide carriers conjugated with the same therapeutic antisense PMO and saline solution (error bars: standard deviation, n= 6); Figure 7: Shows serum BUN levels measured in C57BL / 6 mice seven days after administration of a single 30 mg / kg dose of various DPEP peptides conjugated to a therapeutic antisense PMO, compared to currently available peptide carriers conjugated to the same therapeutic antisense PMO and saline (error bars: standard deviation, n=6); Figure 8: shows serum creatinine levels measured in C57BL / 6 mice seven days after administration of a single 30 mg / kg dose of various DPEP peptides conjugated with a therapeutic antisense PMO, compared to currently available peptide carriers conjugated with the same therapeutic antisense PMO and saline (error bars: standard deviation, n= 6); Figures 9A to 9C: show serum levels of (Figure 9A) alanine transferase, (Figure 9B) alkaline phosphatase, and (Figure 9C) aspartate aminotransferase, measured in C57BL / 6 mice seven days after administration of a single 30 mg / kg dose of various DPEP peptides conjugated to a therapeutic antisense PMO, compared to currently available peptide carriers conjugated to the same therapeutic antisense PMO and saline (error bars: standard deviation, n=6); Figures 10A to 10C: show the in vivo efficacy of exon 23 skipping, assessed by qRT-PCR in (Figure 10A) anterior tibial muscle, (Figure 10B) diaphragm, and (Figure 10C) heart, from C57BL / 6 mice after a single intravenous administration of 30 mg / kg of various DPEP peptides conjugated with a therapeutic antisense PMO, compared to currently available peptide carriers conjugated with the same therapeutic antisense PMO and saline. Figures 11A and 11B. Evaluation of urinary KIM-1 levels on day 2 and day 7 after single-dose administration of varying amounts of peptide-PMO (2.5–50 mg / kg) to 8–10-week-old C57BL6 mice (n = 4–6), compared to currently available peptide carriers conjugated to the same therapeutic antisense PMO. KIM-1 levels were determined by ELISA and normalized to urinary creatinine levels. Data are presented as the number of times change over KIM-1 levels in saline-injected control mice (n = 10). Figures 12A to 12C: Comparative dose-response study of the in vivo exon-skipping efficacy of peptide-PMOs after single-dose administration in increasing amounts from 2.5 to 50 mg / kg to 8- to 10-week-old C57BL6 mice (n=3 to 6), compared to currently available peptide carriers conjugated with the same therapeutic antisense PMO. qPCR analysis of exon 23 exclusion was evaluated in (Figure 12A) anterior tibial muscle, (Figure 12B) diaphragm, and (Figure 12C) heart, 7 days post-administration. Figure 13: shows that different PMO DPEP1 / 3-[CAG]7 conjugates correct Mbnll transcript splicing defects in vitro in DM1 patient-derived myoblasts, with 2600 repeats in the DMPK gene, at various concentrations (n=1 to 3); Figure 14: shows that different PMO DPEP1 / 3-[CAG]7 conjugates correct DMD transcript splicing defects in vitro in DM1 patient-derived myoblasts, with 2600 repeats in the DMPK gene, at various concentrations (error bars: mean ± SEM, n= 1 to 3); Figure 15: Shows the relative levels of KIM-1 assessed in urine on day 2 and day 7 after injection of different DPEP1 / 3-[CAG]7 PMO conjugates in female C57BL6 mice, measured by ELISA with samples diluted for within-the-standard curve fit. Values were normalized to urinary creatinine levels to account for protein concentration in the urine. KIM-1 levels were similar to saline control injections compared to the number-fold increases induced with previous Pip series peptide carriers (error bars: mean ± SEM, n=4 to 10). Figure 16: Shows the relative levels of NGAL measured in urine on day 2 and day 7 after injection of different DPEP1 / 3-[CAG]7 PMO conjugates in female C57BL6 mice, measured by ELISA with samples diluted for within-the-standard curve fit. Values were normalized to urinary creatinine levels to account for protein concentration in the urine. NGAL levels were similar to saline control injections compared to the number-fold increases induced with previous Pip series peptide carriers (error bars: mean ± SEM, n = 4 to 10). Figure 17: Shows BLIN levels assessed in serum on day 7 after injection of different DPEP1 / 3-[CAG]7 PMO conjugates in female C57BL6 mice, compared to saline. BUN levels were similar to saline control injections compared to the number-fold increases induced with the previous Pip series peptide carriers (error bars: mean ± SEM, n = 4 to 10); Figure 18: Shows serum creatinine levels assessed on day 7 after injection of different DPEP1 / 3-[CAG]7 PMO conjugates in female C57BL6 mice, compared to saline. Creatinine levels were similar to saline control injections compared to the number-fold increases induced with previous Pip series peptide carriers (error bars: mean ± SEM, n = 4 to 10); Figures 19A to 19C show the levels of (Figure 19A) alanine aminotransferase (ALT), (Figure 19B) alkaline phosphatase (ALP), and (Figure 19C) aspartate aminotransferase (AST) assessed in the serum of female C57BL6 mice administered an IV bolus injection (tail vein) of different DPEP1 / 3-[CAG]7 PMO conjugates collected on day 7 post-injection compared to saline control. ALP, ALT, and AST levels were similar to saline control injections compared to the multi-fold increases induced by the Pip series of peptide carriers. Throughout the description and claims of this specification, the words “comprises” and “contains” and variations thereof mean “including, but not limited to” and are not intended to exclude (and do not exclude) any other portions, additives, components, wholes, or steps. Throughout the description and claims of this specification, the singular encompasses the plural unless the context otherwise requires. In particular, where the indefinite article is used, it is understood that the specification contemplates both plurality and singularity, unless the context otherwise requires. It is understood that the elements, wholes, features, compounds, portions, or chemical groups described in conjunction with a particular aspect, embodiment, or example of the invention are applicable to any other aspect, embodiment, or example described