Antisense nucleic acids that induce exon 51 skipping

Antisense oligomers with specific sequences efficiently induce exon 51 skipping in the dystrophin gene, addressing the need for effective DMD treatment by producing functional dystrophin protein with improved solubility and safety.

JP2026001070APending Publication Date: 2026-01-06NIPPON SHINYAKU CO LTD +1
View PDF 10 Cites 0 Cited by

Patent Information

Application Number
JP2025157620
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2020-02-28
Filing Date
2025-09-24
Publication Date
2026-01-06

AI Technical Summary

Technical Problem

There is a need for an antisense oligomer that can highly efficiently induce skipping of exon 51 of the dystrophin gene, while maintaining excellent solubility and safety, to treat Duchenne muscular dystrophy (DMD) by restoring the amino acid reading frame and producing a partially functional dystrophin protein.

Method used

The development of antisense oligomers with specific nucleotide sequences, including variants and modifications, that efficiently induce exon 51 skipping of the human dystrophin gene, ensuring high solubility and safety, thereby correcting the reading frame and producing a functional dystrophin protein.

Benefits of technology

The antisense oligomers effectively induce exon 51 skipping, improving muscle cell stability and function, with high solubility and minimal adverse effects on kidney and liver function.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2026001070000027
    Figure 2026001070000027
  • Figure 2026001070000028
    Figure 2026001070000028
  • Figure 2026001070000029
    Figure 2026001070000029
Patent Text Reader

Abstract

To provide an agent for highly efficiently skipping the 51st exon of a human dystrophin gene in the treatment of Duchenne muscular dystrophy (DMD).SOLUTION: The following (a1) to (d1): (a1) an antisense oligomer comprising a specific nucleotide sequence; (b1) an antisense oligomer comprising a nucleotide sequence derived from the specific nucleotide sequence by deletion, substitution, insertion, and / or addition of 1 to 5 nucleotides; (c1) an antisense oligomer comprising a nucleotide sequence derived from the specific nucleotide sequence by deletion, substitution, insertion, and / or addition of 1 to 5 nucleotides; An antisense oligomer comprising a base sequence having a sequence identity of 80% or more; and (d1) an antisense oligomer hybridizing under stringent conditions with an oligonucleotide consisting of a base sequence complementary to a specific base sequence, provided that the specific base sequence is excluded, or a pharmaceutically acceptable salt thereof or a hydrate thereof.SELECTED DRAWING: None
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] The present invention relates to an antisense oligomer that induces skipping of exon 51 of the human dystrophin gene, and a pharmaceutical composition containing the antisense oligomer. [Background technology]

[0002] Duchenne muscular dystrophy (DMD) is the most common severe hereditary progressive muscular atrophy, occurring in approximately 1 in 3,500 male births. During infancy, patients exhibit motor function almost identical to that of healthy individuals, but muscle weakness begins to decline from around age 4-5. Subsequently, muscle weakness in DMD patients progresses, leading to the inability to walk by around age 12 and death from cardiac or respiratory failure in the patient's twenties. Currently, there is no satisfactory treatment for DMD, and there is a strong need for the development of effective therapeutic agents.

[0003] DMD is known to be caused by mutations in the dystrophin gene. The dystrophin gene is located on the X chromosome and is a large gene consisting of 2.2 million base pairs of DNA. The DNA is transcribed into pre-mRNA, which is then spliced ​​to remove introns and join 79 exons, resulting in an mRNA of 11,058 bases corresponding to the translated region. This mRNA is translated into 3,685 amino acids to produce the dystrophin protein. The dystrophin protein is involved in maintaining muscle cell membrane stability and is necessary for preventing muscle cell breakdown. Because the dystrophin gene in DMD patients is mutated, functional dystrophin protein is barely expressed in muscle cells. As a result, muscle cell structure cannot be maintained in DMD patients, and large amounts of calcium ions flow into the muscle cells. This results in an inflammation-like response, leading to fibrosis and making muscle cell regeneration more difficult.

[0004] Becker muscular dystrophy (BMD) is also caused by mutations in the dystrophin gene. Although symptoms of BMD include muscle atrophy, they are generally milder than DMD, and the progression of muscle weakness is slower. BMD often develops in adulthood. The clinical differences between DMD and BMD are thought to be due to whether the mutation disrupts or maintains the amino acid reading frame during translation of dystrophin mRNA into dystrophin protein (Non-Patent Document 1). In other words, DMD has a mutation that shifts the amino acid reading frame, resulting in the expression of almost no functional dystrophin protein. In BMD, the mutation results in the deletion of a portion of an exon, but the amino acid reading frame is maintained, resulting in the production of an incomplete but functional dystrophin protein.

[0005] Exon skipping is a promising treatment for DMD. This method involves modifying splicing to restore the amino acid reading frame of dystrophin mRNA, thereby inducing the expression of a partially functional dystrophin protein (Non-Patent Document 2). The amino acid sequence targeted by exon skipping is lost. Therefore, the dystrophin protein expressed by this treatment is shorter than normal, but the amino acid reading frame is maintained, thereby partially retaining its function of stabilizing muscle cells. Therefore, exon skipping is expected to result in DMD exhibiting symptoms similar to milder forms of BMD. Following animal experiments in mice and dogs, exon skipping is currently undergoing clinical trials in human DMD patients.

[0006] Exon skipping can be induced by binding of antisense nucleic acids targeting either or both of the 5' and 3' splice sites, or the interior of an exon. An exon is included in mRNA only when both splice sites are recognized by the spliceosome complex. Therefore, exon skipping can be induced by targeting splice sites with antisense nucleic acids. Furthermore, it is believed that binding of SR proteins to exon splicing enhancers (ESEs) is required for exons to be recognized by the splicing machinery, and exon skipping can also be induced by targeting ESEs.

[0007] Because mutations in the dystrophin gene vary among DMD patients, antisense nucleic acids appropriate for the location and type of gene mutation are required. To date, Steve Wilton et al. of the University of Western Australia have created antisense nucleic acids that induce exon skipping for all 79 exons (Non-Patent Document 3), and Annemieke Aartsma-Rus et al. of the Netherlands have created antisense nucleic acids that induce exon skipping for 39 types of exons (Non-Patent Document 4).

[0008] It is believed that approximately 13% of all DMD patients can be treated by skipping the 51st exon (hereinafter referred to as "exon 51"). In recent years, several reports have been published on research targeting exon 51 of the dystrophin gene for exon skipping (Patent Documents 1 to 10 and Non-Patent Documents 3 to 7). [Prior art documents] [Patent documents]

[0009] [Patent Document 1] International Publication No. 2015 / 137409 [Patent Document 2] International Publication No. 2019 / 241385 [Patent Document 3] International Publication No. 2002 / 024906 [Patent Document 4] International Publication No. 2004 / 048570 [Patent Document 5] International Publication No. 2004 / 083432 [Patent Document 6] International Publication No. 2006 / 000057 [Patent Document 7] International Publication No. 2010 / 048586 [Patent Document 8] International Publication No. 2009 / 054725 [Patent Document 9] International Publication No. 2010 / 050801 [Patent Document 10] International Publication No. 2010 / 050802

[0010] [Non-Patent Document 1] Monaco AP et al., Genomics 2:90-95 (1988) [Non-patent document 2] Matsuo M., Brain and Development 18:167-172 (1996) [Non-patent document 3] Wilton SD et al., Molecular Therapy 15:1288-1296 (2007) [Non-patent document 4] Annemieke Aartsma-Rus et al., Neuromuscular Disorders 12:S71-S77 (2002) [Non-patent document 5] Aoki Y. et al., Molecular Therapy 18:1995-2005 (2010) [Non-patent document 6] Nakano S. et al., Pediatrics International 53:524-529 (2011) [Non-Patent Document 7] Echigoya Y et al., Molecular Therapy 25:2561-2572(2017) Summary of the Invention [Problem to be solved by the invention]

[0011] In light of the above-mentioned circumstances, there is a need for a novel antisense oligomer that can highly efficiently induce skipping of exon 51 of the dystrophin gene. There is also a need for an antisense oligomer that maintains the activity of highly efficiently inducing skipping of exon 51 of the dystrophin gene and has excellent pharmaceutical properties (e.g., solubility and safety). [Means for solving the problem]

[0012] The present inventors have conducted detailed studies of the technical details described in the above-mentioned documents and the structure of the dystrophin gene, and have found that administration of an antisense oligomer having a nucleotide sequence set forth in any one of SEQ ID NOS: 1 to 89 and 91 to 93 highly efficiently induces exon 51 skipping of the human dystrophin gene. Furthermore, as a result of their research, they have discovered an antisense oligomer that highly efficiently induces exon 51 skipping of the human dystrophin gene while also having excellent solubility and safety. Based on this finding, the present inventors have completed the present invention.

[0013] That is, the present invention is as follows. [1] (a1)~(d1) below: (a1) an antisense oligomer comprising any one of the nucleotide sequences of SEQ ID NOs: 1 to 89 and 91 to 93; (b1) an antisense oligomer comprising a nucleotide sequence in which 1 to 5 nucleotides are deleted, substituted, inserted, and / or added relative to any of the nucleotide sequences of SEQ ID NOs: 1 to 89 and 91 to 93, and having the activity of inducing skipping of exon 51 of the human dystrophin gene; (c1) an antisense oligomer comprising a nucleotide sequence having 80% or more sequence identity to any of the nucleotide sequences of SEQ ID NOs: 1 to 89 and 91 to 93, and having the activity of inducing skipping of exon 51 of the human dystrophin gene; and (d1) An antisense oligomer that hybridizes under stringent conditions to an oligonucleotide consisting of a nucleotide sequence complementary to any one of the nucleotide sequences of SEQ ID NOs: 1 to 89 and 91 to 93, and has the activity of inducing skipping of exon 51 of the human dystrophin gene. An antisense oligomer selected from the group consisting of (excluding antisense oligomers consisting of any of the base sequences of SEQ ID NOs: 90 and 97 to 126), or a pharmaceutically acceptable salt thereof, or a hydrate of these. [2] (e) to (h) below: (e) an antisense oligomer consisting of any one of the nucleotide sequences of SEQ ID NOs: 1 to 89 and 91 to 93; (f) an antisense oligomer consisting of a nucleotide sequence in which 1 to 5 nucleotides are deleted and / or substituted with respect to any of the nucleotide sequences of SEQ ID NOs: 1 to 89 and 91 to 93, and having the activity of inducing skipping of exon 51 of the human dystrophin gene; (g) an antisense oligomer consisting of a nucleotide sequence having 80% or more sequence identity to any of the nucleotide sequences of SEQ ID NOs: 1 to 89 and 91 to 93, and having the activity of inducing skipping of exon 51 of the human dystrophin gene; and (h) an antisense oligomer that hybridizes under highly stringent conditions to an oligonucleotide consisting of a nucleotide sequence complementary to any one of the nucleotide sequences of SEQ ID NOs: 1 to 89 and 91 to 93, and that has the activity of inducing skipping of exon 51 of the human dystrophin gene; An antisense oligomer selected from the group consisting of (excluding antisense oligomers consisting of any of the base sequences of SEQ ID NOs: 90 and 97 to 126), or a pharmaceutically acceptable salt thereof, or a hydrate of these. [3] the antisense oligomer is An antisense oligomer having a nucleotide sequence with 90% or more sequence identity to any of the nucleotide sequences of SEQ ID NOS: 1 to 89 and 91 to 93, and having the activity of inducing skipping of exon 51 of the human dystrophin gene. The antisense oligomer according to [1] or [2] above, or a pharmaceutically acceptable salt thereof, or a hydrate of the foregoing. [4] the antisense oligomer is (a2) an antisense oligomer comprising any one of the nucleotide sequences of SEQ ID NOs: 7, 8, 10, 16, 21, 24, 31, 42, 67, and 76; (b2) an antisense oligomer comprising a nucleotide sequence in which 1 to 5 nucleotides are deleted, substituted, inserted, and / or added relative to any one of the nucleotide sequences of SEQ ID NOs: 7, 8, 10, 16, 21, 24, 31, 42, 67, and 76, and having the activity of inducing skipping of exon 51 of the human dystrophin gene; (c2) an antisense oligomer comprising a nucleotide sequence having 80% or more sequence identity to any of the nucleotide sequences of SEQ ID NOs: 7, 8, 10, 16, 21, 24, 31, 42, 67, and 76, and having the activity of inducing skipping of exon 51 of the human dystrophin gene; and (d2) An antisense oligomer that hybridizes under stringent conditions to an oligonucleotide consisting of a nucleotide sequence complementary to any one of the nucleotide sequences of SEQ ID NOs: 7, 8, 10, 16, 21, 24, 31, 42, 67, and 76, and has the activity of inducing skipping of exon 51 of the human dystrophin gene. an antisense oligomer selected from the group consisting of The antisense oligomer according to [1] above, or a pharmaceutically acceptable salt thereof, or a hydrate of the foregoing. [5] The antisense oligomer according to any one of the above [1] to [4], which is an oligonucleotide, or a pharmaceutically acceptable salt thereof, or a hydrate of the foregoing. [6] The antisense oligomer according to [5] above, or a pharmaceutically acceptable salt thereof, or a hydrate of either, wherein the sugar moiety and / or the phosphate linkage moiety of at least one nucleotide constituting the oligonucleotide is modified. [7] The antisense oligomer or pharmaceutically acceptable salt thereof according to [5] or [6] above, or a hydrate of either, wherein the sugar moiety of at least one nucleotide constituting the oligonucleotide is ribose in which the -OH group at the 2' position is substituted with any group selected from the group consisting of OR, R, R'OR, SH, SR, NH2, NHR, NR2, N3, CN, F, Cl, Br and I (wherein R represents alkyl or aryl, and R' represents alkylene). [8] The antisense oligomer or pharmaceutically acceptable salt thereof, or a hydrate of either of the above [5] to [7], wherein the phosphate bond of at least one nucleotide constituting the oligonucleotide is any one selected from the group consisting of a phosphorothioate bond, a phosphorodithioate bond, an alkylphosphonate bond, a phosphoramidate bond, and a boranophosphate bond. [9] The antisense oligomer according to any one of [1] to [4] above, which is a morpholino oligomer, or a pharmaceutically acceptable salt thereof, or a hydrate of the foregoing.

