IN VITRO COMPOSITIONS AND METHODS FOR PREPARING GENETICALLY MODIFIED STEM CELLS.

Abstract

The present invention provides systems and methods for producing and using gene-modified stem cells for gene therapy. In particular, methods are provided herein for treating Fanconi anemia in which the subject's stem cells are selected by a combination of high-striction CD34+ selection and low-striction CD34+ selection, genetically modified using a gene therapy vector encoding a FANC protein or a gene-editing system, and administered to the subject.

Description

field of invention The present invention relates generally to methods for preparing hematopoietic cell populations comprising gene-modified hematopoietic stem cells (HSCs) for use in HSC transplantation, including for the treatment of Fanconi anemia (FA). , for its acronym in English). Cross reference to related requests This application claims priority to US Provisional Application No. 62 / 656,292, filed April 11, 2018, which is incorporated by reference herein in its entirety. Electronically Submitted Text File Description The contents of the text file submitted electronically herewith are incorporated herein by reference in their entirety: A copy in machine-readable format of the Sequence Listing (file name: ROPA_008_01 WO_SeqList_ST25, record date: April 11, 2019, file size ~52 kilobytes). Background of the invention Ex vivo mediated gene transfer into target cells is a clinically applied method for cell and gene therapy. Isolation and ex vivo engineering of HSCs containing CD34-enriched populations provides two important benefits: reduced gene transfer to non-target cells; and thus reducing the need / amount of genetic modifiers, e.g. eg, gene therapy vectors, which in turn reduces the costs associated with the clinical production of gene-engineered HSCs. A model system for the transplantation of genetically modified HSCs is the FA. Methods developed in the context of AF can also be applied to other disorders and conditions. FA is an autosomal recessive disease (except for the FA-B complementation group, which is associated with the X chromosome), where the median survival of patients is approximately 24 years (Butturini A, et al. (1994) Blood 84 :1650-1655; Kutler DI, et al. (2003) Blood 101:1249-1256). When born, the blood count of these patients is usually normal. Macrocytosis is often the first hematologic abnormality detected in these patients. This normally evolves with thrombocytopenia, anemia and pancytopenia. Barrow marrow failure (BMF) is typically seen in these patients after 5-10 years, with a median age of onset of hematologic disease of 7 years. Approximately 80% of patients with AF will develop BMF in the first decade of life. Based on epidemiologic studies to date, if no malignant episodes occur before aplasia, virtually all patients will develop BMF by age 40 (Butturini A, et al. (1994) Blood 84:1650-1655; Kutler qi yni η / ηζηζ / Ε / γ DI, et al. (2003) Blood 101:1249-1256), which is considered the leading cause of mortality in these patients. Due to the complex clinical manifestations of AF, the treatment of these patients is mainly focused on improving the following clinical manifestations: bone marrow failure (BMF), myeloid leukemia, and solid tumors. The treatment of AF and other diseases depends on the effective incorporation of a genetically modified HSC graft. Accordingly, there is a need in the art for methods of preparing gene-modified HSC-containing cell populations that achieve high levels of graft incorporation in patients, including patients with AF. The present invention addresses this need and more. Brief description of the invention The present invention relates generally to the fields of hematologic malignancy and stem cell transplantation, and in particular, to the production and use of CD34+ cell-enriched stem cell populations for use in gene therapy, including gene delivery and gene repair. In particular, these CD34-enriched cell populations are useful in gene therapy for the treatment of mammals, and in particular, human diseases, disorders and impairments related to dysregulation of the complementation group A (FANCA), group C gene product. (FANCC) or group G (FANCG) of Fanconi anemia. In certain embodiments, the methods of the present disclosure are carried out ex vivo and not in the human body per se. In one embodiment, the disclosure provides a method of treating Fanconi anemia in a subject in need thereof, comprising providing the subject with a combination of: (i) a high stringency CD34-enriched cell population prepared from a first sample biological obtained from the subject by selecting CD34+ cells under high stringency conditions; and (ii) a low stringency CD34-enriched cell population prepared from a second biological sample obtained from the subject by selecting for CD34+ cells under low stringency conditions, wherein one or both of the CD34-enriched cell population with high stringency and / or the low stringency CD34-enriched cell population has been transduced with a recombinant gene therapy vector encoding a FANC polypeptide, including functional fragments or variants or naturally occurring FANC proteins (eg. , FANCA or FANCC or FANCG), and wherein the first biological sample and the second biological sample are optionally the same biological sample, and thus treat Fanconi anemia. In one embodiment, the method comprises treating Fanconi anemia in a subject by preparing a CD34-enriched cell population under high stringency conditions, preparing another CD34-enriched cell population under low stringency conditions, contacting one or both of the enriched populations with CD34 with a recombinant gene therapy vector, and administering the two CD34-enriched cell populations, sequentially or simultaneously, to the subject, thereby treating Fanconi anemia. In particular embodiments, the cell population(s) contacted with the gene therapy vector are transduced as a result and therefore comprise a polynucleotide encoding a nucleic acid or polypeptide. therapy for the treatment of Fanconi anemia. In a In the 7ΠΙ η / η7Π7 / Ε / Υ modality, the recombinant gene therapy vector comprises an autoinactivated lentiviral vector encoding a therapeutic FANC (eg, FANCA or FANCCo FANCG) gene segment or protein, such as the vector described in international patent application no. PCT / US2017 / 050837. In one embodiment, the recombinant gene therapy vector is configured to repair an endogenous FANC gene (eg, FANCA or FANCCo FANCG), such as by delivering a CRISPR / Cas system comprising a Cas protein or nucleic acid that encodes a Cas protein, a gRNA or sgRNA, and a repair template comprising a FANC gene or a fragment of a FANC gene that overlaps with one or more mutations in the endogenous FANC gene. In one embodiment, the present disclosure provides a method of treating Fanconi anemia in a subject in need thereof, comprising: preparing a high stringency CD34-enriched cell population from a first biological sample obtained from the subject by selecting for CD34+ cells in highly rigorous conditions; prepare a low stringency CD34-enriched cell population from a second biological sample obtained from the subject by selecting for CD34+ cells under low stringency conditions, contacting one or both of the high stringency CD34-enriched cell population, or the Low stringency CD34-enriched cell population with a recombinant gene therapy vector for Fanconi anemia; and administering the high stringency CD34-enriched cell population and the low stringency CD34-enriched cell population to the subject, wherein one or both of the high stringency CD34-enriched cell population or the low stringency CD34-enriched cell population is contacted with or transduced by the recombinant gene therapy vector; and thus treat Fanconi anemia. In one aspect of the present invention, the first biological sample and the second biological sample are each independently peripheral blood or bone marrow. In one aspect, the first biological sample and the second biological sample are peripheral blood obtained after the subject has been treated with granulocyte-macrophage colony-stimulating factor (G-CSF), plerifaxor, or a combination. of G-CSF and plerifaxor. In one embodiment, either method further comprises selecting CD34+ cells under high stringency conditions, which may comprise applying the first biological sample to a capture matrix that binds CD34+ cells, washing the capture matrix one or more times by using a wash buffer, and eluting the CD34-enriched cell population with high stringency from the capture matrix using an elution buffer. In one embodiment, the application step is carried out at 5-10 mL / min, 515 mL / min, 15-20 mL / min, 20-25 mL / min, or 25-30 mL / min. In one embodiment, the elution step is carried out at 5-10 mL / min, 5-15 mL / min, 15-20 mL / min, 20-25 mL / min, or 25-30 mL / min. In one embodiment, the application step is carried out at 10-20 mL / min. In one embodiment, the elution step is carried out at 20 mL / min. In one embodiment, either method further comprises selecting CD34+ cells under low stringency conditions, which may comprise applying the second biological sample to a capture matrix that binds CD34+ cells, allowing an unbound fraction of the second biological sample flow through the capture matrix and elute the CD34-enriched cell population with low stringency qi and ni η / ηζηζ / Ε / γ from the capture matrix using an elution buffer. In one embodiment, the application step is carried out at 5-10 mL / min, 5-15 mL / min, 15-20 mL / min, 20-25 mL / min, or 25-30 mL / min. In one embodiment, the elution step is carried out at 5-10 mL / min, 5-15 mL / min, 15-20 mL / min, 20-25 mL / min, or 25-30 mL / min. In one embodiment, the application step is carried out at 10-20 mL / min. In one embodiment, the elution step is carried out at 20 mL / min. In one aspect of the present invention, the high stringency CD34-enriched cell population and / or the low stringency CD34-enriched cell population is contacted with the recombinant gene therapy vector. In some embodiments, the percentage of CD34+ cells in the high stringency CD34-enriched cell population is two to four times greater than the percentage of CD34+ cells in the low stringency CD34-enriched cell population. In one embodiment, the percentage of CD34+ cells in the high stringency CD34-enriched cell population is greater than or about 60% and the percentage of CD34+ cells in the low stringency CD34-enriched cell population is less than 60% or 15- 60% or between 15-30%. In one embodiment, the percentage of CD34+ cells in the high stringency CD34-enriched cell population is greater than or about 70% and the percentage of CD34+ cells in the low stringency CD34-enriched cell population is 17.5-35%. In one embodiment, the percentage of CD34+ cells in the high stringency CD34-enriched cell population is greater than or about 80% and the percentage of CD34+ cells in the low stringency CD34-enriched cell population is less than 40% or 20- 40%. In one embodiment, the percentage of CD34+ cells in the high stringency CD34-enriched cell population is greater than or about 90% and the percentage of CD34+ cells in the low stringency CD34-enriched cell population is less than 40% or 22, 5-40%. In an embodiment of the present invention, the recombinant gene therapy vector for the treatment of Fanconi anemia comprises a polynucleotide sequence comprising in the following order from 5' to 3': (a) a eukaryotically active promoter sequence; and (b) a sequence encoding a human FANC gene or polypeptide, including fragments and functional variants thereof; wherein the sequence encoding the human FANC gene or polypeptide or functional fragments and variants thereof is operatively linked to the eukaryotically active promoter sequence; and wherein the FANC gene or polypeptide is selected from FANCA, FANCC and FANCG, e.g. eg, human wild type FANCA, FANCC and FANCG or fragments or functional variants thereof. In certain embodiments, a functional fragment or functional variant of a wild-type FANC protein has substantially similar biological activity to the wild-type FANC protein. In an embodiment of the present invention, the recombinant Fanconi anemia gene therapy vector comprises a gene editing system capable of targeting repair of an endogenous FANC gene, wherein the gene editing system comprises; a Cas protein or polynucleotide encoding a Cas protein; a gRNA; and a repair template comprising a sequence comprising the FANC gene or a fragment thereof that overlaps with one or more mutations in the endogenous FANC gene; wherein the sgRNA is configured to guide the repair template to the FANC qi jm η / ηζηζ / Ε / γ gene; and wherein the FANC gene is selected from FANCA, FANCC and FANCG. In one embodiment, the selection methods are carried out by bead-based magnetic selection. In one embodiment, the methods described herein further comprise performing apheresis on peripheral blood one or more times. In one aspect, the methods described herein generate a progressive increase in gene-modified Fanconi anemia cells over time. In one aspect, the treatment methods described herein inhibit the development of, arrest the progression of, and / or reverse the progression of a hematologic manifestation of Fanconi anemia in the subject, for example, without limitation, one or more of marrow failure, thrombocytopenia, leukopenia, pancytopenia, neutropenia and anemia. In one aspect, the methods described herein cause recovery of one or more hematopoietic lineages that had been decreased in the subject prior to administration of the high stringency CD34-enriched cell population and the low stringency CD34-enriched cell population. to the subject, for example, without limitation, one or more of lymphocytes, eosinophils, neutrophils, erythrocytes, and platelets. In particular embodiments, the methods cause a slowing of or a reduction in the decline of one or more hematopoietic lineages, or a stabilization in the populations of one or more hematopoietic lineages, e.g. eg, one or more of lymphocytes, eosinophils, neutrophils, erythrocytes, and platelets. In one aspect, the method causes stabilization or recovery of one or more hematological parameters that had decreased in the subject prior to administration of the high stringency CD34-enriched cell population and the low stringency CD34-enriched cell population to the subject, such as hemoglobin. In one embodiment, the present disclosure provides a method of preparing genetically modified cells for the treatment of Fanconi anemia, comprising: preparing a high stringency CD34-enriched cell population from a first biological sample obtained from a subject by screening CD34+ cells under high stringency conditions; preparing a low stringency CD34-enriched cell population from a second biological sample obtained from a subject by selecting for CD34+ cells under low stringency conditions; and contacting one or both of the high stringency CD34-enriched cell population or the low stringency CD34-enriched cell population with a recombinant Fanconi anemia gene therapy vector. In certain embodiments, cell population(s) contacted with the gene therapy vector are transduced by the gene therapy vector, and generate cell populations comprising transduced cells comprising a nucleotide sequence encoding a therapeutic nucleic acid or polypeptide, e.g. eg, a FANC polypeptide, which may be a native or natural FANC polypeptide, or a fragment or functional variant thereof. In one aspect, selection of either or both low stringency and high stringency CD34-enriched cell populations is accomplished with the use of antibodies or functional fragments thereof that specifically bind to CD34. In one aspect, selection is carried out using qi jm η / ηζηζ / Ε / γ at a flow rate of 10-20 mL / min. In one embodiment, the present invention provides a system comprising: a high stringency CD34-enriched cell population prepared from a first biological sample by selecting for CD34+ cells under high stringency conditions; and a low stringency CD34-enriched cell population prepared from a second biological sample by selecting for CD34+ cells under low stringency conditions, wherein either or both of the high stringency CD34-enriched cell population or the CD34-enriched cell population with low stringency is contacted with or has been transduced by a recombinant gene therapy vector for Fanconi anemia. In certain embodiments, the high stringency CD34-enriched cell population is present in a first pharmaceutical composition comprising one or more pharmaceutically acceptable carriers, diluents, or excipients, and the low stringency CD34-enriched cell population is present in a second pharmaceutical composition. comprising one or more pharmaceutically acceptable carriers, diluents or excipients. In some embodiments, both the high stringency CD34-enriched cell population and the low stringency CD34-enriched cell population are present in the same pharmaceutical composition comprising one or more pharmaceutically acceptable carriers, diluents, or excipients. In certain embodiments, both the high stringency CD34-enriched cell population and the low stringency CD34-enriched cell population have been transduced by the gene therapy vector for the treatment of Fanconi anemia. In certain embodiments, the gene therapy vector and / or the transduced cells comprise a nucleotide sequence encoding a therapeutic nucleic acid or polypeptide, e.g. eg, a FANC polypeptide, which can be a native or natural FANC polypeptide, or a fragment or functional variant thereof. In another embodiment, the