herein, unless incompatible. All elements disclosed in this specification (which includes every claim, abstract, and accompanying drawing) and / or all steps of any disclosed method or process may be combined in any combination, except for combinations where at least some of such elements and / or steps are mutually exclusive. The invention is not restricted to the details of any of the preceding embodiments. The invention extends to any novel element or combination thereof disclosed in this specification (including the claims, abstract, and accompanying drawings), or to any novel step or combination of steps of any disclosed method or process. The reader's attention is directed to all articles and documents filed concurrently with or prior to this specification in connection with this application and open to public inspection with this specification, and the contents of all such articles and documents are incorporated herein by reference. Examples 1. Materials and methods 1.1 Synthesis and preparation of the P-PMO L-amino acids protected with 9-fluoroenylmethoxycarbonyl (Fmoc), benzotazol-1-yl-oxy-tris-pyrrolidone-phosphonium (PyBOP), 2-(1H-benzotriazol-1-yl)-1,1,3,3-tetramethyluronium hexafluorophosphate (HBTU), and Wang resin preloaded with Fmoc-3-Ala-OH (0.19 or 0.46 mmol g-1) were obtained from Merck (Hohenbrunn, Germany). HPLC-grade acetonitrile, methanol, and synthesis-grade N-methyl-2-pyrrolidone (NMP) were obtained from Fisher Scientific (Loughborough, UK). Synthesis-grade A / ,A / -dimethylformamide (DMF) and diethyl ether were obtained from VWR (Leicestershire, UK). Pipedine and trifluoroacetic acid were obtained from Alfa Aesar (Heysham, England). PMO was obtained from Gene Tools Inc. (Philomath, USA). Chicken embryo extract and horse serum were obtained from Sera Laboratories International Ltd (West Sussex, UK). Interferon was obtained from Roche Applied Science (Penzberg, Germany). All other reagents were obtained from Sigma-Aldrich (St. Louis, Missouri, USA).), unless otherwise stated. MALDI-TOF mass spectrometry was performed using a Voyager DE Pro BioSpectrometry workstation. A 10 mg mL·1 stock solution of either acyano-4-hydroxycinnamic acid or sinapinic acid in 50% acetonitrile in water was used as the matrix. Error bars are ±0.1%. 1.2 Synthesis of P-PMO peptides for screening in H2k mdx cells a) Preparation of a peptide variant collection. Peptides were prepared at a 10 pmol scale using an Intavis Parallel Peptide Synthesizer, or at a 100 pmol scale using a CEM Liberty Blue™ Peptide Synthesizer (Buckingham, UK), using Wang resin preloaded with Fmoc-P-Ala-OH (0.19 or 0.46 mmol g, Merck Millipore), applying standard Fmoc chemistry and following the manufacturer's recommendations. For synthesis with the Intavis Parallel Peptide Synthesizer, double coupling steps were used with a PyBOP / NMM coupling mixture, followed by acetic anhydride covering after each step. For synthesis with the CEM Liberty Blue Peptide Synthesizer, standard single couplings were performed for all amino acids except arginine, which was synthesized by double couplings.The coupling was performed once at 75 °C for 5 min at a microwave power of 60 watts, except for the arginine residues, which were coupled twice each. Each deprotection reaction was carried out twice at 75 °C, once for 30 s and then for 3 min at a microwave power of 35 watts. After the synthesis was complete, the resin was washed with DMF (3 x 50 mL) and the N-end of the peptide attached to the solid phase was acetylated with acetic anhydride in the presence of DIPEA at room temperature. After N-end acetylation, the peptide resin was washed with DMF (3 x 20 mL) and DCM (3 x 20 mL). The peptides were separated from the solid support by treatment with a separation cocktail consisting of trifluoroacetic acid (TFA): H2O: triisopropylsilane (TIPS) (95%: 2.5%: 2.5%: 3 to 10 mL) for 3 h at room temperature. After peptide release, excess TFA was removed by spraying with nitrogen.The crude peptide was precipitated by adding cold diethyl ether (15 to 40 mL, depending on the scale of the synthesis) and centrifuged at 3200 rpm for 5 min. The crude peptide pellet was washed three times with cold diethyl ether (3 x 15 mL) and purified by RPHPLC using a Varian 940-LC HPLC system equipped with a 445-LC Scale-up module and a 440-LC fraction collector. The peptides were purified by semi-preparative HPLC on an RP-C18 column (10 x 250 nm, Phenomenex Jupiter) using a linear gradient of CH3CN in 0.1% TFA / H2O, with a flow rate of 15 mL min⁻¹. Detection was performed at 220 nm and 260 nm. The fractions containing the desired peptide were combined and lyophilized to produce the peptide as a white solid. ML / E / ZuZu / UO1101 Table 1: Peptides synthesized for testing in the examples with N-terminal acetylation and a C-terminal beta-alanine linker. Pip9b2 and R6Gly are comparison peptides. R6Gly uses a C-terminal glycine as a linker. μλ / ε / zuzi / uo i 1 ot Número del péptido Secuencia ID NO. incorporada Secuencia probada (con modificaciones adicionales en los extremos C y N terminales) D-PEP 1.1 27 Ac-RBRRBRRFQILYRBRBR-B D-PEP 1.2 28 Ac-RBRRBRRFQILYRBRR-B D-PEP 1.3 29 Ac-RBRRBRFQILYRRBRBR-B D-PEP 1.4 30 Ac-RBRRBRR-B D-PEP 1.5 31 Ac-RBRRBRRYQFLIRBRBR-B D-PEP 1.6 32 Ac-RBRRBRRILFQYRBRBR-B D-PEP 1.7 33 Ac-RBRRBRFQILYRBRBR-B D-PEP 1.8 34 Ac-RBRRBFQILYRBRRBR-B D-PEP 1.9 35 Ac-RBRRBRFQILYBRBR-B D-PEP 1.10 36 Ac-RBRRBFQILYRBRBR-B D-PEP 3.1 37 Ac-RBRRBRRFQILYRBHBH-B D-PEP 3.2 38 Ac-RBRRBRRFQILYHBHBR-B D-PEP 3.3 39 Ac-RBRRBRRFQILYHBRBH-B D-PEP 3.4 40 Ac-RBRRBRRYQFLIRBHBH-B D-PEP 3.5 41 Ac-RBRRBRRILFQYRBHBH-B D-PEP 3.6 42 Ac-RBRHBHRFQILYRBRBR-B D-PEP 3.7 43 Ac-RBRBBHRFQILYRBHBH-B D-PEP 3.8 44 Ac-RBRRBRFQILYRBHBH-B D-PEP 3.9 45 Ac-RBRRBRFQILYHBHBH-B D-PEP 3.10 46 Ac-RBRRBHFQILYRBHBH-B D-PEP 3.11 47 Ac-HBRRBRFQILYRBHBH-B D-PEP 3.12 48 Ac-RBRRBFQILYRBHBH-B D-PEP 3.13 49 Ac-RBRRBRFQILYBHBH-B D-PEP 3.14 50 Ac-RBRRBRYQFLIHBHBH-B D-PEP 3.15 51 Ac-RBRRBRILFQYHBHBH-B D-PEP 3.16 52 Ac-RBRRBRRFQILYHBHBH -B Pip9b2 113 Ac-RXRRBRR-FQILY-RBRXR-B R6Gly 114 RRRRRR-G. b) S / nts / s of a PMO-approved colección A 25-element antisense PMO sequence for mouse dystrophin exon 23 (GGCCAAACCTCGGCTTACCTGAAAT (SEQ ID NQ:90)) was used. The peptide