[10] The antisense oligomer according to [9] above, which is a phosphorodiamidate morpholino oligomer, or a pharmaceutically acceptable salt thereof, or a hydrate of the foregoing.

[11] The 5' end is represented by the following chemical formulas (1) to (3): [ka] The antisense oligomer according to [9] or

[10] above, or a pharmaceutically acceptable salt thereof, or a hydrate of the foregoing, wherein the antisense oligomer is any one of the groups represented by the formula:

[12] A pharmaceutical composition for treating muscular dystrophy, comprising the antisense oligomer according to any one of [1] to

[11] above, or a pharmaceutically acceptable salt thereof, or a hydrate of these.

[13] The pharmaceutical composition according to

[12] above, further comprising a pharmaceutically acceptable carrier.

[14] The pharmaceutical composition according to

[12] or

[13] above, for administration to a patient with muscular dystrophy, wherein the patient has a mutation in the dystrophin gene that is subject to exon 51 skipping.

[15] The pharmaceutical composition according to

[14] above, wherein the patient has a dystrophin gene that has a frameshift mutation due to deletion of at least an exon near exon 51 and in which the amino acid reading frame is corrected by skipping of exon 51.

[16] The pharmaceutical composition according to

[14] or

[15] above, wherein the patient has a frameshift mutation in the dystrophin gene due to a deletion of exons 13-50, 29-50, 40-50, 43-50, 45-50, 47-50, 48-50, 49-50, 50, 52, or 52-63.

[17] The pharmaceutical composition according to any one of

[14] to

[16] above, wherein the patient is a human.

[18] Use of the antisense oligomer according to any one of [1] to

[11] above, or a pharmaceutically acceptable salt thereof, or a hydrate of the same in the manufacture of a medicament for treating muscular dystrophy.

[19] A method for treating muscular dystrophy, comprising administering to a patient with muscular dystrophy an effective amount of the antisense oligomer described in any one of [1] to

[11] above, or a pharmaceutically acceptable salt thereof, or a hydrate of these, or a pharmaceutical composition described in any one of

[12] to

[16] above.

[20] The method of treatment described in

[19] above, wherein the patient is a human. [twenty one] The antisense oligomer according to any one of [1] to

[11] above, or a pharmaceutically acceptable salt thereof, or a hydrate thereof, or the pharmaceutical composition according to any one of

[12] to

[16] above, for use in the treatment of muscular dystrophy. [twenty two] The antisense oligomer or a pharmaceutically acceptable salt thereof or a hydrate of the same, or the pharmaceutical composition according to

[21] above, wherein the patient with muscular dystrophy in the treatment is a human. [Effects of the Invention]

[0014] The present invention provides an antisense oligomer that highly efficiently induces exon 51 skipping of the human dystrophin gene. The present invention also provides an antisense oligomer that maintains the activity of highly efficiently inducing exon 51 skipping of the human dystrophin gene and has excellent solubility. Furthermore, the present invention also provides an antisense oligomer that maintains the activity of highly efficiently inducing exon 51 skipping of the human dystrophin gene and has excellent solubility and safety (for example, no effect on kidney and liver function or an extremely low likelihood of an effect). [Brief explanation of the drawings]

[0015] [Figure 1] 1 shows the efficiency of antisense oligomers of PMO Nos. 43, 44, 45, and 46 in skipping exon 51 of the human dystrophin gene in human rhabdomyosarcoma cells (RD cells). [Figure 2] 1 shows the efficiency of antisense oligomers of PMO Nos. 42, 45, 47, 48, 49, and 50 in skipping exon 51 of the human dystrophin gene in RD cells. [Figure 3] 1 shows the efficiency of antisense oligomers of PMO Nos. 42, 62, 63, and 89 in skipping exon 51 of the human dystrophin gene in RD cells. [Figure 4]1 shows the exon 51 skipping efficiency of the antisense oligomers of PMO Nos. 83 and 85 in the human dystrophin gene in RD cells. [Figure 5] 1 shows the efficiency of antisense oligomers of PMO Nos. 33, 34, 35, 36, 37, and 38 in skipping exon 51 of the human dystrophin gene in RD cells. [Figure 6] 1 shows the efficiency of antisense oligomers of PMO Nos. 83, 85, and 90 in skipping exon 51 of the human dystrophin gene in RD cells. [Figure 7] 1 shows the efficiency of antisense oligomers of PMO Nos. 82, 84, 86, and 87 in skipping exon 51 of the human dystrophin gene in RD cells. [Figure 8] 1 shows the efficiency of antisense oligomers of PMO Nos. 45, 51, 52, 56, 57, 58, 59, 60, and 61 in skipping exon 51 of the human dystrophin gene in RD cells. [Figure 9] 1 shows the efficiency of antisense oligomers of PMO Nos. 42, 64, 65, 66, and 85 in skipping exon 51 of the human dystrophin gene in RD cells. [Figure 10] 1 shows the efficiency of antisense oligomers of PMO Nos. 1, 2, 42, 66, 67, 85, 88, 92, and 93 in skipping exon 51 of the human dystrophin gene in RD cells. [Figure 11] 1 shows the efficiency of antisense oligomers of PMO Nos. 3, 4, 5, 6, 7, 8, 42, 68, 69, 70, and 85 in skipping exon 51 of the human dystrophin gene in RD cells. [Figure 12] 1 shows the efficiency of antisense oligomers of PMO Nos. 8, 9, 10, 11, 12, 13, 14, 42, 71, 72, 73, and 91 in skipping exon 51 of the human dystrophin gene in RD cells. [Figure 13]1 shows the efficiency of antisense oligomers of PMO Nos. 8, 15, 16, 17, 42, 74, 75, and 76 in skipping exon 51 of the human dystrophin gene in RD cells. [Figure 14] 1 shows the efficiency of antisense oligomers of PMO Nos. 8, 18, 19, 20, 42, 63, 75, 76, and 77 in skipping exon 51 of the human dystrophin gene in RD cells. [Figure 15] 1 shows the efficiency of antisense oligomers of PMO Nos. 8, 21, 22, 23, 24, 25, 26, 42, 77, and 78 in skipping exon 51 of the human dystrophin gene in RD cells. [Figure 16] 1 shows the efficiency of antisense oligomers of PMO Nos. 8, 21, 27, 28, 29, 30, 42, 79, 80, and 81 in skipping exon 51 of the human dystrophin gene in RD cells. [Figure 17] 1 shows the efficiency of antisense oligomers of PMO Nos. 8, 16, 21, 31, 32, and 67 in skipping exon 51 of the human dystrophin gene in RD cells. [Figure 18] 1 shows the efficiency of antisense oligomers of PMO Nos. 16, 21, and 94 in skipping exon 51 of the human dystrophin gene in RD cells. [Figure 19] The results of a safety test in mice for the antisense oligomer of PMO No. 42 are shown. From the left, aspartate aminotransferase (AST) levels, alanine aminotransferase (ALT) levels, blood urea nitrogen (BUN) levels, and creatinine levels are shown as mean ± standard deviation (Student's t-test significance level: p<0.05). [Figure 20] These figures show the results of safety tests in mice for the antisense oligomers of PMO No. 16 and 90. From the left, AST, ALT, BUN, and creatinine values ​​are shown as mean ± standard deviation, and values ​​that showed significant increases are indicated with a p-value (Dunnett's significance level: p<0.05). [Figure 21]The results of a safety test in mice for the antisense oligomer of PMO No. 21 are shown. From the left, AST, ALT, BUN, and creatinine values ​​are shown as mean ± standard deviation (Student's t-test significance level: p<0.05). DETAILED DESCRIPTION OF THE INVENTION

[0016] The present invention will be described in detail below. The following embodiments are merely examples for explaining the present invention, and are not intended to limit the present invention to these embodiments. The present invention can be embodied in various forms without departing from the gist of the present invention.

[0017] 1. Antisense oligomers The present invention provides an antisense oligomer that efficiently skips the 51st exon of the human dystrophin gene (hereinafter referred to as "the antisense oligomer of the present invention").

[0018] [Exon 51 of the human dystrophin gene] In the present invention, the term "gene" includes not only genomic genes but also cDNA, pre-mRNA, and mRNA. Preferably, the gene is a pre-mRNA, i.e., pre-mRNA. In the human genome, the human dystrophin gene is located at locus Xp21.2. With a size of 2.2 million base pairs, it is the largest known human gene. However, the coding region of the human dystrophin gene is only 14 kb, and the coding region is distributed within the dystrophin gene as 79 exons (Roberts, R.G., et al., Genomics, 16: 536-538 (1993); Koenig, M., et al., Cell 53: 219-228 (1988)). The pre-mRNA, which is the transcript of the human dystrophin gene, undergoes splicing to generate a 14 kb mature mRNA. The nucleotide sequence of the wild-type human dystrophin gene is known (GenBank Accession No. NM_004006). The nucleotide sequence of exon 51 of the human wild-type dystrophin gene is shown in SEQ ID NO: 127.