present invention provides a pharmaceutical composition comprising: a high stringency CD34-enriched cell population prepared from a first biological sample by selecting for CD34+ cells under high stringency conditions; and a low stringency CD34-enriched cell population prepared from a second biological sample by selecting for CD34+ cells under low stringency conditions, wherein either or both of the high stringency CD34-enriched cell population or the CD34-enriched cell population with low stringency have been transduced with a recombinant gene therapy vector. In particular embodiments, the gene therapy vector is a lentivirus. In certain embodiments, the gene therapy vector encodes a therapeutic FANC (eg, FANCA or FANCC or FANCG) gene segment or protein, or a functional fragment or variant thereof. The pharmaceutical composition may comprise one or more pharmaceutically acceptable excipients, diluents or carriers. Other features and advantages of the invention will be apparent from and encompassed by the following detailed description and claims. qi / ni η / ηζηζ / Ε / γ Brief description of the drawings Figure 1 shows a map of an illustrative recombinant gene therapy plasmid vector, pCCL-PGK-FANCAW-82-RO. Detailed description of the invention Fanconi anemia (FA) presents several unique challenges for drug production. For FA, as with other ex vivo gene therapy applications, the target cell population for gene transfer expresses the cell surface protein CD34. For AF patients, when CD34+ cells are analyzed by flow cytometry, a lower proportion of BM cells are CD34+ relative to healthy individuals, 0.1-1.5% compared to 1-3%, respectively. It was not surprising to find lower absolute CD34+ cells in drug production from mPB starting material from an AF patient given the established characteristic of limited CD34+ cells in AF patients that declines with age. However, the lower yields of CD34+ and poor purity from FA patients were concerning, as this directly affects the potential efficacy of the drug produced. During standard CD34+ cell enrichment, a low percentage of CD34+ cells (relative to total cells) bind to immunomagnetic beads; therefore, the column loads relatively quickly (mL / min) and washes are rigorous because purity is the primary goal. The present inventors recognized the problem that when using mPB from FA patients, this strategy provides suboptimal results with low yield of CD34. To overcome the limits of the standard CD34+ cell enrichment protocol for FA patients, the present inventors developed new methods for preparing CD34+ cell populations from FA patients, which yield a higher yield and an effective drug. These methods involve preparing two cell populations, one selected under standard CD34+ cell enrichment conditions ("high stringency" conditions) and the other selected under "low stringency" conditions. One or both of these two cell populations are transduced with a suitable gene therapy vector and administered to the FA patient. As shown herein, the new method exhibits advantageous therapeutic effects. Without wishing to be bound by theory, it is believed that the increased number of CD34+ cells or the presence of other cells or other factors present in cell preparations with lower CD34+ cell purity contribute to the surprising efficacy of compositions prepared according to the methods described herein. Accordingly, the present disclosure provides systems and methods for producing and using gene-modified or gene-corrected stem cells for gene therapy. In particular, provided herein are methods of treating a disease or disorder (eg, Fanconi anemia) in which the subject's stem cells are selected by a combination of high stringency CD34+ selection and CD34+ selection. with low stringency, they are transduced with a vector encoding a therapeutic agent (eg, a FANC protein) and administered to the subject. Unexpectedly, treatment with a combination of high stringency selected CD34+ cells and low stringency selected CD34+ cells transduced with the therapeutic vectors, which combined have lower CD34+ cell purity than conventional high stringency preparations, resulted in qi and ni efficacy. η / ηζηζ / Ε / γ improved therapeutics. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as that commonly understood by a person skilled in the art to whom the present invention pertains. Although methods and materials similar or equivalent to those described herein may be used to practice the present invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are expressly incorporated by reference in their entirety. In cases of conflict, this specification, including definitions, will control. Furthermore, the materials, methods, and examples described herein are illustrative only and are not intended to be limiting. In one aspect, methods and systems are provided for the production of CD34-enriched cell populations with high stringency and with low stringency (eg, by bead-based magnetic selection with antibodies or functional fragments thereof that specifically bind to CD34). ) from biological samples under high stringency conditions and / or under low stringency conditions; and for the use of these CD34-enriched cell populations in the preparation of medicaments useful in the targeted gene therapy of diseases, disorders and impairments in a mammal and in humans in particular. In another aspect, the present invention provides a CAH transplant regimen for treating Fanconia anemia and disorders related to the FANC gene product based on the administration of CD34-enriched populations with high stringency and with low stringency where either or both populations CD34-enriched cells are contacted with a gene therapy vector (eg, transduced with a lentiviral vector harboring a segment of the FANCA, FANCC, or FANCG gene), or contacted with a gene therapy vector which induces site-specific repair of FANC genes (eg, CRISP-Cas). In some embodiments, the biological samples are peripheral blood or bone marrow obtained from a subject, eg. eg, the subject to be treated. In certain embodiments, the biological samples are peripheral blood obtained after the subject has been treated with G-CSF, plerifaxor, or a combination of G-CSF and plerifaxor. In one embodiment, one or both of the biological samples are prepared by performing apheresis on the peripheral blood one or more times. The present disclosure refers to these methods collectively as "mobilized leukapheresis." In some embodiments, selecting CD34+ cells under high stringency conditions comprises applying a biological sample to a capture matrix that binds CD34+ cells, washing the capture matrix one or more times using wash buffer, and eluting the population. CD34-enriched cell with high stringency from the capture matrix when using an elution buffer. In some cases, the biological sample is reapplied to the capture matrix one or more times, such as 2, 3, 4, 5, or 6 times. In one embodiment, the application step is carried out at 5-10 mL / min, 5-15 mL / min, 15-20 mL / min, 20-25 mL / min, or 25-30 mL / min. In particular embodiments, the elution step is carried out at 5-10 mL / min, 5-15 mL / min, 15-20 mL / min, 25-25 mL / min, or 25-30 mL / min. In one embodiment, the application step is carried out at qi yni η / ηζηζ / Ε / γ at 10-20 mL / min. In one embodiment, the elution step is carried out at 20 mL / min. In some embodiments, the washing step comprises washing the capture matrix one or more times using a wash buffer. In some cases, the wash buffer comprises a volume of at least 100 mL, at least 200 mL, at least 300 mL, at least 400 mL, at least 500 mL, or more. In one embodiment, the wash step is carried out at 5-10 mL / min, 5-15 mL / min, 15-20 mL / min, 20-25 mL / min, or 25-30 mL / min. In one embodiment, the wash step is carried out at 10-20 mL / min. In some embodiments, the wash buffer is phosphate buffered saline (PBS) with, optionally, ethylenediaminetetraacetic acid (EDTA) and / or, optionally, human serum albumin, eg, at a concentration of approximately 2.5% w / v. . In some embodiments, the elution buffer is phosphate buffered saline (PBS) with, optionally, ethylenediaminetetraacetic acid (EDTA) and / or, optionally, human serum albumin, eg, at a concentration of approximately 2.5% w / v. . In some embodiments, the wash buffer and elution buffer are hypotonic. In some embodiments, selecting CD34+ cells under low stringency conditions comprises applying a biological sample to a capture matrix that binds CD34+ cells, allowing an unbound fraction of the biological sample to flow through the capture matrix, and eluting the CD34-enriched cell population with low stringency from the capture matrix when using an elution buffer. In one embodiment, the application step is carried out at 1-2 mL / min, 2-3 mL / min, 1-2 mL / min, 1-2 mL / min, 5-10 mL / min, 5- 15 mL / min or 15-20 mL / min. In one embodiment, the elution step is carried out at 5-10 mL / min, 5-15 mL / min, 15-20 mL / min, 25-25 mL / min, or 25-30 mL / min. In one embodiment, the application step is carried out at 10-20 mL / min. In some embodiments, the application step is carried out at a flow rate of about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90% or lower than the flow rate under high stringency conditions, e.g. g., a flow rate at least 10% lower, at least 20% lower, at least 30% lower, at least 40% lower, at least 50% lower, at least 60% lower, at least least 70% lower, at least 80% lower, or at least 90% lower than the flow rate under high stringency conditions. In some embodiments, the washing step comprises washing the capture matrix one or more times using a wash buffer. In some cases, the wash buffer comprises a volume of 500 mL, 400 mL, 300 mL, 200 mL, 100 mL or less, e.g. eg, less than 500 mL, less than 400 mL, less than 300 mL, less than 200 mL, or less than 100 mL. In some cases, the washing step is omitted. In one embodiment, the wash step is carried out at 5-10 mL / min, 5-15 mL / min, 15-20 mL / min, 20-25 mL / min, or 25-30 mL / min. In one embodiment, the wash step is carried out at 10-20 mL / min. In some embodiments, the wash buffer is phosphate buffered saline (PBS) with, optionally, ethylenediaminetetraacetic acid (EDTA) and / or, optionally, human serum albumin, eg, at a concentration of approximately 2.5% w / v. . In some embodiments, the elution buffer is phosphate buffered saline (PBS) with, optionally, ethylenediaminetetraacetic acid (EDTA) and / or, optionally, human serum albumin, eg, at a concentration of approximately 2.5% w / v. . In some embodiments, the wash buffer and elution buffer are hypotonic. Ql 7ΠΙ η / η7Π7 / Ε / Υ In some embodiments, selection is carried out by bead-based magnetic selection. In one embodiment, antibodies or functional fragments thereof that specifically bind to CD34 are used for selection, e.g. g., bead-based magnetic selection. Selection, in some cases, is carried out using a flow rate of 10-20 mL / min. In some cases, the flow rate is 1.5, 10, 15, 20, 25, 30 or greater mL / min, or anything in between. In embodiments, the high stringency CD34-enriched cell population is contacted with the recombinant gene therapy vector; the low stringency CD34-enriched cell population is contacted with the recombinant gene therapy vector; or both high stringency and low stringency CD34-enriched cell populations are contacted with the recombinant gene therapy vector. In particular embodiments, the vector is a virus, a liposome, or a lipid or lipid-like nanoparticle. In some cases, the virus is a lentivirus, an adeno-associated virus, an adenovirus, or a spumavirus. In some embodiments, the percentage of CD34+ cells in the high stringency CD34-enriched cell population is two to four times greater than the percentage of CD34+ cells in the low stringency CD34-enriched cell population. In embodiments of the methods or systems of the present invention, the recombinant gene therapy vector comprises a polynucleotide sequence comprising in the following order from 5' to 3': (a) a eukaryotically active promoter sequence, and (b) a sequence encoding a human FANC gene polypeptide, or a fragment and functional variant thereof; and the sequence encoding the human FANC gene polypeptide or fragment or functional variant thereof is operably linked to the eukaryotically active promoter sequence. In some embodiments, the FANC gene is selected from FANCA, FANCC, and FANCG. In one embodiment, the method inhibits the development of, arrests the progression of, and / or reverses the progression of a hematologic manifestation of a disease or disorder (eg, Fanconi anemia) in the subject; and, optionally, the hematologic manifestation of Fanconi anemia is selected from one or more of bone marrow failure (BMF), thrombocytopenia, leukopenia, pancytopenia, neutropenia, and anemia. In one embodiment, the method causes the progressive increase of gene-modified Franconian anemia cells (or cells from a subject suffering from another disease or disorder, such as a myeloproliferative disorder or immunodeficiency disorder) over time. In one embodiment, the method causes recovery of one or more hematologic parameters (eg, hemoglobin) that had decreased in the subject prior to administration of the high stringency CD34-enriched cell population and the CD34-enriched cell population. with low stringency to the subject. In one embodiment, the method causes recovery of one or more hematopoietic lineages that had been decreased in the subject prior to administration of the high stringency CD34-enriched cell population and the low stringency CD34-enriched cell population to the subject; and this one or more hematopoietic lineages may comprise one or more of lymphocytes, eosinophils, neutrophils, erythrocytes, and platelets. In some cases, recovery of specific cell populations is achieved. Recovery can be monitored by various methods known in the art, such as qi yni η / ηζηζ / Ε / γ flow-assisted cell separation, cytometry or microscopy. The present invention further provides compositions and systems for use in any of the embodiments of these methods. The present invention provides CD34-enriched cell populations for use in a medicament, including, but not limited to, CD34-enriched cell populations transduced with a gene therapy vector, e.g. eg, a gene therapy vector comprising a polynucleotide sequence encoding a human FANC protein or a variant or functional fragment thereof. As used herein, "high stringency" or "high stringency conditions" refers to a method of enriching a cell population intended to generate substantial cell enrichment for cells expressing a particular biomarker, e.g. eg CD34. For example, “high stringency” CD34 enrichment used clinically results in a mean of: 61.6% and a median of: 65.7% yield of CD34+ cells and a mean of: 88.5% and a median of of: 95.9% relative purity (N=166) (Clin Lab. 2016 Jul 1 ;62(7) :1243-1248 (PMID: 28164638)). "High stringency" refers to a process with the goal of substantial enrichment of a relatively rare cell type, CD34+, which typically comprises between 0.2-2% of the cell product in a mobilized leukapheresis or bone marrow harvest. High stringency enrichment of CD34+ cells from mobilized leukapheresis or bone marrow extraction targets final CD34+ percentages that have increased from 0.2-2% to >80%. To accomplish this, after the initial application of a biological sample to a capture matrix, repeated buffer exchanges, referred to herein as "washes," are performed with the goal of removing loosely or non-specifically attached cells to the capture matrix. capture. Cells are generally removed from the capture matrix and reapplied for each wash cycle. Withdrawal and reapplication can be accomplished manually by pipetting from tubes or automatically by using a pump and tubing system. For example, using Quad Technologies MagCloudz® coupled with the Dynabeads® magnetic cell separation system, cell-magnetic particle complexes are separated into tubes on a magnetic machine and washes are done manually. Using the Miltenyi Biotec CliniMACS® system, a preconfigured automated program applies the cell-magnetic particle complexes to a magnetic column in a tubing set and washes / reapplications are done using a valved pump system. In certain embodiments, selection under high stringency conditions can be performed on various instruments, including, without limitation, Miltenyi Biotec MACSQuant Tyto®, Quad Technologies MagCloudz®, GE Sepax® Cell Separation System, Cell Separation System Terumo Elutra® Cell, COBE Spectra® Cell Sorter, SynGen LAB® or WASH® Systems, Fresenius-Kabi Lovo®, Miltenyi Biotec CliniMACS® System, or CliniMACS Prodigy® System. Selection can be carried out in a laboratory or at a point of care. Detailed methods for the preparation and enrichment of cells and cell populations, including illustrative methods for the selection of CD34+ cells under high stringency conditions, are described, e.g. e.g., in international patent publication no. WO 2016 / 118780. An illustrative selection method useful for high stringency selection is provided in US Pat. 8,727,132. qi yni η / ηζηζ / Ε / γ In a high stringency enrichment protocol, a biological sample comprising CD34+ cells is labeled with a CD34 labeling reagent, e.g. eg, directly conjugated immunomagnetic beads. The biological sample can be suspended in a suitable fluid, such as, without limitation, phosphate buffered saline (PBS) with, optionally, ethylenediaminetetraacetic acid (EDTA) at a buffer pH and isotonicity compatible with cell viability. In some cases, the used fluid also contains human serum albumin at a suitable concentration, such as