was conjugated to the 3' end of the PMO via its C-terminal carboxyl group. This was achieved using 2.3 and 2 equivalents of PyBOP and HOAt in NMP, respectively, in the presence of 2.3 equivalents of DIPEA on the peptide and a 2.5-fold excess of the peptide on the PMO dissolved in DMSO. In some instances, 2.3 equivalents of HBTU were used instead of PyBOP for activation of the peptide's C-terminal carboxyl group. In general, a peptide solution (2500 nmol) in A / -methylpyrrolidone (NMP, 80 pL) was mixed with PyBOP (19.2 pL of 0.3 M NMP), HOAt (16.7 pL of 0.3 M NMP), DIPEA (1.0 pL), and PMO (100 pL of 10 mM DMSO). The mixture was left for 2.5 h at 40 °C, and the reaction was stopped by the addition of 0.1% TFA in H2O (300 pL).This solution was purified by ion-exchange chromatography using a converted Gilson HPLC system. PMO-peptide conjugates were purified on an ion-exchange column (Resource S 4 mL, GE Healthcare) using a linear gradient of sodium chloride (0 to 1 M) in sodium phosphate buffer (25 mM, pH 7.0) containing 20% CH3CN, at a flow rate of 4 mL min⁻¹. Fractions containing the desired compound were pooled and lyophilized to produce the peptide-PMO derivative as a white solid. Removal of excess salts from the peptide-PMO conjugate was achieved by filtration of the collected fractions after ion exchange using an Amicon® Ultra-15 3K centrifugal filtration device. The conjugate was lyophilized and analyzed by MALDI-TOF. The conjugates were dissolved in sterile water and filtered through a 0.22 pm cellulose acetate membrane before use.The concentration of the peptide-PMO was determined by molar absorption of the conjugates at 265 nm in 0.1 N HCl solution. (See Table 2 for yields). Table 2. Yields of P-PMO conjugates for cell culture analysis (yields are based on the dry weight of lyophilized purified P-PMO). The purity of the P-PMO is greater than 95%, as determined by normal-phase HPLC at 220 nm and 260 nm. (a) The P-PMO was synthesized using HBTU activation instead of PyBOP). ma / e / zuzi / uo i 1 ot Peptide-PMO Performance D-Pep 1.1-PMO 36% D-Pep 1.2-PMO -- D-Pep 1.3-PMO 25 %a D-Pep 1.4-PMO 24 %a D-Pep 1.5-PMO 24 %a D-Pep 1.6-PMO 25 %a D-Pep 1.7-PMO 33% D-pep 1.8-PMO 41% D-Pep 1.9-PMO 35% D-Pep 1.10-PMO 33% D-Pep 3.1-PMO 28% D-Pep 3.2-PMO 33 7o D-Pep 3.3-PMO 33 7o D-Pep 3.4-PMO 35 7o D-Pep 3.5-PMO 37 7o D-Pep 3.6-PMO 34 7o D-Pep 3.7-PMO 26 7o D-pep 3.8-PMO 34 7o D-Pep 3.9-PMO 28 7o D-Pep 3.10-PMO 28 7o D-Pep 3.11-PMO 29 7o D-Pep 3.12-PMO 29 7o D-Pep 3.13-PMO 31 7o D-Pep 3.14-PMO 34 7o D-Pep 3.15-PMO 32 7o D-Pep 3.16-PMO -- 1.3 Cultivo celular Murine H2k mdx myoblasts were cultured in gelatin-coated flasks (0.01%) at 33 °C under 10% CO2 in Dulbecco's modified Eagle medium (DMEM PAA Laboratories), supplemented with 20% heat-inactivated fetal bovine serum (FBS Gold, PAA Laboratories), 2% chicken embryo extract (Seralab), 1% penicillin-streptomycin-neomycin antibiotic mixture (PSN, Gibco), and 3 pg / pL of γ-interferon a (Roche). The cells were seeded in 24-well gelatin-coated plates (0.01%) at a density of 2 x 105 cells / mL and left for 2 days at 33 °C, 10% CO2. To differentiate into myotubes, the cells were allowed to grow further in DMEM supplemented with 5% horse serum (Sigma) and 1% PSN at 37°C, under 5% CO2 for 2 days. 1.4. Cell transfection The cells were incubated with the peptide-PMO conjugates prepared as described above, which were formed in serum-free Opti-MEM. 350 pL were added to each well in duplicate and incubated at 37 °C for 4 h. The transfection medium was then replaced with DMEM supplemented with 5% horse serum and 1% PSN, and the cells were incubated for a further 20 h at 37 °C. The cells were washed with PBS, and 0.5 mL of TRI RNA isolation reagent (Sigma) was added to each well. The cells were then frozen at -80 °C for 1 h. 1.5 RNA extraction and nested RT-PCR analysis Total cellular RNA was extracted using TRI reagent with an additional ethanol precipitation. The purified RNA was quantified using a Nanodrop® ND-1000 (Thermo Scientific). The RNA (400 ng) was used as a template for RT-PCR using a OneStep RT-PCR Kit (Roche, Indianapolis, USA). For primer sequences, see Table 4. The cycling conditions for the initial reverse transcription were 50 °C for 30 min and 94 °C for 7 min for 1 cycle, followed by 30 cycles at 94 °C for 20 s, 55 °C for 40 s, and 68 °C for 80 s. One pL of the RT-PCR product was used as a template for the second PCR step. Amplification was performed using 0.5 U of SuperTAQ in 25 cycles, at 94 °C for 30 s, 55 °C for 1 min and 72 °C for 1 min. The products were separated by electrophoresis using a 1.5% agarose gel.Images of the agarose gels were acquired using a Molecular Imager ChemiDoc™ XRS+ imaging system (BioRad, UK) and analyzed using Image Lab (V4.1). Microsoft Excel was used to analyze and graph the exon skipping assay data, which were expressed as the percentage of exon 23 skipping from at least three independent experiments. 1.6 Synthesis of PMO-peptide conjugates for analysis in H2k mdx mice a) Synthesis of peptide variants The peptides were synthesized on a 100 pmol scale using a CEM Liberty Blue™ microwave peptide synthesizer (Buckingham, UK) and Fmoc chemistry, following the manufacturer's recommendations. The side-chain protecting groups used were labile to trifluoroacetic acid treatment, and the peptide was synthesized using a 5-fold excess of Fmoc-protected amino acids (0.25 mmol), which were activated using PyBOP (5-fold excess) in the presence of DIPEA. Piperidine (20% v / v in DMF) was used to cleave the N-Fmoc protecting groups. Coupling was performed once at 75 °C for 5 min at a microwave power of 60 watts, except for the arginine residues, which were coupled twice each. Each deprotection reaction was performed twice at 75 °C, once for 30 s and then once for 3 min at a microwave power of 35 watts.Once the synthesis was complete, the resin was washed with DMF (3 x 50 mL) and the N-terminus of the peptide attached to the solid phase was acetylated with acetic anhydride in the presence of DIPEA at room temperature. After N-terminus acetylation, the peptide resin was washed with DMF (3 x 20 mL) and DCM (3 x 20 mL). The peptide was separated from the solid support by treatment with