COMPOSITION FOR PREVENTING, TREATING OR IMPROVING GASTROINTESTINAL DISEASES COMPRISING A STRAIN OF THE GENUS CORYNEBACTERIUM AND CULTURE THEREOF.

Abstract

This application relates to a composition for preventing, improving, or treating gastrointestinal diseases comprising a strain of the genus Corynebacterium, a culture thereof, and threonine. Since the composition according to this application has been confirmed to have excellent anti-Helicobacter pylori efficacy in cell experiments, efficacy in improving gastrointestinal diseases in animal experiments, and efficacy in the synthesis of gastric mucus, the composition may be used as a pharmaceutical composition for preventing or treating gastrointestinal diseases, as a feed for preventing or improving gastric ulcers, or as a feed composition.

Description

COMPOSITION FOR PREVENTING, TREATING OR IMPROVING GASTROINTESTINAL DISEASES COMPRISING A STRAIN OF THE GENUS CORYNEBACTERIUM AND CULTURE THEREOF Field of Invention This application relates to a composition for the prevention, treatment or improvement of a gastric disorder containing a strain of Corynebacterium sp., its cultured product and threonine. Background of the Invention Gastric ulcers represent the highest incidence of gastric lesions and are common worldwide in all species. The incidence of gastric ulcers is increasing with the development of the livestock industry, and along with a decrease in growth rate due to reduced appetite, efforts to prevent gastric lesions from an animal welfare perspective are becoming increasingly important as they address the accompanying symptoms of pain. Threonine (Thr) is the main amino acid (AA) that makes up mucin, a protective substance for the intestinal epithelium. Mucin promotes protein absorption and, at the same time, protects the digestive organs from highly acidic digestive fluids such as gastric juice, playing an important role in maintaining intestinal health. It has been reported that feed treatment with Thr improves intestinal health by aiding in mucin synthesis in piglets (non-patent document 1). The production of Thr for animal feed is carried out using a microbial fermentation method. The main classes of microorganisms used include Escherichia coli (E. coli) and Corynebacterium glutamicum (C. glutamicum), and similar strains. Although they produce the same amino acid (AA), these two strains are divided into Gram-negative and Gram-positive bacteria, respectively. The cell wall of both Gram-negative and Gram-positive bacteria is composed of peptidoglycan (PG). However, in the case of Gram-negative bacteria, in addition to PG, a lipopolysaccharide (LPS) layer is also present. This LPS layer consists of lipoprotein and protein, and a somatic antigen (O antigen) is present as lipid A, which is toxic. Therefore, in the pharmaceutical industry, it is essential to remove endogenous toxins from parenteral drugs with biological activity. IVIA / a / ZUZl / UlDDOf -2 harmful properties such as pyrogenicity, lethality, Schwartzman reactivity, adjuvant activity and macrophage activation (non-patent document 2). Recently, the production of amino acids for feed in granule form by simplifying (or omitting) the high-purification procedure due to the cost-effectiveness of feed additives inevitably mixes the bacteria used for fermentation in a heat-inactivated form into the product. Several studies have shown that heat-inactivated bacteria of the representative Gram-positive bacteria, lactic acid bacteria, are stable with respect to the environment, exhibit strong resistance to acid and heat, and are easy to handle since high concentrations are possible. They are used as food for beneficial bacteria established in the intestines, thereby strengthening the unique immune-boosting activity of lactic acid bacteria (non-patent document 3). Against this background, the present applicants have attempted to develop a pharmaceutical composition that has an effect on the prevention and treatment of a gastric disorder, and as a result, have confirmed that a composition comprising a strain of Corynebacterium sp., its cultured product and threonine is effective in the prevention, treatment and improvement of a gastric disorder, thereby completing the present application. Previous Techniques Non-Patent Documents (Non-Patent Document 1) Law G. (2000) Threonine requirement and the effect of threonine on gut mucin characteristics in piglets receiving intragastric nutrition. Master's thesis, University of Alberta. 1-143. (Non-patent document 2) Miyamoto T., Okono S. and Kasai N (2009) Inactivation of Escherichia coli endotoxin by soft hydrothermal processing. Applied and Environmental Microbiology, 75(15), 5058-5063. (Non-patent document 3) Lee IH (2018) Latest trend surrounding animal antimicrobial agents and alternatives. Pig & Consulting, 4, 70-73. Summary of the Invention Technical problem This application provides a feed composition for the prevention or improvement of a gastric disorder, comprising a strain of -3Corynebacterium sp., its cultured product and threonine. The present application provides a pharmaceutical composition for the prevention or treatment of a gastric disorder, comprising a strain of Corynebacterium sp., its cultured product, and threonine. The present application provides a food composition for the prevention or improvement of a gastric disorder, comprising a strain of Corynebacterium sp., its cultured product and threonine. The present application provides an antimicrobial composition against Helicobacter pylori, comprising a strain of Corynebacterium sp., its cultured product, and threonine. Technical Solution One aspect may provide a composition for the prevention, improvement or treatment of a gastric disorder, comprising a strain of Corynebacterium sp., its cultured product and threonine. In this application, "prevention" may mean all actions that inhibit or delay the onset of a disease by administering the composition according to an example, and "treatment" may mean all actions in which the symptoms of subjects suspected of having and experiencing a disease are improved or beneficially changed by administering the composition according to an example, and "improvement" may mean all actions that at least reduce parameters related to the condition in which the disease is treated, for example, the severity of symptoms, by administering the composition according to an example. "Disease" may mean a gastric disorder. One aspect may provide a feed composition for the prevention or improvement of a gastric disorder, comprising a strain of Corynebacterium sp., its cultured product and threonine. In the present application, strain of Corynebacterium sp. (Coryne sp.) may comprise all strains of Corynebacterium sp. The strain of Corynebacterium sp. may be, for example, Corynebacterium glutamicum, Corynebacterium ammoniagenes, Corynebacterium crudílactis, Corynebacterium deserti, Corynebacterium efficiens, Corynebacterium callunae, Corynebacterium stationis, Corynebacterium singuiare, Corynebacterium halotolerans, Corynebacterium striatum, Corynebacterium pollutísoli, Corynebacterium imitans, Corynebacterium testudinoris and / or -4 Corynebacterium flavescens, and more specifically, it can be Corynebacterium glutandcum, Corynebacterium ammoniagenes or a combination of the same (Corynebacterium glutandcum and Corynebacterium ammoniagenes). For example, a strain of Corynebacterium sp. may have threonine productivity. In the present application, having threonine productivity means demonstrating the ability to produce and accumulate threonine in the microorganism and / or the medium when the microorganism is cultured in a medium. When the composition for the prevention, improvement or treatment of a gastric disorder according to an example comprises Corynebacterium glutandcum, (i) a preventive, improvement or treatment effect of a gastric disorder and / or (ii) an anti-Helicobacter pylori efficacy may be excellent compared to a composition comprising any other class of Corynebacterium sp. strains other than Corynebacterium glutandcum (e.g., Corynebacterium efficiens). When the composition for the prevention, improvement, or treatment of a gastric disorder, according to an example, comprises Corynebacterium ammoniagenes, (i) a preventive, improvement, or treatment effect on a gastric disorder and / or (ii) an anti-Helicobacter pylori efficacy may be superior to a composition comprising any other class of Corynebacterium sp. strains other than Corynebacterium ammoniagenes (e.g., Corynebacterium efficiens). When the composition for the prevention, improvement or treatment of a gastric disorder according to an example comprises Corynebacterium glutamicum and Corynebacterium ammoniagenes, (i) a preventive, improvement or treatment effect of a gastric disorder and / or (ii) an anti-Helicobacter pylori efficacy may be excellent(s) with respect to a composition comprising any other class of Corynebacterium sp. strains other than Corynebacterium glutamicum and Corynebacterium ammoniagenes (e.g., Corynebacterium efficiens). In one example, the excellent anti-Helicobacter pylori efficacy of the composition may mean that the antimicrobial activity against the Helicobacter pylori strain is excellent or that the activity in preventing apoptosis of cells (e.g., gastric mucosa cells) infected by Helicobacter pylori is excellent. The Corynebacterium sp. strain may refer to a concentrated microbial cell culture from which a culture medium is removed, and which can be passed through a centrifugation and / or filtration procedure to recover only the concentrated microbial cells from the -5 cultivated product. In one example, the Corynebacterium sp. strain may be comprised in the form of heat-inactivated bacteria. In this application, "heat-inactivated bacteria" is the opposite of "viable bacteria," meaning a form in which bacterial growth is prevented by the heat treatment of viable bacteria and metabolites obtained through fermentation, and the like. The heat-inactivated bacteria may comprise antimicrobial substances such as cytoplasm, cell wall, bacteriocin, and the like, polysaccharides and / or organic acids, and the like. The composition comprising a heat-inactivated bacterium according to an example may have at least one feature selected from the group consisting of the following points (1) to (6) with respect to the composition comprising a viable cell. (1) Excellent acid resistance; (2) Excellent heat resistance; (2) Possibility of concentration to a high concentration; (4) Excellent stability; (5) Easy handling and storage; and (6) Possibility of being used as a food source for beneficial intestinal bacteria. The Corynebacterium sp. strain can be inactivated by Tyndall and / or thermal treatment. For example, the cultured solution that sterilizes the Corynebacterium sp. strain and its cultured product comprises a thermally inactivated bacterium of the strain. For example, the thermal treatment can be carried out at a temperature of 60 to 130°C for 3 to 30 minutes. Additionally, the thermal treatment can be carried out by ultra-high temperature sterilization, autoclave sterilization, and / or hot air drying one to ten times.Ultra-high temperature sterilization can be carried out at a temperature of 110°C to 130°C for 3.0 to 10.0 seconds, and for example, it can be carried out at 100°C for 1.0 to 10 seconds twice, and at 121°C for 1.0 to 10.0 seconds once, and autoclave sterilization can be carried out at 120 to 125°C, or at 121°C for 10 to 30 minutes, 15 to 25 minutes, or 20 minutes, and hot air drying can be carried out at a temperature of 60 to 70°C. In one specific example, it was confirmed that the composition comprising a heat-inactivated bacterium of the Corynebacterium sp. strain, a cultured product of -6The Corynebacterium sp. strain and threonine have (i) a preventive or treatment effect on a gastric disorder and / or (ii) excellent anti-Helicobacter pylori efficacy in vatro and / or in vivo. The composition, according to an example, may comprise the Corynebacterium sp. strain (or heat-inactivated bacteria of the strain) at an OD concentration of 20 to 40 (wavelength of 560 to 565 nm), OD of 25 to 35 (wavelength of 560 to 565 nm) or OD of 30 (wavelength 560 to 565 nm). The composition, for example, may comprise from 1 to 100 g / 1, from 5 to 100 g / 1, from 10 to 100 g / 1, from 15 to 100 g / 1, from 20 to 100 g / 1, from 21 to 100 g / 1, from 1 to 80 g / 1, from 5 to 80 g / 1, from 10 to 80 g / 1, from 15 to 80 g / 1, from 20 to 80 g / 1, from 21 to 80 g / 1, from 1 to 60 g / 1, from 5 to 60 g / 1, from 10 to 60 g / 1, from 15 to 60 g / 1, from 20 to 60 g / 1, from 21 to 60 g / 1, from 1 to 50 g / 1, from 5 to 50 g / 1, from 10 to 50 g / 1, 15 to 50 g / 1, 20 g / 1, 21 to 50 g / 1, 1 to 30 g / 1, 5 to 30 g / 1, 10 to 30 g / 1, 15 to 30 g / 1, 20 to 30 g / 1, 21 to 30 g / 1, 1 to 25 g / 1, 5 to 25 g / 1, 10 to 25 g / 1, 15 to 25 g / 1, 20 to 25 g / 1 or 21 to 25 g / 1 of the Corynebacterium sp. strain. (or heat-inactivated bacteria of the strain) at an OD concentration of 20 to 40 (wavelength of 560 to 565 nm), OD of 25 to 35 (wavelength of 560 to 565 nm) or OD of 30 (wavelength of 560 to 565 nm). The composition, for example, may include the strain of Corynebacterium, sp. (or heat-inactivated bacteria of the strain) at a concentration of 1 to 100 g / 1, 5 to 100 g / 1, 10 to 100 g / 1, 15 to 100 g / 1, 20 to 100 g / 1, 21 to 100 g / 1, 1 to 80 g / 1, 5 to 80 g / 1, 10 to 80 g / 1, 15 to 80 g / 1, 20 to 80 g / 1, 21 to 80 g / 1, 1 to 60 g / 1, 5 to 60 g / 1, 10 to 60 g / 1, 15 to 60 g / 1, 20 to 60 g / 1, 21 to 60 g / 1, 1 to 50 g / 1, 5 to 50 g / 1, 10 to 50 g / 1, 15 to 50 g / 1, 20 to 50 g / 1, 21 to 50 g / 1, 1 to 30 g / 1, 5 to 30 g / 1, 10 to 30 g / 1, 15 to 30 g / 1, 20 to 30 g / 1, 21 to 30 g / 1, 1 to 25 g / 1, 5 to 25 g / 1, to 25 g / 1, 15 to 25 g / 1, 20 to 25 g / 1 or 21 to 25 g / 1. The composition, for example, may include the strain of Corynebacterium sp. (or heat-inactivated bacteria of the strain) in an amount of 0.1 to 10% by weight, 0.1 to 8% by weight, 0.1 to 5% by weight, 0.1 to 4% by weight, 0.1 to 3.5% by weight, 0.1 to 3% by weight, 0.1 to 1% by weight, 1 to 10% by weight, 1 to 8% by weight, 1 to 5% by weight, 1 to 4% by weight, 1 to 3.5% by weight, 1 to 3% by weight, 2 to 10% by weight, 2 to 8% by weight, 2 to 5% by weight, 2 to 4% by weight, 2 to 3.5% by weight, 2 to 3% by weight, 3 to 10% by weight, 3 to 8% in