about 2.5%. Using a magnetically activated cell sorting (MACS) technology, the biological sample, after it has been labelled, is applied to a column, the column containing magnetically susceptible or ferromagnetic material. Using the MACS system, the magnetically susceptible or ferromagnetic material in the column retains the target cells without affecting the ability of non-target cells to flow through the column and out. Such magnetically susceptible or ferromagnetic materials include alloy iron, steel, cobalt nickel and other ferromagnetic rare earth metals thereof. Those skilled in the art will appreciate that such materials can be magnetized and demagnetized without drawbacks. In some embodiments, the biological sample is recirculated over the magnetically susceptible or ferromagnetic material one or more times. After loading onto the column, bound cells are washed, eluted and / or loaded onto the column at a slow rate to increase the purity of the spiked fraction. Suitable wash buffers include PBS with (optionally) EDTA and (optionally) human serum albumin. Any components of the labeled biological sample that are removed during the wash steps are collected in the waste bag or “non-target”. After appropriate washing steps, the high stringency spiked cells are eluted into the target cell pocket. As used herein, "low stringency" or "low stringency conditions" refers to a method of enriching a cell population intended to generate a cell enrichment for cells expressing a particular biomarker, e.g. eg CD34, in a manner that preserves a higher yield of the enriched cell population than achieved by high stringency selection, at the expense of enrichment of cells expressing the biomarker compared to other cells in the biological sample, i.e. , enrichment reduced. By definition, the enrichment volume under high stringency conditions is greater than the enrichment volume under low stringency conditions. The volume of cell enrichment, e.g. eg, CD34+ cells, in the cell population spiked with (CD34 or other marker) with high stringency is, in some cases, 2, 2.25, 2.5, 2.75, 3, 3.25, 3.5 , 3.75, or 4-fold greater than the volume of enrichment CD34+ cells in the cell population spiked with (CD34 or other marker) at low stringency. In one embodiment, the volume of cell enrichment, e.g. eg, CD34+ cells, in the cell population spiked with (CD34 or other marker) at high stringency is 2 to 4-fold greater than the volume of enrichment CD34+ cells in the cell population spiked with (CD34 or other marker) at low stringency. In certain embodiments, selection under low stringency conditions can be performed on various instruments, including, without limitation, Miltenyi Biotec MACSQuant Tyto®, Quad Technologies MagCloudz®, GE Sepax® Cell Separation System, Cell Separation System Terumo qi / ni n / nznz / B / v cell phone Elutra®, COBE Spectra® Cell Sorter, SynGen LAB® or WASH® Systems, Fresenius-Kabi Lovo®, Miltenyi Biotec CliniMACS® System, or CliniMACS Prodigy® System. Selection can be carried out in a laboratory or at a point of care. In a low stringency enrichment protocol, a biological sample comprising CD34+ cells is labeled with a CD34 labeling reagent, e.g. eg, directly conjugated immunomagnetic beads. Using a magnetically activated cell sorting (MACS) technology, the biological sample, after it has been labeled, is applied to a column containing magnetically susceptible or ferromagnetic material at a lower flow rate than in high stringency enrichment. As in high stringency enrichment, the magnetically susceptible or ferromagnetic material in the column retains the target cells without affecting the ability of non-target cells to flow through the column and out. In some embodiments, the biological sample is recirculated over the magnetically susceptible or ferromagnetic material one or more times. After loading the column, for low stringency enrichment, bound cells are washed at a lower stringency. The bound cells are then eluted into a collection bag. In an illustrative embodiment, low stringency enrichment is accomplished by modifying the standard operating procedure of the MACS system so that a computer program in "depletion mode" intended to achieve high stringency depletion (i.e., challenge target cells). ) instead achieve enrichment with low stringency. Operating a MACS system in depletion mode causes target cells in the biological sample to bind to magnetically susceptible or ferromagnetic material on the column by using slow column loading and lower stringency wash steps than operating in depletion mode. of enrichment. The MACS system discharges the non-target cells towards the washing bag or called "target". The depletion mode program then moves the outlet valve to direct fluid toward the so-called "non-target" bag and then demagnetizes the column. The continuous application of fluid on the demagnetized column causes the elution of a CD34+-enriched cell population, which has been enriched under low stringency conditions, into the so-called "non-target" pocket, which when using this method collects the target cells. Those skilled in the art will recognize that this low stringency enrichment method can be performed on a number of instruments, including, without limitation, the Miltenyi Biotec MACSQuant Tyto®, Quad Technologies MagCloudz®, the GE Sepax® Cell Separation System, the Terumo Elutra® Cell Separation System, COBE Spectra® Cell Separator, SynGen LAB® or WASH® Systems, Fresenius-Kabi Lovo®, Miltenyi Biotec CliniMACS® System, or CliniMACS Prodigy® System. Those skilled in the art will be able to reprogram, without undue experimentation, the software of a system such as MACs such that the outlet valve directs the flow through the initial binding stage to the debris bag or "non-target" (and not into the target bag) and direct the low stringency eluted CD34-enriched population into the “target” bag. In fact, the enrichment with low stringency is then carried out in separation mode without the usual washing steps of conventional MACs programs. A "vector", as used herein, refers to a macromolecule or association qi jm η / ηζηζ / Ε / γ of macromolecules that comprises or is associated with a polynucleotide and that can be used to mediate delivery of the polynucleotide to a cell. Illustrative vectors include, for example, plasmids, viral vectors (eg, retroviral vectors, such as lentiviral vectors), liposomes, and other gene delivery vehicles. The term "LV" is an abbreviation for lentivirus and can be used to refer to the virus itself or to derivatives of it. The term encompasses all naturally occurring and recombinant forms and subtypes, except where otherwise required. As used herein, the term "gene" or "coding sequence" refers to a nucleotide sequence in vitro or in vivo that encodes a gene product. In some instances, the gene consists or consists essentially of the coding sequence, ie, the sequence that codes for the gene product. In other instances, the gene comprises an additional non-coding sequence. For example, the gene may or may not include regions before and after the coding region, e.g. 5' untranslated sequences (5' UTR) or “leaders” and 3' UTR or “tail” sequences, as well as interspersed sequences (introns) between individual coding segments (exons). As used herein, a "therapeutic gene" refers to a gene that, when expressed, confers a beneficial effect on the cell or tissue in which it is present, or on a mammal in which the gene is expressed. Examples of beneficial effects include ameliorating a sign or symptom of a condition or disease, preventing or inhibiting a condition or disease, or conferring a desired characteristic. Therapeutic genes include genes that correct a genetic deficiency in a cell or mammal. As used herein, a transgene is a gene that is delivered to a cell by a vector. As used herein, the term "gene product" refers to the desired expression product of a polynucleotide sequence, such as an interfering polypeptide, peptide, protein, or RNA, including small interfering RNA (siRNA). ), miRNA, or short bracketed RNA (shRNA). In certain embodiments, the gene product is a product of a therapeutic gene, which, when expressed, confers a beneficial effect on the cell or tissue in which it is present, or on a mammal in which the gene is expressed. As used herein, the terms "polypeptide", "peptide" and "protein" refer to amino acid polymers of any length. The terms also encompass an amino acid polymer that has been modified; for example, disulfide bond formation, glycosylation, lipidation, pegylation, phosphorylation, or conjugation with a tagging component. By "comprising / comprising" is meant that the mentioned elements are necessary in, for example, the composition, method, kit, etc., but other elements may be included to form, for example, the composition, method, kit, etc. within the scope of the claim. For example, an expression cassette "comprising" a gene encoding a therapeutic polypeptide operably linked to a promoter is an expression cassette that can include elements other than the gene and promoter, e.g. eg, a polyadenylation sequence, enhancer elements, other genes, linker domains, etc. For example, a method for preparing or treating "comprising" preparing a cell population enriched with qi and ni η / ηζηζ / Ε / γ CD34 is a method that other steps may include in others to prepare a CD34-enriched cell population, e.g. eg, administering an agent to mobilize stem cells, administering induction therapy, or co-administering a drug as a combination therapy. The term "comprising" or "comprising" as used herein in reference to low stringency conditions should not be construed to allow additional high stringency selection to be applied to the same sample during the same selection step. . It will be understood that performing a selection under low stringency conditions and high stringency conditions will result in a high stringency selection, while low stringency selection is expressly defined herein as excluding a selection under high stringency conditions. Preparing a low stringency CD34-enriched cell population by selecting CD34+ cells under low stringency conditions can include other method steps in an open manner, as long as loading of the biosample onto the column and elution of the cell population spiked with CD34 at low stringency from the column, the column did not lift under high stringency conditions. By “consists essentially of” is meant a limitation to the scope of, for example, the described composition, method, kit, etc., to specified materials or steps that do not materially affect the basic characteristic(s)( s) and new(s) of, for example, the composition, method, kit, etc. For example, an expression cassette "consisting essentially of" a gene encoding a therapeutic polypeptide operably linked to a promoter and polyadenylation sequence may include additional sequences, e.g. eg, linker sequences, provided they do not materially affect the transcription or translation of the gene. As a further example, a variant or mutant polypeptide fragment "consisting essentially of" a named sequence has the amino acid sequence of the named sequence plus or minus about 10 amino acid residues at the sequence boundaries depending on the length of the unmodified polypeptide. complete from which it was derived, p. 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 residues less than the listed limiting amino acid residue or 1,2, 3, 4, 5, 6, 7, 8, 9, or 10 residues other than the limiting amino acid residue mentioned. It is understood by "consists of" the exclusion of the composition, method or kit of any element, step or ingredient not specified in the claim. For example, an expression cassette "consisting of" a gene encoding a therapeutic polypeptide operably linked to a promoter and a post-transcriptional regulatory element consists only of the promoter, the polynucleotide sequence encoding the therapeutic polypeptide, and the post-transcriptional regulatory element. As a further example, a polypeptide "consisting of" a named sequence contains only the named sequence. As used herein "bone marrow cells" or "bone marrow stem cells" refers herein to cells obtained directly from the bone marrow, such as by biopsy, and cells obtained from peripheral blood that originated in the bone marrow, e.g. For example, after mobilization. An "expression vector" as used herein encompasses a vector, e.g. eg, plasmid, minicircle, viral vector, liposome and the like as described above or as known in the art, comprising a polynucleotide encoding a gene product of interest, and used for qi and ni η / ηζηζ / Ε / γ producing expression of a gene product in an intended target cell. An expression vector also comprises control elements operably linked to the coding region to facilitate expression of the gene product in the target. The combination of control elements, e.g. eg, promoters, enhancers, UTRs, miRNA targeting sequences, etc., and a gene or genes to which they are operatively linked for expression is sometimes referred to as an "expression cassette". Many of these control elements are known and available in the art or can be readily constructed from components that are available in the art. A "promoter" as used herein encompasses a DNA sequence that directs RNA polymerase binding and thereby promotes RNA synthesis, ie, a minimal sequence sufficient to drive transcription. Promoters and corresponding protein or polypeptide expression may be ubiquitous, ie, strongly active in a wide range of cells, tissues, and species or cell-type-specific, tissue-specific, or species-specific. Promoters can be "constitutive", ie continuously active, or "inducible", ie the promoter can be turned on or off by the presence or absence of biotic or abiotic factors. Also included in the nucleic acid constructs or vectors of the invention are enhancer sequences that may or may not be contiguous with the promoter sequence. Enhancer sequences influence promoter-dependent gene expression and can be located in the 5' or 3' regions of the wild-type gene. An "enhancer", as used herein, encompasses a cis-acting element that stimulates or inhibits the transcription of adjacent genes. An enhancer that inhibits transcription is also called a "silencer." Enhancers may function (ie, be associated with a coding sequence) in any orientation, at distances of up to several kilobase pairs (kb) from the coding sequence and from a position downstream of a transcribed region. A "termination signal sequence" as used herein encompasses any genetic element that causes RNA polymerase to terminate transcription, such as, for example, a polyadenylation signal sequence. As used herein, the terms "functionally linked" or "operably linked" refer to a juxtaposition of genetic elements, e.g. eg, promoter, enhancer, termination signal sequence, polyadenylation sequence, etc., where the elements are in a relationship that allows them to function as expected. For example, a promoter is operably linked to a coding region if the promoter helps initiate transcription or expression of the coding sequence. There may be residues interspersed between the promoter and the coding region, as long as this functional relationship is maintained. As used herein, the term "heterologous" means derived from an entity genotypically distinct from the rest of the entity with which it is being compared. For example, a polynucleotide introduced by genetic manipulation techniques into a plasmid or vector derived from a different species is a heterologous polynucleotide. As a further example, a promoter that is removed from its natural coding sequence and operatively linked to a coding sequence with the Ql 7ΠΙ η / η7Π7 / Ε / Υ which is not naturally bound is a heterologous promoter. Thus, for example, an LV vector that includes a heterologous nucleic acid encoding a heterologous gene product is an LV vector that includes a nucleic acid that is not normally included in naturally occurring LV, and the encoded heterologous gene product is a gene product not normally encoded by a naturally occurring LV. The term "endogenous" as used herein with reference to a nucleotide molecule or gene product refers to a nucleic acid sequence, e.g. eg, gene or genetic element or gene product, e.g. eg, RNA, protein, which naturally originates in or is associated with a virus or host cell. The term "native" as used herein refers to a nucleotide sequence, e.g. eg, gene or gene product, e.g. eg, RNA, protein, which is present in a natural virus or cell. The term "variant", as used herein, refers to a mutant or variant of a reference polynucleotide or polypeptide sequence, for example, a naturally occurring polynucleotide or polypeptide sequence, i.e., having less than 100% identicality. sequence identity to the reference polynucleotide or polypeptide sequence. In other words, a variant comprises at least one amino acid difference (eg, amino acid substitution, amino acid insertion, amino acid deletion) from a reference polynucleotide sequence, e.g. eg, a natural polynucleotide or polypeptide sequence. For example, a variant can be a polynucleotide that has 70% or more sequence identity to a full-length natural polynucleotide sequence, e.g. eg, 75% or 80% or greater identity, such as 85%, 90%, or 95% or greater, eg, 98% or 99% identity to the full-length natural polynucleotide sequence. As a further example, a variant may be a polypeptide having 70% or more sequence identity to a full-length natural polypeptide sequence, e.g. eg, 75% or 80% or greater identity, such as 85%, 90%, or 95% or greater, eg, 98% or 99% identity to the full length natural polypeptide sequence. Variants