[0019] [Antisense oligomer] The antisense oligomers of the present invention were produced for the purpose of modifying a protein encoded by a DMD-type dystrophin gene into a BMD-type dystrophin protein by skipping exon 51 of the human dystrophin gene. Therefore, exon 51 of the dystrophin gene that is the target of exon skipping by the antisense oligomers includes not only wild-type but also mutant types.

[0020] Specifically, the antisense oligomer of the present invention is any one of antisense oligomers selected from the group consisting of the following (a1) to (d1): (a1) an antisense oligomer comprising any one of the nucleotide sequences of SEQ ID NOs: 1 to 89 and 91 to 93; (b1) an antisense oligomer comprising a nucleotide sequence in which 1 to 5, 1 to 4, 1 to 3, 1 to 2, or 1 nucleotide is deleted, substituted, inserted, and / or added with respect to the nucleotide sequence of any one of SEQ ID NOs: 1 to 89 and 91 to 93, and having the activity of inducing skipping of exon 51 of the human dystrophin gene; (c1) an antisense oligomer comprising a nucleotide sequence having 80% or more, 84% or more, 85% or more, 89% or more, 90% or more, 94% or more, or 95% or more sequence identity to any of the nucleotide sequences of SEQ ID NOs: 1 to 89 and 91 to 93, and having the activity of inducing skipping of exon 51 of the human dystrophin gene; and (d1) An antisense oligomer that hybridizes under stringent conditions to an oligonucleotide consisting of a nucleotide sequence complementary to any one of the nucleotide sequences of SEQ ID NOs: 1 to 89 and 91 to 93, and has the activity of inducing skipping of exon 51 of the human dystrophin gene.

[0021] In another embodiment, the antisense oligomer of the present invention is specifically any one of the antisense oligomers selected from the group consisting of the following (e) to (h): (e) an antisense oligomer consisting of any one of the nucleotide sequences of SEQ ID NOs: 1 to 89 and 91 to 93; (f) an antisense oligomer consisting of a nucleotide sequence in which 1 to 5, 1 to 4, 1 to 3, 1 to 2, or 1 nucleotide is deleted and / or substituted with respect to the nucleotide sequence of any of SEQ ID NOs: 1 to 89 and 91 to 93, and having the activity of inducing skipping of exon 51 of the human dystrophin gene; (g) an antisense oligomer consisting of a nucleotide sequence having 80% or more, 84% or more, 85% or more, 89% or more, 90% or more, 94% or more, or 95% or more sequence identity to any of the nucleotide sequences of SEQ ID NOs: 1 to 89 and 91 to 93, and having the activity of inducing skipping of exon 51 of the human dystrophin gene; and (h) an antisense oligomer that hybridizes under highly stringent conditions to an oligonucleotide consisting of a nucleotide sequence complementary to any one of the nucleotide sequences of SEQ ID NOs: 1 to 89 and 91 to 93, and that has the activity of inducing skipping of exon 51 of the human dystrophin gene;

[0022] The antisense oligomer of the present invention is more preferably any one of the antisense oligomers selected from the group consisting of the following (a2) to (d2): (a2) an antisense oligomer comprising any one of the nucleotide sequences of SEQ ID NOs: 7, 8, 10, 16, 21, 24, 31, 42, 67, and 76; (b2) an antisense oligomer comprising a nucleotide sequence in which 1 to 5 nucleotides are deleted, substituted, inserted, and / or added relative to any one of the nucleotide sequences of SEQ ID NOs: 7, 8, 10, 16, 21, 24, 31, 42, 67, and 76, and having the activity of inducing skipping of exon 51 of the human dystrophin gene; (c2) an antisense oligomer comprising a nucleotide sequence having 80% or more sequence identity to any of the nucleotide sequences of SEQ ID NOs: 7, 8, 10, 16, 21, 24, 31, 42, 67, and 76, and having the activity of inducing skipping of exon 51 of the human dystrophin gene; and (d2) An antisense oligomer that hybridizes under stringent conditions to an oligonucleotide consisting of a nucleotide sequence complementary to any one of the nucleotide sequences of SEQ ID NOs: 7, 8, 10, 16, 21, 24, 31, 42, 67, and 76, and has the activity of inducing skipping of exon 51 of the human dystrophin gene. An antisense oligomer selected from the group consisting of:

[0023] The antisense oligomers (b1) to (d1), (f) to (h), and (b2) to (d2) above are specifically variants of the antisense oligomers (a1), (e), and (a2), respectively, and are intended to correspond to mutations (e.g., polymorphisms) in the patient's dystrophin gene.

[0024] However, the antisense oligomer of the present invention does not include (does not include) the antisense oligomer having the following base sequence described in WO 2015 / 137409: [Table 1]

[0025] As used herein, the term "antisense oligomer that hybridizes under stringent conditions" refers to an antisense oligomer obtained by colony hybridization, plaque hybridization, Southern hybridization, or the like, using as a probe, for example, all or part of an oligonucleotide consisting of a nucleotide sequence complementary to any of the nucleotide sequences of SEQ ID NOS: 1 to 89 and 91 to 93. Hybridization methods that can be used include those described in, for example, "Sambrook & Russell, Molecular Cloning: A Laboratory Manual Vol. 3, Cold Spring Harbor, Laboratory Press 2001" and "Ausubel, Current Protocols in Molecular Biology, John Wiley & Sons 1987-1997."

[0026] As used herein, "stringent conditions" refers to low stringency conditions, moderate stringency conditions, and high stringency conditions. "Low stringency conditions" refer to, for example, 5x SSC, 5x Denhardt's solution, 0.5% SDS, 50% formamide, and 32°C. "Moderate stringency conditions" refer to, for example, 5x SSC, 5x Denhardt's solution, 0.5% SDS, 50% formamide, and 42°C, or 5x SSC, 1% SDS, 50 mM Tris-HCl (pH 7.5), 50% formamide, and 42°C. Examples of "highly stringent conditions" include, but are not limited to, (1) 5xSSC, 5xDenhardt's solution, 0.5% SDS, 50% formamide, 50°C; (2) 0.2xSSC, 0.1% SDS, 60°C; (3) 0.2xSSC, 0.1% SDS, 62°C; (4) 0.2xSSC, 0.1% SDS, 65°C; or (5) 0.1xSSC, 0.1% SDS, 65°C. Under these conditions, increasing the temperature is expected to result in more efficient production of antisense oligomers with higher sequence identity. However, several factors, such as temperature, probe concentration, probe length, ionic strength, time, and salt concentration, can affect hybridization stringency, and those skilled in the art can achieve similar stringency by appropriately selecting these factors. Here, "sequence identity" refers to the identity of the entire range of the base sequences to be compared for a pair of two nucleic acids, and is expressed as the percentage (%) of matching bases in an optimal alignment of the base sequences created using a mathematical algorithm known in the technical field of the present invention. For example, an antisense oligomer consisting of a base sequence having "80% sequence identity" with a 20-base antisense oligomer means an antisense oligomer having 16 or more identical bases to the 20-base antisense oligomer.

[0027] Sequence identity can be determined using FASTA (Science 227 (4693): 1435-1441, (1985)) or the BLAST (Basic Local Alignment Search Tool) algorithm by Carlin and Altschul (Proc. Natl. Acad. Sci. USA 872264-2268, 1990; Proc Natl Acad Sci USA 90: 5873, 1993). Programs based on the BLAST algorithm, such as blastn, blastx, tblastn, and tblastx, have been developed (Altschul SF, et al: J Mol Biol 215: 403, 1990). When analyzing nucleotide sequences using blastn, the parameters are, for example, score=100 and wordlength=12. When using the BLAST and Gapped BLAST programs, the default parameters of each program are used.

[0028] When using a commercially available hybridization kit, for example, the Alkphos Direct Labeling and Detection System (GE Healthcare) can be used. In this case, the hybridized antisense oligomer can be detected by incubating the membrane with the labeled probe overnight according to the protocol provided with the kit, washing the membrane with a primary wash buffer containing 0.1% (w / v) SDS at 55°C, and then detecting the hybridized antisense oligomer. Alternatively, when preparing a probe based on all or part of the base sequence complementary to any of SEQ ID NOS: 1-89 and 91-93, if the probe is labeled with digoxigenin (DIG) using commercially available reagents (e.g., PCR Labeling Mix (Roche Diagnostics)), hybridization can be detected using a DIG Nucleic Acid Detection Kit (Roche Diagnostics).

[0029] Other hybridizable antisense oligomers include those that have a sequence identity of 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more, 99.1% or more, 99.2% or more, 99.3% or more, 99.4% or more, 99.5% or more, 99.6% or more, 99.7% or more, 99.8% or more, or 99.9% or more to the base sequence of any of SEQ ID NOs: 1 to 89 and 91 to 93, when calculated using default parameters with homology search software such as FASTA or BLAST.

[0030] "Inducing skipping of the 51st exon of the human dystrophin gene" means that the antisense oligomer of the present invention binds to a site corresponding to exon 51 and / or its adjacent intron in a transcript (e.g., pre-mRNA) of the human dystrophin gene, thereby excluding exon 51 when the transcript is spliced; for example, in the case of a DMD patient in which exon 52 is deleted, the base sequence corresponding to the 5' end of exon 53 is linked to the base sequence corresponding to the 3' end of exon 50, resulting in the formation of a mature mRNA in which no codon frameshift has occurred.

[0031] Therefore, DMD patients with a mutation in the dystrophin gene that is subject to exon 51 skipping can be treated by skipping exon 51. Examples of such DMD patients include DMD patients with a frameshift mutation due to deletion of at least an exon near exon 51 and a dystrophin gene in which the amino acid reading frame is corrected by skipping of exon 51, and more specifically, examples of such DMD patients include DMD patients with a frameshift mutation due to deletion of exons 13-50, 29-50, 40-50, 43-50, 45-50, 47-50, 48-50, 49-50, 50, 52, 52-63, etc. of the dystrophin gene.

[0032] Here, the term "binding" refers to the hybridization of the antisense oligomer of the present invention with a transcript of the human dystrophin gene under physiological conditions to form a double strand. The term "physiological conditions" refers to conditions controlled to pH, salt composition, and temperature similar to those in vivo. For example, conditions include 25 to 40°C, preferably 37°C, pH 5 to 8, preferably pH 7.4, and a sodium chloride concentration of 150 mM.

[0033] Whether or not exon 51 skipping of the human dystrophin gene has occurred can be confirmed by introducing the antisense oligomer of the present invention into dystrophin-expressing cells (e.g., human rhabdomyosarcoma cells), amplifying the region surrounding exon 51 of the mRNA of the human dystrophin gene from the total RNA of the dystrophin-expressing cells by RT-PCR, and then performing nested PCR or sequence analysis on the PCR amplification product. The skipping efficiency ES (unit: %) can be calculated according to the following formula (1) based on the measured values ​​of "A" and "B": the polynucleotide amount "A" of the band in which exon 51 was skipped and the polynucleotide amount "B" of the band in which exon 51 was not skipped, respectively, by recovering mRNA of the human dystrophin gene from test cells. WO 2012 / 029986 can be referenced for the calculation of the skipping efficiency.

[0034] ES=100×A / (A+B) (1)

[0035] Preferably, the antisense oligomers of the present invention skip exon 51 with an efficiency of 10% or more, 20% or more, 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, or 90% or more.