weight, from 3 to 5% by weight, from 3 to 4% by weight, from iviA / a / zuzi / uiooo / to 3.5% by weight, from 3.5 to 10% by weight, from 3.5 to 8% by weight, from 3.5 to 5% by weight or from 3.5 to 4% by weight. In one example, the Corynebacterium sp. strain may be included in the cultured product of the strain. The cultured product means products obtained after cultivating the Corynebacterium sp. strain, and may include fermented products. For example, the cultured product may be fermented products in which the Corynebacterium sp. strain is cultivated in a medium. Fermented products mean products of enzymatic or metabolic decomposition of organic substances using a microorganism. In this application, fermentation may mean all activities or processes that include enzymatic or metabolic decomposition of organic substances using a microorganism, except for the spoilage reaction. The cultured product (or fermented product) may be the total cultured product of the Corynebacterium sp. strain, its dilute solution, concentrate, dry matter, lyophilized product, used and / or fraction, and the like; the concentrate may be obtained by centrifuging or evaporating the cultured product, and the dry matter may be obtained by drying the cultured product using a dryer, and the like; the lyophilized product may be obtained by lyophilizing the cultured product using a freeze dryer, and the like; the used product may be obtained by physically or ultrasonically treating the strain or cultured product; and the fraction may be obtained by applying the cultured product, lysate, and the like to the centrifugation, chromatography, and similar methods. The cultured product or fermented product may be in solid phase (solid, for example, dry matter), liquid phase (liquid) or fluidized bed, but is not limited to these. In one example, the cultured product may mean all media comprising a cultured strain, its metabolite and / or residual nutrient, and the like, obtained by cultivating the Corynebacterium sp. strain for a specified period In one example, the cultured product may mean components other than the strain (microbial cell) and / or threonine in the fermented product in which the Corynebacterium sp. strain is cultured in a medium. In one example, the cultivated product may be one in which the Corynebacterium sp. strain is either removed or not removed. In one example, the cultured product can be a cultured solution (or IVIA / a / ZUZ l / UI 030 / -8cultured product) in which the strain is removed from the cultured solution in which the Corynebacterium sp. strain is grown in a medium. The cultured solution (or cultured product) in which the strain is removed may be a cell-free cultured solution (or cultured product) or a cultured solution comprising a heat-inactivated bacterium, and for example, may be a filtrate in which the strain is removed by centrifugation (centrifuged supernatant) and filtration and / or a cultured solution (or dry matter of the cultured solution) comprising a heat-inactivated bacterium. The composition, according to an example, may comprise the cultured product (or fermented product) in an amount of 1 to 80% by weight, 5 to 80% by weight, 10 to 80% by weight, 15 to 80% by weight, 20 to 80% by weight, 23 to 80% by weight, 25 to 80% by weight, 1 to 60% by weight, 5 to 60% by weight, 10 to 60% by weight, 15 to 60% by weight, 20 to 60% by weight, 23 to 60% by weight, 25 to 60% by weight, 1 to 50% by weight, 5 to 50% by weight, 10 to 50% by weight, 15 to 50% by weight, 20 to 50% by weight, 23 50% by weight, 25-50% by weight, 1-40% by weight, 5-40% by weight, 10-40% by weight, 15-40% by weight, 20-40% by weight, 23-40% by weight, 25-40% by weight, 1-30% by weight, 5-30% by weight, 10-30% by weight, 15-30% by weight, 20-30% by weight, 23-30% by weight, 25-30% by weight, 1-25% by weight, 5-25% by weight, 10-25% by weight, 15-25% by weight20 to 25% by weight or 23 to 25% by weight. For example, the composition comprising the product cultivated within the above range may have (i) excellent preventive or treatment effects for a gastric disorder and / or (ii) excellent anti-Helicobacter pylori efficacy compared to the composition comprising the product cultivated with a content outside the above range. The cultivated product may comprise the Corynebacterium sp. strain, and may comprise the Corynebacterium sp. strain. in the cultivated product with a content of 0.1 to 10% by weight, 0.1 to 8% by weight, 0.1 to 5% by weight, 0.1 to 4% by weight, 0.1 to 3.5% by weight, 0.1 to 3% by weight, 0.1 to 1% by weight, 1 to 10% by weight, 1 to 8% by weight, 1 to 5% by weight, 1 to 4% by weight, 1 to 3.5% by weight, 1 to 3% by weight, 2 to 10% by weight, 2 to 8% by weight, 2 to 5% by weight, 2 to 4% by weight, 2 to 3.5% by weight, 2 to 3% by weight, 3 to 10% by weight, 3 to 8% by weight, 3 to 5% by weight, 3 to 4% by weight, 3 to 3.5% by weight, 3.5 to 10% by weight, of MA / a / x'Uí'l / UlDDOf 3.5 to 8% by weight, 3.5 to 5% by weight or 3.5 to 4% by weight. In one example, the Corynebacterium sp. strain and its cultured product may be a cultured product comprising a heat-inactivated bacterium of the Corynebacterium sp. strain obtained by heat treatment (or sterilization (e.g., autoclave sterilization or hot air drying)) the cultured product prepared by cultivating the Corynebacterium sp. strain in a medium for a certain period. In this application, "culture" means a series of actions for the growth and development of a microorganism under an artificially and appropriately adjusted environmental condition. The culture may use any culture condition and culture method known in the art. For example, the culture may be carried out continuously using a batch culture method, a continuous culture method, a semi-continuous culture method, a batch procedure, or a known semi-continuous or repeated semi-continuous procedure. The culture condition may then be adjusted to an appropriate pH (e.g., pH 5 to 9, pH 6 to 8, or pH 6.8) using, but not limited to, a basic compound (e.g., sodium hydroxide, potassium hydroxide, or ammonia) or an acidic compound (e.g., phosphoric acid or sulfuric acid).In one example, bubble formation can be inhibited by using an antifoaming agent such as fatty acid polyglycol ester and / or an aerobic condition can be maintained by introducing oxygen or an oxygen-containing gas mixture into the cultured product. In one example, the culture temperature could be 20 to 45°C, 25 to 40°C, 30 to 40°C, 30 to 35°C, or 35 to 40°C, and the culture speed could be 100 to 500 rpm, 150 to 300 rpm, 150 to 250 rpm, or 200 rpm. The culture time (period) could be 1 to 160 hours, 10 to 100 hours, 12 to 72 hours, 24 to 72 hours, 30 to 60 hours, 40 to 50 hours, 45 to 50 hours, or 48 hours. The culture period can be continued until a beneficial substance (e.g., L-threonine, threonine) is obtained at the desired yield. In one example, the cultivation can be carried out at the cultivation temperature in the previous interval for the cultivation time in the previous interval. A culture medium must meet the specific requirements of a particular strain appropriately, and those skilled in the technique can use it correctly based on its known contents. For example, for a culture medium for the Corynebacterium sp. strain, reference can be made to bibliographies. MA / a / x'Uí'l / UlDDOf - 10 known ones (for example, Manual of Methods for General Bacteriology. American Society for Bacteriology. Washington DC, USA, 1981), but not limited to them. To cultivate a specific strain of Corynebacterium sp., the survival requirements of that strain can be met by appropriately adjusting the temperature, pH, and other parameters under anaerobic conditions in a standard medium containing suitable carbon sources, nitrogen sources, amino acids, vitamins, and other relevant nutrients. The following may be used as carbon sources in the medium, either separately or in combination: saccharides and carbohydrates (e.g., glucose, sucrose, lactose, fructose, maltose, molasses, starch, and cellulose), oils and fats (e.g., soybean oil, sunflower seed oil, peanut oil, and coconut oil), fatty acids (e.g., palmitic acid, stearic acid, and linoleic acid), alcohols (e.g., glycerol and ethanol), and organic acids (e.g., acetic acid), and other similar substances, but are not limited to these.As a nitrogen source, an organic nitrogen-containing compound (e.g., peptone, yeast extract, meat juice, malt extract, corn fermentation liquor, soybean meal, and urea) or an inorganic compound (e.g., ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate, and ammonium nitrate), and similar substances, may be used separately or in combination, but are not limited to them. As a phosphate source, potassium dihydrogen phosphate, dipotassium hydrogen phosphate, the corresponding nitrogen-containing salt, and similar substances, but are not limited to them, may be used separately or in combination. In addition, the culture medium may contain other metallic salts (e.g., magnesium sulfate or ferrous sulfate) required for growth and / or comprise substances essential for growth such as amino acids and vitamins, but are not limited to them. In one example, the medium may be a medium for producing threonine (e.g., medium no. 435), and the Corynebacterium sp. strain and its cultured product may be a cultured product in which the Corynebacterium sp. strain is grown in the medium for producing threonine, and the threonine may be released into the culture medium or be contained within a cell. In one example, the Corynebacterium sp. strain and / or its cultured product (the Corynebacterium sp. strain) may comprise threonine. In one example, the strain of Corynebacterium sp. and / or its cultivated product MA / a / x'Uí'l / UlDDOf may not include threonine. In this application, threonine (Thr) is a hydroxy-α-amino acid and is one of the essential amino acids that are not produced by the body; that is, the amino acid with the chemical formula HO₂CCH(NH₂)CH(OH)CH₃. Threonine may be an L-type optical isomer (L-type threonine (L-Thr)), a D-type isomer, or a combination thereof. Threonine is an essential amino acid and is a component of mucin, a protective substance for the intestinal epithelium. Insufficient threonine can lead to growth retardation and wasting. According to one example, when the Corynebacterium sp. strain, its cultured product and / or threonine are mixed, it may show (i) a preventive or treatment effect on a gastric disorder and / or (ii) synergistically excellent anti-Helicobacter pylori efficacy. The composition, for example, may comprise threonine from 50 to 90% by weight, from 50 to 85% by weight, from 50 to 80% by weight, from 50 to 75% by weight, from 50 to 70% by weight, from 55 to 90% by weight, from 55 to 85% by weight, from 55 to 80% by weight, from 55 to 75% by weight, from 55 to 70% by weight, from 60 to 90% by weight, from 60 to 85% by weight, from 60 to 80% by weight, from 60 to 75% by weight, from 60 to 70% by weight, from 65 to 90% by weight, from 65 to 85% by weight, from 65 to 80% by weight, from 65 to 75% by weight, from 65 to 70% by weight, 70 to 90% by weight, 70 to 85% by weight, 70 to 80% by weight, 70 to 75% by weight, or 70% by weight. The composition comprising threonine in the above range may have (i) a preventive or therapeutic effect on a gastric disorder and / or (ii) excellent anti-Helicobacter pylori efficacy compared to the composition comprising threonine with a content outside the above range. Threonine may be commercially available or produced using an extraction method, a fermentation method, an enzymatic method, and / or a synthetic method, and similar methods. For example, it may be obtained by obtaining a fermented product comprising threonine using a Coryne-type strain and then purifying it, or synthesized via a threonine biosynthesis pathway, and / or chemically synthesized. Threonine may (1) be contained in the Corynebacterium sp. strain and / or its cultured product, or (2) be further contained in a form not contained in the Corynebacterium sp. strain and / or its cultured product, or (3) a combination thereof (for example, the Corynebacterium sp. strain and its cultured product contained in the composition contain threonine and, furthermore, contain - 12 additionally threonine), in the composition according to an example. The threonine included in the composition according to an example may (1) be included in the Corynebacterium sp. strain, its cultured product, or both (strain and cultured product); or (2) be added separately; or (3) be included in the Corynebacterium sp. strain, its cultured product, or both (strain and cultured product) and be added separately to them. Adding threonine separately may mean adding purified threonine in addition to the threonine contained in the strain and / or cultivated product. Threonine can be in powder and / or granular form. Granular threonine can have a particle size of 100 to 1000 µm or 200 to 1000 µm. The composition, according to an example, may comprise the Corynebacterium sp. strain from 0.1 to 5 parts by weight, the cultured product from 10 to 90 parts by weight, and threonine from 10 to 80 parts by weight. Specifically, the following may be included: strain of 0.2 to 5 parts by weight, cultured product of 12 to 88 parts by weight, and threonine of 10.5 to 78 parts by weight; strain of 0.3 to 5 parts by weight, cultured product of 13 to 87 parts by weight, and threonine of 11 to 77 parts by weight; strain of 0.4 to 5 parts by weight, cultured product of 14 to 86 parts by weight, and threonine of 11.5 to 76 parts by weight; strain of 0.5 to 5 parts by weight, cultured product of 15 to 85 parts by weight, and threonine of 12 to 75 parts by weight; strain of 0.6 to 5 parts by weight, cultured product of 16 to 84 parts by weight, and threonine of 12.5 to 74 parts by weight; strain from 0.7 to 5 parts by weight, the cultivated product from 17 to 83 parts by weight, and threonine from 13 to 73 parts by weight,the strain from 0.8 to 5 parts by weight, the cultured product from 18 to 82 parts by weight and threonine from 13.5 to 72 parts by weight, the strain from 0.9 to 5 parts by weight, the cultured product from 19 to 81 parts by weight and threonine from 14 to 71 parts by weight, the strain from 0.9 to 4 parts by weight, the cultured product from 20 to 80 parts by weight and threonine from 14 to 70 parts by weight, the strain from 1 to 4 parts by weight, the cultured product from 