may also include variant fragments of a reference sequence, e.g. g ., natural, which share 70% or more sequence identity with a fragment of the reference sequence, e.g. eg, natural, p. eg, an identity of 75% or 80% or more, such as 85%, 90% or 95% or more, eg, 98% or 99% identity with the natural sequence. As used herein, the terms "biological activity" and "biologically active" refer to the activity attributed to a particular biological element in a cell. For example, the "biological activity" of an "immunoglobulin", "antibody" or fragment or variant thereof refers to the ability to bind to an antigenic determinant and thereby facilitate immune function. As a further example, the biological activity of a polypeptide or functional fragment or variant thereof refers to the ability of the polypeptide or functional fragment or variant thereof to carry out its natural functions of, e.g. g., binding, enzymatic activity, etc. As a third example, the biological activity of a gene regulatory element, eg. eg, promoter, enhancer, kozak sequence and the like, refers to the ability of the regulatory element or functional fragment or variant thereof to regulate, i.e. promote, enhance or activate translation of, respectively, the expression of the gene at which is functionally qi jm η / ηζηζ / Ε / γ linked. The terms "administer" or "introduce" as used herein refer to the delivery of a cell population to a subject, e.g. eg, by transfusion of the cell population into the subject's blood intra-arterially or intravenously. The cell population can be administered in various solutions, such as saline. In some embodiments, the solution used will be isotonic with respect to the subject's blood and pH regulated. "Transformation" is typically used to refer to the process of introducing heterologous DNA into bacteria or another cell, or to cells that express an oncogene and have therefore gone into a mode of continuous multiplication such as tumor cells. A vector used to "transform" a cell can be a plasmid, virus, or other vehicle. Typically, a cell is referred to as "transduced", "infected;" "transfected" or "transformed" depending on the medium used for the administration, introduction or insertion of the heterologous DNA (ie, the vector) into the cell. The terms "transduced", "transfected" and "transformed" may be used interchangeably herein regardless of the method of introduction of the heterologous DNA. The term "host cell" as used herein refers to a cell that has been transduced, infected, transfected, or transformed with a vector. The vector can be a plasmid, a virus particle, a phage, etc. Culture conditions, such as temperature, pH, and the like, are those used above with the host cell selected for expression and will be apparent to those skilled in the art. It will be appreciated that the term "host cell" refers to the original transduced, infected, transfected or transformed cell and its progeny. The terms "treatment", "treating" and the like are used herein to mean generally obtaining a desired pharmacological and / or physiological effect. The effect may be prophylactic in the sense of completely or partially preventing a disease or symptom thereof, e.g. eg, reduce the probability that the disease or its symptom appears in the subject, and / or it can be therapeutic in the sense of a partial or complete cure of a disease and / or adverse effect attributable to the disease, or the slowing down the progression of the disease. "Treatment", as used herein, encompasses any treatment of a disease in a mammal, and includes: (a) preventing the disease from occurring in a subject who may be predisposed to the disease, but has not yet been diagnosed who suffers from it; (b) inhibit the disease, ie stop its development; or (c) alleviate the disease, ie, cause regression of the disease. The therapeutic agent can be administered before, during or after the onset of the disease or injury. Treatment of ongoing disease, where treatment stabilizes or reduces the patient's undesirable clinical symptoms, is of particular interest. Said treatment, desirably, is carried out before the total loss of function of the affected tissues. The subject treatment can be administered during the symptomatic stage of the disease and, in some cases, after the symptomatic stage of the disease. In certain embodiments, the treatment is administered to the subject after genetic testing has identified that the subject has a disease-associated or disease-causing mutation, e.g. eg, FA. qi yni η / ηζηζ / Ε / γ The terms "individual", "host", "subject" and "patient" are used interchangeably herein, and refer to a mammal, including, but not limited to, humans and non-human primates, including apes and humans; sporting mammals (eg, horses); farm mammals (eg, sheep, goats, etc.); pet mammals (dogs, cats, etc.); and rodents (eg, mice, rats, etc.). As used herein, "fragment" as applied to a polypeptide will typically have at least 10 amino acid residues, more typically at least 20 residues, and preferably at least 30 (eg, 50) residues. residues in length, but less than the entire intact sequence. The fragments can be generated by methods known to those skilled in the art, e.g. eg, by enzymatic digestion of a naturally occurring or recombinant protein, by recombinant DNA techniques using an expression vector encoding a defined fragment, or by chemical synthesis. The ability of a candidate fragment to bind to a particular DNA sequence can be assessed by methods described herein. Purified fragments or antigenic fragments can be used to isolate regulatory regions or to generate new regulatory enzymes (eg, using multiple functional fragments from different enzymes), as well as to generate antibodies, all using standard protocols known to those skilled in the art. in technique. As used herein, "functional fragment" is intended to encompass not only those peptide fragments that retain biological activity, but also those peptide fragments that retain binding specificity to a particular nucleotide sequence. A "functional fragment" of an anti-CD34 antibody is a fragment capable of binding CD34 molecules on the cell surface with sufficient affinity and specificity to allow selection or enrichment of CD34+ cells. The terms "identical" or "percent identity" in the context of two or more nucleic acid or polypeptide sequences, refer to two or more sequences or subsequences that are the same or have a specified percentage of nucleotide or amino acid residues that they are equal, when compared and aligned for maximum correspondence. To determine percent identity, sequences are aligned for optimal comparison purposes (eg, gaps can be introduced into the sequence of a first amino acid or nucleic acid sequence for optimal alignment with a second amino acid or acid sequence). nucleic). The amino acid or nucleotide residues at the corresponding amino acid or nucleotide positions are then compared. When a position in the first sequence is occupied by the same amino acid residue or nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences (ie, % identity = number of identical positions / total number of positions (eg, overlapping positions) x 100). . In some embodiments, the two sequences are the same length. An illustrative computer program for performing optimal alignment, taking gap penalties into account, is the GCG Wisconsin Bestfit package (University of Wisconsin, USA; qi jm η / ηζηζ / Ε / γ Devereux et al. (1984) Nucleic Acids Res. 12: 387). Examples of other software that can perform sequence comparisons include, but are not limited to, the BLAST package (see Ausubel et al. (1999) ibid - Ch. 18), FASTA (Atschul et al. (1990) J. Mol. Biol. 403-410), the GENEWORKS comparison toolkit, the GCG Bestfit program and BLAST 2 Sequences can be used (see FEMS Microbiol. Lett. (1999) 174: 247-50; FEMS Microbiol. Lett. (1999) 177: 187-8). A scaled similarity score matrix can be used that assigns scores to each pairwise comparison based on chemical similarity or evolutionary distance. An example of such an array is the BLOSUM62 array - which is the default array for the BLAST suite. GCG Wisconsin programs can use the public defaults or a custom symbol comparison table if supplied (see user manual for details). The term "substantially identical," in the context of two nucleic acids or polypeptides, refers to two or more sequences or subsequences that are at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% identity, or at least 99% identity (eg, as determined using one of the established methods infra). Unless otherwise indicated by the context, a "variant" is a polypeptide or fragment thereof that has one or more non-conservative or conservative amino acid substitutions with respect to a second polypeptide (also referred to as a "derivative"); or a polypeptide or fragment thereof that is modified by covalent coupling of a second molecule such as, e.g. eg, by coupling a heterologous polypeptide, or by glycosylation, acetylation, phosphorylation, and the like. Also included within the definition of "variant" are, for example, polypeptides containing one or more analogues of an amino acid (eg, unnatural amino acids and the like), polypeptides with unsubstituted linkages, as well as other known modifications. in the technique, natural and of non-natural origin. The various compositions and methods of the invention are described below. Although particular compositions and methods are exemplified herein, it will be understood that any of a number of alternative compositions and methods are applicable and suitable for use in practicing the invention. It will also be understood that an evaluation of the constructs and expression methods of the invention can be carried out using procedures standard in the art. The practice of the present invention employs, unless otherwise indicated, conventional techniques of cell biology, molecular biology (including recombinant techniques), microbiology, biochemistry, and immunology, which are within the purview of those skilled in the art. technique. Such techniques are fully explained in the literature, such as, "Molecular Cloning: A Laboratory Manual", second edition (Sambrook et al., 1989); "Oligonucleotide Synthesis" (M.J. Gait, ed., 1984); "Animal Cell Culture" (R.I. Freshney, ed., 1987); "Methods in Enzymology" (Academic Press, Inc.); "Handbook of Experimental Immunology" (D.M. Weir & C.C. Blackwell, eds.); "Gene Transfer Vectors for Mammalian Cells" (J. M. Miller & Μ. P. Calos, eds., 1987); "Current Protocols in Molecular Biology" (F.M. Ausubel et al., eds., 1987); "PCR: The Polymerase Chain Reaction", (Mullis et al., eds., 1994); and “Current Ql 7ΠΙ η / η7Π7 / Ε / Υ Protocols in Immunology" (J. E. Coligan et al., eds., 1991), each of which is expressly incorporated herein by reference. Various aspects of the invention are described below with reference to example applications for purposes of illustration. It will be understood that numerous specific details, relationships, and methods are set forth to provide a thorough understanding of the invention. One of skill in the relevant art, however, readily recognizes that the invention can be practiced without one or more of the specific details or by other methods. The present invention is not limited by the illustrated order of acts or events, since some acts may occur in different orders and / or simultaneously with other acts or events. Furthermore, not all of the illustrated acts or events are necessary to implement a methodology in accordance with the present invention. The terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit the invention. As used herein, the singular forms "a", "an" and "the" are intended to include the plural forms as well, unless the context clearly indicates otherwise. In addition, to the extent that the terms "including", "includes", "having", "has", "with" or variations thereof are used in the detailed description and / or claims, it is intended that said terms are inclusive in a similar way to the term “comprising / n”. The term "approximately" means within an acceptable error range for the particular value, as determined by one skilled in the art, which will depend in part on how the value is measured or determined, i.e., the limitations of the measurement system. . For example, "about" can mean within 1 or more than 1 standard deviation, depending on the practice in the art. Alternatively, "about" can mean a range of up to 20%, preferably up to 10%, more preferably up to 5%, and most preferably still up to 1% of a given value. Alternatively, particularly with respect to biological systems or processes, the term can mean within an order of magnitude, preferably within 5 times, and more preferably, within 2 times of a value. When particular values ​​are described in the application and claims, unless otherwise indicated, the term "approximately" should be assumed to mean within an acceptable error range for the particular value. All publications mentioned herein are incorporated herein by reference to describe and disclose the methods and / or materials in connection with which the publications are mentioned. This description shall be deemed to supersede any description in an incorporated publication to the extent of any inconsistency. It is further noted that claims can be written to exclude any optional elements. As such, this statement is intended to serve as the underlying background for the use of such proprietary terminology such as "solely," "only," and the like in connection with the mention of claim elements, or the use of a "negative" limitation. . The publications described herein are provided for disclosure only prior to the filing date of the present application. In addition, the release dates provided may differ from the actual release dates and qi / ni n / nznz / B / v may need to be confirmed independently. Unless otherwise indicated, all terms used herein have the same meaning as they would to a person skilled in the art and the practice of the present invention will employ techniques of microbiology and recombinant DNA technology. conventional, which are within the knowledge of a person skilled in the art. Methods for preparing, transducing, and using CD34+-enriched cell populations In one aspect, the disclosure provides methods for preparing cell populations enriched with CD34+ cells, including gene-modified CD34+ cells. In certain embodiments, the methods comprise preparing two CD34-enriched cell populations, one prepared using low stringency conditions and the other prepared using high stringency conditions. As demonstrated herein, the use of a combination of the low stringency CD34-enriched cell population and the high stringency CD34-enriched cell population advantageously results in an unexpectedly efficient reconstitution of CD34+ stem cells in a subject. In another aspect, the disclosure provides methods of treating a subject afflicted with a disease or disorder by providing the subject with a therapeutically effective amount of one or more cell populations enriched with CD34+ cells, including gene-modified CD34+ cells, wherein the cells Gene-modified C34+ encode an effective therapeutic agent for treating the disease or disorder. In particular embodiments, the therapeutic agent is a polypeptide or polynucleotide, e.g. eg, an RNA. In particular embodiments, CD34-enriched cell populations are prepared from CD34 cells obtained from the subject to be treated. In certain embodiments of the methods described herein, two cell populations enriched with CD34+ cells are produced, including a high stringency CD34-enriched cell population and a low stringency CD34-enriched cell population. These two cell populations can be kept apart or combined to produce a mixed cell population comprising the high stringency CD34-enriched cells and the low stringency CD34-enriched cells. In particular embodiments, either or both of the two cell populations are transduced with a gene therapy vector, e.g. eg, an LV vector encoding FANCA or a fragment or functional variant thereof. In particular embodiments, the cells may be from any mammalian species, e.g. eg, rodent (eg, mice, rats, gerbils, squirrels), rabbit, feline, canine, goat, sheep, pig, equine, bovine, primate, human. In certain embodiments, the cells may be from established cell lines or may be primary cells, where "primary cells," "primary cell lines," and "primary cultures" are used interchangeably herein to refer to cells and cultures. cells that have been derived from a subject and allowed to multiply in vitro for a limited number of passages, ie, divisions, of the culture. For example, primary crops are crops that may have undergone passages 0 times, 1 time, 2 times, 4 times, 5 times, 10 times, or 15 times, but not enough times to go through the crisis stage. Typically, the primary cell lines of the present invention are maintained for less than 10 passages in vitro. qi yni η / ηζηζ / Ε / γ In certain embodiments, the methods comprise preparing CD34-enriched cell populations from a first biological sample obtained from a subject. In one embodiment, the biological sample is a bone marrow sample. In another embodiment, the biological sample is peripheral blood. In particular embodiments, the biological sample, e.g. eg, peripheral blood, is obtained from the subject after mobilization of hematopoietic stem cells (HSCs). In one embodiment, HSCs and / or progenitor cells are mobilized by treating the subject with G-CSF or an analogue thereof, e.g. eg, in an amount and for a time sufficient to cause mobilization of the HSCs in the patient. HSCs and progenitor cells (HSPCs) in