[0036] The antisense oligomer of the present invention preferably also has high solubility in physiological saline. Unlike antisense oligomers with low solubility, antisense oligomers with high solubility in physiological saline are extremely unlikely to precipitate and become unusable during storage of the formulation, and are also extremely unlikely to precipitate and become unusable when used in an infusion solution containing salt. Furthermore, because antisense oligomers with high solubility in physiological saline are less likely to precipitate, they are also extremely unlikely to exhibit toxicity upon administration (Bulletin of Osaka University of Pharmaceutical Sciences 1, 91-99 (2007)). Therefore, antisense oligomers with high solubility in physiological saline are highly useful as active ingredients in pharmaceuticals.

[0037] The solubility in physiological saline is preferably 20 mg / mL or more, more preferably 30 mg / mL or more, even more preferably 40 mg / mL or more, and particularly preferably 50 mg / mL or more. The solubility of an antisense oligomer in physiological saline can be evaluated by dissolving the antisense oligomer in physiological saline at a desired concentration and visually checking for the presence or absence of precipitation after a certain period of time.

[0038] Furthermore, it is preferable that the antisense oligomer is highly safe as an active ingredient of a pharmaceutical. Safety can be evaluated, for example, using aspartate aminotransferase (AST) levels, alanine aminotransferase (ALT) levels, blood urea nitrogen (BUN) levels, and creatinine levels in blood after administration of the antisense oligomer as indicators. AST levels tend to increase when liver damage occurs, ALT levels increase when there is a liver problem, BUN levels increase when kidney function decreases, and creatinine levels tend to increase when the filtration function of the kidney's glomeruli decreases. Therefore, these values ​​can be used as indicators to evaluate the effects of the antisense oligomer on kidney and liver function.

[0039] Specifically, for example, after administering antisense oligomer to healthy mice, measure the AST level, ALT level, BUN level and creatinine level in blood, and perform statistical significance test. If a significant increase is observed compared to the measured values ​​of the control group (solvent administration or no treatment), it can be judged as an abnormal value, and it can be judged that the administered antisense oligomer has an effect on kidney and liver function, or is likely to have an effect. On the other hand, if no significant increase is observed, it can be judged that there is no effect on kidney and liver function, or that there is a low possibility of an effect. In addition, if a certain increase rate is observed compared to the measured values ​​of the control group, specifically, an increase rate of, for example, 30% or more, it can be judged as an abnormal value.

[0040] Examples of antisense oligomers of the present invention include oligonucleotides, morpholino oligomers, and peptide nucleic acid (PNA) oligomers having a length of 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, or 35 bases. The length of the antisense oligomer is preferably 20 to 30 bases, 20 to 29 bases, 22 to 30 bases, 22 to 29 bases, or 25 to 29 bases, more preferably 22 to 30 bases, 22 to 29 bases, or 25 to 29 bases, and morpholino oligomers are preferred.

[0041] The above-mentioned oligonucleotide (hereinafter referred to as "the oligonucleotide of the present invention") is an antisense oligomer of the present invention having nucleotides as its constituent units, and such nucleotides may be any of ribonucleotides, deoxyribonucleotides, or modified nucleotides.

[0042] A modified nucleotide refers to a ribonucleotide or deoxyribonucleotide in which all or part of the nucleic acid base, sugar moiety, and phosphate linkage moiety that constitute the ribonucleotide or deoxyribonucleotide have been modified.

[0043] In the present invention, examples of nucleic acid bases include adenine, guanine, hypoxanthine, cytosine, thymine, uracil, and modified bases thereof. Examples of such modified bases include pseudouracil, 3-methyluracil, dihydrouracil, 5-alkylcytosine (e.g., 5-methylcytosine), 5-alkyluracil (e.g., 5-ethyluracil), 5-halouracil (5-bromouracil), 6-azapyrimidine, 6-alkylpyrimidine (6-methyluracil), 2-thiouracil, 4-thiouracil, 4-acetylcytosine, 5-(carboxyhydroxymethyl)uracil, 5'-carboxymethylaminomethyl-2-thiouracil, 5-carboxymethylaminomethyluracil, 1-methyladenine, 1-methylhypoxanthine. Examples of amino acids include, but are not limited to, 2,2-dimethylguanine, 3-methylcytosine, 2-methyladenine, 2-methylguanine, N6-methyladenine, 7-methylguanine, 5-methoxyaminomethyl-2-thiouracil, 5-methylaminomethyluracil, 5-methylcarbonylmethyluracil, 5-methyloxyuracil, 5-methyl-2-thiouracil, 2-methylthio-N6-isopentenyladenine, uracil-5-oxyacetic acid, 2-thiocytosine, purine, 2,6-diaminopurine, 2-aminopurine, isoguanine, indole, imidazole, and xanthine.

[0044] Modifications of the sugar moiety include, for example, modifications of the 2'-position of ribose and modifications of other parts of the sugar. Modifications of the 2'-position of ribose include, for example, substitution of the -OH group at the 2'-position of ribose with OR, R, R'OR, SH, SR, NH2, NHR, NR2, N3, CN, F, Cl, Br, or I. Here, R represents alkyl or aryl, and R' represents alkylene. Modifications of other sugar moieties include, but are not limited to, substitution of the O at the 4' position of ribose or deoxyribose with S, and cross-linking of the 2' and 4' positions of the sugar, such as LNA (Locked Nucleic Acid) or ENA (2'-O,4'-C-Ethylene-bridged Nucleic Acids).

[0045] Modifications of the phosphate linkage moiety include, for example, substitution of the phosphodiester bond with a phosphorothioate bond, a phosphorodithioate bond, an alkylphosphonate bond, a phosphoramidate bond, or a boranophosphate bond (Enya et al: Bioorganic & Medicinal Chemistry, 2008, 18, 9154-9160) (see, for example, Patent Republished Publications Nos. 2006 / 129594 and 2006 / 038608).

[0046] In the present invention, the alkyl is preferably a linear or branched alkyl having 1 to 6 carbon atoms. Specific examples include methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, n-pentyl, isopentyl, neopentyl, tert-pentyl, n-hexyl, and isohexyl. The alkyl may be substituted, and examples of such substituents include halogen, alkoxy, cyano, and nitro, and the alkyl may be substituted with 1 to 3 of these. In the present invention, the cycloalkyl is preferably a cycloalkyl having a carbon number of 5 to 12. Specific examples include cyclopentyl, cyclohexyl, cycloheptyl, cyclooctyl, cyclodecyl, and cyclododecyl. In the present invention, examples of halogen include fluorine, chlorine, bromine, and iodine. Examples of alkoxy include linear or branched alkoxy having 1 to 6 carbon atoms, such as methoxy, ethoxy, n-propoxy, isopropoxy, n-butoxy, isobutoxy, sec-butoxy, tert-butoxy, n-pentyloxy, isopentyloxy, n-hexyloxy, isohexyloxy, etc. In particular, alkoxy having 1 to 3 carbon atoms is preferred.

[0047] In the present invention, the aryl is preferably an aryl having 6 to 10 carbon atoms. Specific examples include phenyl, α-naphthyl, and β-naphthyl. Phenyl is particularly preferred. The aryl may be substituted, and examples of such substituents include alkyl, halogen, alkoxy, cyano, and nitro, and the aryl may be substituted with 1 to 3 of these. In the present invention, the alkylene is preferably a linear or branched alkylene having 1 to 6 carbon atoms. Specific examples include methylene, ethylene, trimethylene, tetramethylene, pentamethylene, hexamethylene, 2-(ethyl)trimethylene, and 1-(methyl)tetramethylene. In the present invention, acyl can include linear or branched alkanoyl or aroyl. Examples of alkanoyl include formyl, acetyl, 2-methylacetyl, 2,2-dimethylacetyl, propionyl, butyryl, isobutyryl, pentanoyl, 2,2-dimethylpropionyl, and hexanoyl. Examples of aroyl include benzoyl, toluoyl, and naphthoyl. Such aroyl can be substituted at any substitutable position, and can also be substituted with alkyl.

[0048] The oligonucleotide of the present invention is preferably an antisense oligomer of the present invention having a constituent unit represented by the following general formula, in which the -OH group at the 2'-position of ribose is substituted with methoxy and the phosphate linkage is a phosphorothioate linkage. [ka] (In the formula, Base represents a nucleic acid base.)

[0049] The oligonucleotides of the present invention can be easily synthesized using various automated synthesizers (e.g., AKTA oligopilot plus 10 / 100 (GE Healthcare)), or can be produced by outsourcing to a third party (e.g., Promega, Takara, or Japan Bioservices).

[0050] The morpholino oligomer of the present invention is an antisense oligomer of the present invention having a group represented by the following general formula as a constituent unit. [ka] (wherein Base has the same meaning as defined above; W represents a group represented by any of the following formulas:

[0051] [ka] (Wherein, X is —CHR 1 , -O-CH2R 1 , -S-CH2R 1 , -NR 2 R 3 or represents F; R 1 represents H, alkyl; R 2 and R 3 are the same or different and represent H, alkyl, cycloalkyl, or aryl; Y1 is O, S, CH2 or NR 1 represents; Y2 is O, S or NR 1 represents; Z represents O or S.

[0052] Examples of morpholino monomer compounds used in the synthesis of the morpholino oligomer of the present invention include, but are not limited to, morpholino monomer compound (A), morpholino monomer compound (C), morpholino monomer compound (T), and morpholino monomer compound (G) listed in the table below.

[0053] [Table 2]

[0054] The morpholino oligomer is preferably an oligomer having a group represented by the following formula as a constituent unit (phosphorodiamidate morpholino oligomer (hereinafter referred to as "PMO")). [ka] (In the formula, Base, R 2 , R 3 has the same meaning as above.) The morpholino oligomers of the present invention include those in which the nucleic acid base, morpholino ring moiety, phosphate linkage moiety, 3' end and / or 5' end constituting the oligomer are all or partially modified.

[0055] Modifications of the phosphate linkage moiety include, for example, substitution with a phosphorodiamidate linkage, phosphorothioate linkage, phosphorodithioate linkage, alkylphosphonate linkage, phosphoramidate linkage, or boranophosphate linkage (Enya et al., Bioorganic & Medicinal Chemistry, 2008, 18, 9154-9160) (see, for example, Patent Republished Publications Nos. 2006 / 129594 and 2006 / 038608). Morpholino oligomers can be prepared, for example, according to WO 1991 / 009033 or WO 2009 / 064471. In particular, PMOs can be prepared according to the methods described in WO 2009 / 064471 or the methods described below.

[0056] [PMO manufacturing method] One embodiment of PMO is, for example, a compound represented by the following general formula (I) (hereinafter referred to as PMO(I)). [ka] [In the formula, each Base, R 2 , R 3 has the same meaning as above; n is any integer within the range of 1 to 99, preferably any integer within the range of 19 to 29, 19 to 28, 21 to 29, 21 to 28, or 24 to 28, and more preferably 21 to 29, 21 to 28, or 24 to 28.]

[0057] PMO(I) can be produced according to known methods, for example, by carrying out the following steps. The compounds and reagents used in the following steps are not particularly limited, as long as they are generally used in the production of PMOs. All of the following steps can be carried out by liquid phase or solid phase methods (manual or using a commercially available automated solid phase synthesizer). When producing PMOs by the solid phase method, it is preferable to use an automated synthesizer in terms of simplification of the operating procedure and accuracy of the synthesis.