21 to 79 parts by weight and threonine from 14 to 69 parts by weight, or the strain from 1 to 3 parts by weight, the cultured product from 22 to 78 parts by weight and threonine from 14 to 68 parts by weight. In the composition, according to an example, the weight ratio of the strain and its cultured product and threonine (weight of the strain and its cultured product:weight of threonine) MA / a / x'Uí'l / UlOOOf - 13 can be from 1:0.1 to 1:10, from 1:0.1 to 1:5, from 1:0.1 to 1:3, from 1:0.2 to 1:10, from 1:0.2 to 1:5, from 1:0.2 to 1:3, from 1:0.5 to 1:10, from 1:0.5 to 1:5, from 1:0.5 to 1:3, from 1:1 to 1:10, from 1:1 to 1:5, from 1:1 to 1:3, from 1:3 to 1:10, from 1:3 to 1:5, or from 1:3. The composition according to an example may further comprise lignosulfonate. When the composition according to an example further comprises lignosulfonate, (i) the effect of preventing or treating a gastric disorder and / or (ii) the anti-Helicobacter pylori efficacy may be excellent. The composition, for example, may also include calcium lignosulfonate to adjust the threonine content. According to an example, the composition may comprise calcium lignosulfonate from 0.1 to 50% by weight, from 0.1 to 30% by weight, from 0.1 to 25% by weight, from 0.1 to 20% by weight, from 0.1 to 15% by weight, from 0.1 to 10% by weight, from 0.1 to 7% by weight, from 1 to 50% by weight, from 1 to 30% by weight, from 1 to 25% by weight, from 1 to 20% by weight, from 1 to 15% by weight, from 1 to 10% by weight, from 1 to 7% by weight, from 3 to 50% by weight, from 3 to 30% by weight, from 3 to 25% by weight, from 3 to 20% by weight, from 3 to 15% by weight, from 3 to 10% by weight weight, from 3 to 7% by weight, from 5 to 50% by weight, from 5 to 30% by weight, 5 from to 25% by weight, 5 to 20% by weight, 5 to 15% by weight, 5 to 10% by weight, 5 to 7% by weight, 6.5 to 50% by weight, 6.5 to 30% by weight, 6.5 to 25% by weight, 6.5 to 20% by weight, 6.5 to 15% by weight, 6.5 to 10% by weight or 6.5 to 7% by weight. In one example, the composition may comprise the Corynebacterium sp. strain and its cultured product in dried form (e.g., dried matter of 'Corynebacterium sp. strain and its cultured product'). The dried matter may be prepared by drying the Corynebacterium sp. strain and its cultured product, and the dried matter may comprise threonine. In one example, the drying may be carried out by at least one method selected from the group consisting of vacuum drying, hot air drying, freeze-drying, ambient air drying, thin-film drying, and / or vacuum drying. In one example, the composition may comprise the Corynebacterium sp. strain, its cultured product, and threonine in dry form (e.g., dry matter of 'Corynebacterium sp. strain and its cultured product' comprising threonine). The formulation of the composition, according to an example, may be in the form of an emulsion, suspension, or solution in oil or aqueous media, or in the form of an extract, powder, granule, tablet, capsule, or gel (e.g., hydrogel), and may further comprise a dispersing agent or a stabilizing agent. The composition, according to a specific example, can be prepared by drying the strain. - 14 of Corynebacterium sp. and its cultured product (fermented product), and this composition may include threonine, the Corynebacterium sp. strain (e.g., strain in a heat-inactivated bacterium), and a component of the cultured product other than threonine and strain. In one example, the composition prepared by drying the Corynebacterium sp. strain and its cultured product may be in granule form, and this may have (i) a preventive or treatment effect on a gastric disorder and / or (ii) excellent anti-Helicobacter pylori efficacy compared to purified threonine in powder form. In this application, "granule" means a state in which powder is aggregated to form a particle 30–150 times larger, and "granulation" may mean inducing a raw material to become a granule by treatment with a process, and the like. For example, in the process of drying the composition comprising the Corynebacterium sp. strain, its cultured product, and / or threonine, the composition may exhibit a granule form. For example, gastric disorder can be caused by Helicobacter pylori infection. In one example, the gastric disorder may be at least one selected from the group consisting of gastritis, gastric ulcer, duodenal ulcer, peptic ulcer, and gastric cancer. Gastritis is a condition characterized by inflammation of the stomach lining. Gastric ulcers can develop when the balance between damaging factors and protective factors in the stomach and intestines is disrupted. These factors include stomach acid, various digestive enzymes, bile, medications, alcohol, Helicobacter pylori infection, nonsteroidal anti-inflammatory drugs (NSAIDs), smoking, and similar conditions. When the composition according to an example is used as a feed composition, a feed composition may be prepared in such a form that the composition according to an example is added to a commercially available feed composition. The feed in which the composition according to an example may be used is preferably, but not limited to, a powder or microgranule formulation, or a liquid formulation. Furthermore, the added quantity of the composition of this application that is added to the feed does not require any - 15 particular limitation. In the present application, "feed" may mean any diet, food and the like, whether natural or artificial, recommended or a component of food, for animals to eat, digest or otherwise suitable for them. The type of feed is not particularly restricted, and feeds commonly used in the art may be used. A non-limiting example of feed may include feeds of plant origin such as cereals, roots, food processing by-products, algae, fiber, pharmaceutical by-products, fats and oils, starches, hulls or cereal by-products, or the like; and feeds of animal origin such as proteins, inorganic compounds, fats and oils, minerals, single-cell proteins, animal feed or plankton, or the like. They may be used alone or in combination with two or more. The subject (animal) to which the feed comprising the composition according to an example may be supplied is not particularly limited, but may be mammals, fish, crustaceans and / or mollusks, and for example, may be a pig, cow, horse, goat, deer, sheep, chicken, duck, goose, turkey, dog, cat, rabbit or fish. The press composition may further comprise an excipient, a diluent, or an additive. The feed composition may comprise an animal growth promoter, a nutrient component, a nutrient supplement, a shelf-life stability enhancer, a coating material component, an amino acid preparation for disease prevention, a vitamin preparation, an enzyme preparation, a nitrogenous compound other than protein, a silicate preparation, a buffer, an extraction solvent, a probiotic; enzymes such as amylase, lipase, and the like; vitamins such as L-ascorbic acid, choline chloride, inositol, and the like; minerals such as potassium chloride, ferrous citrate, magnesium oxide, phosphates, and the like; amino acids such as lysine, alanine, methionine, and the like;Organic acids such as fumaric acid, butyric acid, lactic acid, and the like, or salts thereof; antioxidants such as vitamin C, vitamin E, and the like; mold-inhibiting agents such as calcium propionate and the like; emulsifiers such as lecithin, glycerol fatty acid ester, and the like; and / or pigments and the like, in addition to the components. Although not described above, the feed composition according to an example may also include other nutrients within a range that can be expected. - 16 experts in the technique. Another aspect may provide a pharmaceutical composition for the prevention or treatment of a gastric disorder, comprising a strain of Corynebacterium sp., its cultured product, and threonine. The strain of Corynebacterium sp., its cultured product, threonine, and / or the gastric disorder comprising the pharmaceutical composition for prevention or treatment, as per an example, are as described for the feed composition for the prevention or improvement of a gastric disorder. The pharmaceutical composition, by way of example, may further comprise a suitable carrier, excipient, or diluent commonly used in the preparation of pharmaceutical compositions. Specifically, the pharmaceutical composition may be formulated as oral formulations such as powder, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, and the like, as well as for external applications, suppositories, and sterile solutions for injection, according to each common method. The carrier, excipient, and diluent to be included in the pharmaceutical composition may include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gum arabic, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methylcellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methyl hydroxybenzoate, propyl hydroxybenzoate, talc, magnesium stearate, and mineral oil.When formulated, it is prepared using a diluent or excipient such as a filler, extender, binder, wetting agent, disintegrant, surfactant, and the like. Solid formulations for oral administration include tablets, lozenges, powders, granules, capsules, and the like, and these solid formulations are prepared by mixing at least one excipient, for example, starch, calcium carbonate, sucrose or lactose, gelatin, and the like, with the composition. In addition to the simple excipient, a lubricant such as magnesium stearate and talc may also be included. Liquid formulations for oral administration include suspensions, oral liquids, emulsions, syrups, and the like, and in addition to commonly used simple diluents, they may include water and liquid paraffin, and various excipients, for example, wetting agents, sweeteners, flavorings, preservatives, and the like.Parenteral formulations include sterile aqueous solution, non-aqueous solvent, suspension, emulsion, freeze-dried formulation, and suppositories. Propylene glycol, polyethylene glycol, vegetable oil such as olive oil, and esters may be used as non-aqueous solvents and suspensions. - 17 Injectable such as ethyl oleate, and the like. As a base compound for suppositories, Witepsol, Macrogol, Tween 61, cocoa butter, laurinum, glycerol gelatin, and the like may be used. The pharmaceutical composition according to an example may be administered in a pharmaceutically effective amount, and in the present application, pharmaceutically effective amount means an amount sufficient to treat or prevent a disease, at a reasonable benefit / risk ratio, applicable for medical treatment or prevention, and the effective dose level may be determined by factors including severity of disease, pharmacological activity, patient's age, body weight, health, gender, patient's sensitivity to drugs, time of administration, route of administration and discharge rate of the composition of the present application used, period of treatment, drugs used in combination or concurrently with the composition of the present application used, and other factors known in the medical field.The pharmaceutical composition, as an example, can be administered as a standalone therapeutic agent or in combination with other therapeutic agents, and can be administered sequentially or simultaneously with a conventional therapeutic agent. Furthermore, it can be administered individually or in multiple doses. It is important to administer a quantity that will achieve the maximum effect in the minimum amount without side effects, considering all factors. The dosage of the pharmaceutical composition, by way of example, may be approximately 0.0001 to 100 mg / kg, specifically, 0.001 to 10 mg / kg, for a mammal per day. The frequency of administration of the pharmaceutical composition of this application may be once daily or administered in divided doses, but is not limited to these. The dosage does not limit the scope of this application in any respect. The pharmaceutical composition, as an example, is not limited in terms of the method of administration as long as it can reach the target tissue. For example, this includes intra-articular injection, oral administration, intra-arterial injection, intravenous injection, or percutaneous injection, or similar methods. Furthermore, the pharmaceutical composition can be administered using any device capable of delivering an active ingredient to a target cell. Another aspect is that it may provide a dietary composition for the prevention or improvement of a gastric disorder, comprising a strain of Corynebacterium sp., its cultured product, and threonine. The Corynebacterium strain - 18 sp., its cultivated product, threonine and / or gastric disorder included in the feed composition for the prevention or improvement of a gastric disorder are as described for the feed composition for the prevention or improvement of a gastric disorder. Food includes meat, sausage, bread, chocolate, candy, snacks, sweets, pizza, ramen, other noodles, geminola, dairy products including ice cream, various kinds of soup, beverages, tea, drinkable liquids, alcoholic beverages, vitamin complexes, functional health foods, and health foods, and the like, and includes all foods in the usual sense. Functional health food is a synonymous term for food for specific health use (FoSHU), and refers to food with significant medicinal and medical effects, processed to effectively modulate the body in addition to providing nutrition. In this document, "function" means achieving a beneficial effect for health purposes, such as adjusting nutrients or having physiological effects on the structure and function of the human body. The food described in this application may be prepared using a method commonly employed in the art, and when prepared, it may be prepared by adding a raw material and a component commonly added. Furthermore, the food formulation may be prepared without limitation, provided it is formulated in a manner permitted as food.The food composition of the present application can be prepared in various formulation forms and is different from general drugs. It has the advantage of not causing the side effects that can occur when taking drugs for a long period and has excellent portability. Therefore, the food of the present invention can be taken as a supplement to enhance the prevention or improvement of gastric ulcers. Health food refers to food that has an active health-maintaining or health-enhancing effect compared to a