peripheral blood can be mobilized prior to collection of the biological sample. Peripheral blood HSCs and HSPCs can be mobilized by any method known in the art. Peripheral blood HSCs and HSPCs can be mobilized by treating the subject with any agent(s), described herein or known in the art, that increases the amount of HSCs and / or HSPCs circulating in the subject's peripheral blood. . A reference made throughout this specification to HSC or HSPC is intended to encompass both HSC and HSPC, unless otherwise indicated. For example, in particular modalities, peripheral blood is mobilized by treating the subject with one or more cytokines or growth factors (eg, G-CSF, kit ligand (KL), IL-I , IL-7, IL-8, IL-11, Flt3 ligand, SCF, thrombopoietin, or GM-CSF (such as sargramostim)). Different types of G-CSF that can be used in peripheral blood mobilization methods include filgrastim and the longer acting G-CSF: pegfilgrastim. In particular embodiments, peripheral blood is mobilized by treating the subject with one or more chemokines (eg, macrophage inflammatory protein-1 a (MIP1 a / CCL3)), chemokine receptor ligands (eg, chemokine receptor 2 ligands GROI3 and GR013M), chemokine receptor analogs (eg, stromal cell-derived factor-1 a (SDF-1 a) analogs proteins such as CTCE-0021, CTCE-0214 or SDF-1 to such as Met-SDF-113) or chemokine receptor antagonists (eg, antagonists (C-X-C motif) of chemokine receptor 4 (CXCR4, by its acronym in English) such as AMD3100). In particular embodiments, peripheral blood is mobilized by treating the subject with one or more anti-integrin signaling agents (eg, anti-very late antigen 4 (VLA-4) or anti-integrin molecule antibody). vascular cell adhesion 1 (VCAM-1) blocking function). In particular embodiments, peripheral blood is mobilized by treating the subject with one or more cytotoxic drugs such as cyclophosphamide, etoposide, or paclitaxel. In particular embodiments, peripheral blood can be mobilized by administering to a subject one or more of the agents noted above over a period of time. For example, the subject may be treated with one or more agents (eg, G-CSF) via injection (eg, subcutaneous, intravenous, or intraperitoneal), once daily or twice daily, for 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14 days prior to HSPC collection. In specific modalities, HSPCs are collected within 1,2, 3, 4, 5, 6,7, 8, 12, 14, 16, 18, 20, or 24 hours after the last dose of an agent used for mobilization. of HSPCs in peripheral blood. In particular embodiments, HSCs and HSPCs are mobilized by treating the subject with two or more different types of agents described above or known in the art, such as a growth factor (eg, G-CSF) and a growth factor antagonist. chemokine receptor (eg, qi jm η / ηζηζ / Ε / γ receptor antagonist CXCR4 such as AMD3100), or a growth factor (eg, G-CSF or KL) and an anti-integrin agent (p eg, function-blocking antibody to VLA-4). In one embodiment, HSCs and / or progenitor cells are mobilized by treating the subject with G-CSF or an analog thereof. In one embodiment, the G-CSF is filgrastim. In one embodiment, HSCs and / or progenitor cells are mobilized by treating the subject with plerixafor. In a certain embodiment, HSCs and / or progenitor cells are mobilized using a combination of filgrastim and plerixafor, by filgrastim alone, or by plerixafor alone. In particular embodiments, different types of mobilization agents are administered simultaneously or sequentially.For additional information on peripheral blood mobilization methods see, p. eg, Craddock et al., 1997, Blood 90(12):4779-4788; Jin et al., 2008, Journal of Translational Medicine 6:39; Pelus, 2008, Curr. Opinion. Hematol. 15(4):285-292; Papayannopoulou et al., 1998, Blood 91(7):2231-2239; Tricot et al., 2008, Haematologica 93(11):1739-1742; and Weaver et al., 2001, Bone Marrow Transplantation 27(2):S23-S29). In certain embodiments, peripheral blood is obtained through a syringe or catheter inserted into a subject's vein. For example, peripheral blood can be collected using an apheresis machine. Blood flows from the vein through the catheter to an apheresis machine, which separates leukocytes, including HSPCs, from the rest of the blood and then returns the rest of the blood to the subject's body. Apheresis can be carried out over several days (eg, 1-5 days) until enough HSPCs have been collected. In certain embodiments, bone marrow is obtained from the subject's posterior iliac crest by needle aspiration (see, eg, Koda et al., 1984, J. Clin Invest. 73:1377-1384). In certain embodiments, a hematocrit level of the biological sample can be determined. The hematocrit level can be determined by centrifuging the sample within a treatment chamber to separate the RBCs from a sample into one layer so that the packed cell volume can be determined. It should be appreciated that the sample may be combined with an anticoagulant to help determine the hematocrit level and that such an anticoagulant may be added to the treatment chamber prior to or during centrifugation. Alternatively, the hematocrit level can be determined by measuring the optical properties of the sample. For example, a spectrometer can be used to analyze the sample. It should be appreciated that any type of known spectroscopic methods can be used to determine the hematocrit level such as, for example, Raman spectroscopy and / or light scattering techniques. In certain embodiments, the erythrocytes in the biological sample are depleted, e.g. eg, before preparing the one or more cell populations enriched with CD34+ cells from the biological sample. In some embodiments, cells that remain after depletion techniques are washed away. In another embodiment, non-specific IgG is given to washed cells. In some modalities, the non-specific IgG is phlebogamma. Two cell populations enriched with CD34+ cells can be produced by selecting one cell population with CD34+ cells under high stringency conditions and selecting another cell population with CD34+ cells under low stringency conditions, thus producing two cell populations, qi and ni η / ηζηζ / Ε / γ one is a high stringency CD34-enriched cell population and the other is a low stringency CD34-enriched cell population. The methods used to select for CD34+ cells can be positive selection, negative selection, or a combination of these. In certain embodiments, the biological sample obtained from the subject is divided into two samples, where one sample is used to prepare the high stringency CD34-enriched cell population, and the other sample is used to prepare the low stringency CD34-enriched cell population. . In other embodiments, the biological sample obtained from the subject is first subjected to low stringency CD34+ selection to prepare a low stringency CD34-enriched cell population, and then a portion of the low stringency CD34-enriched population is subjected to selection of CD34+ with high stringency to prepare a cell population enriched with CD34 with high stringency. The selection can be applied sequentially, e.g. eg, a selection of CD34-enriched cells under low stringency conditions may first be applied and then a selection from the resulting population of additional CD34-enriched cells under high stringency conditions. In other cases, a selection of CD34-enriched cells may be applied first under high stringency conditions and then a selection from the residual population of additional CD34-enriched cells under low stringency conditions. In some cases, cell populations can be divided such that low stringency or high stringency selection is applied to a fraction of cells previously subjected to high stringency or low stringency selection. In some cases, a biological sample is divided into two or more samples prior to selection for CD34-enriched cells under low or high stringency conditions. In some cases, two or more biological samples are mixed together prior to selection, including e.g. g., samples of bone marrow mobilized at different times, such as 1,2,3,4 or more days apart, or 1,2 or 3 weeks apart, or 1,2 or 3 months apart, or years apart. interval, even with other time increments. In cases, biological samples from different subjects are mixed, such as, e.g. eg, an autologous biological sample and a sample from an allogeneic donor. In each case, high stringency or low stringency selection is contemplated before or after mixing or splitting the biological samples or spiked cell populations, in all possible versions. In certain embodiments, the method comprises preparing a high stringency CD34-enriched cell population from a first biological sample obtained from the subject by selecting for CD34+ cells under high stringency conditions; and preparing a low stringency CD34-enriched cell population from a second biological sample obtained from the subject by selecting for CD34+ cells under low stringency conditions. In some embodiments, the percentage of CD34+ cells in the high stringency CD34-enriched cell population is between 1.5-fold, 2-fold, 2.5-fold, 3-fold, 3.5-fold, 4-fold, or in some instances 5-fold, 6-fold, 7-fold, or 8-fold greater than the percentage of CD34+ cells in the CD34-enriched cell population at low stringency. Various yields and purities of CD34+ cells can be achieved by the qi and ni η / ηζηζ / Ε / γ methods described. In some cases, selection of CD34+ cells under high stringency conditions results in high stringency CD34-enriched cell populations with yields of CD34+ cells compared to the input biological sample of at least 10%, 20%, 30%, 40 %, 50%, 60%, 70%, 80% or more, or anything in between; and / or in purity compared to the total number of cells in the sample spiked to at least about 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or more, or any value in between. In some cases, selection of CD34+ cells under high stringency conditions results in high stringency CD34-enriched cell populations with yields of CD34+ cells compared to the input biological sample of approximately 10-20%, 20-30% o 30% to 40% or any value in between; and / or in purity compared to the total number of cells in the sample spiked to at least about 20%, 30%, 40%, 50%, or any value in between. In particular embodiments, selection of CD34+ cells under high stringency conditions results in high stringency CD34-enriched cell populations with yields of CD34+ cells compared to the input biological sample of at least about 20%; and / or in purity compared to the total number of cells in the sample spiked to at least about 20% or at least about >30%. In some cases, selection of CD34+ cells under low stringency conditions results in low stringency CD34-enriched cell populations with yields of CD34+ cells compared to the input biological sample of at least 30, 40, 50, 60 %, 70%, 80%, 90%, 95% or more, or anything in between; and / or in purity as compared to the total number of cells in the sample spiked to at least about 5%, 10%, 15%, 25%, 40%, 50% or more, or any value in between. In some cases, selection of CD34+ cells under low stringency conditions results in low stringency CD34-enriched cell populations with yields of CD34+ cells compared to the input biological sample of greater than 30%, approximately 30% to 40%, 40% to 50% or 50% to 60% or anything in between; and in purity compared to the total number of cells in the spiked sample of at least about 3%, 5%, 8%, 10%, or any value in between. In particular embodiments, selection of CD34+ cells under low stringency conditions results in high stringency CD34-enriched cell populations with yields of CD34+ cells compared to the input biological sample of greater than 35%; and / or in purity compared to the total number of cells in the sample spiked to less than 30%, less than 25%, less than 20%, less than 10%, or less than 5%. In particular embodiments, selection of CD34+ cells under low stringency conditions results in low stringency CD34-spiked cell populations with purity compared to the total number of cells in the spiked sample of less than 1-30%, 1-20% , 1 -10%, 10-30%, 10-20% or 20-30%. In some embodiments, low stringency CD34-enriched cell populations further comprise at least neutrophils and B lymphocytes. In particular embodiments, high stringency and low stringency selection are performed by positive selection, e.g. eg, by using an agent that binds to CD34+ cells. In particular embodiments, the agent is in solution, while in other embodiments, the agent is attached to a solid surface qi yni η / ηζηζ / Ε / γ. In certain embodiments, the agent is attached to the surface of a magnetic bead. In some embodiments, the agent is an anti-CD34 antibody or functional fragment thereof. In certain embodiments, selection under high stringency conditions and / or low stringency conditions can be performed on various instruments, including, without limitation, Miltenyi Biotec MACSQuant Tyto®, Quad Technologies MagCloudz®, GE Cell Separation System Sepax®, Terumo Elutra® Cell Separation System, COBE Spectra® Cell Separator, SynGen LAB® or WASH® Systems, Fresenius-Kabi Lovo®, Miltenyi Biotec CliniMACS® System, or CliniMACS Prodigy® System. Selection can be carried out in a laboratory or at a point of care. Detailed methods for the preparation and enrichment of cells and cell populations, including illustrative methods for the selection of CD34+ cells under high stringency conditions, are described, e.g. e.g., in international patent publication no. WO 2016 / 118790. An illustrative selection method useful for high stringency selection is provided in US Pat. 8,727,132. In one embodiment, the instrument is a closed system device that includes material inlets (eg, sample, buffers, gas), at least one treatment chamber with centrifugation and cell incubation capabilities, a closed tubing assembly, a pump and a target cell selector. The control software allows the device to isolate, engineer, and formulate target cells ex vivo, in particular modalities, directly from a subject sample. In particular modalities, the selection process can be completed in 30 hours, in 25 hours or in 20 hours with minimal to no user participation. In particular modalities, the entire process is completed in 72 hours or in 64 hours. In particular embodiments, minimal user involvement means that between sample inputs into the device and retrieval of formulated genetically modified cells for administration to a subject, the user interacts with the device no more than 20, 15, 10, or 5 times. and / or interact with the device for no more than 12 hours, 10 hours, 8 hours, 5 hours, 4 hours, or 3 hours. Illustrative user interactions may include one or more of connecting a sterile tubing set; verify maintenance of a sterile, closed system; determine that a stage should be repeated (eg, sedimentation); verify the successful completion of a stage; allow a new stage to start after a process quality check; provide reagents for input into the device; and determine and / or calculate addition or removal volumes. Interactions can be measured in time, after sample receipt, by the amount of time the user spends actually preparing or interacting with the device. In certain embodiments, one or both of the high stringency CD34-enriched cell population and / or the low stringency CD34-enriched cell population is prepared using the CliniMACS® instrument, such as the CliniMACS® p|us instrument, which is a computer program controlled instrument that processes HSC apheresis. The CliniMACS® p|us instrument and related equipment and reagents are commercially available from Miltenyi Biotec GmbH, Bergisch Gladbach, Germany). The kit or reagents used include the CliniMACS® CD34 Antigen / Reagent, which is a solution containing an antibody conjugate consisting of a murine IgG monoclonal antibody directed to the class II epitope of the human CD34 antigen, which is chemically conjugated to Ql 7ΠΙ η / η7Π7 / Ε / Υ with dextran beads having an iron oxide / hydroxide core, which is used for selection or enrichment of CD34+ cells; CliniMACS® tubing, which are a single-use, sterile, disposable tubing set with two cell separation columns for processing up to 0.6x109 CD34+ cells from a total cell count not exceeding 60x109 leukocytes (standard scale) or up to 1.2x109 CD34+ cells out of a total number of cells not exceeding 120x109 leukocytes (large scale); and CliniMACS® PBS / EDTA buffer, which is a sterile, phosphate-buffered, isotonic saline solution, 1 mM EDTA, used as external transport and lavage fluid for in vitro apheresis processing of HSCs. Washes can be carried out using CliniMACS buffer comprising PBS and 2.5% human serum albumin. Procedures for using the CliniMACS® system are provided in the CliniMACS user manuals available on the Miltenyi website, including e.g. e.g., the CliniMACS® User Manual for the CliniMACS® CD34 Reagent System retrieved April 8, 2019 at https: / / www.miltenyibiotec.com / _Resources / Persistent / 2c28c84939f4ce793b29c9f2e897c0bb1a334c47 / LJ ser7o20Manual7o20for%20the%20CI¡ n¡MACS%20CD34%20Reagent%20System.pdf. In one embodiment, the high stringency CD34-enriched cell population is prepared by labeling cells using the CD34 reagent and then CD34+ cells are selected using a standard CliniMACS® CD34 enrichment program. In one embodiment, the low stringency CD34-enriched cell population is prepared using a modified version of a CliniMACS® depletion program. According to this embodiment, cells are labeled using the CD34 reagent, but a modified depletion program is run. After loading the labeled cells with the magnet on, the cell collection bag is removed and the collected cells are not used for transplantation. Instead, the magnet is turned off