[0058] (1) Process A: A process for producing a compound represented by the following general formula (III) (hereinafter referred to as compound (III)) by reacting an acid with a compound represented by the following general formula (II) (hereinafter referred to as compound (II)). [ka] [where n, R 2 , R 3 has the same meaning as above; Each B P each independently represents an optionally protected nucleobase; T represents a trityl group, a monomethoxytrityl group, or a dimethoxytrityl group; L represents hydrogen, acyl, or a group represented by the following general formula (IV) (hereinafter referred to as group (IV)). [ka]

[0059] B P The "nucleobase" according to the present invention can be the same as the "nucleobase" of Base. However, B P The amino group or hydroxyl group of the nucleic acid base may be protected. Such an amino-protecting group is not particularly limited as long as it is used as a protecting group for nucleic acids, and specific examples include benzoyl, 4-methoxybenzoyl, acetyl, propionyl, butyryl, isobutyryl, phenylacetyl, phenoxyacetyl, 4-tert-butylphenoxyacetyl, 4-isopropylphenoxyacetyl, and (dimethylamino)methylene. Examples of the hydroxyl-protecting group include 2-cyanoethyl, 4-nitrophenethyl, phenylsulfonylethyl, methylsulfonylethyl, trimethylsilylethyl, phenyl optionally substituted with 1 to 5 electron-withdrawing groups at any substitutable position, diphenylcarbamoyl, dimethylcarbamoyl, diethylcarbamoyl, methylphenylcarbamoyl, 1-pyrrolidinylcarbamoyl, morpholinocarbamoyl, 4-(tert-butylcarboxy)benzyl, 4-[(dimethylamino)carboxy]benzyl, and 4-(phenylcarboxy)benzyl (see, for example, WO 2009 / 064471).

[0060] The "solid phase carrier" is not particularly limited as long as it can be used in solid phase reactions of nucleic acids, but for example, it is desirable that the carrier (i) is practically insoluble in reagents that can be used in the synthesis of morpholino nucleic acid derivatives (e.g., dichloromethane, acetonitrile, tetrazole, N-methylimidazole, pyridine, acetic anhydride, lutidine, trifluoroacetic acid), (ii) is chemically stable against reagents that can be used in the synthesis of morpholino nucleic acid derivatives, (iii) can be chemically modified, (iv) can be loaded with a desired morpholino nucleic acid derivative, (v) has sufficient strength to withstand high pressures applied during processing, and (vi) has a certain particle size range and distribution. Specifically, swelling polystyrene (e.g., aminomethyl polystyrene resin 1% divinylbenzene cross-linked (200-400 mesh) (2.4-3.0 mmol / g) (Tokyo Chemical Industry Co., Ltd.), Aminomethylated Polystyrene Resin·HCl [divinylbenzene 1%, 100-200 mesh] (Peptide Institute Co., Ltd.)), non-swelling polystyrene (e.g., Primer Support (GE Healthcare)), PEG chain-bonded polystyrene (e.g., NH2-PEG resin (Watanabe Chemical Industry Co., Ltd.), TentaGel resin), controlled pore glass (CPG) (e.g., CPG), oxalyl-controlled pore glass (see, for example, Alul et al., Nucleic Acids Research, Vol. 19, 1527 (1991)), TentaGel support-aminopolyethylene glycol derivatized support (e.g., Wright et al., Tetrahedron Letters, Vol. 34, 3373 (1993)), and a copolymer of Poros-polystyrene / divinylbenzene. As the "linker," any known linker that is typically used to link nucleic acids or morpholino nucleic acid derivatives can be used, including, for example, 3-aminopropyl, succinyl, 2,2'-diethanolsulfonyl, and long-chain alkylamino (LCAA).

[0061] This step can be carried out by reacting compound (II) with an acid.

[0062] Examples of the "acid" that can be used in this step include trifluoroacetic acid, dichloroacetic acid, and trichloroacetic acid. The amount of the acid used is, for example, within the range of 0.1 to 1000 molar equivalents, preferably 1 to 100 molar equivalents, relative to 1 mole of Compound (II). An organic amine can also be used together with the acid. The organic amine is not particularly limited, but examples thereof include triethylamine. The amount of organic amine used is, for example, within the range of 0.01 to 10 molar equivalents, and preferably within the range of 0.1 to 2 molar equivalents, per mole of acid. When a salt or mixture of an acid and an organic amine is used in this step, for example, a salt or mixture of trifluoroacetic acid and triethylamine can be used, and more specifically, a mixture of 2 equivalents of trifluoroacetic acid and 1 equivalent of triethylamine can be used. The acid that can be used in this step can be diluted with an appropriate solvent to a concentration within the range of 0.1% to 30%. The solvent is not particularly limited as long as it is not involved in the reaction, and examples thereof include dichloromethane, acetonitrile, alcohols (ethanol, isopropanol, trifluoroethanol, etc.), water, and mixtures thereof.

[0063] The reaction temperature in the above reaction is, for example, preferably in the range of 10°C to 50°C, more preferably in the range of 20°C to 40°C, and even more preferably in the range of 25°C to 35°C. The reaction time varies depending on the type of acid used and the reaction temperature, but is usually within the range of 0.1 minute to 24 hours, preferably 1 minute to 5 hours.

[0064] After this step is completed, a base can be added to neutralize the acid present in the system, if necessary. The "base" is not particularly limited, but examples thereof include diisopropylethylamine. The base can also be diluted with an appropriate solvent to a concentration within the range of 0.1% (v / v) to 30% (v / v). The solvent used in this step is not particularly limited as long as it is not involved in the reaction, and examples thereof include dichloromethane, acetonitrile, alcohols (ethanol, isopropanol, trifluoroethanol, etc.), water, and mixtures thereof. The reaction temperature is, for example, preferably within the range of 10°C to 50°C, more preferably within the range of 20°C to 40°C, and even more preferably within the range of 25°C to 35°C. The reaction time varies depending on the type of base used and the reaction temperature, but is usually within the range of 0.1 minute to 24 hours, preferably within the range of 1 minute to 5 hours.

[0065] In addition, a compound represented by the following general formula (IIa) (hereinafter referred to as compound (IIa)), in which n=1 and L is group (IV) in compound (II), can be produced by the following method. [ka] [In the formula, B P , T, linker, and solid phase support are as defined above.]

[0066] Step 1: A process for producing a compound represented by the following general formula (VI) (hereinafter referred to as compound (VI)) by reacting an acylating agent with a compound represented by the following general formula (V): [ka] [In the formula, B P , T, linker are as defined above; R 4 represents a hydroxyl group, a halogen, a carboxyl group, or an amino group.

[0067] This step can be carried out by a known linker introduction reaction using compound (V) as a starting material. In particular, the compound represented by the following general formula (VIa) can be produced by carrying out a method known as an esterification reaction using compound (V) and succinic anhydride. [ka] [In the formula, B P , T has the same meaning as above.]

[0068] Step 2: A process in which compound (VI) is reacted with a condensing agent or the like to react with a solid support to produce compound (IIa). [ka] [In the formula, B P , R 4 , T, linker, and solid phase support are as defined above.] This step can be carried out by a method known as a condensation reaction using compound (VI) and a solid support. A compound represented by the following general formula (IIa2), in which n=1 to 99 in compound (II) (in a specific embodiment, n is, for example, 2 to 29, 2 to 28, 2 to 27, 2 to 26, 2 to 25, 2 to 24, 2 to 23, 2 to 22, 2 to 21, or 2 to 20, and preferably 19 to 29, 19 to 28, 21 to 29, 21 to 28, or 24 to 28, and more preferably 21 to 29, 21 to 28, or 24 to 28), and L is group (IV), can be produced by using compound (IIa) as a starting material and repeatedly carrying out step A and step B of the method for producing PMO described in this specification a desired number of times. [ka] [In the formula, B P ,n,R 2 , R3 , T, linker, and solid phase support are as defined above.]

[0069] (2) Process B: A process for producing a compound represented by the following general formula (VII) (hereinafter referred to as compound (VII)) by reacting compound (III) with a morpholino monomer compound in the presence of a base. [ka] [In the formula, each B P , L, n, R 2 , R 3 , T has the same meaning as above.]

[0070] This step can be carried out by reacting compound (III) with a morpholino monomer compound in the presence of a base.

[0071] The morpholino monomer compound may be, for example, a compound represented by the following general formula (VIII): [ka] [In the formula, B P , R 2 , R 3 , and T has the same meaning as above.] Examples of the "base" that can be used in this step include diisopropylethylamine, triethylamine, and N-ethylmorpholine. The amount of the base used is, for example, within the range of 1 to 1000 molar equivalents, and preferably within the range of 10 to 100 molar equivalents, relative to 1 mole of compound (III). The morpholino monomer compound and base that can be used in this step can be diluted with an appropriate solvent to a concentration of 0.1% to 30%. The solvent is not particularly limited as long as it is inert to the reaction, and examples thereof include N,N-dimethylimidazolidone, N-methylpiperidone, DMF, dichloromethane, acetonitrile, tetrahydrofuran, and mixtures thereof.

[0072] The reaction temperature is, for example, preferably in the range of 0°C to 100°C, and more preferably in the range of 10°C to 50°C. The reaction time varies depending on the type of base used and the reaction temperature, but is usually within the range of 1 minute to 48 hours, preferably within the range of 30 minutes to 24 hours.

[0073] Furthermore, after completion of this step, an acylating agent can be added if necessary. Examples of the "acylating agent" include acetic anhydride, acetic acid chloride, and phenoxyacetic anhydride. The acylating agent can also be used after diluting with an appropriate solvent to a concentration within the range of, for example, 0.1% to 30%. The solvent is not particularly limited as long as it is not involved in the reaction, and examples thereof include dichloromethane, acetonitrile, tetrahydrofuran, alcohols (ethanol, isopropanol, trifluoroethanol, etc.), water, and mixtures thereof. If necessary, a base such as pyridine, lutidine, collidine, triethylamine, diisopropylethylamine, or N-ethylmorpholine can be used together with the acylating agent. The amount of the acylating agent used is preferably within the range of 0.1 to 10,000 molar equivalents, and more preferably within the range of 1 to 1,000 molar equivalents. The amount of the base used is, for example, appropriately within the range of 0.1 to 100 molar equivalents, and preferably within the range of 1 to 10 molar equivalents, relative to 1 mole of the acylating agent. The reaction temperature of this reaction is preferably within the range of 10° C. to 50° C., more preferably within the range of 10° C. to 50° C., more preferably within the range of 20° C. to 40° C., and even more preferably within the range of 25° C. to 35° C. The reaction time varies depending on, for example, the type of acylating agent used and the reaction temperature, but is usually within the range of 0.1 minute to 24 hours, and preferably within the range of 1 minute to 5 hours.

[0074] (3) Process C: A step of removing the protecting group from compound (VII) produced in step B using a deprotecting agent to produce a compound represented by general formula (IX). [ka] [In the formula, Base, B P , L, n, R 2 , R 3 , T has the same meaning as above.]

[0075] This step can be carried out by reacting compound (VII) with a deprotecting agent.

[0076] Examples of the "deprotecting agent" include concentrated aqueous ammonia and methylamine. The "deprotecting agent" that can be used in this step can be diluted with, for example, water, methanol, ethanol, isopropyl alcohol, acetonitrile, tetrahydrofuran, DMF, N,N-dimethylimidazolidone, N-methylpiperidone, or a mixed solvent thereof. Among these, ethanol is preferred. The amount of the deprotecting agent used is, for example, appropriately within the range of 1 to 100,000 molar equivalents, and preferably within the range of 10 to 1,000 molar equivalents, relative to 1 mole of compound (VII).

[0077] The reaction temperature is suitably within the range of, for example, 15° C. to 75° C., preferably within the range of 40° C. to 70° C., and more preferably within the range of 50° C. to 60° C. The deprotection reaction time varies depending on the type of compound (VII), the reaction temperature, etc., but is suitably within the range of 10 minutes to 30 hours, preferably within the range of 30 minutes to 24 hours, and more preferably within the range of 5 hours to 20 hours.