general food, and health supplement food refers to food intended for health supplementation purposes. In some cases, the terms functional health food, health food, and health supplement food may be used interchangeably. Specifically, a functional food for health is a food in which the composition, as an example, is added to food materials such as beverages, teas, spices, gummies, sweets, and the like, or to a prepared food such as capsules, powders, suspensions, and the like, and means that it has a certain MA / a / x'Uí'l / UlDDOf - 19 effect on health when ingested, but unlike general drugs, it has the advantage that it does not cause any side effects that can occur when taking drugs for a long period of time by using food as a raw material. It is possible that the dietary composition according to an example is ingested daily and, therefore, a great effect can be expected for the prevention or improvement of a gastric disorder, and thus it can be used very usefully. The food composition may further comprise a physiologically acceptable carrier, and the class of carrier is not particularly limited, and any carrier commonly used in the technique may be used. Furthermore, the food composition may include an additional component that can improve the odor, flavor, appearance, and similar characteristics, and which is commonly used in food composition. For example, it may include vitamins A, C, D, E, B1, B2, B6, B12, niacin, biotin, folate, pantothenic acid, and similar components. It may also include minerals such as zinc (Zn), iron (Fe), calcium (Ca), chromium (Cr), magnesium (Mg), manganese (Mn), copper (Cu), and chromium (Cr). Additionally, it may include amino acids such as fructose, tryptophan, cysteine, valine, and similar components. In addition, the food composition may include food additives such as preservatives (potassium sorbate, sodium benzoate, salicylic acid, sodium dehydroacetic acid, etc.), disinfectants (bleaching powder and superior bleaching powder, sodium hypochlorite, etc.), antioxidants (butylhydroxyanisole (BHA), butylhydroxytoluene (BHT), etc.), coloring agents (tar color, etc.), coloring agents (sodium nitrite, sodium nitrous acid, etc.), bleaching agents (sodium sulfite), flavorings (sodium glutamate, MSG, etc.), sweeteners (dulcin, cyclamate, saccharin, sodium, etc.), flavoring agents (vanillin, lactones, etc.), expanding agents (alum, potassium D-bitartrate, etc.), reinforcing agents, emulsifiers, thickeners (paste), coating agents, gum bases, foam inhibitors, solvents, improvers, and the like. Additives can be selected depending on the type of food and used in an appropriate amount. The composition, as per the example, can be added on its own or used with other food or food components, and can be used appropriately according to the usual method. The amount of the active ingredient in the mixture can be determined appropriately depending on the intended use (prevention, health, or (Therapeutic treatment). In general, when preparing a food or beverage, the food composition of this application may be added in an amount of 50 parts by weight or less, specifically 20 parts by weight or less, based on the food or beverage. However, when taken for health and hygiene purposes over a long period, a content lower than the above range may be used, and since there are no safety concerns, the active ingredient may be used in an amount higher than the above range. As an example of a food composition, it can be used as a healthy beverage composition, and in this case, as with a regular beverage, it may contain additional components such as various flavoring agents or a natural carbohydrate, or similar. The aforementioned natural carbohydrate may be monosaccharides such as glucose and fructose; disaccharides such as maltose and sucrose; polysaccharides such as dextrin and cyclodextrin; sugar alcohols such as xylitol, sorbitol, erythritol, and similar. As a sweetener, natural sweeteners such as stevia extract and thaumatin; synthetic sweeteners such as saccharin and aspartame, and similar products may be used. The ratio of natural carbohydrate may generally be approximately 0.01 to 0.04 g, specifically, approximately 0.02 to 0.03 g, per 100 ml of the healthy beverage composition of this application. Furthermore, the composition of the health beverage may contain various nutrients, vitamins, electrolytes, flavoring agents, coloring agents, pectic acid, pectic acid salts, alginate, alginate salts, organic acids, protective colloidal thickeners, pH adjusting agents, stabilizers, preservatives, glycerin, alcohol, or carbonating agents, or similar substances. Additionally, it may contain pulp for the preparation of natural fruit juice, fruit juice drinks, or plant-based beverages. These components may be used individually or in combination. The rationale for these additives is not critical, but it is common practice to select from a range of 0.01 to 0.1 parts by weight per 100 parts by weight of the health beverage composition described in this application. The dietary composition, according to an example, may be comprised of various percentages by weight, provided it can demonstrate a preventive or improving effect on a gastric disorder; but, for example, the composition, according to an example, may be comprised of an amount from 0.00001 to 100% by weight, from 0.01 to 80% by weight MA / a / x'Uí'l / UlDDOf -21 weight or from 10 to 50% by weight based on the total weight of the food composition. The composition comprising the Corynebacterium sp. strain, its cultured product, and threonine, according to one example, can prevent, treat, or improve a gastric disorder (e.g., gastric ulcer) by inhibiting the proliferation of Helicobacter pylori (H. pylori) and inhibiting Helicobacter pylori-induced inflammation, oxidative stress, vascular growth, and / or apoptosis. The composition comprising the Corynebacterium sp. strain, its cultured product, and threonine, according to one example, can prevent, treat, or improve a gastric disorder by promoting mucus synthesis and release, promoting tissue regeneration, inhibiting damage to the gastric mucosa, inhibiting oxidative stress, inhibiting apoptosis of gastric mucosal cells, and / or inhibiting inflammation. In the composition according to an example, it is confirmed that there is a difference in (i) the effect of preventing or treating a gastric disorder and / or (ii) the anti-Helicobacter pylori efficacy, depending on whether the Corynebacterium sp. strain is contained or not; whether the Corynebacterium sp. strain is comprised as a heat-inactivated bacterium; the class of the Corynebacterium sp. strain; the presence or absence of the cultured product; the presence or absence of threonine; and / or the combination of the Corynebacterium sp. strain, its cultured product and threonine, and it is confirmed that the composition according to an example presents the most excellent. Another aspect may provide a method for the prevention, improvement, or treatment of a gastric disorder, which involves administering the composition (feed composition, food composition, or pharmaceutical composition) for the prevention, improvement, or treatment of a gastric disorder to a subject (patient). The feed composition, food composition, pharmaceutical composition, and the gastric disorder are described as above. According to one example, the method for the prevention, improvement, or treatment of a gastric disorder may further include confirming (selecting) a subject (patient) who requires the prevention, improvement, or treatment of a gastric disorder, prior to administration. In this application, subject may mean all animals, including humans, that suffer from or are at risk of developing a gastric disorder. IVIA / a / ZUZ l / UI 030 / -22E1 The target subject to which the method is applied for the prevention or treatment of a gastric disorder may be a mammal, including humans, who suffer from or are at risk of developing a gastric disorder, and, for example, may be a pig, cow, horse, goat, reindeer, sheep, chicken, duck, goose, turkey, dog, cat, and / or. In this application, administration means introducing the composition for the prevention, improvement, or treatment of a gastric disorder to a target subject by any appropriate method, and as a route of administration, it may be administered through various oral or parenteral routes (e.g., intravenous, subcutaneous, intramuscular, intraperitoneal, or local application) that can reach the target tissue. The method for prevention, improvement, or treatment may administer the feed composition, food composition, or pharmaceutical composition, as an example, in a (pharmaceutically) effective dose. The appropriate total daily use amount may be determined by treatment within the correct medical determination interval and may be administered once or several times.However, the specific therapeutic effective dose for a specific subject (patient) may be applied differently depending on various factors including a specific composition, the subject's (patient's) age, body weight, general health status, gender and diet, the time of administration, the route of administration and the secretion rate of the composition, the treatment period and drugs to be used with the specific composition or used concurrently, and similar factors well known in the pharmaceutical field, in addition to the class and degree of reaction to be achieved, and in some cases whether other agents are used. Another aspect may provide an antimicrobial composition against Helicobacter pylori, comprising a strain of Corynebacterium sp., its cultured product, and threonine. The Corynebacterium sp. strain, its cultured product, threonine, and / or the gastric disorder comprising the antimicrobial composition against Helicobacter pylori are described for the pharmaceutical composition for the prevention or treatment of a gastric disorder. When the Corynebacterium sp. strain, its cultured product, and threonine are combined, as in one example, the antimicrobial effect against Helicobacter pylori can be synergistically excellent. Another aspect may provide a composition for prevention, improvement, or -23The treatment of a gastric disorder, comprising a strain of Corynebacterium, sp. and its cultured product, and the strain and its cultured product may comprise threonine. Another aspect may provide a composition for preparing an active ingredient for the prevention, improvement or treatment of a gastric disorder comprising a strain of Corynebacterium sp. and its cultured product (fermented product), and the strain of Corynebacterium sp. or its cultured product (fermented product) may comprise or contain threonine. The composition for preparing an active ingredient for the prevention, improvement, or treatment of a gastric disorder may comprise the Corynebacterium sp. strain from 0.1 to 5 parts by weight, the fermented product from 10 to 90 parts by weight, and threonine from 10 to 80 parts by weight, based on the total composition. Specifically, it may comprise the strain from 0.2 to 5 parts by weight, the fermented product from 12 to 88 parts by weight and threonine from 10.5 to 78 parts by weight, the strain from 0.3 to 5 parts by weight, the fermented product from 13 to 87 parts by weight and threonine from 11 to 77 parts by weight, the strain from 0.4 to 5 parts by weight, the fermented product from 14 to 86 parts by weight and threonine from 11.5 to 76 parts by weight, the strain from 0.5 to 5 parts by weight, the fermented product from 15 to 85 parts by weight and threonine from 12 to 75 parts by weight, the strain from 0.6 to 5 parts by weight, the fermented product from 16 to 84 parts by weight and threonine from 12.5 to 74 parts by weight, the strain of 0,7 to 5 parts by weight, the fermented product from 17 to 83 parts by weight and threonine from 13 to 73 parts by weight, the strain from 0.8 to 5 parts by weight, the fermented product from 18 to 82 parts by weight and threonine from 13.5 to 72 parts by weight, the strain from 0.9 to 5 parts by weight, the fermented product from 19 to 81 parts by weight and threonine from 14 to 71 parts by weight, the strain from 0.9 to 4 parts by weight, the fermented product from 20 to 80 parts by weight and threonine from 14 to 70 parts by weight, the strain from 1 to 4 parts by weight, the fermented product from 21 to 79 parts by weight and threonine from 14 to 69 parts by weight, the strain from 1 to 3 parts by weight, the fermented product from 22 to 78 parts by weight and threonine from 14 to 68 parts by weight, based on, but not limited to, the total composition. The composition for preparing an active ingredient for the prevention or treatment of a gastric disorder may further comprise calcium lignosulfonate, to adjust the threonine content. The calcium lignosulfonate may be present in an amount of 0.1 to 50% by weight, or 0.1 to 30% by weight. -24 from 0.1 to 25% by weight, from 0.1 to 20% by weight, from 0.1 to 15% by weight, from 0.1 to 10% by weight, from 0.1 to 7% by weight, from 1 to 50% by weight, from 1 to 30% by weight, from 1 to 25% by weight, from 1 to 20% by weight, from 1 to 15% by weight, from 1 to 10% by weight, from 1 to 7% by weight, from 3 to 50% by weight, from 3 to 30% by weight, from 3 to 25% by weight, from 3 to 20% by weight, from 3 to 15% by weight, from 3 to 10% by weight, from 3 to 7% by weight, from 5 to 50% by weight, from 5 to 30% by weight, from 5 to 25% by weight, 5 to 20% by weight, 5 to 15% by weight, 5 to 10% by weight, 5 to 7% by weight, 6.5 to 50% by weight, 6.5 to 30% by weight, 6.5 to 25% by weight, 6.5 to 20% by weight, 6.5 to 15% by weight, 6.5 to 10% by weight, 6.5 to 7% by weight, 0.1 to 18% by weight, 0.1 to 16% by weight, 0.1 to 14% by weight, 0.1 to 13% by weight, 0.1 to 12% by weight, 0.1 to 11% by weight, 0.1 to 9% by weight, 0.1 to 8% by weight or 0.1 to 7% by weight,based on, but not limited to, the total weight of the composition, and may be added without limitation so that the threonine in the composition reaches the desired content. Another aspect may provide a pharmaceutical composition for the prevention or treatment of a gastric disorder comprising the composition to prepare an active ingredient for the prevention or treatment of a gastric disorder. Another aspect may provide a food composition for the prevention or improvement of a gastric disorder comprising the composition to prepare an active ingredient for the prevention or treatment of a gastric disorder. Another aspect may provide a feed composition for the prevention or improvement of a gastric disorder comprising the composition to prepare an active ingredient for the prevention or treatment of a gastric disorder. Another aspect provides the formulation to treat a gastric disorder comprising the granular composition to prepare an active ingredient for the prevention or treatment of a gastric disorder comprising the Corynebacterium sp. strain and its cultured product (fermented product) as the active ingredient. The strain of Corynebacterium sp. and its fermented product, the gastric disorder, prevention, improvement and treatment are as described above. In this application, formulation refers to processing to be -25 Suitable for preparation, preservation or use, and sufficiently showing a therapeutic effect, by mainly physical operations, for example, pulverization, mixing, kneading, leaching (distillation) or evaporation, or similar, without changing the nature of the drugs, and furthermore, products made in this way are also called medicinal preparations (Chemistry Unabridged Dictionary, 2001. 