and an elution buffer is applied to the instrument causing CD34+ cells to elute, which are collected. In certain modes, compared to select mode, in depletion mode, the instrument loads more slowly (mL / min) and washes are done with lower stringency. In certain embodiments, one or both of the high stringency CD34-enriched cell population and / or the low stringency CD34-enriched cell population is transduced with a vector, e.g. eg, a gene therapy vector encoding a therapeutic agent, e.g. eg, by contacting one or both of the high stringency CD34-enriched cell population and / or the low stringency CD34-enriched cell population with the vector. In certain embodiments, cells are contacted with the vector for about 30 minutes, about 1 hour, about 1.5 hours, about 2 hours, about 2.5 hours, about 3 hours, about 3.5 hours, about 4 hours, about 5 hours, about 6 hours, about 7 hours, about 8 hours, about 12 hours, about 16 hours, about 18 hours, about 20 hours, about 24 hours, about 36 hours, about 48 hours, about 60 hours. In some modalities, cells are transduced for less than 60 hours, less than 48 hours, less than 36 hours, or less than 24 hours. In certain embodiments, cells may be contacted with the vector qi yni η / ηζηζ / Ε / γ one or more times, eg. eg, once, twice, three times, or more than three times, and the cells are allowed to incubate with the agent(s) for some amount of time after each contact event, e.g. eg, 16-24 hours, after this time the media is replaced with fresh media and the cells are grown further. Contacting the cells with the vector can occur in any culture media and under any culture conditions to promote cell survival. The culture may contain growth factors to which the cells are sensitive. Growth factors, as defined herein, are molecules capable of promoting the survival, multiplication and / or differentiation of cells, either in culture or in intact tissue, through specific effects on a transmembrane receptor. Growth factors include polypeptide and non-polypeptide factors. In certain embodiments, cells are contacted with an effective amount of gene therapy vector sufficient to achieve detectable levels of the encoded therapeutic agent. In particular embodiments, the therapeutic agent is a polypeptide or polynucleotide useful or effective for the treatment of a disease or disorder. In particular embodiments, the therapeutic agent is a polypeptide that is deregulated or mutated in cells obtained from the subject, e.g. eg, a FANC polypeptide for the treatment of AF. The effective amount can be determined empirically without drawbacks, e.g. eg, by detecting the presence or levels of the therapeutic agent, by detecting an effect on cell viability or function, etc. Typically, the expression of the therapeutic agent will be enhanced 2-fold or more, eg, 3-fold, 4-fold or 5-fold or more, in some instances, 10-fold, 20-fold or 50-fold or more, e.g. eg, 100-fold transduced cells compared to non-transduced cells. Any convenient gene therapy vector that can be used to deliver polynucleotide sequences to mammalian cells is encompassed by the gene therapy vectors of the present disclosure. For example, the vector may comprise single- or double-stranded nucleic acid, e.g. eg, single-stranded or double-stranded DNA. For example, the gene therapy vector can be DNA, e.g. eg, an unmodified DNA, e.g. eg, a plasmid, a minicircle, etc. The vector can comprise single-stranded or double-stranded DNA, including modified forms of RNA. In another example, the gene therapy vector can be an RNA, e.g. eg, an mRNA or modified mRNA. In particular embodiments, the gene therapy vector may be a viral vector derived from a virus, e.g. an adenovirus, an adeno-associated virus, a lentivirus (LV), a herpes virus, an alphavirus or a retrovirus, e.g. Moloney murine leukemia virus (M-MuLV), Moloney murine sarcoma virus (MoMSV), Harvey murine sarcoma virus (HaMuSV). murine mammary tumor virus (MuMTV), gibbon ape leukemia virus (GaLV), feline leukemia virus (FLV) ), spumavirus, Friend murine leukemia virus, murine stem cell virus (MSCV), or Rous sarcoma virus (RSV). Although modalities encompassing the use of LV are described in greater detail below, it is hoped that one skilled in the art will appreciate that similar knowledge and skill in the art may also be accessed through gene therapy vectors other than LV. In some embodiments, the qi / ni n / nznz / B / v gene therapy vector is a self-limiting LV. In particular, certain methods described herein relate to transducing one or both populations of stem cells or progenitor cells, e.g. eg, hematopoietic stem cells (HSCs) or hematopoietic progenitor cells (also referred to herein as "hematopoietic progenitors") with a gene therapy vector encoding and / or expressing a therapeutic polypeptide, e.g. eg, FANCA, where one population is prepared by selection under high stringency conditions and the other population is prepared by selection under low stringency conditions. In one embodiment, cell populations are enriched for CD34+ cells. In one embodiment, the HSCs or hematopoietic progenitors are from a subject with decreased or absent protein activity of one or more FANCA-encoded proteins. In one embodiment, the subject suffers from AF-A. In one embodiment, the endogenous HSC FANCA gene is deleted and / or mutated. In one embodiment, transducing a cell with a gene therapy vector causes integration into the cell's genome of an expression cassette comprising a promoter operably linked to a polynucleotide sequence encoding a therapeutic agent within the gene therapy vector. In some embodiments, transducing a cell with a gene therapy vector causes expression of the therapeutic agent, e.g. eg, a biologically active FANCA protein. For example, a biologically active FANCA protein is part of the FA core complex. In certain embodiments, a FANCA gene is delivered via a viral vector. In one embodiment, a FANCA gene is delivered via a lentiviral vector. In certain embodiments, the lentiviral vector is PGK-FANCA.WPRE*LV. It is contemplated that following transduction of bone marrow (BM) cells or stem cells or progenitor cells from FA-A patients with a FANCA lentiviral (LV) vector, the therapeutic vector integrates into the genome of the cells. After it integrates, the cells express the therapeutic protein (eg, human FANCA protein). The transduced FA cells are genetically corrected and therefore capable of activating the FA pathway by monoubiquitination of FANCD2 and FANCI. These proteins will then be able to migrate to areas of DNA damage, and in cooperation with other DNA repair proteins, will promote DNA repair in these cells, as occurs in healthy cells. As described herein, the subject compositions and methods are used to express a transgene, e.g. eg, FANCA, in cells of an animal. For example, the subject compositions can be used in research, e.g. eg, to determine the effect that the gene has on cell viability and / or function. As a further example, the subject compositions may be used in medicine, e.g. g., to treat a disorder such as AF. Accordingly, the present disclosure provides methods of treating a disease or disorder in a subject in need thereof, comprising providing or administering to the subject a combination of a high stringency CD34-enriched cell population and a low stringency CD34-enriched cell population. prepared as described herein, wherein either or both of the high stringency CD34-enriched cell population or the low stringency CD34-enriched cell population is transduced with a recombinant gene therapy vector that qi yni η / ηζηζ / Ε / γ comprises a polynucleotide sequence encoding a therapeutic agent or comprising an expression cassette expressing the therapeutic agent, wherein the therapeutic agent is effective in treating the disease or disorder. In particular embodiments, the disease is FA and the therapeutic agent is a Fanconi anemia A complementation group (FANCA) polypeptide or a functional fragment or variant thereof. In particular embodiments, the method comprises: (a) preparing a high stringency CD34-enriched cell population from a first biological sample obtained from the subject by selecting for CD34+ cells under high stringency conditions; (b) preparing a low stringency CD34-enriched cell population from a second biological sample obtained from the subject by selecting for CD34+ cells under low stringency conditions, (c) transducing one or both of the CD34-enriched cell population with high stringency or low stringency CD34-enriched cell population with the gene therapy vector comprising the polynucleotide sequence encoding the therapeutic agent; and (d) providing or administering the high stringency CD34-enriched cell population and the low stringency CD34-enriched cell population to the subject, wherein either or both of the high stringency CD34-enriched cell population or the CD34-enriched cell population CD34 with low stringency is transduced with the recombinant gene therapy vector; wherein the therapeutic agent is effective in treating the disease or disorder. In particular embodiments, the disease is FA and the therapeutic agent is a Fanconi anemia A complementation group (FANCA) polypeptide or a functional fragment or variant thereof. In certain embodiments, all cells obtained from each of the two cell populations are administered to the patient. The cell doses of each of the two cell populations may be similar or different, e.g. eg, with more total cells and more total CD34+ cells coming from the low stringency population. In certain embodiments, cells originally obtained from the patient are divided into two approximately equal populations, one population that is processed under high stringency CD34+ selection conditions and one under low stringency CD34+ selection conditions, which can result in ~ 2 times more CD34+ cells and 5-10 times more total cells resulting from the low stringency selection process. In particular embodiments of any of the treatment methods described herein, the first biological sample and the second biological sample are each independently peripheral blood or bone marrow. In certain embodiments, the first biological sample and the second biological sample are peripheral blood obtained after the subject has been treated with G-CSF, plerifaxor, or a combination of G-CSF and plerifaxor. In particular embodiments of the treatment methods described herein, selecting for CD34+ cells under high stringency conditions comprises loading the first biological sample onto a column that binds to CD34+ cells, washing the loaded column one or more times using a buffer wash, and elute the CD34-enriched cell population with high stringency from the column using an elution buffer. In one embodiment, the application step is carried out at 5-10 mL / min, 5-15 mL / min, 15-20 mL / min, 20-25 mL / min, or 25-30 mL / min. In one embodiment, the elution step is carried out at 5-10 mL / min, 5-15 mL / min, 15-20 mL / min, 25-25 mL / min, or 25-30 mL / min. In a qi jm η / ηζηζ / Ε / γ modality, the application step is carried out at 10-20 mL / min. In one embodiment, the elution step is carried out at 20 mL / min. In particular embodiments of the treatment methods described herein, selecting for CD34+ cells under low stringency conditions comprises loading the second biological sample onto a column that binds CD34+ cells, allowing the second biological sample to flow through the column and elute the CD34-enriched cell population with low stringency from the column using an elution buffer. In one embodiment, the application step is carried out at 5-10 mL / min, 5-15 mL / min, 15-20 mL / min, 20-25 mL / min, or 25-30 mL / min. In one embodiment, the elution step is carried out at 5-10 mL / min, 5-15 mL / min, 15-20 mL / min, 25-25 mL / min, or 25-30 mL / min. In one embodiment, the application step is carried out at 10-20 mL / min. In one embodiment, the elution step is carried out at 20 mL / min. In particular embodiments of the treatment methods described herein, the CD34-enriched cell population is transduced with high stringency and / or the CD34-enriched cell population is transduced with low stringency. In some embodiments, the subject methods result in therapeutic benefit, e.g. eg, prevent the development of a disorder, stop the progression of a disorder, reverse the progression of a disorder, etc. For example, in one embodiment, the disorder is FA. In another embodiment, the disease or disorder is BMF. In one embodiment, the disorder is thrombocytopenia. In another embodiment, the disorder is leukopenia. In one embodiment, the disorder is pancytopenia. In one embodiment, the disorder is neutropenia. In another embodiment, the disorder is anemia. In some embodiments, the subject method comprises the step of detecting that a therapeutic benefit has been achieved. One of skill in the art will appreciate that such measures of therapeutic efficacy will be applicable to the particular disease being modified and will recognize the appropriate detection methods to use to measure therapeutic efficacy. As described in further detail in the Examples, clinical data with mobilized bone marrow cells in peripheral blood biological samples and administered according to the methods of the present invention have unexpectedly demonstrated graft incorporation kinetics of faster in vivo selection with respect to the other patients with AF transplanted by prior art methods. In particular embodiments, the methods and composition of the present disclosure are used to treat AF. Accordingly, the present invention provides methods for the treatment of AF, or one or more of the hematologic manifestations of AF. In one embodiment, the hematologic manifestation of AF is selected from one or more of bone marrow failure (BMF), thrombocytopenia, leukopenia, pancytopenia, neutropenia, and anemia. In a particular modality, the hematological manifestation is BMF, which appears in pediatric ages in the majority of patients with AF. In one embodiment, the hematologic manifestation is thrombocytopenia. In another embodiment, the hematologic manifestation is leukopenia. In one embodiment, the hematologic manifestation is pancytopenia. In one embodiment, the hematologic manifestation is neutropenia. In another embodiment, the hematologic manifestation is anemia. In one embodiment, the hematologic manifestation is a combination of two or more of BMF, qi jm η / ηζηζ / Ε / γ thrombocytopenia, leukopenia, pancytopenia, neutropenia, and anemia. It is also an object of the present invention to repair endogenous FANC genes (eg FANCA, FANCC and / or FANCG) using a CRISPR / Cas gene editing system or the like. Cas9-mediated gene repair related to Fanconi anemia has been demonstrated in vitro, e.g. eg, Obsorn et al. Fanconi anemia gene editing by the CRISPR / Cas9 system. Hmm Gene Ther. 2015 Feb;26(2):114-26. The present invention provides methods for treating Fanconi anemia and a method for preparing genetically modified cells that result in improved in vivo efficacy of improved bone marrow repair and reconstitution. In some cases, the gene editing system repairs a single nucleotide polymorphism, deletion, insertion, indel, or other genetic defect. The repair in some instances is directed to a coding region of a gene, an intron, or a posterior or anterior region, such as a gene regulatory region of the genome proximal or distant from a gene associated with the disease or disorder. In one embodiment of the methods of the present invention, the disclosure provides a method for treating Fanconi anemia in a subject in need thereof, comprising preparing a high stringency CD34-enriched cell population from a first biological sample obtained from the subject when selecting CD34+ cells under high stringency conditions; prepare a low stringency CD34-enriched cell population from a second biological sample obtained from the subject by selecting for CD34+ cells under low stringency conditions, contacting one or both of the high stringency CD34-enriched cell population, or the Low stringency CD34-enriched cell population with a recombinant gene therapy vector for Fanconi anemia; and administering the high stringency CD34-enriched cell population and the low stringency CD34-enriched cell population to the subject, wherein one or both of the high stringency CD34-enriched cell population or the low stringency CD34-enriched cell population is contacts with the recombinant gene therapy vector; and wherein the gene therapy vector comprises a gene editing system capable of targeting an endogenous gene and thus treating Fanconi anemia. In some cases, the gene editing system is a CRISPR-Cas system (eg, CRISPR-Cas9). In some embodiments, the gene editing system comprises a nucleic acid encoding a Cas, Cas9, or spCas gene product (such as an mRNA, cDNA, plasmid, or the like) operably linked to a promoter. In some embodiments, the gene editing system comprises a nucleic acid encoding a Cas, Cas9, or spCas protein. In some cases, the gene therapy vector is a liposome or lipid nanoparticle or other lipid-based or lipid-like delivery systems. In some cases, the gene therapy vector is a virus, such as a lentivirus, adenovirus, or adeno-associated virus. In some embodiments, the gene editing system comprises a guide RNA, e.g. eg, a simple guide RNA (sgRNA) and, optionally, a repair template. The repair template and the guide RNA are in some cases different molecules or in some cases the same molecule. The repair template and guide RNA may be covalently or non-covalently linked. The guide RNA is, in some cases, preloaded with a Cas, Cas9, or spCas protein. The components of the gene editing