a separation cocktail consisting of trifluoroacetic acid (TFA): H₂O: triisopropylsilane (TIPS) (95%:2.5%:2.5%, 10 mL) for 3 h at room temperature. Excess TFA was removed by spraying with nitrogen. The separated peptide was precipitated by the addition of ice-cold diethyl ether and centrifuged at 3000 rpm for 5 min. The crude peptide pellet was washed three times with cold diethyl ether (3 x 40 mL) and purified by RP-HPLC using a Varian 940-LC HPLC system equipped with a 445-LC Scale-up module and a 440-LC fraction collector.The peptides were purified by semi-preparative HPLC on an RP-C18 column (10 x 250 nm, Phenomenex Jupiter) using a linear gradient of CH3CN in TFA 0.1% / H2O, with a flow rate of 15 mL min'1. Detection was performed at 220 nm and 260 nm. b) Synthesis of PMO-peptide conjugates A 25-element antisense PMO sequence for mouse dystrophin exon 23 (GGCCAAACCTCGGCTTACCTGAAAT (SEQ ID NQ:90)) was used. The peptide was conjugated to the 3' end of the PMO via its C-terminal carboxyl group. This was achieved using 2.3 and 2 times equivalents of PyBOP and HOAt in NMP, respectively, in the presence of 2.3 eq of DIPEA on the peptide and a 2.5-fold excess of the peptide on the PMO dissolved in DMSO. In some instances, HBTU (2.3 equivalents) was used instead of PyBOP for activation of the peptide's C-terminal carboxyl group. In general, a peptide solution (10 pmol) in N-methylpyrrolidone (NMP, 100 pL) was mixed with PyBOP (76.6 pL of 0.3 M NMP), HOAt (66.7 pL of 0.3 M NMP), DIPEA (4.0 pL), and PMO (400 pL of 10 mM DMSO). The mixture was left to stand for 2 h at 40 °C, and the reaction was stopped by adding 0.1% TFA (1 mL).The reaction was purified on a cation-exchange chromatography column (Resource S 6 mL column, GE Healthcare) using a linear gradient of sodium chloride (0 to 1 M) in sodium phosphate buffer (25 mM, pH 7.0) containing 20% CH3CN, at a flow rate of 6 mL min⁻¹. Removal of excess salts from the peptide-PMO conjugate was performed by filtration of the collected fractions after ion exchange using an Amicon® Ultra-15 3K centrifugal filtration device. The conjugate was lyophilized and analyzed by MALDI-TOF. The conjugates were dissolved in sterile water and filtered through a 0.22 µm cellulose acetate membrane before use. The peptide-PMO concentration was determined by molar absorption of the conjugates at 265 nm in 0.1 N HCl solution. Overall yields were 25 to 36% based on PMO (Table 3). Table 3. Yields of P-PMO conjugates synthesized on a larger scale for in vivo analysis (yields are based on the dry weight of the purified lyophilized P-PMO). The purity of the P-PMO is greater than 95%, as determined by normal-phase HPLC at 220 nm and 260 nm. (a) The PMO was synthesized using HBTU activation instead of PyBOP. Peptide-PMO Performance D-Pep 1.1-PMO 36% D-Pep 1.3-PMO 25%a D-Pep 1.4-PMO 24%a D-Pep 1.5-PMO 25%a D-Pep 1.6-PMO 25%a D-Pep 3.1-PMO 28% D-Pep 3.2-PMO 33% D-Pep 3.7-PMO 26% D-pep 3.8-PMO 34% D-Pep 3.9-PMO 28% D-Pep 3.10-PMO 28% 1.7 In vivo evaluation of dystrophin restoration by P-PMO The experiments were conducted at the Biomedical Sciences Unit, University of Oxford, under a Home Office Project Licence following institutional ethics review. Mice were housed in a minimal disease facility; the environment was temperature-controlled with a 12-hour light-dark cycle. All animals had free access to commercial rodent food and water. The experiments were performed using 10- to 12-week-old female mdx mice. The mdx mice were restrained prior to a single injection of 10 mg / kg of P-PMO into the tail vein. One week after the injection, the mice were sacrificed, and their TA muscles, heart, and diaphragm were removed and flash-frozen in isopentane cooled on dry ice and stored at -80 °C. 1.8 Western blot analysis To assess the duration of dystrophin restoration after a single administration, one-third of the muscle (for TA and diaphragm) or ninety 7-µm thick cryosections (for the heart) were used in 300 pL of buffer (50 mM Tris pH 8, 150 mM NaCl, 1% NP40, 0.5% sodium deoxycholate, 10% SDS, and protease / phosphatase inhibitors) before centrifugation at 13,000 rpm (Heraeus, No. 3325B) for 10 min. The supernatant was collected and warmed to 100 °C for 3 min. Protein was quantified by the BCA method, and 40 pg of protein / sample were resolved on a NuPage gel with 3–8% Tris-acetate as previously described (19). The proteins were transferred to a PVDF membrane with a pore size of 0.45 pm for 1 h at 30V, followed by 1 h at 100V, and were probed with anti-dystrophin (1:200, NCL-DYS1, Novocastra) and anti-vinculin (load control, 1:100,000, hVIN-1, Sigma) monoclonal antibodies as described above (37).The goat mouse secondary antibody 800CW IRDye was used at a dilution of 1:20000 (LiCOR). Dystrophin restoration levels in P-PMO-treated mdx mice were expressed relative to levels in wild-type C57BL / 10 control mice, considered as 100%. A standard curve was generated for this purpose, including five serial dilutions of the protein in C57BL / 10, run in parallel with the P-PMO-treated mdx samples. The dilution series were as follows: 75%, 40%, 15%, 5%, or 0%, respectively, of the 40 pg of total protein loaded per lane, were from C57BL / 10 protein, and the remainder from untreated mdx protein. These standards were aliquoted and used in each Western blot in parallel with the treated mdx samples. For all standard and treated samples, dystrophin intensity was quantified using the Fluorescence Odyssey imaging system and normalized by calculating the ratio with respect to vinculin fluorescence intensity in all samples.Standard normalized values were plotted against their known dystrophin concentration to obtain the best-fit mathematical expression, and this expression was used to interpolate the normalized values for each sample of mdx mice treated with P-PMO. 1.9 In vivo RT-qPCR analysis of exon 23 skipping of Dmd The exclusion of exon 23 from the mouse DMD transcript was quantified in peptide-PMO-treated skeletal muscle and cardiac tissue. Briefly, RNA was extracted from the homogenized tissue using a Trizol-based extraction method, and cDNA was synthesized using random primers. Primers / probes were synthesized by Integrated DNA Technologies and