5. 20., Sehwa editorial department). The additives used when formulating to prepare the formulation, i.e., the filler, extender, binder, wetting agent, disintegrating agent, diluent or excipient, are as described above, and the solid formulations for oral administration and the additives included therein, the liquid formulations for oral administration and the additives included therein or the formulations for parenteral administration and the additives added thereto are as described above. The formulation may be a solid formulation, a liquid formulation, and a fluidized bed formulation, but is not limited to these, and any formulation that shows the effect of preventing, treating, and improving gastric ulcers may be applied without limitation. The formulations are as described above. Another aspect may provide a method for preparing an active ingredient that has (1) a preventive, improving, or treating effect on a gastric disorder; and / or (2) an antimicrobial effect against Helicobacter pylori, comprising drying the Corynebacterium sp. strain and its cultured product. The Corynebacterium sp. strain and its cultured product are as described above. In one example, drying can be carried out by at least one method selected from the group consisting of vacuum drying, hot air drying, freeze-drying, ambient air drying, thin film drying and / or vacuum drying. In one example, drying can dry a composition in which threonine is added separately to the Corynebacterium sp. strain and its cultured product. In one example, the method for preparing an active ingredient may further comprise adding threonine separately to the prepared dry matter after drying. Advantageous Effects -26It is confirmed that the composition according to the present application is excellent in terms of anti-Helicobacter pylori efficacy in the cell experiment, and efficacy in improving a gastric ulcer, efficacy in gastric mucosa synthesis and the like in the animal experiment, and can therefore be applied as a pharmaceutical composition for the prevention or treatment of a gastric disorder, or as a food composition or feed composition for the prevention or improvement of a gastric disorder. IVIA / a / ZUZl / UlDDOf Brief Description of the Figures of the Invention Figure 1 shows the antimicrobial activity against H. pylori of groups 1 to 8. Figures 2a through 2c show the results of measuring the expression of inflammatory mediators when RGM1 cells infected with 100 MOIs were treated with groups 1 to 8 for 6 hours using the H. pylori strain. Specifically, Figure 2a shows the change in Cox-2 mRNA expression according to the treatment of groups 1 to 8 in RGM1 cells infected with the H. pylori strain, Figure 2b shows the change in INOS protein expression according to the treatment of groups 1 to 8 in RGM1 cells infected with the H. pylori strain, and Figure 2c shows the change in phosphorylated NF-κB p65 protein expression according to the treatment of groups 1 to 8 in RGM1 cells infected with the H. pylori strain. GAPDH and β-actin are used as internal mRNA and protein controls, respectively. In Figure 2a to Figure 6b, N (first lane from the left) represents the negative control group (untreated RGM1 cell with H. pylori), and Hp (second lane from the left) represents the positive control group (RGM1 cell infected with H. pylori), and groups 1 to 8 represent the outcome in the cell in which the RGM1 cell infected with H. pylori is treated with the composition of groups 1 to 8. Figure 3a shows the change in expression of the oxidative stress-related protein (HIF-α) according to treatment groups 1 to 8 in the RGM1 cell infected with H. pylori. β-actin is used as an internal control group. Figure 3b shows the result of measuring the change in intracellular active oxygen concentration according to treatment groups 1 to 8 in the RGM1 cell infected with H. pylori (result of increased and decreased DCF). Figure 4a shows the change in HO-1 mRNA expression according to the Figure 4b shows the change in GST(pi) and HO-1 protein expression according to the treatment of groups 1 to 8 in the RGM1 cell infected with H. pylori. GAPDH and β-actin are used as an internal control group. Figure 5 shows the effectiveness of apoptosis inhibition according to the treatment of groups 1 to 8 in the RGM1 cell infected with H. pylori. Specifically, Figure 5a shows the change in protein expression of Bax and Bcl-2 according to the treatment of groups 1 to 8 in the H-infected RGM1 cell. pylori, and β-actin is used as an internal control group. Figure 5b shows the change in apoptosis (TUNEL staining result) according to the treatment of groups 1 to 8 in the RGM1 cell infected with H. pylori. Figure 6 shows the changes in mucosal proliferation and angiogenesis growth factors following treatment groups 1 to 8 in H. pylori-infected RGM1 cells. Figure 6a shows the changes in TGF-β and VEGF protein expression following treatment groups 1 to 8 in H. pylori-infected RGM1 cells, with β-actin used as an internal control. Figure 6b shows the changes in β-catenin protein expression following treatment groups 1 to 8 in H. pylori-infected RGM1 cells, with Lamin B used as an internal control. In Figures 7a to 10, groups 1-4 signify experimental animal groups 1-4 from Table 5. Figure 7 shows the efficacy of SRMD (stress-related mucosal disease) improvement by administering the composition as per an example in the WIRS animal model experimental group. Specifically, Figure 7a shows pathological photographs of the stomach from each experimental group, with the photographs in the two rows on the right indicated at 40x magnification. Figure 7b shows (A) macroscopic injury index (top left graph), (B) inflammation; pathological score (top right graph), (C) ulcer / erosion; pathological score (bottom left graph), (D) regeneration; pathological score (bottom right graph), by administering the composition as per an example in the WIRS animal model experimental group. Figure 8 shows the change in inflammation, angiogenesis, and signaling following administration of the compound, as exemplified in the WIRS experimental animal model group. (A) Figure 8a shows the change in MA / a / x'Uí'l / UlOOOf Figure 8b shows the change in mRNA expression of iNOS, TNF-α and IFN-γ in experimental animal groups 1-4, and Figure 8c shows the change in ρ-IκΒα protein expression in experimental animal groups 1-4, and Figure 8d shows the change in p-ERK and p-JNK protein expression in experimental animal groups 1-4. GAPDH and β-actin are used as internal control groups for mRNA and protein, respectively. Figure 9 shows the results of the cell cycle changes following administration of the compound, as described in an example from the WIRS animal model experimental group. Specifically, Figure 9a shows the TUNEL analysis results for the level of apoptosis in the SRMD-enhanced region of the gastric mucosa in animal experimental groups 1-4. Figure 9b shows the changes in protein expression of PARP-1, Bcl-2, Bax, cleaved caspase-8, and cleaved caspase-3, and Figure 9c shows the changes in protein expression of CDK4 and cyclin DI. β-Actin is used as an internal control group. Figure 10 shows the mucin content in the stomach tissue of experimental animal groups 1-4. Figure 11 shows pathological photographs of the stomachs of rats with WIRS in which samples comprising threonine of varying weight percentages were administered. The composition and content of samples 1 to 5 in Figure 11 are given in Table 4. Detailed Description of the Invention The following documents describe the application in detail with examples to aid understanding. However, the following examples illustrate the content of this application, and its scope is not limited to them. The examples provided are intended to provide a more complete description of the application to those skilled in the art. Example 1. Composition containing a strain of Corynebacterium sp. and infection of cells Example 1-1. Preparation of composition containing a strain of Corynebacterium sp. -29To verify the difference in anti-Helicobacter pylori efficacy, apoptosis inhibition and cell protection of the strain composition containing a Corynebacterium sp. strain, and the efficacy between Corynebacterium sp. strains, compositions from group 1 to group 8 were prepared. Wild-type strains of Corynebacterium glutamicum (C. glutamicum), Corynebacterium ammoniagenes (C. ammoniagenes), and Corynebacterium efficiens (C. efficiens) were provided by the CJ CheilJedang BIO R&D Center (Blossom Park) and used. The strains were inoculated into threonine production broth and cultured at 35°C for 48 hours at 200 rpm. The components and contents of the threonine production broth are disclosed in Table 1 below. [Table 1] Component Concentration (per liter) Glucose 70 g KH2PO4 1 g (NH4) 2SO4 30 g MgSO4 -7H2O 1 g FeSO4 -7H2O 200 mg MnSO4 -4H2O 100 mg Biotin 1 mg Yeast extract 2.5 g Calcium pantothenic acid 1 mg Thiamine hydrochloride 1 mg Calcium carbonate 30 g pH 6.8 Group 1 comprises fermented broth supernatant in which a microbial cell has been removed by centrifuging the fermented broth prepared by cultivating Corynebacterium glutamicum under the above conditions, and Group 2 is buffer (TrisHCl) comprising threonine at a concentration of 100 g / L. Groups 3 to 5 were prepared by centrifuging the fermented broth prepared by cultivating the strain under the above conditions to collect a microbial cell, and suspending the collected microbial cell in buffer (Tris-HCl). Groups 6 to 8 are fermented broth in which each strain is cultivated under the above conditions, and comprise each strain and the -30cultured product in which each strain has been cultured in the medium (referred to as 'fermented broth supernatant' in Table 2). The compositions in groups 3 to 8 comprise each strain at an OD concentration of 30 (wavelength 562 nm), and comprise the strain as thermo-inactivated bacteria via autoclave sterilization. Groups 1 to 8 all comprise threonine, and there is one group comprising threonine in each strain (comprised in the form of heat-inactivated bacteria) or cultured product, and therefore, additional threonine (threonine produced through CJ BIO strains; purity >99%) was added so that the final concentration of threonine in groups 1 to 8 was 100 g / 1 by measuring the threonine content in the strain and / or cultured product. The components of each group were disclosed in Table 2 below. In Table 2, 'fermented broth supernatant' of Group 1 and Group 6 means that one microbial cell is removed from the cultured product prepared by cultivating the 'C. glutamicum strain' under the above condition, and 'fermented broth supernatant' of Groups 7 and 8 means that one microbial cell is removed from the cultured product prepared by cultivating the 'C. ammoniagenes strain' and the 'C. efficiens strain' under the above condition. [Table 2] Group Components in the compositions Group 1 Threonine + Fermented broth supernatant Group 2 Threonine Group 3 Threonine + C. glutamicum Group 4 Threonine + C. ammoniagenes Group 5 Threonine + C. efficiens Group 6 Threonine + C. glutamicum + Fermented broth supernatant Group 7 Threonine + C. ammoniagenes + Fermented broth supernatant Group 8 Threonine + C. efficiens + Fermented broth supernatant The groups 1-8 disclosed in the following examples 2 to 7 and Figure 1 to Figure 6b signify the groups 1-8 of Table 2. Example 1-2. Culture of rat gastric mucosal cell lines The normal rat gastric mucosal cell line, RGM1 cell, was cultured in a mixed Ham F12 and DMEM (Dulbecco's modified essential medium) medium comprising 10% fetal bovine serum with a cell incubator at 37°C (95% -31% air, 5% CO2). The RGM1 cell line was established by Professor Matsui of the University of Tsukuba in Japan, and was used after receiving his consent. Example 1-3. H. pylori strain and cell infection The Helicobacter pylori (H. pylori) strain (cytotoxin-associated gene A [CagA]-positive strain, NCTC 11637) was acquired from the ATCC (American Type Culture Collection, Rockville, MD). The H. pylori strain was cultured with shaking under 10% CO2 conditions to 1 x 10⁸ CFU / mL (OD₆₀₀=1) in Brucella broth to which 5% bovine calf serum and an antibiotic were added. The RGM1 cell was infected with the H. pylori strain for 6 hours at the multiplicity of infection (MOI) of 100:1 (hereafter referred to as 100 MOI). Example 2. Anti-Helicobacter efficacy test of the composition containing a Corynebacterium sp. strain in vitro The efficacy of inhibiting H. pylori growth, i.e., anti-Helicobacter efficacy, was measured on a blood agar plate using the disk diffusion assay. Specifically, 40 g / L of TSA (Trypticase™ Soy Agar) was dissolved in purified water and then autoclaved (121°C, 20 min). After cooling to approximately 50°C, 5% sheep blood was added, followed by the addition of an antibiotic {trimethoprim (5 mg / L), polymyxin B (2500 U / L), vancomycin (10 mg / L)}. 