[0078] (4) Process D: A step of producing PMO (I) by reacting compound (IX) produced in step C with an acid. [ka] [where Base, n, R 2 , R 3 , T has the same meaning as above.]

[0079] This step can be carried out by adding an acid to compound (IX).

[0080] Examples of the "acid" that can be used in this step include trichloroacetic acid, dichloroacetic acid, acetic acid, phosphoric acid, and hydrochloric acid. The amount of acid used is, for example, such that the pH of the solution falls within the range of 0.1 to 4.0, and more preferably within the range of 1.0 to 3.0. The solvent is not particularly limited as long as it is not involved in the reaction, and examples thereof include acetonitrile, water, and a mixed solvent thereof.

[0081] The reaction temperature is preferably within the range of 10° C. to 50° C., more preferably within the range of 20° C. to 40° C., and even more preferably within the range of 25° C. to 35° C. The deprotection reaction time varies depending on the type of compound (IX), the reaction temperature, etc., but is suitably within the range of 0.1 minute to 5 hours, preferably within the range of 1 minute to 1 hour, and more preferably within the range of 1 minute to 30 minutes.

[0082] PMO(I) can be separated and purified from the reaction mixture obtained in this step by conventional separation and purification means, such as extraction, concentration, neutralization, filtration, centrifugation, recrystallization, C8 to C 18 The desired PMO(I) can be isolated and purified by using, alone or in combination, means such as reverse phase column chromatography, cation exchange column chromatography, anion exchange column chromatography, gel filtration column chromatography, high performance liquid chromatography, dialysis, and ultrafiltration (see, for example, WO 1991 / 09033). When PMO (I) is purified using reverse phase chromatography, a mixed solution of 20 mM triethylamine / acetic acid buffer and acetonitrile can be used as the elution solvent, for example. When ion exchange chromatography is used to purify PMO(I), a mixed solution of 1 M saline and 10 mM aqueous sodium hydroxide solution can be used, for example.

[0083] Peptide nucleic acids are antisense oligomers of the present invention that have as their constituent units groups represented by the following general formula: [ka] (In the formula, Base has the same meaning as defined above.)

[0084] Peptide nucleic acids can be produced, for example, according to the following literature: 1)PE Nielsen, M. Egholm, RH Berg, O. Buchardt,Science, 254, 1497 (1991) 2) M. Egholm, O. Buchardt, PE Nielsen, RH Berg, Jacs., 114, 1895 (1992) 3) KL Dueholm, M. Egholm, C. Behrens, L. Christensen, HF Hansen, T. Vulpius, KH Petersen, RH Berg, PE Nielsen, O. Buchardt, J. Org. Chem., 59, 5767 (1994) 4) L. Christensen, R. Fitzpatrick, B. Gildea, KH Petersen, HF Hansen, T. Koch, M. Egholm, O. Buchardt, PE Nielsen, J. Coull, RH Berg, J. Pept. Sci., 1, 175 (1995) 5) T. Koch, HF Hansen, P. Andersen, T. Larsen, HG Batz, K. Otteson, H. Orum, J. Pept. Res., 49, 80 (1997)

[0085] Furthermore, the 5'-end of the antisense oligomer of the present invention may be a group represented by any one of the following chemical formulas (1) to (3), preferably (3) -OH. [ka] Hereinafter, the groups represented by (1), (2) and (3) above will be referred to as "group (1)," "group (2)" and "group (3)," respectively.

[0086] The antisense oligomers of the present invention may include compounds in which the stereochemistry of the phosphorus atom is optically pure, since the phosphorus atom in the phosphate binding moiety is an asymmetric center. Those skilled in the art can obtain pure optically active compounds from mixtures of isomers (WO 2017 / 024264). Alternatively, the antisense oligomers of the present invention may be synthesized as pure optically active compounds. Those skilled in the art can control the synthesis reaction to obtain pure optically active compounds (Patent Publication No. 2018-537952).

[0087] 2. Peptide-linked antisense oligomers The antisense oligomer of the present invention may be conjugated with a functional peptide (e.g., a membrane-permeable peptide for improving transport efficiency to target cells) for the purpose of improving efficacy (WO 2008 / 036127, WO 2009 / 005793, WO 2012 / 150960, WO 2016 / 187425, WO 2018 / 118662, WO 2018 / 118599, WO 2018 / 118627, JD Ramsey, NH Flynn, Pharmacology & Therapeutics 154, 78-86 (2015), MK Tsoumpra et al., EBioMedicine, 45, 630-645 (2019)). The binding site is not particularly limited, but it is preferable that the 5' or 3' end of the antisense oligomer is bound to the amino or carboxyl terminus of the functional peptide. In another embodiment, the antisense oligomer of the present invention and the functional peptide may form a complex via a linker. The linker is not particularly limited, but it is preferred that one end of the linker is bound to the 5' or 3' end of the antisense oligomer, and the other end of the linker is bound to the amino or carboxyl end of the functional peptide. An additional amino acid may be present between the functional peptide and the linker.

[0088] 3. Pharmaceutical Compositions The antisense oligomers of the present invention can induce exon 51 skipping with high efficiency, even when their length is shorter than that of conventional antisense oligomers. Furthermore, the antisense oligomers of the present invention have excellent solubility while maintaining the activity of inducing exon 51 skipping with high efficiency. Furthermore, the antisense oligomers of the present invention have excellent solubility and safety while maintaining the activity of inducing exon 51 skipping with high efficiency. Therefore, it is expected that the symptoms of muscular dystrophy can be efficiently alleviated by administering the antisense oligomers of the present invention to DMD patients who have a mutation in the dystrophin gene that is subject to exon 51 skipping (e.g., a frameshift mutation, a missense mutation / nonsense mutation in exon 51, etc.). For example, it is expected that the symptoms of muscular dystrophy can be efficiently alleviated by administering the antisense oligomers of the present invention to DMD patients who have a specific mutant dystrophin gene lacking at least an exon near exon 51. The predetermined mutant dystrophin gene refers to a dystrophin gene that has a frameshift mutation due to deletion of at least an exon near exon 51, and in which the amino acid reading frame is corrected when exon 51 is omitted (skipped). Examples of DMD patients include DMD patients with frameshift mutations due to deletion of exons 13-50, 29-50, 40-50, 43-50, 45-50, 47-50, 48-50, 49-50, 50, 52, 52-63, etc. More specifically, administration of a pharmaceutical composition containing the antisense oligomer of the present invention to DMD patients (patients with in-frame mutations resulting from exon 51 skipping, e.g., patients with exon 13-50 deletion, exon 29-50 deletion, exon 40-50 deletion, exon 43-50 deletion, exon 45-50 deletion, exon 47-50 deletion, exon 48-50 deletion, exon 49-50 deletion, exon 50 deletion, exon 52 deletion, and exon 52-63 deletion) is expected to result in highly efficient alleviation of symptoms of muscular dystrophy. For example, when using a pharmaceutical composition containing the antisense oligomer of the present invention, a therapeutic effect comparable to that of conventional oligomers can be obtained at a lower dose, thereby reducing side effects and being more economical. Furthermore, the antisense oligomers of the present invention are useful in preparing pharmaceutical compositions because they have excellent solubility while maintaining the activity of inducing exon 51 skipping with high efficiency. Furthermore, the antisense oligomers of the present invention are useful as pharmaceutical compositions because they have excellent solubility and safety while maintaining the activity of inducing exon 51 skipping with high efficiency. Therefore, in another embodiment, we provide a pharmaceutical composition for treating muscular dystrophy (hereinafter referred to as the "composition of the present invention") containing the antisense oligomer of the present invention, or a pharmaceutically acceptable salt or hydrate thereof, as an active ingredient. The present invention also provides a method for treating muscular dystrophy, comprising the step of administering the antisense oligomer of the present invention to a DMD patient. In this treatment method, the antisense oligomer of the present invention may be administered as a pharmaceutical composition for treating muscular dystrophy. The present invention further provides the use of an antisense oligomer of the present invention in the manufacture of a pharmaceutical composition for treating muscular dystrophy, and an antisense oligomer of the present invention for use in treating muscular dystrophy.

[0089] Examples of pharmaceutically acceptable salts of the antisense oligomers of the present invention that can be contained in the compositions of the present invention include alkali metal salts such as sodium salt, potassium salt, and lithium salt, and alkaline earth metal salts such as calcium salt and magnesium salt; metal salts such as aluminum salt, iron salt, zinc salt, copper salt, nickel salt, and cobalt salt; ammonium salt; t-octylamine salt, dibenzylamine salt, morpholine salt, glucosamine salt, phenylglycine alkyl ester salt, ethylenediamine salt, N-methylglucamine salt, guanidine salt, diethylamine salt, triethylamine salt, dicyclohexylamine salt, N,N'-dibenzylethylenediamine salt, chloroprocaine salt, procaine salt, diethanolamine salt, N-benzyl-phenethylamine salt, and the like. Examples of suitable salts include organic amine salts such as amine salts, piperazine salts, tetramethylammonium salts, and tris(hydroxymethyl)aminomethane salts; hydrohalide salts such as hydrofluoride, hydrochloride, hydrobromide, and hydroiodide; inorganic acid salts such as nitrate, perchlorate, sulfate, and phosphate; lower alkane sulfonate salts such as methanesulfonate, trifluoromethanesulfonate, and ethanesulfonate; arylsulfonate salts such as benzenesulfonate and p-toluenesulfonate; organic acid salts such as acetate, malate, fumarate, succinate, citrate, tartrate, oxalate, and maleate; and amino acid salts such as glycine salt, lysine salt, arginine salt, ornithine salt, glutamate, and aspartate. These salts can be prepared by known methods. Alternatively, the antisense oligomer of the present invention contained in the composition of the present invention may be in the form of a hydrate.

[0090] The administration form of the composition of the present invention is not particularly limited as long as it is a pharmaceutically acceptable administration form and can be selected depending on the treatment method, but from the viewpoint of ease of delivery to muscle tissue, intravenous administration, intraarterial administration, intramuscular administration, subcutaneous administration, oral administration, intratissue administration, transdermal administration, etc. Furthermore, the dosage form that the composition of the present invention can take is not particularly limited, and examples thereof include various injections, oral preparations, infusions, inhalants, ointments, lotions, etc.

[0091] When the antisense oligomer of the present invention is administered to a patient with muscular dystrophy, the composition of the present invention may contain a carrier that promotes delivery of the oligomer to muscle tissue. Such a carrier is not particularly limited as long as it is pharmaceutically acceptable, and examples thereof include cationic carriers such as cationic liposomes and cationic polymers, or carriers that utilize viral envelopes. Examples of cationic liposomes include liposomes formed from 2-O-(2-diethylaminoethyl)carbamoyl-1,3-O-dioleoylglycerol and phospholipids as essential components (hereinafter referred to as "Liposome A"), Oligofectamine® (Invitrogen), Lipofectin® (Invitrogen), Lipofectamine® (Invitrogen), Lipofectamine 2000® (Invitrogen), DMRIE-C® (Invitrogen), GeneSilencer® (Gene Therapy Systems), TransMessenger® (QIAGEN), TransIT TKO® (Mirus), and Nucleofector II (Lonza). Among these, Liposome A is preferred. Examples of cationic polymers include JetSI (registered trademark) (manufactured by Qbiogene) and Jet-PEI (registered trademark) (polyethyleneimine, manufactured by Qbiogene). Examples of carriers utilizing viral envelopes include GenomeOne (registered trademark) (HVJ-E liposome, manufactured by Ishihara Sangyo Kaisha). Alternatively, the pharmaceutical device described in Japanese Patent No. 2924179 and the cationic carriers described in Japanese Patent Republication Nos. 2006 / 129594 and 2008 / 096690 can also be used. For details, reference can be made to U.S. Pat. Nos. 4,235,871 and 4,737,323, International Publication No. 96 / 14057, and "New RRC, Liposomes: A practical approach, IRL Press, Oxford (1990) pages 33-104," etc.