were designed to amplify a region spanning exons 23–24, representing an unskipped product (mDMD23–24, see Table 4), or to specifically amplify transcripts lacking exon 23 using a probe spanning the boundary of exons 22–24 (mDMD22–24). The levels of the respective transcripts were determined by calibration with standard curves prepared using known quantities of the transcripts, and the skipping percentages were derived by [skipped] / [skipped + unskipped]. MA / t / ZUZl / UO / lO / Table 4: Primer and probe sequences for exon 23 skipping quantification using nested RT-PCR or quantitative RT-PCR methods. Assay ID Initiator Sequence (5'-3') Sequence ID NO. Nested RT-PCR Exon20Fo CAGAATTCTGCCAATTGCTGAG 91 Exon26Ro TTCTTCAGCTTGTGTCATCC 92 Exon20F¡ CCCAGTCTACCACCCTATCAGAGC 93 Exon26Ri CCTGCCTTTAAGGCTTCCTT 94 qRT-PCR Primer 1 CAGGCCATTCCTCTTTCAGG 95 Primer 2 GAAACTTTCCTCCCAGTTGGT 96 mDMD23-24 Probe / 5FAM / TCAACTTCA / ZEN / GCCATCCATTTCTGTAAGGT / 3IABkFQ / 97 Initiator 1 CTGAATATGAAATAATGGAGGAGAGACTCG 98 mDMD22-24 Initiator 2 CTTCAGCCATCCATTTCTGTAAGGT 99 Probe / 5FAM / ATGTGATTC / ZEN / TGTAATTTCC / 3IABkFQ / 100 1.10 Toxicological evaluation of the PMO-peptide Eight- to ten-week-old female C57BL / 6 mice were administered a single 30 mg / kg dose of the peptide-PMO in 0.9% saline by intravenous bolus injection into the tail vein. Urine was collected non-invasively under cold conditions on days 2 and 7 post-administration, followed by 20 hours of housing in metabolic cages (Tecniplast, UK). Serum was collected from the jugular vein on day 7 at necropsy, as were anterior tibial muscle, diaphragm, and cardiac tissue. The same procedure was followed for different amounts of single doses ranging from 2.5 mg / kg to 50 mg / kg of the peptide-PMO in 0.9% saline solution by intravenous injection into the tail vein. Urinary levels of KIM-1 (kidney injury molecule 1) and NGAL (neutrophil gelatinase-associated lipocalin) were quantified by ELISA (KIM-1 R&D Cat. No. MKM100, NGAL R&D Cat. No. MLCN20), following appropriate urine dilutions to fit the standard curves. Values were normalized to urine creatinine levels, which were quantified at the MRC Harwell Institute, Mary Lyon Centre, Oxfordshire, UK. Blood urea nitrogen levels were quantified at the MRC Harwell Institute, Mary Lyon Centre, Oxfordshire, UK. All levels were quantified on an AU680 Clinical Chemistry Analyser, Beckman Coulter. The quantification of exon skipping efficiency was determined by quantitative RT-PCR of skipped and non-skipped exon 23 transcripts and expressed as a percentage of skipped transcript versus total (skipped and non-skipped) (see sequences in Table 4). 2. Results The results presented here demonstrate a clear dose-response effect of the peptide-PMO conjugates generated herein on exon skipping activity within cells (Figures 1, 2, and 12A to 12C). These figures also highlight that all peptides in the DPEP1 and DPEP3 series, i.e., the peptides of the invention, have sufficient cell penetration efficacy to be considered for therapeutic use. The results presented herein also highlight the in vivo activity of the peptide-PMO conjugates in a relevant mouse disease model (Figures 3A to 4C). Overall, the results suggest that the activity of such conjugates is highest in the anterior tibial muscle > diaphragm > heart. These figures demonstrate that the DPEP peptide conjugates of the invention have good exon-skipping activity in vivo and increase dystrophin protein expression in vivo. Furthermore, the DPEP conjugates of the invention compare favorably in both respects with prior cell-penetrating peptides, such as the 'PIP' and R6Gly peptides, when used in the same conjugate. It is also demonstrated herein that KIM-1 and NGAL levels (which are indicators of nephrotoxicity) after administration of the DPEP peptide conjugates are all significantly lower than those of the previously described cell-penetrating peptide conjugates. DPEP 1.9 and 3.8 conjugates show the lowest levels of these markers (Figures 5, 6, and 11A to 11B). Furthermore, serum urea nitrogen levels (another marker of renal dysfunction) are elevated only for the Pip9b2 conjugates and not for the DPEP peptide conjugates of the invention (Figure 7). The second major finding is that seven days after administration, KIM-1 and NGAL levels are reduced to almost saline levels for all DPEP peptide conjugates, suggesting some reversal and improvement of the kidney-related toxicity.This effect is not observed with conjugates using the aforementioned cell-penetrating peptides. This reservoir effect of toxicity is still observed with the DPEP peptides of the invention when administered at high doses of 50 mg / kg (Figures 11A and 11B). The toxicity of the aforementioned cell-penetrating peptides is not reduced after 7 days, and the toxic markers remain significantly higher overall. It is further demonstrated that exon skipping activity remains high for all DPEP peptide conjugates in TA and diaphragm (Figures 10A to 10C and Figures 12A to 12C) at higher doses of 30 and 50 mg / kg, which, when corroborated by the reduced levels of renal damage markers, suggests a broader therapeutic index for these compounds because the toxicity markers are significantly lower. It is also noteworthy that all DPEP peptide conjugates exhibit higher activity than the known comparator R6Gly in a conjugate, while maintaining at least similar levels of toxicity markers; and similar activity to the known peptide comparator PIP in a conjugate, while having much lower levels of toxicity markers. In some cases, the DPEP peptide conjugates of the invention exhibit not only higher activity compared to the known conjugate R6Gly, but also reduced toxicity markers. Therefore, the DPEP1 and 3 peptides of the invention provide promising cell-penetrating peptides to improve the efficacy and reduce the toxicity of therapeutic conjugates for the treatment of neuromuscular disorders in humans. 3. Additional Examples: P-PMO Synthesis and Preparation L-amino acids protected with 9-fluoroenylmethoxycarbonyl (Fmoc), benzotriazol-1-yl-oxy-tris-pyrrolidone-phosphonium (PyBOP), 2-(1H-benzotriazol-1-yl)-1,1,3,3-tetramethyluronium hexafluorophosphate (HBTU), and Wang resin preloaded with Fmoc-P-Ala-OH (0.19 or 0.46 mmol g⁻¹) were obtained from Merck (Hohenbrunn, Germany). 