20–25 mL aliquots were taken from the medium, placed on the sterilized plate, and then stored at 4°C. 200 µA aliquots of the H. pylori strain solution were spread onto the prepared blood agar plate, and 40 µA of each composition from groups 1 to 8, prepared in Example 1-1, was absorbed onto each disc paper and cultured in a CO2 incubator at 37°C for 48 hours. The diameter of the cleared zone around the disc was then measured and shown in Figure 1 (the result for group 1 is not shown in the graph). In Figure 1, 'untreated' means that the RGM1 cell is not infected with H. pylori. As shown in Figure 1, groups 6 and 7 were confirmed to have significant anti-Helicobacter activity, as the numerical value of the cleared zone diameter was significantly high in groups 6 and 7 compared to the untreated group. -32In addition, the appropriate concentration of groups 1-8 to be used in the following experiments had to be derived. H. pylori were treated with dilute solutions in which the compositions of groups 1 to 8 prepared in Example 1-1 were diluted to 1 / 4, 1 / 40, or 1 / 100 of 40 μA, respectively, and cell viability was measured. At the 1 / 4 dilution concentration, viability of 0.5 or less was observed in many groups, while at the 1 / 100 dilution concentration, there was no clear difference in results between groups. In subsequent experiments, the 1 / 40 dilution was used, which showed a significant difference in results compared to group 1. ML / a / ZUZ 1 / U1 300 / Example 3. Test for inflammatory mediator and NF-κB transcription using a composition containing a Corynebacterium sp. strain. Similar to the method in Example 1-3, H. pylori-infected RGM1 cells (100 MOI) were treated with compositions from groups 1 to 8, diluted 1 / 40, at 40 μA, respectively, for 6 hours. The expression level of the inflammatory mediator, Cox-2 mRNA, was then confirmed in the treated RGM1 cells by RT-PCR (reverse transcription PCR), and the results are shown in Figure 2a. Specifically, RNA was extracted using TRIzol (Gibco BRL, Rockville, MD), and the extracted RNA was synthesized to give cDNA using Moloney murine leukemia virus reverse transcriptase (Perkin Elmer, Morrisville, NC). The nucleic acid sequence of each primer used for PCR analysis is shown in Table 3 below, and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as an internal standard. [Table 3] Gene Forward primer(5' 3') Reverse primer(5' ^3') IL-Ιβ CAG GCT CCG AGA TGA ACA ACA AA(SEQ ID NO: 1) TGG GGA ACT CTG CAG ACT CA(SEQ ID NO: 2) IL-8 CAG ACA GTG GCA GGG ATT CA(SEQ ID NO: 3) TTG GGG ACA CCC TTT AGC AT(SEQ ID NO: 4) Cox-2 GAA ATG GCT GCA GAG TTG AA(SEQ ID NO: 5) TCA TCT AGT CTG GAG TGG GA(SEQ ID NO: 6) iNOS CTC ACT GGG ACT GCA CAG AA(SEQ ID NO: 7) TGT TGA AGG GTG TCG TGA AA(SEQ ID NO: 8) HO-1 GAC AGC ATG TCC CAG GAT TT(SEQ ID NO: 9) GGT TCT GCT TGT TTC GCT CT(SEQ ID NO: 10) HSP70 GAG TTG AGC GGC ATC CCG CC(SEQ ID NO: 11) GTC CTA GAT TCA CAC CTG GAG(SEQ ID NO: 12) Gapdh GGT GCT GAG TAT GTC GTG GA(SEQ ID NO: 13) TTC AGC TCT GGG ATG ACC TT(SEQ ID NO: 14) MA / a / x'Uí'l / UlDDOf Furthermore, in the RGM1 cell in which the compositions were treated, the increase and reduction of the level of iNOS protein expression and the phosphorylation of NF-κB p65 that transcribes it were confirmed by Western-type immunoblotting analysis, and the result was shown in Figure 2b and Figure 2c. Specifically, the cultured cells treated with the compositions were washed with PBS (phosphate-buffered saline) solution and then dissolved with cell lysis buffer (150 mM NaCl, 0.5% Triton X-100, 50 mM Tris-HCl, pH 7.4, 25 mM NaF, 20 mM ethylene glycol-bis(βN'-tetraacetic acid, 1 mM dithiothreitol, 1 mM NasVCt, protease inhibitor cocktail tablet [Boehringer, Mannheim, Germany]) to prepare a protein lysate. After electrophoresis by SDS-PAGE (sodium dodecyl sulfate-polyacrylamide gel electrophoresis), the unfolded protein was transferred to a PVDF membrane (Gelman Sciences, Ann Arbor, MI) for reaction with a primary antibody and a secondary antibody. secondary, respectively, and was then analyzed using a chemiluminescence system. As shown in Figure 2a, compared to the normal RGM1 cell (N), in the RGM1 cell infected with H. pylori (Hp), Cox-2 mRNA was significantly increased, and the increase in Cox-2 mRNA expression by H. pylori infection was most significantly reduced by the addition of the group 6 composition. As shown in Figure 2b and Figure 2c, iNOS protein expression and the phosphorylation of the NF-κB p65 that transcribes it increased significantly upon infection with H. pylori, but iNOS protein expression and the phosphorylation of the NF-κB p65 that transcribes it decreased most significantly upon the addition of the Group 6 composition. -34result, it could be observed that the composition according to an example regulated the inflammation mediation pathway by the Helicobacter strain. Example 4. Efficacy test of oxidative stress weakening using a composition containing a Corynebacterium sp. strain in vitro Similar to the method in Example 1-3, H. pylori-infected RGM1 cells (100 MOI) were treated with the compositions from groups 1 to 8, diluted 1 / 40, in 40 μA doses, respectively, for 6 hours. Western blot immunoblotting was then performed using a method similar to Example 3, and the change in HIF-α expression level associated with oxidative stress was measured; the results are shown in Figure 3a. As shown in Figure 3a, HIF-la increased significantly due to Helicobacter pylori infection, and HIF-la expression was significantly reduced in groups 6 and 7. Furthermore, to measure the change in intracellular reactive oxygen concentration, the DCF potentiation reaction was analyzed using a DCF-DA probe with a confocal imaging device. DCF-DA (2',7'-dichlorofluorescein diacetate), a non-fluorescent substance, is oxidized by reactive oxygen species (ROS) when peroxides are present in a cell and exhibits green fluorescence. Therefore, the amount of reactive oxygen species can be directly quantified by the fluorescence intensity at a specific wavelength. Specifically, samples were taken from RGM-1 cells (either untreated RGM-1 cells infected with H. pylori or RGM-1 cells infected with H. pylori).H. pylori (100 MOI) (example 1-3) aliquots of 5 x 10⁵ cells / well were placed in a 24-well plate and incubated at 37°C (95% air, 5% CO₂) overnight. The compositions of groups 1 to 8 were then treated for a specified time, respectively. The cells were washed with DMEM, and DCF-DA 10 pg / ml (2',7'-dichlorofluorescein diacetate, Sigma-Aldrich Co., St. Louis, MO) was added to the medium and incubated for 30 minutes. After incubation, the washed cells were observed in 4°C PBS and photographed using a fluorescence microscope. The results are shown in Figure 3b. As shown in Figure 3b, the DCF-DA fluorescence intensity, which increased after Helicobacter pylori infection, was confirmed to be statistically significantly reduced in the treated groups. -35 with groups 1, 3, 6, and 8 (P<0.05), and in the group treated with group 6, the degree of reduction was the greatest (P<0.01). From the result, it could be observed that the composition according to an example was able to immediately cope with the oxidative stress or hypoxic response of the Helicobacter pylori strain. MA / a / x'Uí'l / UlDDOf Example 5. Test of the efficacy of cell protection mediated by antioxidants associated with Helicobacter pylori using a composition containing a Corynebacterium sp. strain in vitro Similar to the method in Example 1-3, H. pylori-infected RGM1 cells (100 MOI) were treated with the compositions from groups 1 to 8, diluted 1 / 40, in 40 μA doses, respectively, for 6 hours. The change in mRNA expression of HO-1, a representative cytoprotective factor, was then analyzed using the method described in Example 3 (PCR) and shown in Figure 4a. The change in protein expression of HO-1 and GST (glutathione S-transferase (pi)) was analyzed similarly to the method described in Example 3 (Western-type immunoblotting) and shown in Figure 4b. As a result, as shown in Figure 4a and Figure 4b, in the control group, a significant reduction in HO-1 protein and mRNA was observed after Helicobacter pylori infection. In the groups treated with groups 6 through 8, the reduced HO-1 expression increased significantly, with the group treated with group 6 showing the most significant increase. Furthermore, as shown in Figure 4b, GST(pi) expression was significantly reduced in groups 6 and 7, with the group treated with group 6 showing the most significant reduction. From the result, it could be observed that the composition, according to one example, showed antioxidant action and cell protection efficacy based mainly on the HO-1 reaction to the Helicobacter pylori strain. Example 6. Efficacy test of inhibition of apoptosis associated with Helicobacter pylori using a composition containing a Corynebacterium sp. strain in vitro Similar to the method in Example 1-3, the H. pylori (100 MOI) infected RGM1 cell was treated with the compositions from groups 1 to 8, diluted 1 / 40, of 40 μA, respectively, for 6 hours. Then, using a method similar to In example 3, Bcl-2 and Bax expression was confirmed by Western blot, and the result is shown in Figure 5a. Apoptosis was analyzed by TUNEL staining, and the result is shown in Figure 5b. Specifically, TUNEL staining was performed by taking cell aliquots, placing them on a Lab-Tek chamber slide at 1x105 cells / chamber, and then culturing them in an incubator at 37°C (95% air, 5% CO2). After treating each reagent for a specified time, the experimental method was performed according to the manufacturer's instructions using an apoptosis detection kit (Oncogene Research Products, Cambridge, MA). The cultured solution was removed and washed three times with PBS solution, then 4% PEA (paraformaldehyde) was added, and the solution was fixed at room temperature for 20 minutes.After washing twice with PBS, the sample was treated with 0.1% Triton X-100 at 4°C for 5 minutes, light was blocked, and then reacted with a solution prepared by mixing TdT (terminal deoxynucleotidyl transferase) and a nucleotide mixture at 37°C for 60 minutes. After washing with PBS, apoptosis was observed using a fluorescence microscope. As shown in Figure 5a, the reduction of Bcl-2 expression and the increase of Bax expression could be observed in the H. pylori (Hp) infected cell, and it could be confirmed that the significantly increased expression of Bax was reduced and the reduced expression of Bcl-2 increased in the groups treated with groups 6 to 8, and among them, in the group treated with group 6, the effect was the most excellent. Helicobacter pylori infection is known to induce mucosal damage and ulceration by significantly increasing apoptosis, and as shown in Figure 5b, in the TUNEL staining result, a statistically significant increase in apoptosis was observed for Helicobacter pylori infection (P<0.01), but in the groups treated with groups 6 to 8, apoptosis was significantly reduced, and among them, in the group treated with group 6, apoptosis was mostly reduced. Example 7. Test for change in proliferation factor, vascular growth and cell growth associated with Helicobacter pylori using a composition containing a Corynebacterium sp. strain in vitro Similar to the method in Example 1-3, the H. pylori (100 MOI) infected RGM1 cell was treated with the compositions from groups 1 to 8, diluted 1 / 40, -37 of 40 μA, respectively for 6 hours. Then, using a method similar to example 3, the change in TGF-β and VEGF was analyzed by Western-type immunoblotting, and the result was shown in figure 6a. As a result, as shown in Figure 6a, TGF-β and VEGF, which increased following Helicobacter pylori infection, promoted uncontrolled mucosal proliferation or cancerous inflammation. However, in the groups treated with compounds 6 through 8, TGF-β and VEGF expression was significantly reduced, and in particular, in the group treated with compound 6, TGF-β and VEGF expression was most significantly reduced. This demonstrated that the compound used in this example was able to alleviate inflammation or cancerization caused by Helicobacter pylori infection. Furthermore, nuclear transfer of β-catenin was confirmed using a nuclear fraction in the Helicobacter pylori-infected cell by Western blot, and the result is shown in Figure 6b. As shown in Figure 6b, it was confirmed that the nuclear transfer of β-catenin qae, which increased due to Helicobacter pylori infection, could be significantly inhibited by the group 6 treatment. All experimental values ​​in examples 1 to 7 were statistically verified using the T-test method, and p<0.05 or more was defined as statistically significant. Example 8. Sample preparation comprising threonine Fermented broth was prepared by inoculating wild strain of C. glutamicum (CJ CheilJedang BIO R&D Center (Blossom park)) into broth to produce threonine (Table 1) and culturing it under the condition of 35°C and 200 rpm for 48 hours and crystallized to prepare sample 1. Sample 1 comprised 99% by weight or more of purified threonine in powder form. Fermented broth (comprising C. glutamicum) obtained by cultivating C. glutamicum in a medium for producing threonine was directly dried (hot air dried at 60 to 70°C) to prepare sample 2. In addition, calcium lignosulfonate (Aladdin Industrial Co., Shanghai, China) was added to the fermented broth obtained by cultivating C. glutamicum under the above conditions in various concentrations, and the fermented broth (comprising C. glutamicum) to which calcium lignosulfonate was added was dried (hot air dried at 60 to 70°C) to prepare samples 3 to 5. Samples 2 to 5 comprised C. -38glutamicum in the form of thermo-inactivated bacteria through hot air drying. Samples 2 to 5 were prepared in granule form with a particle size of approximately 200 to 1000 µm. The components and contents of samples 1 to 5 are disclosed in Table 4. In Table 4, Thr (wt. %), calcium lignosulfonate (wt. %), and other components of the fermented product (comprising C. glutamicum microbial cells) (wt. %) represent the wt. percentage of dry matter obtained by drying the fermented broth, and the fermented product in dry matter comprises the C. glutamicum strain. Furthermore, the C. glutamicum strain content in the fermented product is disclosed in Table 4. [Table 4] Thr (% by weight) Fermented product (% by weight) C. glutamicum in the fermented product (% by weight)1 Calcium lignosulfonate (% by weight) Sample 1 100.0 - - - Sample 2 75 25.0 4.0 0.0 Sample 3 70 23.3 3.8 6.7 Sample 4 65 21.7 3.5 13.3 Sample 5 60 20.0 3.2 20.0 1 value converted when the microbial cell content in the fermented product is dried Example 9. Preparation of the WIRS (water immersion retention stress) model for SRMD (stress-related mucosal disease) A total of 110 SD rats were acquired from Charles River (Osaka, Japan) and housed