[0092] The concentration of the antisense oligomer of the present invention contained in the composition of the present invention varies depending on the type of carrier, etc., but in one embodiment, it is suitably in the range of 0.1 nM to 100 μM, and preferably in the range of 100 nM to 10 μM. Furthermore, the weight ratio of the antisense oligomer of the present invention to the carrier contained in the composition of the present invention (carrier / antisense oligomer of the present invention) varies depending on the properties of the oligomer, the type of carrier, etc., but it is suitably in the range of 0.1 to 100, and preferably in the range of 0.1 to 10.

[0093] The composition of the present invention may be in the form of an aqueous solution, in which case the composition may contain the antisense oligomer of the present invention at a concentration of 2.5 to 500 mg / mL, 5 to 450 mg / mL, 10 to 400 mg / mL, 15 to 350 mg / mL, 20 to 300 mg / mL, 20 to 250 mg / mL, 20 to 200 mg / mL, 20 to 150 mg / mL, 20 to 100 mg / mL, 20 to 50 mg / mL, 20 to 40 mg / mL, 20 to 30 mg / mL, 23 to 27 mg / mL, 24 to 26 mg / mL, or 25 mg / mL. Alternatively, the composition of the present invention may contain the antisense oligomer of the present invention at a concentration of 10 to 100 mg / mL, 15 to 95 mg / mL, 20 to 80 mg / mL, 25 to 75 mg / mL, 30 to 70 mg / mL, 35 to 65 mg / mL, 40 to 60 mg / mL, 45 to 55 mg / mL, 47 to 53 mg / mL, 48 to 52 mg / mL, 49 to 51 mg / mL, or 50 mg / mL.

[0094] The composition of the present invention may be in a dry form. In this case, to prepare an aqueous solution of the composition of the present invention, for example, a dry composition of the present invention containing 125 mg or 250 mg of the antisense oligomer of the present invention in a dry form may be mixed with 0.5 mL to 100 mL of water (corresponding to a concentration of the antisense oligomer of the present invention of 1.25 mg / mL to 250 mg / mL or 2.5 mg / mL to 500 mg / mL), preferably with 1 mL to 50 mL of water (corresponding to a concentration of the antisense oligomer of the present invention of 2.5 mg / mL to 125 mg / mL or 5 mg / mL to 250 mg / mL), more preferably with 5 mL to 10 mL of water (corresponding to a concentration of the antisense oligomer of the present invention of 12.5 mg / mL to 25 mg / mL or 25 mg / mL to 50 mg / mL).

[0095] In addition to the antisense oligomer of the present invention and the carrier described above, the composition of the present invention can optionally contain pharmaceutically acceptable additives. Examples of such additives include emulsifiers (e.g., fatty acids having 6 to 22 carbon atoms or pharmaceutically acceptable salts thereof, albumin, and dextran), stabilizers (e.g., cholesterol, phosphatidic acid, sucrose, mannitol, sorbitol, and xylitol), tonicity agents (e.g., sodium chloride, glucose, maltose, lactose, sucrose, trehalose, mannitol, sorbitol, and xylitol), and pH adjusters (e.g., hydrochloric acid, sulfuric acid, phosphoric acid, acetic acid, sodium hydroxide, potassium hydroxide, and triethanolamine). These additives can be used alone or in combination. The content of the additive in the composition of the present invention is preferably 90% by weight or less, more preferably 70% by weight or less, and even more preferably 50% by weight or less.

[0096] The composition of the present invention can be prepared by adding the antisense oligomer of the present invention to a dispersion of a carrier and stirring appropriately. The additives can be added at any appropriate stage, either before or after the addition of the antisense oligomer of the present invention. When the composition of the present invention is in the form of an aqueous solution, the aqueous solvent that can be used when adding the antisense oligomer of the present invention is not particularly limited as long as it is pharmaceutically acceptable, and examples thereof include electrolyte solutions such as water for injection, distilled water for injection, and physiological saline, and sugar solutions such as glucose solution and maltose solution. In such cases, conditions such as pH and temperature can be appropriately selected by those skilled in the art.

[0097] The composition of the present invention can be, for example, a liquid formulation or a lyophilized formulation thereof. As one embodiment of the dried form of the composition of the present invention, the lyophilized formulation can be prepared by lyophilizing the composition of the present invention in liquid form using a conventional method. For example, after appropriate sterilization of the composition of the present invention in liquid form, a predetermined amount can be dispensed into vials, pre-frozen at approximately −40 to −20°C for about 2 hours, primary dried under reduced pressure at approximately 0 to 10°C, and then secondary dried under reduced pressure at approximately 15 to 25°C, thereby lyophilizing the composition. The atmosphere inside the vial can then generally be replaced with nitrogen gas, and the vial can be sealed to obtain a lyophilized formulation of the composition of the present invention.

[0098] The lyophilized formulation of the composition of the present invention can generally be reconstituted and used by adding any appropriate solution (reconstitution liquid). Examples of such reconstitution liquid include water for injection, physiological saline, and other general infusion solutions. The volume of this reconstitution liquid varies depending on the intended use, and is not particularly limited, but is suitably 0.5 to 2 times the volume of the liquid before lyophilization, or 500 mL or less.

[0099] The dosage of the composition of the present invention is preferably determined taking into consideration the type of antisense oligomer of the present invention contained therein, the dosage form, the patient's condition (e.g., age and weight), the route of administration, and the nature and severity of the disease. For adults, the amount of the antisense oligomer of the present invention is generally in the range of 0.1 mg to 10 g per person per day, preferably 1 mg to 1 g per person. This value may vary depending on the type of target disease, the administration form, and the target molecule. Therefore, in some cases, a lower dose may be sufficient, while in other cases, a higher dose may be required. The composition can be administered once or several times daily, or at intervals of one to several days.

[0100] Another embodiment of the composition of the present invention is a pharmaceutical composition comprising a vector capable of expressing an oligonucleotide of the present invention and the above-described carrier. Such an expression vector may be capable of expressing multiple oligonucleotides of the present invention. Similar to the composition of the present invention containing the oligomer of the present invention, pharmaceutically acceptable additives may be added to the composition. The concentration of the expression vector contained in the composition varies depending on the type of carrier, etc., but in one embodiment, it is suitably in the range of 0.1 nM to 100 μM, preferably in the range of 100 nM to 10 μM. The weight ratio of the expression vector to the carrier (carrier / expression vector) contained in the composition varies depending on the properties of the expression vector, the type of carrier, etc., but is suitably in the range of 0.1 to 100, preferably in the range of 0.1 to 10. The content of the carrier contained in the composition is the same as in the composition of the present invention containing the antisense oligomer of the present invention, and the preparation method, etc., are also the same as in the composition of the present invention.

[0101] The present invention will be explained in more detail below with reference to examples and test examples, but the present invention is not limited to the scope shown in the examples. [Example]

[0102] Example 1: Synthesis of antisense oligomers According to the method described in WO 2015 / 137409, antisense oligomers (PMO Nos. 1 to 93 (SEQ ID NOs: 1 to 93)) shown in Table 1 were synthesized, targeting a portion of the base sequence of exon 51 of the human dystrophin gene and / or its 5'-adjacent intron, intron 50. The table also shows the theoretical molecular weight of each antisense oligomer and the actual measured value by ESI-TOF-MS. In Table 1, for example, "H51_67-81_131-142" indicates that, when the base at the 5' end of exon 51 of the human dystrophin gene is designated as the first base and the bases subsequent to it on the 3' side are numbered in order, the antisense oligomer targets the sequence of bases 67 to 81 and the sequence of bases 131 to 142. The sequence of bases prior to -1 in the target base sequence is the base sequence in intron 50. A base sequence containing the sequence of exon 51 of the human wild-type dystrophin gene and the sequence near the 3' end of intron 50 is shown in SEQ ID NO: 128. [Table 3-1] [Table 3-2] [Table 3-3]

[0103] Example 2: Exon skipping activity test of antisense oligomers In vitro study of exon 51 skipping of the human dystrophin gene (1) Test method RD cells (human rhabdomyosarcoma cell line, CCL-136, purchased from ATCC) 3.5 × 10 5 Each cell was transfected with 0.3 to 120 μM of each antisense oligomer listed in Tables 1 and 2 using the Amaxa Cell Line Nucleofector Kit L and Nucleofector II (Lonza). The pulse program used for transfection was T-030.

[0104] After transfection, the RD cells were cultured for three nights at 37°C and 5% CO2 in 2 mL of Eagle's minimal essential medium (EMEM) medium (Sigma, same below) containing 10% fetal bovine serum (FBS) (Invitrogen). After culturing, the RD cells were washed once with PBS (Nissui, hereinafter the same), and then 350 μL of Buffer RA1 (Takara Bio) containing 1% 2-mercaptoethanol (Nacalai Tesque) was added to the cells. The cells were left at room temperature for several minutes to lyse the cells, and then collected on a NucleoSpin® Filter (Takara Bio). The homogenate was prepared by centrifugation at 11,000 × g for 1 minute. Total RNA was extracted according to the protocol attached to the NucleoSpin® RNA (Takara Bio). The concentration of the extracted total RNA was measured using a NanoDrop ONE (Thermo Fisher).

[0105] One-step RT-PCR was performed on 400 ng of extracted total RNA using the QIAGEN OneStep RT-PCR Kit (Qiagen) and a thermal cycler. The reaction mixture was prepared according to the protocol attached to the kit. The thermal cycler used was a TaKaRa PCR Thermal Cycler Dice Touch (Takara Bio). The RT-PCR program used was as follows: 50℃, 30 minutes: reverse transcription 95℃, 15 minutes: Polymerase activation, reverse transcriptase inactivation, cDNA denaturation PCR amplification: [94°C, 30 seconds; 60°C, 30 seconds; 72°C, 1 minute] x 35 cycles 72℃, 10 minutes: Final extension reaction

[0106] The nucleotide sequences of the forward and reverse primers used in RT-PCR are as follows: Forward primer: 5'-CTGAGTGGAAGGCGGTAAAC-3' (SEQ ID NO: 95) Reverse primer: 5'- GAAGTTTCAGGGCCAAGTCA -3' (SEQ ID NO: 96)

[0107] 1 μL of the PCR reaction product was analyzed using Bioanalyzer (Agilent) or MultiNA (Shimadzu Corporation). The polynucleotide amount "A" of the band in which exon 51 was skipped and the polynucleotide amount "B" of the band in which exon 51 was not skipped were measured as the signal intensity of the bands. Based on the measured values ​​of "A" and "B," the skipping efficiency was calculated according to the above formula (1).

[0108] (2) Test results The results of exon 51 skipping efficiency obtained for each antisense oligomer are shown in Figures 1 to 18. As a direct or indirect control, an antisense oligomer (PMO No. 94 (SEQ ID NO: 94)) shown in Table 2 was synthesized according to the method described in JP 2015-91229 A. This oligomer has the same base sequence as the exon 51 skipping drug eteplirsen (WHO Drug Information 24, 2, 137-139 (2010), Proposed INN List 103) and the same 5'-end modification, i.e., the 5'-end contains the above-mentioned group (1), resulting in an identical overall structure. The antisense oligomers of the present invention shown in Table 1 had significantly higher skipping efficiency than the antisense oligomers shown in Table 2, which have the same overall structure as eteplirsen, and skipped exon 51 extremely effectively. [Table 4]

[0109] Example 3: Solubility test of antisense oligomers Solubility test of antisense oligomers in physiological saline For each of the antisense oligomers PMO Nos. 7, 8, 10, 16, 21, 24, 31, 42, 67, 76 and 90, which showed extremely high skipping efficiency in Example 2, a solubility test in physiological saline was carried out to further verify their usefulness for pharmaceutical applications.