1-Hydroxy-7-azabenzotriazole (HOAt) was obtained from Sigma-Aldrich. HPLC-grade acetonitrile, methanol, and synthesis-grade N-methyl-2-pyrrolidone (NMP) were obtained from Fisher Scientific (Loughborough, UK). Synthesis-grade A / ,A / -dimethylformamide (DMF) and diethyl ether were obtained from VWR (Leicestershire, UK). Piperidine and trifluoroacetic acid were obtained from Alfa Aesar (Heysham, England). PMO was obtained from Gene Tools Inc. (Philomath, USA). All other reagents were obtained from Sigma-Aldrich (St. Louis, Missouri, USA), unless otherwise noted.MALDI-TOF mass spectrometry was performed using a Voyager DE Pro BioSpectrometry workstation. A 10 mg mL⁻¹ stock solution of α-cyano-4-hydroxycinnamic acid or sinapinic acid in 150% acetonitrile in water was used as the matrix. Error bars are ±0.1%. Synthesis of P-PMO peptides for cell screening a) Preparation of a collection of peptide variants Peptides were prepared at a 10 pmol scale using an Intavis Parallel Peptide Synthesizer, or at a 100 pmol scale using a CEM Liberty Blue™ Peptide Synthesizer (Buckingham, UK), using Wang resin preloaded with Fmoc-p-Ala-OH (0.19 or 0.46 mmol g⁻¹, Merck Millipore), applying standard Fmoc chemistry and following the manufacturer's recommendations. For synthesis with the Intavis Parallel Peptide Synthesizer, double coupling steps were used with a PyBOP / NMM coupling mixture, followed by acetic anhydride covering after each step. For synthesis with the CEM Liberty Blue Peptide Synthesizer, standard single couplings were performed for all amino acids except arginine, which was synthesized by double couplings.The coupling was performed once at 75 °C for 5 min at a microwave power of 60 watts, except for the arginine residues which were coupled twice. Each deprotection reaction was carried out twice at 75 °C, once for 30 s and then for 3 min at a microwave power of 35 watts. After the synthesis was completed, the resin was washed with DMF (3 x 50 mL) and the N-terminus of the peptide attached to the solid phase was acetylated with acetic anhydride in the presence of DIPEA at room temperature. After N-terminus acetylation, the peptide resin was washed with DMF (3 x 20 mL) and DCM (3 x 20 mL). The peptides were separated from the solid support by treatment with a separation cocktail consisting of trifluoroacetic acid (TFA): H₂O: triisopropylsilane (TIPS) (95%: 2.5%: 2.5%: 3 to 10 mL) for 3 h at room temperature. After peptide release, excess TFA was removed by spraying with nitrogen. The crude peptide was precipitated by the addition of cold diethyl ether (15 to 40 mL, depending on the scale of the synthesis) and centrifuged at 3200 rpm for 5 min.The crude peptide pellet was washed three times with cold diethyl ether (3 x 15 mL) and purified by RPHPLC using a Varian 940-LC HPLC system equipped with a 445-LC Scale-up module and a 440-LC fraction collector. Peptides were purified by semi-preparative HPLC on an RP-C18 column (10 x 250 nm, Phenomenex Jupiter) using a linear gradient of CH3CN in 0.1% TFA / H2O, with a flow rate of 15 mL min⁻¹. Detection was performed at 220 nm and 260 nm. Fractions containing the desired peptide were pooled and lyophilized to produce the peptide as a white solid (see yields in Table 5). ma / e / zuzi / UO11 or t Table 5: Peptides synthesized for testing in the examples with N-terminal acetylation (Ac), C-terminal β-alanine linker (B); S* is a glycosylated serine residue. DPEP5.7, Pip9b2 and Pip6a are comparator peptides. Peptide Number Sequence ID NO. Incorporated Tested Sequence (with additional modifications at the C and N terminals) D-PEP 1.1 27 Ac-RBRRBRRFQI LYRBRBR-B D-PEP 1.7 33 Ac-RBRRBRFQI LYRBRBR-B D-PEP 1.8 34 Ac-RBRRBFQILYRBRRBR-B D-PEP 1.9 35 Ac-RBRRBRFQI LYBRBR-B D-PEP 1.9W3 104 Ac-RBRRBRWWWBRBR-B DPEP 1.9W4P 105 Ac-RBRRBRWWPWWBRBR-B D-PEP 3.1 37 Ac-RBRRBRRFQILYRBHBH-B D-PEP 3.8 44 Ac-RBRRBRFQILYRBHBH-B D-PEP 5.70 106 Ac-RBRBRS*RBRBR-B Pip6a 112 Ac-RXRRBRRXR-YQFLI-RXRBRXR-B Pip9b2 113 Ac-RXRRBRR-FQI LY-RBRXR-B b) Synthesis of a collection of Peptide-PMO conjugates A 25-element antisense PMO sequence for triplet repeat sequences (CAGCAGCAGCAGCAGCAGCAG (SEQ ID NO.107)), also known as [CAG]7, was used. The peptide was conjugated to the 3' end of the PMO via its C-terminal carboxyl group. This was achieved using 2.5 and 2 equivalents of PyBOP and HOAt in NMP, respectively, in the presence of 2.5 equivalents of DIPEA, and a 2.5-fold excess of the peptide was used over the PMO dissolved in DMSO. In general, a peptide solution (2500 nmol) in N-methylpyrrolidone (NMP, 80 pL) was mixed with PyBOP (19.2 pL of 0.3 M NMP), HOAt (16.7 pL of 0.3 M NMP), DIPEA (1.0 mL), and PMO (180 pL of 10 mM DMSO). The mixture was left to stand for 2.5 h at 40 °C, and the reaction was stopped by the addition of 0.1% TFA in H₂O (300 pL). This solution was purified by ion-exchange chromatography using a converted Gilson HPLC system.PMO-peptide conjugates were purified on an ion-exchange column (Resource S 4 mL, GE Healthcare) using a linear gradient of sodium phosphate buffer (25 mM, pH 7.0) containing 20% CH3CN. A 1 M sodium chloride solution was used to elute the conjugate from the column at a flow rate of 4 mL min⁻¹ to 6 mL min⁻¹. Fractions containing the desired compound were pooled and immediately desalted. Removal of excess salts from the peptide-PMO conjugate was achieved by filtration of the collected fractions after ion exchange using an Amicon® Ultra-15 3K centrifugal filtration device. The conjugate was lyophilized and analyzed by MALDI-TOF. The conjugates were dissolved in sterile water and filtered through a 0.22 µm cellulose acetate membrane before use. The concentration of the peptide-PMO was determined by the molar absorption of the conjugates at 265 nm in 0.1 N HCl solution.