in an animal facility. The experimental animals were handled in the licensed animal facility according to the AAALAC International Animal Care Policy. The animals were fasted for 24 hours prior to WIRS exposure, and water was available ad libitum. Ten rats from each group were placed in a WIRS cage and immersed in water for 6 hours. Samples 1 to 5 prepared in Example 8 were administered orally to rats 8 hours before WIRS treatment, so that the same amount of threonine (0.15% wt / diet) was administered, and after applying WIRS -39 for 6 hours, the animals were sacrificed and the stomach was removed and an incision was made and the contents removed, and an image of the internal surface of the stomach was taken and this is shown in figure 11. As shown in figure 11, as a result of observing the stomach tissue of rats with the naked eye, it could be confirmed that in the group in which WIRS was induced (the second row in figure 11), gastrorrhagia was provoked, and the degree of gastrorrhagia was reduced (excellent therapeutic effect of gastric ulcer) in the order of sample 1 < sample 5 < sample 4 < sample 3 or sample 2. On the other hand, the following experiment was carried out by dividing the animals into 4 experimental groups as indicated in Table 5 below. They were divided into an untreated group in which nothing was treated after the oral administration of saline solution (positive control group, experimental animal group 1), a WIRS group in which WIRS was applied for 6 hours (negative control group, experimental animal group 2), and experimental animal groups in which they were treated orally with feed containing sample 1 (prepared in example 8) of 0.15% by weight (experimental animal group 3) and feed containing sample 3 (prepared in example 8) of 0.21% by weight (experimental animal group 4) by means of 30 mg / kg of body weight, respectively, 8 hours before the WIRS treatment. The L-Thr (L-threonine) content in the feed of experimental animal groups 3 and 4 was set at 0.15% by weight / diet equally. [Table 5] iviA / a / zuz ι / ui□□□ / Experimental Animal Group Experimental Animal WIRS Induction Test Substance (supplied 8 hours prior to WIRS treatment) Administration Dose (% wt / diet) Number of Animals 1 Rat No. Positive control group (no stress, no Thr) 0 10 2 WIRS induction for 6 hours Negative control group (no Thr) 0 20 3 Sample 1 (example 8; LThr) 0.15 10 4 Sample 3 (example 8; LThr + fermented C. glutamicum product (comprising one microbial cell)) 0.21 10 -40All experimental animals (rats) were sacrificed with a high dose of anesthetic (sodium thiopental, 50 mg / kg) after 6 hours of WIRS. The experimental animal groups 1-4 disclosed in the following examples 10 to 12 mean the experimental animal groups 1-4 of Table 5, and in Figure 7a to Figure 10, groups 1-4 mean the experimental animal groups 1-4 of Table 5. Example 10. Efficacy test for improvement of SRMD (stress-related mucosal disease) An incision was made in the stomach of the sacrificed rat in Example 9, opened along the longer curvature, and then washed with cold PBS solution. After determining the number and size of erosions or ulcers using magnified photographs, half of the stomach was anatomically dissected for observation. The incised stomach was spread on a plastic sheet and fixed in 10% formalin buffer for 4 hours and used to produce a paraffin-embedded tissue section. The other half was stored in a liquid nitrogen tank for molecular biological observation. Additionally, mucosal homogenate was stored by mixing the same experimental animal groups. The stomach sample was observed using a microscope with the naked eye (Figure 7a), and in the control group and each experimental group (experimental animal groups 1-4), the macroscopic injury index, inflammation; pathological score, ulcer / erosion; pathological score, regeneration; pathological score were calculated and shown in Figure 7b. As shown in Figure 7a, a significant occurrence of SRMD such as erosions, hemorrhage, and ulcers was shown in all rats in experimental animal group 2, but SRMD was significantly improved in experimental animal group 3 and experimental animal group 4.As shown in Figure 7b, the macroscopic injury index, inflammation; pathological score, ulcer / erosion; pathological score, regeneration; pathological score were significantly improved (p <0.05) in experimental animal groups 3 and 4, and in particular, the macroscopic injury index of experimental animal group 4 was significantly lower than that of experimental animal group 3, and the regeneration; pathological score was significantly improved compared to experimental animal group 3. -41 Example 11. Anti-inflammatory efficacy test Since SRMD was physiologically related to ischemia-reperfusion injury, in experimental animal groups 1 to 4, the mRNA expression of angiogenic growth factors including PDGF (platelet-derived growth factor) and the mRNA expression of inflammatory mediators, iNOS, TNF-α, IFN-γ and PDGF, were measured, and the result is shown in Figure 8a and Figure 8b. Specifically, total RNA was extracted using the RNeasy minikit (Qiagen Korea, Seoul, Korea). The primers used to measure the expression of inflammatory cytokines and mediators are shown in Table 6 below. Amplification was performed using 1Ox reaction buffer (Promega Korea, Seoul, Korea), 1.5 mM / L MgCl2, 200 mM / L deoxynucleotide triphosphate (dNTP), 1 mM / L of each primer, and 2.5 units of Taq DNA polymerase (Promega), using the Perkin-Elmer GeneAmp 2400 PCR system. Each cycle consisted of denaturation at 95°C for 1 minute, annealing at 55°C for 45 minutes, and amplification at 72°C for 45 seconds. [Table 6] Gen Cebador directo(5'^3') Cebador inverso(5'^3') IL-8 CACTCCCAGCATCGTAGAGC(SEQ ID NO: 15) CAGTGTACTTGTGGCGTGGA(SEQ ID NO: 16) iNos TTTTCCCAGGCAACCAGACG(SEQ ID NO: 17) GTAGCGGGGTTCAGAATGG(SEQ ID NO: 18) lh'N-γ ATCCATGAGIGCTACACGCC(SEQ ID NO: 19) TCIGTGGGTTGTTCACCTCG(SEQ ID NO: 20) HIF-la TATCACTGGACTTCGGCAGC(SEQ ID NO: 21) GCTGCCGAAGTCCAGTGATA(SEQ ID NO: 22) PDGF AGGAAGCCATTCCCGCAGTT(SEQ ID NO: 23) CTAACCTCACCTGGACCTCT(SEQ ID NO: 24) VEGF CAATGATGAAGCCCTGGAGT(SEQ ID NO: 25) GATTTCTTGCGCTTTCGTTT(SEQ ID NO: 26) TNF-a CCCTCACACTCAGATCATCTTCTCAA(SEQ ID NO: 29) TCTAAGGTACTTGGGCAGGTTGACCTC(SEQ ID NO: 30) GAPDH GGTGCTGAGTATGTCGTGGA(SEQ ID NO: 27) TTCAGCTCTGGGATGACCTT(SEQ ID NO: 28) Furthermore, in each of the experimental animal groups 1-4, the protein levels of ρ-IκBα, p-ERK, and p-JNK were measured and shown in Figure 8c and Figure 8d. Specifically, to perform Western blot immunoblotting to measure the protein levels, the gastric mucosa collected in Tris buffer was homogenized. -42HC1 20 mM ice cream (pH 7.5) containing 2 mM EDTA (ethylenediaminetetraacetic acid), 0.5 mM EGTA (ethylene glycol tetraacetic acid), 300 mM sucrose, and 2 mM PMSF (phenylmethylsulfonyl fluoride) was homogenized with a tissue homogenizer. After electrophoresis of 30 pg of protein on an 8% SDS-PAGE (sodium dodecyl sulfate-polyacrylamide gel electrophoresis), it was transferred to a PVDF (polyvinylidene fluoride) membrane using a semi-dry transfer system (Hoefer, Holliston, MA, USA). Non-specific binding was blocked by incubation with 5% nonfat dry milk. The membrane was thermostatically incubated with a 500x dilute solution of a primary antibody at 4°C overnight, and then incubated with a 1:1000 dilute HRP (horseradish peroxidase) binding secondary antibody. The immune complex was detected using the ECL detection kit (Amersham Biosciences Korea, Seoul, Korea) and the X-ray film was automatically irradiated.The antibodies used for Western blot were as follows. Antibodies against β-actin, iNOS (nitric oxide synthase), COX-2 (cyclooxygenase), P-JNK (phospho-JNK), P-ERK (phospho-ERK), Bcl-2 (B-cell lymphoma 2), Bax (B-cell lymphoma-associated protein X 2), and cyclin DI were acquired from Santa Cruz Biotechnology (Santa Cruz, CA). ρ-IκBα (phosphorylated inhibitor of kappa B alpha), p-STAT3 (phosphorylated signal transducer and activator of transcription 3), PARP (poly(ADP-ribose) polymerase), CDK4 (cyclin-dependent kinase 4), and CDK2 (cyclin-dependent kinase 2) were acquired from Cell Signaling Technology (Beverly, MA). The antibody against HO-1 (heme oxygenase-1) was acquired from Enzo life Sciences (Farmingdale, NY). As shown in Figure 8a, in experimental animal group 2 (WIRD-induced SRMD), the mRNA expression of iNOS, TNF-α, and interferon gamma (IFN-γ) was significantly increased, but the increased expression of inflammatory mediators (iNOS, TNF-α, IFN-γ) was significantly reduced in experimental animal group 3 or experimental animal group 4 (P <0.01 or P <0.05, Figure 8a), and the expression of TNF-α and iFN-γ was significantly reduced, particularly in experimental animal group 4 compared to experimental animal group 3 (P <0.05, Figure 8a). As shown in Figure 8b, the expression of the angiogenic growth factor, PDGF, increased significantly in experimental animal group 2, but was significantly reduced in experimental animal group 3 or experimental animal group 4 (P<0.01, Figure 8b), and in particular, in group -43experimental animal 4, the reduction level was higher. As shown in Figure 8c, as a result of measuring ρ-IκBα expression at the protein level, ρ-IκBα expression was significantly reduced by WIRS in experimental animal group 2, and this reduction was related to the transcriptional activation of NF-κB. Meanwhile, the reduced expression of ρ-IκBα was significantly increased (P<0.01, Figure 8c) in experimental animal group 4 compared to experimental animal group 3 (P<0.01, Figure 8c), and this increased expression induced redox inhibition of NF-κB. On the other hand, with respect to the signaling related to ischemia and inflammation, as shown in Figure 8d, in the experimental animal group 2, activation of p-ERK and p-JNK was shown, and in the experimental animal group 4, the signaling was completely inactivated, but in the experimental animal group 3, it was partially inactivated (P<0.01). Example 12. Gastric mucosa protection efficacy test Since the SRMD causing erosions or ulcers showed increased apoptosis in the corresponding region, gastric mucosal apoptosis was measured according to the experimental animal group. Specifically, apoptosis was visualized using the TdT FragEL DNA fragmentation detection kit (Oncogene Research Products, Cambridge, MA) and the TUNEL (terminal deoxynucleotidyl transferase-mediated end-cut tipping) method. To measure the apoptotic index (AI) by identifying a region where apoptosis occurs in large quantities (apoptotic focus) in each experimental group, the TUNEL-stained section was magnified 100-fold and examined.Next, the number of TUNEL-positive cells was counted in 400 fields to record the AI. The mean coefficient was determined by randomly selecting at least 5 foci in fragments that included corrosive or ulcerative lesions, and the result is shown in Figure 9a, and the result is indicated by the mean percentage of the total number of cells. As shown in Figure 9a, apoptosis was significantly increased in experimental animal group 2 compared to experimental animal group 1, and the level of apoptosis was significantly reduced in experimental animal groups 3 and 4 compared to experimental animal group 2 (P<0.01, Figure 9a). -44 was observed at a significantly lower level in experimental animal group 4 compared to experimental animal group 3 (P<0.01, Figure 9a). To verify the TUNEL result for the expression of Bcl-2, apoptosis prevention protein and cleaved PARP, Bax, cleaved caspase-8 and cleaved caspase-3 that induce apoptosis, Western-type immunoblotting analysis was performed using the method of example 11, and the result was shown in figure 9b. As shown in Figure 9b, the expression of Bax, cleaved caspase-8, cleaved caspase-3, and PARP cleavage increased significantly in experimental animal group 2, and the expression of Bax, cleaved caspase-8, cleaved caspase-3, and PARP cleavage increased significantly in experimental animal groups 3 and 4, and were observed at a significantly lower level, particularly in experimental animal group 4 compared to experimental animal group 3. On the other hand, the expression of Bcl-2, the apoptosis prevention protein, increased significantly in experimental animal group 4 (Figure 9b). The activity of CDK4 and cyclin DI, genes related to the cell cycle, was confirmed at the protein level using the method described in Example 11, and the results are shown in Figure 9c. As shown in Figure 9c, the expression of CDK4 and cyclin DI was significantly increased in experimental animal group 2 (P < 0.01), and the increased expression of CDK4 and cyclin DI was significantly reduced in experimental animal groups 3 and 4. In particular, the expression of CDK4 and cyclin DI was significantly lower in experimental animal group 4 compared to experimental animal group 3 (Figure 9c, P < 0.01 ~ 0.05). In the stomach tissue of experimental animal groups 1 to 4, mucin content was confirmed by PAS staining, and the result is shown in Figure 10. As shown in Figure 10, gastric mucin was observed at a significantly low level in experimental animal group 2 (P <0.01), and gastric mucus expression was significantly conserved in experimental animal groups 3 and 4, and mucus expression was significantly higher in experimental animal group 4 than in group 3 (P<0.01). Based on the previous result, it could be observed that WIRS jeopardized the integrity of the mucosa, but this threat was alleviated by treatment. -45previous of the composition (sample) according to an example. The results for examples 8 to 11 were represented by the mean IDE. Data were analyzed using one-tailed analysis of variance (ANOVA), and statistical significance between groups was determined using Duncan's multiple range test. Statistical significance converged to P < 0.05. Based on the foregoing description, those skilled in the art to which this application pertains will understand that this application may be implemented in other specific forms without altering its technical spirit or essential characteristics. In this respect, it should be understood that the 10 examples described above are illustrative in all respects and not restrictive. The scope of this application should be interpreted as the meaning and scope of the following claims rather than the detailed description above, and all modifications or modified forms derived from the equivalent concept are included within the scope of this application.