system are delivered, in some cases, in a single gene therapy vector. In some cases, qi and ni η / ηζηζ / Ε / γ the gene editing system is delivered on separate gene therapy vectors. Multiple gene therapy vectors can be used. For example, and without limitation, multiple genetic lesions can be repaired with the same or different gene therapy vectors. In some cases, two or more FANC genes are repaired simultaneously. In some cases, one recombinant gene therapy vector contacts CD34-enriched cell populations with high stringency and another gene therapy vector contacts CD34-enriched cell populations with low stringency. In some cases, the two gene therapy vectors are the same. In some cases, one gene therapy vector comprises a transgene for a disorder associated with a given gene (eg, FANCA) and the other gene therapy vector comprises a gene editing system. In some cases, the gene therapy vector provides a transgene for, or repairs, a gene other than a gene associated with a disease or disorder. For example, without limitation, the gene therapy vector can increase or decrease the expression of immune effector genes, can alter cell surface markers, can provide alternative MHC molecules, or can encode immunoglobulin genes. It is particularly contemplated that, in some instances, the gene therapy vector(s) provide for the use of an allogeneic or mismatched donor transplant, such as by altering immune markers (eg, HLA or MHC genes) or causing the expression of immune effector genes. In some embodiments, the disclosure provides a method of treating a disease or disorder in a subject in need thereof, comprising providing the subject with a combination of a high stringency CD34-enriched cell population and a low stringency CD34-enriched cell population, both prepared from one or more biological samples obtained from a subject, wherein the CD34 cells obtained from the subject comprise one or more gene mutation associated with or causing the disease or disorder, and wherein one or both of the cell population enriched with High stringency CD34 or the low stringency CD34-enriched cell population is subjected to gene editing to repair the one or more gene mutation prior to providing the cell populations to the subject. In certain embodiments, gene editing is performed by contacting one or both of the CD34-enriched cell populations with a Cas protein (eg, Cas9 or spCas); a guide RNA (eg, simple guide RNA, sgRNA); and a repair jig. In particular embodiments, the disease is FA and the gene mutation that is repaired is a mutation in a Fanconi anemia A complementation group (FANCA) gene. In certain embodiments, the gene therapy vector described herein comprises a polynucleotide comprising a promoter operatively linked to a sequence encoding a therapeutic agent, ie, a coding sequence. As used herein, the term "operably linked" means that the promoter is capable of driving expression of the therapeutic agent-encoding sequence. In some embodiments, the polynucleotide comprises one or more enhancers. Enhancers are nucleic acid elements known in the art to enhance transcription and can be located anywhere in association with the gene they regulate, e.g. e.g., before, after, within an intron, etc. qi jm η / ηζηζ / Ε / γ Any enhancer element can be used in the polynucleotide cassettes and gene therapy vectors of the present disclosure, as long as it enhances gene expression when used in combination with the promoter. The coding sequence to be expressed in the cells can be any polynucleotide sequence, e.g. eg, gene or cDNA encoding a gene product, e.g. eg, a polypeptide or RNA-based therapeutic agent (siRNA, antisense, ribozyme, shRNA, etc.). The coding sequence may be heterologous to the promoter sequence to which it is functionally linked, ie, not naturally functionally associated with it. Alternatively, the coding sequence may be endogenous to the promoter sequence to which it is operatively linked, ie naturally associated with said promoter. The gene product may act intrinsically in the mammalian cell or may act extrinsically, e.g. eg, it can be secreted. For example, when the transgene is a therapeutic gene, the coding sequence can be any gene that encodes a desired gene product or fragment or functional variant thereof that can be used as a therapeutic agent to treat a disease or disorder. In various embodiments, the transgene encodes human FANCA. In one embodiment of the invention, the coding sequence of the transgene is modified, or "Codon Optimized" to enhance expression by replacing infrequently represented codons with more frequently represented codons. The coding sequence is the portion of the mRNA sequence that codes for the amino acids for translation. During translation, each of the 61 trinucleotide codons is translated into one of 20 amino acids, leading to degeneracy or redundancy in the genetic code. However, different cell types and different animal species use tRNAs (each carrying an anticodon) that encode the same amino acids at different frequencies. When a gene sequence contains codons that are infrequently represented by the corresponding tRNA, the ribosome's translation machinery can slow down, preventing efficient translation. Expression can be improved through "codon optimization" for a particular species, where the coding sequence is altered to encode the same protein sequence, but uses codons that have high representation and / or are used by human proteins with high expression (Cid-Arregui et al., 2003; J. Viral. 77: 4928). In one aspect of the present invention, the transgene coding sequence is modified to replace codons uncommonly expressed in mammals or primates with codons frequently expressed in primates. For example, in some embodiments, the coding sequence encoded by the transgene encodes a polypeptide that has at least 85% sequence identity to a polypeptide encoded by a sequence described above or herein, eg, at least 90%. % sequence identity, e.g. eg at least 95% sequence identity, at least 98% identity, at least 99% identity, where at least one codon in the coding sequence has a higher tRNA frequency in humans than the corresponding codon in the described sequence above or herein. In a further embodiment of the invention, the transgene coding sequence is modified to enhance expression by terminating or removing open reading frames (ORFs) that do not encode the desired transgene. An open reading frame (ORF) is the nucleic acid sequence qi and ni η / ηζηζ / Ε / γ that follows an initiation codon and does not contain a stop codon. ORFs can be forward or reverse and can be "in frame" or "out of frame" compared to the gene of interest. Such open reading frames have the potential to be expressed in an expression cassette together with the gene of interest and could lead to undesired adverse effects. In one aspect of the present invention, the transgene coding sequence has been modified to remove open reading frames by further altering codon usage. This can be done by deleting initiation codons (ATG) and introducing stop codons (TAG, TAA, or TGA) into antisense or out-of-frame ORFs, while conserving the amino acid sequence and keeping codons with high utilization in the gene of interest (ie, codons with a frequency of <20%) are avoided. In the present disclosure, the transgene coding sequence can be optimized by codon optimization and removal of non-transgene ORFs or by using both techniques. As will be apparent to one skilled in the art, removing or minimizing non-transgene ORFs after codon optimization is preferable to removing ORFs introduced during codon optimization. The present disclosure includes plasmids that comprise an expression cassette or transfer cassette described herein. In particular embodiments, the plasmid is pCCL-PGKFANCA-WPRE* (SEQ ID NO: 24) and / or the plasmid comprises the pCCL-PGK-FANCWPRE expression cassette (SEQ ID NO: 25). In certain embodiments, a gene therapy vector or gene transfer cassette therein comprises one or more additional elements, e.g. eg, one or more elements selected from the following: 5' LTR, 3' LTR, cPPT, CTS, RRE, enhancer sequences, and packaging signals. In some embodiments, the gene therapy vector or gene transfer cassette is any vector or cassette described in International Patent Publication No. WO 2018 / 049273 A1, the description of which is incorporated herein in its entirety for all purposes. Polynucleotide sequences encoding a Fanconi anemia complementation group (FANC) polypeptide include those described in US Pat. 5,952,190, the disclosure of which is incorporated herein in its entirety for all purposes. The RRE sequence improves the efficiency of gene transfer. In particular embodiments of any of the expression cassettes and gene therapy vectors described herein, the RRE sequence comprises or consists of any of the following sequences, or sequences that are at least 80%, at least 85%, at least 90 %, al menos 95 %, al menos 98 % o al menos 99 % de identidad con respecto a las siguientes secuencias (todas expuestas en el sentido de 5' a 3'): AGGAGCTTTGTTCCTTGGGTTCTTGGGAGCAGCAGGAAGCACTATGGGCGCAGCGTCAATGACGCT GACGGTACAGGCCAGACAATTATTGTCTGGTATAGTGCAGCAGCAGAACAATTTGCTGAGGGCTATT GAGGCGCAACAGCATCTGTTGCAACTCACAGTCTGGGGCATCAAGCAGCTCCAGGCAAGAATCCTG GCTGTGGAAAGATACCTAAAGGATCAACAGCTCCT (SEQ ID NO: 1) ; GATCTTCAGACCTGGAGGAGGAGATATGAGGGACAATTGGAGAAGTGAATTATATAAATATAAAGTAG TAAAAATTGAACCATTAGGAGTAGCACCCACCAAGGCAAAGAGAAGAGTGGTGCAGAGAGAAAAAAG AGCAGTGGGAATAGGAGCTTTGTTCCTTGGGTTCTTGGGAGCAGCAGGAAGCACTATGGGCGCAGC Ql 7ΠΙ η / η7Π7 / Ε / Υ GTCAATGACGCTGACGGTACAGGCCAGACAATTATTGTCTGGTATAGTGCAGCAGCAGAACAATTTG CTGAGGGCTATTGAGGCGCAACAGCATCTGTTGCAACTCACAGTCTGGGGCATCAAGCAGCTCCAG GCAAGAATCCTGGCTGTGGAAAGATACCTAAAGGATCAACAGCTCCTGGGGATTTGGGGTTGCTCTG GAAAACTCATTTGCACCACTGCTGTGCCTTGGAATGCTAGTTGGAGTAATAAATCTCTGGAACAGATT TGGAATCACACGACCTGGATGGAGTGGGACAGAGAAATTAACAATTACACAAGCTTAATACACTCCTT AATTGAAGAATCGCAAAACCAGCAAGAAAAGAATGAACAAGAATTATTGGAATTAGATAAATGGGCAA GTTTGTGGAATTGGTTTAACATAACAAATTGGCTGTGGTATATAAAATTATTCATAATGATAGTAGGAG GCTTGGTAGGTTTAAGAATAGTTTTTGCTGTACTTTCTATAGTGAATAGAGTTAGGCAGGGATATTCAC CATTATCGTTTCAGACCCACCTCCCAACCCCGAGGGGACCCGACAGGCCCGAAGGAATAGAAGAAG AAGGTGGAGAGAGAGACAGAGACAGATCCATTCGATTAGTGAACGGATC (SEQ ID NO: 26); or a sequence comprising or consisting of nucleotides 2649-2882 or SEQ ID NO:24 or polynucleotides 1296-2153 of SEQ ID NO:25. The retroviral leader region contains the packaging signal (Ψ), which is involved in the packaging of the retroviral genome into the viral capsid. LV vectors are believed to require approximately 300 bp of the Gag gene in this region. Currently, this Gag sequence has been reduced to just 40 bp (Figure 65). In particular embodiments of any of the expression cassettes and gene therapy vectors described herein, the ψ sequence is an HIV1 ψ sequence or the ψ sequence comprises or consists of any of the following sequences, or sequences having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity to the following sequences: CTCTCTCGACGCAGGACTCGGCTTGCTGAAGCGCGCACGGCAAGAGGCGAGGGGCGGCGACTGGT GAGTACGCCAAAAATTTTGACTAGCGGAGGCTAGAAGGAGAGAGATGGGTGCGAGAGCGTC (SEQ IDEAGAGCGTC:2); TGAGTACGCCAAAAATTTTGACTAGCGGAGGCTAGAAGGAGAGA (SEQ ID NO: 27); or a sequence comprising or consisting of polynucleotides 2031-2156 of SEQ ID NO:24 or polynucleotides 889-933 of SEQ ID NO:25. In particular embodiments of any of the expression cassettes and gene therapy vectors described herein, the truncated HIV-1 5' LTR comprises or consists of any of the following sequences, or sequences that are at least 80%, at at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity to any of the following sequences: GGGTCTCTCTGGTTAGACCAGATCTGAGCCTGGGAGCTCTCTGGCTAACTAGGGAACCCACT GCTTAAGCCTCAATAAAGCTTGCCTTGAGTGCTTCAAGTAGTGTGTGCCCGTCTGTTGTGTGACTCTG GTAACTAGAGATCCCTCAGACCCTTTTAGTCAGTGTGGAAAATCTCTAGCA (SEQ ID NO: 3); GTCTCTCTGGTTAGACCAGATCTGAGCCTGGGAGCTCTCTGGCTAACTAGGGAACCCACTGC TTAAGCCTCAATAAAGCTTGCCTTGAGTGCTTCAAGTAGTGTGTGTGCCCGTCTGTTGTGTGACTCTGGT AACTAGAGATCCCTCAGACCCTTTTAGTCAGTGTGGAAAATCTCTAGCAGTGGCGCCC (SEQ ID NO: 28); or qi yni η / ηζηζ / Ε / γ a sequence comprising or consisting of polynucleotides 1586-9495 of SEQ ID NO:24 or polynucleotides 934-1295 of SEQ ID NO:25. In particular embodiments of any of the expression cassettes and gene therapy vectors described herein, the autoinactivating HIV-1 3' LTR comprises or consists of any of the following sequences, or sequences having at least 80% of them, at menos 85 %, al menos 90 %, al menos 95 %, al menos 98 % o al menos 99 % de identidad con respecto a las siguientes secuencias: TGGAAGGGCTAATTCACTCCCAACGAAGACAAGATCTGCTTTTTGCTTGTACTGGGTCTCTCTGGTTA GACCAGATCTGAGCCTGGGAGCTCTCTGGCTAACTAGGGAACCCACTGCTTAAGCCTCAATAAAGCT TGCCTTGAGTGCTTCAAGTAGTGTGTGCCCGTCTGTTGTGTGACTCTGGTAACTAGAGATCCCTCAG ACCCTTTTAGTCAGTGTGGAAAATCTCTAGCA (SEQ ID NO: 4); TGGAAGGGCTAATTCACTCCCAACGAAGACAAGATCTGCTTTTTGCTTGTACTGGGTCTCTCTGGTTA GACCAGATCTGAGCCTGGGAGCTCTCTGGCTAACTAGGGAACCCACTGCTTAAGCCTCAATAAAGCT TGCCTTGAGTGCTTCAAGTAGTGTGTGCCCGTCTGTTGTGTGACTCTGGTAACTAGAGATCCCTCAG ACCCTTTTAGTCAGTGTGGAAAATCTCTAGCA (SEQ ID NO: 29); or a sequence comprising or consisting of polynucleotides 9262-9495 of SEQ ID NO:24 or polynucleotides 8056-8289 of SEQ ID NO:25. In particular embodiments of any of the expression cassettes and gene therapy vectors described herein, the human cytomegalovirus (CMV) immediate premature promoter comprises or consists of any of the following sequences, a functional fragment of these, or a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identical to any of the following sequences: GTGATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTC TCCACCCCATTGACGTCAATGGGAGTTTGAACTTCAATGCGAATTCAATG AACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGA GCT (SEQ ID NO: 5); ACATTGATTATTGACTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGA GTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATT GACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGG AGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATT GACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTA CTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACATCAAT GGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTT TGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATG GGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGC (SEQ ID NO: 30) o una secuencia que comprende o consiste en los polinucleótidos 1586-1789 de la SEQ ID NO:24 o los polinucleótidos 1 -577 de la SEQ ID NO: 25. In particular embodiments of any of the expression cassettes and gene therapy vectors described herein, the human Rous sarcoma virus (RSV) promoter comprises or consists of any of the following sequences, a functional fragment of Ql 7ΠΙ η / η7Π7 / Ε / Υ these, or a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity to any of the following sequences: TTAATGTAGTCTTATGCAATACTCTTGTAGTCTTGCAACATGGTAACGATGAGTTAGCAACATGCCTTA CAAGGAGAGAAAAAGCACCGTGCATGCCGATTGGTGGAAGTAAGGTGGTACGATCGTGCCTTATTAG GAAGGCAACAGACGGGTCTGACATGGATTGGACGAACCACTGAATTGCCGCATTGCAGAGATATTGT ATTTAAGTGCCTAGCTCGATACAATAAACG (SEQ ID NO: 31). cPPT, which facilitates nuclear translocation of preintegration complexes, together with CTS which is involved in reverse transcriptase cleavage, have been shown to improve viral concentration (Zennou, et al. 2000; Follenzi et al. 2000). . In particular embodiments of any of the expression cassettes and gene therapy vectors described herein, the human HIV-1 central polypurine tract and central termination sequence (cPPT / CTS) comprise or consists of any of the following sequences, a functional fragment thereof, or a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identical with respect to any of the following sequences: TTTTAAAAGAAAAGGGGGGATTGGGGGGTACAGTGCAGGGGAAAGAATAGTAGACATAATAGCAACA GACATACAAACTAAAGAATTACAAAAACAAATTACAAAAATTCAAAATTTT (SEQ ID NO: 6); TTTAAAAGAAAAGGGGGGATTGGGGGGT (SEQ ID NO:12); AAAAGAAAAGGGGGGA (SEQ ID NO: 32); TTGGGGGGTACAGTGCAGGGGAAAGAATAGTAGACATAATAGCAACAGACATACAAACTAAAGAATT ACAAAAACAAATTACAAAAATTCAAAATTTTATCGATCACGAGACTAGCCTCGA (SEQ ID NO: 33) or a sequence comprising or consisting of nucleotides 3378-3495 of SEQ ID NO:24 or nucleotides 2176-235 of SEQ ID NO:23. In particular embodiments of any of the expression cassettes and gene therapy vectors described herein, the human phosphoglycerate kinase 1 (hPGK) promoter comprises or consists of any of the following sequences, a functional fragment of these, or a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity to any of the following sequences: GGGGTTGGGGTTGCGCCTTTTCCAAGGCAGCCCTGGGTTTGCGCAGGGACGCGGCTGCTCTGGGCC GTGGTTCCGGGAAACGCAGCGGCGCCGACCGTTACCTGTCCGTCG TCACCCGGATCTTCGCCGCTACCCTTGTGGGCCCCCCGGCGACGCTTCCTGCTCCGCCCCTAAGTC GGGAAGGTTCCTTGCGGTTCGCGGCGTGCCGGACGTGACAAACGGAAGCCGCACGTCTCACTAGTA CCCTCGCAGACGGACAGCGCCAGGGAGCAATGGCAGCGCGCCGACCGCGATGGGCTGTGGCCAAT AGCGGCTGCTCAGCAGGGCGCGCCGAGAGCAGCGGCCGGGAAGGGGCGGTGCGGGAGGCGGGG TGTGGGGCGGTAGTGTGGGCCCTGTTCCTGCCCGCGCGGTGTTCCGCATTCTGCAAGCCTCCGGAG CGCACGTCGGCAGTCGGCTCCCTCGTTGACCGAATCACCGA CCTCTCTCCCCAG (SEQ ID NO: 7); or a sequence comprising or consisting of nucleotides 3541-4051 of SEQ ID NO:24 or nucleotides 2335-2845 of SEQ ID NO:25. In certain embodiments, the expression cassettes and gene therapy vectors described in the present specification qi / ni n / nznz / B / v comprise one or more additional elements, e.g. eg, a CMV promoter and / or enhancer, an SV40 polyA sequence, an origin of replication, e.g. eg, an SV40 origin sequence, or any of the elements described herein. In particular embodiments of expression cassettes and gene therapy vectors described herein, the human CMV enhancer comprises or consists of the following sequence, a functional fragment