(See Table 6 for yields). MX / C / ZUZI / uo i 1 ot Table 6. Yields of P-PMO conjugates for cell culture analysis and in vivo experiments (yields are based on the dry weight of lyophilized purified P-PMO). The purity of the P-PMO is greater than 95%, as determined by normal-phase HPLC at 220 nm and 260 nm. Peptide Performance D-Pep 1.1 36% D-Pep 1.7 41% D-pep 1.8 38% D-Pep 1.9 40% D-Pep 1.9W3 43% D-Pep 1.9W4P 23% D-Pep 3.1 31% D-Pep 3.8 36% D-Pep 5.70 31% Synthesis of Peptide-PMO Conjugates The peptides were synthesized and conjugated to the PMO as described above. The PMO sequence that targets the expanded CUG / CTG repeats (5CAGCAGCAGCAGCAGCAGCAG-3' (SEQ ID NO: 107)) was obtained from Gene Tools LLC. This is a [CAG]7 PMO as referred to elsewhere herein. Cell culture and treatment with the PMO-Peptide Immortalized myoblasts from healthy individuals or patients with type 1 diabetes (T1D) containing 2600 CTG repeats were cultured in a growth medium consisting of a mixture of M199:DMEM (1:4 ratio; Life Technologies) supplemented with 20% FBS (Life Technologies), 50 pg / mL gentamicin (Life Technologies), 25 pg / mL fetuin, 0.5 ng / mL bFGF, 5 ng / mL EGF, and 0.2 pg / mL dexamethasone (Sigma-Aldrich). Myogenic differentiation was induced by transferring confluent cell cultures to DMEM medium supplemented with 5 pg / mL insulin (Sigma-Aldrich) for myoblasts. For treatment, either wild-type (WT) or T1D cells were differentiated over 4 days. The medium was then changed to fresh differentiation medium with peptide-PMO conjugates at a concentration of 1, 2, 5, 10, 20 or 40 pM. Cells were harvested for analysis after 48h of treatment.Cell viability was quantified after 2 days of transfection of the peptide-PMO at 40 pM in human hepatocytes or at a concentration of 1,2,5,10,20 or 40 pM in human myoblasts, using a fluorescent assay (Promega). RNA isolation, RT-PCR and qPCR analysis. For mouse tissues: Before RNA extraction, muscle tissue was disrupted in TriReagent (Sigma-Aldrich) using a Fastprep system and Lysing Matrix D tubes (MP Biomedicals). For human cells: Before RNA extraction, cells were incubated with proteinase K buffer (500 mM NaCl, 10 mM Tris-HCl, pH 7.2, 1.5 mM MgCl₂, 10 mM EDTA, 2% SDS, and 0.5 mg / mL proteinase K) for 45 min at 55 °C. Total RNAs were isolated using TriReagent according to the manufacturer's protocol. One microgram of RNA was reverse transcribed using the M-MLV first-strand synthesis system (Life Technologies) according to the manufacturer's instructions, in a total of 20 pL. Subsequently, 1 pL of cDNA preparation was used in a semi-quantitative PCR analysis according to the standard protocol. PCR amplification was performed for 25 to 35 cycles within the linear amplification range for each gene.The PCR products were resolved on 1.5–2% agarose gels, stained with ethidium bromide, and quantified using ImageJ software. Exon inclusion ratios were quantified as a percentage of inclusion relative to the total signal intensity of the medium. The primers are shown in Table 7 below. ML / E / ZuZ / UO Z O í Table 7: PCR Initiators Initiator Name SEQ ID NO. Species / Gen / Exon Sequence (5'-3') MbnH.F 108 Mouse-human / mbnl1 / exon5 GCTGCCCAATACCAGGTCAAC Mbnll.R 109 Mouse-human / mbnl1 / exon5 TGGTGGGAGAAATGCTGTATGC DMD.F 110 Human / DMD / exon78 TTAGAGGAGGTGATGGAGCA DMD.R 111 Human / DMD / exon78 GATACTAAGGACTCCATCGC Toxicology Toxicology assessments were performed as described above in section 1.10. Results Treated muscle cells (myoblasts) derived from patients with type 1 diabetes (T1D) showed that PMO peptide-[CAG] / DPEP 1 or 3 conjugates specifically target CUGexpDMPK transcripts to counteract the harmful sequestration of the splicing factor MBNL1 by nuclear RNA foci, and consequently the functional loss of MBNL1, which is responsible for splicing defects and muscle dysfunction. PMO peptide-[CAG]7 DPEP 1 / 3 conjugates penetrate the cells and induce splicing normalization with high efficacy (Figure 13). This new generation of so-called 'DPEP1 and DPEP3' peptides has shown high efficacy in correcting splicing defects in vitro when conjugated to a PMO antisense oligonucleotide with a CAG7 repeat, indicating potential therapeutic use for the treatment of T1D. Furthermore, preliminary toxicological evaluation of the conjugates formed with DPEP1 / 3 indicates that ALP, ALT, AST, KIM-1, BUN, NGAL, and creatinine levels are similar to control saline injections, unlike the number-fold increases typically induced by currently available Pip series peptide carriers. Based on these preliminary data, the present inventors demonstrate that conjugates formed with DPEP peptides and a [CAG]β PMO are as active as conjugates formed with previous peptides, such as Pip6a, but have a broader therapeutic window because they are less toxic (Figures 15 to 19C).
Claims
1. A peptide having a total length of 40 amino acid residues or less, the peptide comprising: two or more cationic domains each comprising at least 4 amino acid residues; and one or more hydrophobic domains each comprising at least 3 amino acid residues; wherein the peptide does not contain artificial amino acid residues 2. The peptide according to claim 1, wherein the peptide does not contain aminohexanoic acid residues (X), preferably wherein the peptide does not contain 6-aminohexanoic acid residues.
3. The peptide according to claims 1 or 2, wherein the peptide consists of naturally occurring amino acid residues.
4. The peptide according to any of the preceding claims, wherein each cationic domain has a length of between 4 and 12 amino acid residues, preferably between 4 and 7 amino acid residues.
5. The peptide according to any of the preceding claims, wherein each cationic domain comprises at least 40%, at least 45%, or at least 50% cationic amino acids.
6. The peptide according to any one of claims 1 to 4, wherein each cationic domain comprises a majority of cationic amino acids, preferably at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% cationic amino acids.
7. The peptide according to any preceding claim, wherein each cationic domain comprises residues of arginine, histidine, beta-alanine, hydroxyproline and / or serine, preferably wherein each cationic domain consists of residues of arginine, histidine, beta-alanine, hydroxyproline and / or serine.
8. The peptide according to any of the preceding claims, wherein each cationic domain is arginine-rich and / or histidine-rich, preferably each cationic domain comprises at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70% of arginine and / or histidine residues.