Claims

CLAIMS 1. Feed composition for the prevention or improvement of a gastric disorder, comprising a strain of Corynebacterium sp., its cultured product and threonine.

2. Feed composition according to claim 1, wherein the Corynebacterium sp. strain is Corynebacterium glutamicum, Corynebacterium ammoniagenes or a combination thereof.

3. Feed composition according to claim 1, wherein the Corynebacterium sp. strain consists of heat-inactivated bacteria.

4. Feed composition according to claim 1, wherein the cultured product is a fermented product in which the Corynebacterium sp. strain is cultivated in a medium.

5. Feed composition according to claim 4, wherein the medium is a means for producing threonine.

6. Feed composition according to claim 1, wherein threonine is present in an amount of 60 to 80% by weight.

7. Feed composition according to claim 1, wherein the Corynebacterium sp. strain and its cultured product are comprised in a dried form.

8. Feed composition according to claim 1, wherein the gastric disorder is caused by Helicobacter pylori infection.

9. Feed composition according to claim 1, wherein the gastric disorder is at least one selected from the group consisting of gastritis, gastric ulcer, duodenal ulcer, peptic ulcer and gastric cancer.

10. Feed composition according to any one of claims 1 to 9, wherein threonine (1) is comprised in the Corynebacterium sp. strain, its cultured product, or both thereof; or (2) is added separately; or (3) is comprised in the Corynebacterium sp. strain, its cultured product, or both thereof, and is further added thereto.

11. Pharmaceutical composition for the prevention or treatment of a gastric disorder, comprising a strain of Corynebacterium sp., its cultured product and threonine.

12. Food composition for the prevention or improvement of a gastric disorder, comprising a strain of Corynebacterium sp., its cultured product and threonine.

13. Antimicrobial composition against Helicobacter pylori, comprising a strain 5 of Corynebacterium sp., its cultured product and threonine.