[0110] (1) Test method 57 μL of water for injection was added to a sample vial containing 5.7 mg of each antisense oligomer, and the solution was dissolved using ultrasound and a vortex mixer. 57 μL of double-strength saline was then added and mixed using a vortex mixer to obtain a 50 mg / mL saline solution. The solution was left to stand at room temperature for 24 hours, after which it was visually inspected for the presence or absence of precipitation. Antisense oligomers that showed no precipitation were evaluated as having high solubility.

[0111] (2) Test results Of the antisense oligomers tested, PMO Nos. 7, 8, 10, 16, 21, 24, 31, 42, 67, and 76 each exhibited a solubility of 50 mg / mL or more in physiological saline. These results indicate that these antisense oligomers have a significantly high exon 51 skipping efficiency and are highly soluble in physiological saline, making them highly useful as pharmaceuticals.

[0112] Example 4: Safety evaluation of antisense oligomers Of the antisense oligomers for which the solubility test in physiological saline was carried out in Example 3, PMO Nos. 16, 21, 42, and 90 were subjected to a safety evaluation to verify their safety for pharmaceutical use.

[0113] (1) Evaluation method Each antisense oligomer was dissolved in saline and administered intravenously to 6-week-old male C57BL / 6N mice. The following day, serum samples were collected from the mice, and blood aspartate aminotransferase (AST), alanine aminotransferase (ALT), blood urea nitrogen (BUN), and creatinine levels were measured. Measurements from control groups (mice administered saline alone or untreated) were considered normal. Statistical significance tests (Student's t-test or Dunnett's test) were performed to determine whether a significant increase in the values ​​observed in the antisense oligomer-treated group was abnormal (p<0.05). Each test was performed using the statistical analysis system SAS (registered trademark, SAS Institute, Inc.) version 9.3. Antisense oligomers were considered highly safe if no abnormal values ​​were observed in AST, ALT, BUN, or creatinine levels at the 1000 mg / kg dose.

[0114] (2) Evaluation results For antisense oligomers PMO No. 16, 21, and 42, no abnormal values ​​were observed in any of the AST, ALT, BUN, and creatinine values ​​at a dose of 1000 mg / kg, confirming that they are highly safe (specifically, have no effect on kidney and liver function or are highly unlikely to have an effect). The results are shown in Figures 19 to 21. Values ​​that showed significant increases at a significance level of p<0.05 (abnormal values) are indicated by p-values.

[0115] The above results demonstrate that the antisense oligomer of the present invention exhibits the activity of inducing exon 51 skipping of the dystrophin gene with high efficiency, and also has excellent physical properties and safety as a pharmaceutical. [Sequence List Free Text]

[0116] SEQ ID NOs: 1 to 126: Synthetic nucleic acids

Claims

1. The following (a1) to (d1): (a1) an antisense oligomer comprising any one of the nucleotide sequences of SEQ ID NOs: 1 to 89 and 91 to 93; (b1) an antisense oligomer comprising a nucleotide sequence in which 1 to 5 nucleotides are deleted, substituted, inserted, and / or added relative to the nucleotide sequence of any one of SEQ ID NOs: 1 to 89 and 91 to 93, and having the activity of inducing skipping of exon 51 of the human dystrophin gene; (c1) an antisense oligomer comprising a nucleotide sequence having 80% or more sequence identity to any of the nucleotide sequences of SEQ ID NOs: 1 to 89 and 91 to 93, and having the activity of inducing skipping of exon 51 of the human dystrophin gene; and (d1) An antisense oligomer that hybridizes under stringent conditions to an oligonucleotide consisting of a base sequence complementary to any of the base sequences of SEQ ID NOs: 1 to 89 and 91 to 93, and has the activity of inducing skipping of exon 51 of the human dystrophin gene. An antisense oligomer selected from the group consisting of (excluding antisense oligomers consisting of any of the base sequences of SEQ ID NOs: 90 and 97 to 126), or a pharmaceutically acceptable salt thereof, or a hydrate thereof.

2. The following (e) to (h): (e) an antisense oligomer consisting of any one of the nucleotide sequences of SEQ ID NOs: 1 to 89 and 91 to 93; (f) an antisense oligomer consisting of a nucleotide sequence in which 1 to 5 bases are deleted and / or substituted with respect to any of the nucleotide sequences of SEQ ID NOs: 1 to 89 and 91 to 93, and having the activity of inducing skipping of exon 51 of the human dystrophin gene; (g) an antisense oligomer consisting of a nucleotide sequence having 80% or more sequence identity to any of the nucleotide sequences of SEQ ID NOs: 1 to 89 and 91 to 93, and having the activity of inducing skipping of exon 51 of the human dystrophin gene; and (h) an antisense oligomer that hybridizes under highly stringent conditions to an oligonucleotide consisting of a base sequence complementary to any of the base sequences of SEQ ID NOs: 1 to 89 and 91 to 93, and has the activity of inducing skipping of exon 51 of the human dystrophin gene. An antisense oligomer selected from the group consisting of (excluding antisense oligomers consisting of any of the base sequences of SEQ ID NOs: 90 and 97 to 126), or a pharmaceutically acceptable salt thereof, or a hydrate thereof.

3. the antisense oligomer is An antisense oligomer having a nucleotide sequence with 90% or more sequence identity to any of the base sequences of SEQ ID NOS: 1 to 89 and 91 to 93, and having the activity of inducing skipping of exon 51 of the human dystrophin gene.

3. The antisense oligomer according to claim 1 or 2, or a pharmaceutically acceptable salt thereof, or a hydrate thereof,

4. the antisense oligomer is (a2) an antisense oligomer comprising any one of the nucleotide sequences of SEQ ID NOs: 7, 8, 10, 16, 21, 24, 31, 42, 67, and 76; (b2) an antisense oligomer comprising a nucleotide sequence in which 1 to 5 nucleotides are deleted, substituted, inserted, and / or added relative to any one of the nucleotide sequences of SEQ ID NOs: 7, 8, 10, 16, 21, 24, 31, 42, 67, and 76, and having the activity of inducing skipping of exon 51 of the human dystrophin gene; (c2) an antisense oligomer comprising a nucleotide sequence having 80% or more sequence identity to any of the nucleotide sequences of SEQ ID NOs: 7, 8, 10, 16, 21, 24, 31, 42, 67, and 76, and having the activity of inducing skipping of exon 51 of the human dystrophin gene; and (d2) An antisense oligomer that hybridizes under stringent conditions to an oligonucleotide consisting of a nucleotide sequence complementary to any one of the nucleotide sequences of SEQ ID NOs: 7, 8, 10, 16, 21, 24, 31, 42, 67, and 76, and has the activity of inducing skipping of exon 51 of the human dystrophin gene. an antisense oligomer selected from the group consisting of The antisense oligomer according to claim 1, or a pharmaceutically acceptable salt thereof, or a hydrate thereof,

5. The antisense oligomer according to any one of claims 1 to 4, which is an oligonucleotide, or a pharmaceutically acceptable salt thereof, or a hydrate of the same.

6. The antisense oligomer or a pharmaceutically acceptable salt thereof, or a hydrate thereof, according to claim 5, wherein the sugar moiety and / or the phosphate linkage moiety of at least one nucleotide constituting the oligonucleotide is modified.

7. The sugar moiety of at least one nucleotide constituting the oligonucleotide has an —OH group at the 2′-position that is selected from the group consisting of OR, R, R′OR, SH, SR, and NH. 2 , N.H.R., N.R. 2 , N 3 7. The antisense oligomer according to claim 5 or 6, or a pharmaceutically acceptable salt thereof, or a hydrate thereof, wherein R is ribose substituted with any group selected from the group consisting of CN, F, Cl, Br and I (wherein R represents alkyl or aryl, and R' represents alkylene).

8. The antisense oligomer, or a pharmaceutically acceptable salt thereof, or a hydrate of either of claims 5 to 7, wherein the phosphate bond of at least one nucleotide constituting the oligonucleotide is any one selected from the group consisting of a phosphorothioate bond, a phosphorodithioate bond, an alkylphosphonate bond, a phosphoramidate bond, and a boranophosphate bond.

9. The antisense oligomer according to any one of claims 1 to 4, which is a morpholino oligomer, or a pharmaceutically acceptable salt thereof, or a hydrate of the same.

10. The antisense oligomer according to claim 9, which is a phosphorodiamidate morpholino oligomer, or a pharmaceutically acceptable salt thereof, or a hydrate thereof.

11. The 5' end is represented by the following chemical formulas (1) to (3): 【Chemistry 1】 The antisense oligomer according to claim 9 or 10, or a pharmaceutically acceptable salt thereof, or a hydrate thereof, wherein the antisense oligomer is any one of the groups shown below.

12. A pharmaceutical composition for treating muscular dystrophy, comprising the antisense oligomer according to any one of claims 1 to 11, or a pharmaceutically acceptable salt thereof, or a hydrate of the same or the like.

13. 13. The pharmaceutical composition of claim 12, further comprising a pharmaceutically acceptable carrier.

14. 14. The pharmaceutical composition according to claim 12 or 13, for administration to a patient with muscular dystrophy, wherein the patient has a mutation in the dystrophin gene that is subject to exon 51 skipping.

15. The pharmaceutical composition of claim 14, wherein the patient has a dystrophin gene that has a frameshift mutation due to deletion of at least an exon near exon 51 and in which the amino acid reading frame is corrected by skipping of exon 51.

16. The pharmaceutical composition according to claim 14 or 15, wherein the patient has a frameshift mutation in the dystrophin gene due to a deletion of exons 13-50, 29-50, 40-50, 43-50, 45-50, 47-50, 48-50, 49-50, 50, 52, or 52-63.

17. The pharmaceutical composition according to any one of claims 14 to 16, wherein the patient is a human.

18. Use of the antisense oligomer according to any one of claims 1 to 11, or a pharmaceutically acceptable salt thereof, or a hydrate of the same in the manufacture of a medicament for treating muscular dystrophy.

19. A method for treating muscular dystrophy, comprising the step of administering to a patient with muscular dystrophy an effective amount of the antisense oligomer according to any one of claims 1 to 11, or a pharmaceutically acceptable salt thereof, or a hydrate of the antisense oligomer or the pharmaceutically acceptable salt thereof, or the pharmaceutical composition according to any one of claims 12 to 16.

20. 20. The method of claim 19, wherein the patient is a human.

21. The antisense oligomer according to any one of claims 1 to 11, or a pharmaceutically acceptable salt or hydrate thereof, or the pharmaceutical composition according to any one of claims 12 to 16, for use in treating muscular dystrophy.

22. The antisense oligomer or a pharmaceutically acceptable salt or hydrate thereof, or pharmaceutical composition according to claim 21 , wherein the patient suffering from muscular dystrophy in the treatment is a human.

Citation Information

Patent Citations

  • Induction of exon skipping in eukaryotic cells

    WO2002024906A1

  • ENA NUCLEIC ACID DRUGS MODIFYING SPLICING IN mRNA PRECURSOR

    WO2004048570A1

  • Modulation of exon recognition in pre-mrna by interfering with the secondary RNA structure

    WO2004083432A1

  • Antisense oligonucleotides for inducing exon skipping and methods of use thereof

    WO2006000057A1

  • Means and methods for counteracting muscle disorders

    WO2009054725A2