9. The peptide according to any preceding claim, wherein the peptide comprises two cationic domains.
10. The peptide according to any preceding claim, wherein each cationic domain comprises one of the following sequences: RBRRBRR (SEQ ID NO:1), RBRBR (SEQ ID NO:2), RBRR (SEQ ID NO:3), RBRRBR (SEQ ID NO:4), RRBRBR (SEQ ID NO:5), RBRRB (SEQ ID NO:6), BRBR (SEQ ID NO:7), RBHBH (SEQ ID NO:8), HBHBR (SEQ ID NO:9), RBRHBHR (SEQ ID NO:10), RBRBBHR (SEQ ID NO:11), RBRRBH (SEQ ID NO:12), HBRRBR (SEQ ID NO:13), HBHBH (SEQ ID NO:14), BHBH (SEQ ID NO:15), BRBSB (SEQ ID NO:16), BRB[Hyp]B (SEQ ID NO:17), R[Hyp]H[Hyp]HB (SEQ ID NO:18), IVIA / t / ZUZ I / UD / IO / R[Hyp]RR[Hyp]R (SEQ ID NO:19) or any combination thereof, preferably wherein each cationic domain consists of one of the following sequences: RBRRBRR (SEQ ID NO:1), RBRBR (SEQ ID NO:2), RBRR (SEQ ID NO:3), RBRRBR (SEQ ID NO:4), RRBRBR (SEQ ID NO:5), RBRRB (SEQ ID NO:6), BRBR (SEQ ID NO:7), RBHBH (SEQ ID NO:8), HBHBR (SEQ ID NO:9), RBRHBHR (SEQ ID NO:10), RBRBBHR (SEQ ID NO:11), RBRRBH (SEQ ID NO:12),HBRRBR (SEQ ID NO:13), HBHBH (SEQ ID NO:14), BHBH (SEQ ID NO:15), BRBSB (SEQ ID NO:16), BRB[Hyp]B (SEQ ID NO:17), R[Hyp]H[Hyp]HB (SEQ ID NO:18), R[Hyp]RR[Hyp]R (SEQ ID NO:19) or any combination thereof.
11. The peptide according to any of the preceding claims, wherein each hydrophobic domain has a length of between 3 and 6 amino acids, preferably each hydrophobic domain has a length of 5 amino acids.
12. The peptide according to any preceding claim, wherein each hydrophobic domain comprises a majority of hydrophobic amino acid residues, preferably each hydrophobic domain comprises at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 100% hydrophobic amino acids.
13. The peptide according to any preceding claim, wherein each hydrophobic domain comprises residues of phenylalanine, leucine, isoleucine, tyrosine, tryptophan, proline, and glutamine; preferably wherein each hydrophobic domain consists of residues of phenylalanine, leucine, isoleucine, tyrosine, tryptophan, proline, and / or glutamine.
14. The peptide according to any of the preceding claims, wherein the peptide comprises a hydrophobic domain.
15. The peptide according to any preceding claim, wherein the hydrophobic domain comprises one of the following sequences: YQFLI (SEQ ID NO:20), FQILY (SEQ ID NO:21), ILFQY (SEQ ID NO:22), FQIY (SEQ ID NO:23), WWW, WWPWW (SEQ ID NO:24), WPWW (SEQ ID NO:25), WWPW (SEQ ID NO:26) or any combination thereof; preferably where the or each hydrophobic domain consists of one of the following sequences: YQFLI (SEQ ID NO:20), FQILY (SEQ ID NO:21), ILFQY (SEQ ID NO:22), FQIY (SEQ ID NO:23), WWW, WWPWW (SEQ ID NO:24), WPWW (SEQ ID NO:25), WWPW (SEQ ID NO:26) or any combination thereof.
16. The peptide according to any preceding claim, wherein the peptide consists of two cationic domains and a hydrophobic domain, preferably wherein the peptide consists of a central hydrophobic domain flanked by two cationic arm domains.
17. The peptide according to any preceding claim, wherein the peptide consists of a central hydrophobic domain comprising a sequence selected from: YQFLI (SEQ ID NO:20), FQILY (SEQ ID NO:21), ILFQY (SEQ ID NO:22), FQIY (SEQ ID NO:23), WWW, WWPWW (SEQ ID NO:24), WPWW (SEQ ID NO:25), and WWPW (SEQ ID NO:26), flanked by two cationic arm domains each comprising a sequence selected from: RBRRBRR (SEQ ID NO:1), RBRBR (SEQ ID NO:2), RBRR (SEQ ID NO:3), RBRRBR (SEQ ID NO:4), RRBRBR (SEQ ID NO:5), RBRRB (SEQ ID NO:6), BRBR (SEQ ID NO:7), RBHBH (SEQ ID NO:8), HBHBR (SEQ ID NO:9), RBRHBHR (SEQ ID NO:10), RBRBBHR (SEQ ID NO:11), RBRRBH (SEQ ID NO:12), HBRRBR (SEQ ID NO:13), HBHBH (SEQ ID ΝΟ:14), ΒΗΒΗ (SEQ ID ΝΟ:15), BRBSB (SEQ ID NO:16), BRB[Hyp]B (SEQ ID NO:17), R[Hyp]H[Hyp]HB (SEQ ID NO:18), and R[Hyp]RR[Hyp]R (SEQ ID NO:19).
18. The peptide according to any preceding claim, wherein the peptide consists of one of the following sequences: RBRRBRRFQILYRBRBR (SEQ ID NO:27), RBRRBRRYQFLIRBRBR (SEQ ID NO:31), RBRRBRRILFQYRBRBR (SEQ ID NO:32), RBRRBRFQILYBRBR (SEQ ID NO:35), RBRRBRRFQILYRBHBH (SEQ ID NO:37), RBRRBRRFQILYHBHBR (SEQ ID NO:38), RBRRBRFQILYRBHBH (SEQ ID NO:44).
19. A conjugate comprising the peptide according to any of claims 1 to 18 covalently linked to a therapeutic molecule.
20. The conjugate according to claim 19, further comprising a linker, preferably wherein the linker links the conjugate to the therapeutic molecule.
21. The conjugate according to claims 19 or 20, wherein the linker is selected from G, BC, XC, C, GGC, BBC, BXC, XBC, X, XX, B, BB, BX and XB.
22. The conjugate according to any one of claims 19 to 21, wherein the therapeutic molecule is selected from: a nucleic acid, peptidonucleic acid, antisense oligonucleotide (such as PNA, PMO), short interfering RNA, microRNA, peptide, cyclic peptide, protein, pharmaceutical agent or drug, preferably wherein the therapeutic molecule is an antisense oligonucleotide.
23. A conjugate according to any of claims 19 to 22, for use as a medicament.
24. A conjugate for use according to claim 23 in the treatment of diseases of the neuromuscular or musculoskeletal system, preferably genetic diseases of the neuromuscular or musculoskeletal system, preferably hereditary genetic diseases of the neuromuscular or musculoskeletal system, preferably X-linked hereditary genetic diseases of the neuromuscular or musculoskeletal system.
25. A conjugate for use according to claims 23 or 24 in the treatment of ML / E / ZυZΊ / UO Z Ί O í DMD.