thereof, or a sequence that is at least 80%, at least 85% functional. %, al menos 90 %, al menos 95 %, al menos 98 % o al menos 99 % de identidad con respecto a la siguiente secuencia: GACATTGATTATTGACTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGG AGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATT GACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGG AGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATT GACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTA CTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATG (SEQ ID NO: 9). In particular embodiments of any of the expression cassettes and gene therapy vectors described herein, the Simian Virus 40 (SV40) poly(A) signal comprises or consists of in the following sequence, a functional fragment thereof, or a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity to the following sequence: AACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAATTTCACAAATAAAGCAT TTTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTCATCAATGTATCTTA (SEQ ID NO: 10); or a sequence comprising or consisting of nucleotides 8361-8482 of SEQ ID NO: 25. In particular embodiments of any of the expression cassettes and gene therapy vectors described herein, the SV40 origin of replication comprises or consists of the following sequence, a functional fragment thereof, or a sequence that has at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity to the following sequence: ATCCCGCCCCTAACTCCGCCCAGTTCCGCCCATTCTCCGCCCCATGGCTGACTAATTTTTTTTATTTA TGCAGAGGCCGAGGCCGCCTCGGCCTCTGAGCTATTCCAGAAGTAGTGAGGAGGCTTTTTTTGGAGG CC (SEQ ID NO: 11); GGCCTCCAAAAAAGCCTCCTCACTACTTCTGGAATAGCTCAGAGGCCGAGGCGGCCTCGGCCTCTG CATAAATAAAAAAAATTAGTCAGCCATGGGGCGGAGAATGGGCGGAACTGGGCGGAGTTAGGGGCGGGATGGGCGGAGTTAGGGGCGGGA (SEQ ID NO: 34); or a sequence comprising or consisting of nucleotides 8502-8657 of SEQ ID NO: 25. In some embodiments of any of the expression cassettes and gene therapy vectors described herein, the dNEF signal present in any of the expression cassettes or gene therapy vectors described herein comprises or consists of in the following sequence, a functional fragment thereof, or a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity with qi and ni η / ηζηζ / Ε / γ with respect to the following sequence: GAATTCGAGCTCGGTACCTTTAAGACCAATGACTTACAAGGCAGCTGTAGATCTTAGCCACTTTTTAAAAGAAAAGGGGGGAC (SEQ ID NO: 13). In particular embodiments of any of the expression cassettes and gene therapy vectors described herein, the KanR sequence present in any of the expression cassettes or gene therapy vectors described herein comprises or consists of en la siguiente secuencia: ATGATTGAACAAGATGGATTGCACGCAGGTTCTCCGGCGGCTTGGGTGGAGAGGCTATTCGGCTAT GACTGGGCACAACAGACAATCGGCTGCTCTGATGCCGCCGTGTTCCGGCTGTCAGCGCAGGGGCGT CCGGTTCTTTTTGTCAAGACCGACCTGTCCGGTGCCCTGAATGAACTGCAAGACGAGGCAGCGCGG CTATCGTGGCTGGCGACGACGGGCGTTCCTTGCGCGGCTGTGCTCGACGTTGTCACTGAAGCGGGA AGGGACTGGCTGCTATTGGGCGAAGTGCCGGGGCAGGATCTCCTGTCATCTCACCTTGCTCCTGCC GAGAAAGTATCCATCATGGCTGATGCAATGCGGCGGCTGCATACGCTTGATCCGGCTACCTGCCCAT TCGACCACCAAGCGAAACATCGCATCGAGCGAGCACGTACTCGGATGGAAGCCGGTCTTGTCGATC AGGATGATCTGGACGAAGAGCATCAGGGGCTCGCGCCAGCCGAACTGTTCGCCAGGCTCAAGGCGT CTATGCCCGACGGCGAGGATCTCGTCGTGACCCACGGCGATGCCTGCTTGCCGAATATCATGGTGG AAAATGGCCGCTTTTCTGGATTCATCGACTGTGGCCGTCTGGGTGTGGCGG ACCGCTATCAGGACAT AGCGTTGGCTACCCGTGATATTGCTGAAGAGCTTGGCGGCGAATGGGCTGACCGCTTCCTTGTGCTTTACGGTATCGCCGCGCCCGATTCGCAGCGCATCGCCTTCTATCGCCTTCTTGACGAGTTCTTCTGA (SEQ ID NO: 14). In particular embodiments of any of the expression cassettes and gene therapy vectors described herein, the RNA-OUT sequence present in any of the expression cassettes or gene therapy vectors described herein comprises or consists of the following sequence: GTAGAATTGGTAAAGAGAGTCGTGTAAAATATCGAGTTCGCACATCTTGTTGTCTGATTATTGATTTTTT GGCGAAACCATTTGATCATATGACAAGATGTGTATCTACCTTAACTTAATGATTTTGATAAAAATCATTA GG (SEQ ID NO: 35); or a sequence comprising or consisting of nucleotides 9731-9871 of SEQ ID NO: 25. In some embodiments of any of the expression cassettes and gene therapy vectors described herein, the rrnG terminator (E. coli ribosomal RNA rrnG operon transcription terminator (Albrechtsen et al. , 1991) present in any of the expression cassettes or gene therapy vectors described herein comprises or consists of the following sequence: GCATTGGCGCAGAAAAAAATGCCTGATGCGACGCTGCGCGTCTTATACTCCCACATATGCCAGATTC AGCAACGGATACGGCTTCCCCAACTTGCCCACTTCCATACGTGTCCTCCTTACCAGAAATTTATCCTT AA (SEQ ID NO: 15) In some embodiments of any of the expression cassettes and gene therapy vectors described herein, the ori (origin of replication ColE1 / pMB1 / pBR322 / pUC with high qi and ni η / ηζηζ / Ε / γ copy number) present in any of the expression cassettes or gene therapy vectors described herein comprises or consists of the following sequence, a functional fragment thereof, or a sequence that is at least 80%, at least 85%, at least 90% , at least 95%, at least 98%, or at least 99% identity to the following sequence: TTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGG TTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATA CCAAATACTGTTCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTAC ATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGG TTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACA CAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGC GCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGA GCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCT CTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAA (SEQ ID NO: 16) GGAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCCTCACTGATTAAGCA TTGGTAACTGTCAGACCAAGTTTACTCATATATACTTTAGATTGATTTAAAACTTCATTTTTAATTTAAAA GGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACT GAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGC TGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTC TTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATAC CAAATACTGTTCTTCTAGTGTAGCCGTAG TTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGT GGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAG GCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACAC CGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGA CAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACG CCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCG TCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGC TGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTT GAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGC GGAAGA (SEQ ID NO: 37); or a sequence comprising or consisting of nucleotides 9731-9871 of SEQ ID NO: 24 or nucleotides 8700-9714 of SEQ ID NO: 25. In some embodiments of any of the expression cassettes and gene therapy vectors described herein, the CAP binding site present on any of the expression cassettes or gene therapy vectors described herein comprises or consists of the following sequence, a functional fragment thereof, or a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identical with respect to the following sequence: TAATGTGAGTTAGCTCACTCAT (SEQ ID NO: 17). In some embodiments of any of the qi jm η / ηζηζ / Ε / γ expression cassettes and gene therapy vectors described herein, the / acde Eco / / promoter present in any of the expression cassettes or gene therapy vectors described herein comprise or consist of the following sequence, a functional fragment thereof, or a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% identity to the following sequence: TTTACACTTTATGCTTCCGGCTCGTATGTTG (SEQ ID NO: 18). In some embodiments of any of the expression cassettes and gene therapy vectors described herein, the lac operator present in any of the expression cassettes or gene therapy vectors described herein comprises or consists of in the following sequence, a functional fragment thereof, or a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity to the following sequence: TTGTGAGCGGATAACAA (SEQ ID NO: 19) In some embodiments of any of the expression cassettes and gene therapy vectors described herein, the T3 promoter (promoter for bacteriophage T3 RNA polymerase) present in any of the expression cassettes or gene therapy vectors gene therapy described herein comprises or consists of the following sequence, a functional fragment thereof, or a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% identity to the following sequence: AATTAACCCTCACTAAAGG (SEQ ID NO: 20). In some embodiments of any of the expression cassettes and gene therapy vectors described herein, the T7 promoter (promoter for bacteriophage T7 RNA polymerase) present in any of the expression cassettes or gene therapy vectors gene therapy described herein comprises or consists of the following sequence, a functional fragment thereof, or a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% identity to the following sequence: CCTATAGTGAGTCGTATTA (SEQ ID NO: 21). In some embodiments of any of the expression cassettes and gene therapy vectors described herein, the f1 ori (bacteriophage f1 origin of replication) present in any of the expression cassettes or gene therapy vectors described herein comprises or consists of the following sequence, a functional fragment thereof, or a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least menos 99 % de identidad con respecto a la siguiente secuencia: ACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACA CTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCT TTCCCCGTCAAGCTCTAAATCGGGGGCTCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGA CCCCAAAAAACTTGATTAGGGTGATGGTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGC CCTTTGACGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAACAACACTCAACCC TATCTCGGTCTATTCTTTTGATTTATAAGGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCT qi yni η / ηζηζ / Ε / γ GATTTAACAAAAATTTAACGCGAATT (SEQ ID NO: 22). As described herein, the expression cassettes and gene therapy vectors of the present invention may comprise an RNA export signal. Illustrative RNA export sequences include, but are not limited to, WPRE. WPRE significantly increases transgene expression in target cells by increasing RNA stability in a transgene, independently of promoter and vector (Zuffrey et al, 1999). However, it can express a truncated 60 amino acid protein derived from the WHV X gene implicated in liver cancer (Kingsman et al, 2005). Therefore, most preclinical protocols and clinical trials include a mutated version of the WPRE element (Zanta-Boussif et al, 2009). On the other hand, it has been observed that the use of two SV40-USE elements in SIN-LV vectors is more effective than the WPRE sequence in suppressing the complete transcriptional read (Schambach et al, 2007). More precisely, the WPRE described herein is a chimeric wPRE carrying 589 nucleotides of the modified WPRE carried out by Axel Schambach (nucleotides 1-589) (WO 2008136670 A2) and 88 of an earlier WPRE (nucleotides 590-677). (Zuffrey et al, 1999). The data described herein shows that this chimeric WPRE performs better than the previous wPRE. The chimeric wPRE comprises the following sequence, a functional fragment thereof, or a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity with respect to the following sequence: CGAGCATCTTACCGCCATTTATTCCCATATTTGTTCTGTTTTTCTTGATTTGGGTATACATTTAAATGTT AATAAAACAAAATGGTGGGGCAATCATTTACATTTTTAGGGATATGTAATTACTAGTTCAGGTGTATTG CCACAAGACAAACATGTTAAGAAACTTTCCCGTTATTTACGCTCTGTTCCTGTTAATCAACCTCTGGAT TACAAAATTTGTGAAAGATTGACTGATATTCTTAACTATGTTGCTCCTTTTACGCTGTGTGGATATGCT GCTTTAATGCCTCTGTATCATGCTATTGCTTCCCGTACGGCTTTCGTTTTCTCCTCCTTGTATAAATCC TGGTTGCTGTCTCTTTATGAGGAGTTGTGGCCCGTTGTCCGTCAACGTGGCGTGGTGTGCTCTGTGT TTGCTGACGCAACCCCCACTGGCTGGGGCATTGCCACCACCTGTCAACTCCTTTCTGGGACTTTCGC TTTCCCCCTCCCGATCGCCACGGCAGAACTCATCGCCGCCTGCCTTGCCCGCTGCTGGACAGGGGC TAGGTTGCTGGGCACTGATAATTCCGTGGTGTTGTCGGGGAAGGGCCTGCTGCCGGCTCTGCGGCC TCTTCCGCGTCTTCGCCTTCGCCCTCAGACGAGTCGGATCTCCCTTTGGGCCGCCTCCCCGCCTG (SEQ ID NO:23). In particular embodiments, the mutated WPRE sequence comprises or consists of WPRE*, which corresponds to nucleotides 8502-9178 of SEQ ID NO: 24 or nucleotides 7293-7888 of SEQ ID NO: 25, or is at least 80% , at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity to this region of SEQ ID NO: 24 or SEQ ID NO: 25. Other combinations of elements as described herein or as known in the art will be readily appreciated by one skilled in the art. In addition, as will be recognized by one of skill in the art, expression cassettes and gene therapy vectors may optionally contain other elements including, but not limited to, restriction sites to facilitate cloning and regulatory elements for a gene therapy vector. particular. qi jm η / ηζηζ / Ε / γ In some aspects of the present invention, the subject polynucleotide cassettes are used to deliver a gene to cells, e.g. eg, to determine the effect that the gene has on cell viability and / or function, to treat a cell disorder, etc. In various embodiments, delivery of a viral vector to cells by transduction can occur in vitro, ex vivo, or in vitro. Accordingly, in some aspects of the invention, the composition that provides for expression of a transgene in mammalian cells is a gene therapy vector, wherein the gene therapy vector comprises a polynucleotide cassette, e.g. eg, a gene transfer cassette, of the present disclosure. Genetic correction of HSCs from patients with AF, with subsequent autologous transplantation of these cells (haematopoietic gene therapy), is a good alternative for patients with AF, particularly those who lack an HLA-identical sibling. In one embodiment, hematopoietic gene therapy is the preferred treatment regimen for a patient who lacks an HLA-identical sibling. In another embodiment, hematopoietic gene therapy is a treatment regimen for a patient who has an HLA-identical sibling. In particular embodiments of any of the methods described herein, the gene therapy vector comprises a polynucleotide sequence encoding a FAC protein and cells transduced with the vector are provided to a subject to treat FA. Since most AF patients belong to AF complementation group A (Casado et al., 2007, Levitus et al., 2004, Taniguchi et al., 2006), a vector harboring the FANCA gene has been developed. functional. The inclusion of a mutated woodchuck hepatitis virus post-transcriptional regulatory element (WPRE*), lacking a residual open reading frame (Schambach Aet al. Gene Ther. 2006;13:641-645) will be used to improve the expression level and stability of the therapeutic gene. In some embodiments, a polynucleotide cassette comprises: (i) a phosphoglycerate kinase (PGK) promoter sequence or a variant or functional fragment thereof; (ii) a sequence encoding a human FANCA protein, or a fragment or functional variant thereof; and: (iii) a mutated post-transcriptional regulatory element of the woodchuck hepatitis virus (WPRE) sequence. In some embodiments, a polynucleotide cassette comprises: (i) a human phosphoglycerate kinase (PGK) promoter sequence; (ii) a sequence encoding a human FANCA protein; and: (iii) a mutant WPRE sequence. In some embodiments, a polynucleotide cassette comprises: a) a 5' LTR, optionally a modified 5' LTR; b) a cPPT sequence; c) a PGK promoter sequence, optionally a human PGK promoter sequence; d) a sequence encoding a human FANCA protein, optionally a cDNA sequence or a codon-optimized sequence; qi jm η / ηζηζ / Ε / γ e) a mutant WPRE sequence; and f) a 3' LTR, optionally a modified 3' LTR. In one embodiment, the modified WPRE is referred to as WPRE*. WPRE* is a modified WPRE that lacks an open reading frame (see, eg, Schambach et al, 2006 Gene Ther. 13:641-645). Since most AF patients belong to AF complementation group A (Casado et al., 2007, Levitus et al., 2004, Taniguchi et al., 2006), in particular modalities, the therapeutic gene product encoded is FANCA , although the description contemplates that FA proteins from other complementation groups may be supplied and are therefore encoded in the expression cassettes described herein, e.g. eg, instead of FANCA. In particular embodiments of any of the expression cassettes and gene therapy vectors described herein, the polynucleotide sequence encoding a codon-optimized FANCA is a human FANCA cDNA sequence comprising or consisting of the following sequence, or a functional fragment thereof, or a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity to the following sequence: ATGTCCGACTCGTGGGTCCCGAACTCCGCCTCGGGCCAGGACCCAGGGGGCCGCCGGAGGGCAGCTG GGCCGAGCTGCTGGCGGGAAGGGTCAAGATAGCGAAACTA GGAATCAGCTGTGCGCCTCCTGCGAAGCCATCAGGACCTGAATGCCCTTTTGCTTGAGGTAGAAGGT CCACTGTGTAAAAAATTGTCTCTCAGCAAAGTGATTGACTGTGACAGTTCTGAGGCCTATGCTAATCA TTCTAGTTCATTTATAGGCTCTGCTTTGCAGGATCAAGCCTCAAGGCTGGGGGTTCCCGTGGGTATTC TCTCAGCCGGGATGGTTGCCTCTAGCGTGGGACAGATCTGCACGGCTCCAGCGGAGACCAGTCACC CTGTGCTGCTGACTGTGGAGCAGAGAAAGAAGCTGTCTTCCCTGTTAGAGTTTGCTCAGTATTTATTG GCACACAGTATGTTCTCCCGTCT TTCCTTCTGTCAAGAATTATGGAAAATACAGAGTTCTTTGTTGCTT GAAGCGGTGTGGCATCTTCACGTACAAGGCATTGTGAGCCTGCAAGAGCTGCTGGAAAGCCATCCC GACATGCATGCTGTGGGATCGTGGCTCTTCAGGAATCTGTGCTGCCTTTGTGAACAGATGGAAGCAT CCTGCCAGCATGCTGACGTCGCCAGGGCCATGCTTTCTGATTTTGTTCAAATGTTTGTTTTGAGGGGA TTTCAGAAAAACTCAGATCTGAGAAGAACTGTGGAGCCTGAAAAAATGCCGCAGGTCACGGTTGATG TACTGCAGAGAATGCTGATTTTTGCACTTGACGCTTTGGCTGCTGGAGTACAGGAGGAGTCCTCCAC TCACAAGATCGTGAGGTGCTGGTTCGGAGTGTTCAGTGGACACACGCTTGGCAGTGTAATTTCCACA GATCCTCTGAAGAGGTTCTTCAGTCATACCCTGACTCAGATACTCACTCACAGCCCTGTGCTGAAAGC ATCTGATGCTGTTCAGATGCAGAGAGAGTGGAGCTTTGCGCGGACACACCCTCTGCTCACCTCACTG TACCGCAGGCTCTTTGTGATGCTGAGTGCAGAGGAGTTGGTTGGCCATTTGCAAGAAGTTCTGGAAA CGCAGGAGGTTCACTGGCAGAGAGTGCTCTCCTTTGTGTCTGCCCTGGTTGTCTGCTTTCCAGAAGC GCAGCAGCTGCTTGAAGACTGGGTGGCGCGTTTGATGGCCCAGGCATTCGAGAGCTGCCAGCTGGA CAGCATGGTCACTGCGTTCCTGGTTGTGCGCCAGGCAGCACTGGAGGGCCCCTCTGCGTTCCTGTC ATATGCAGACTGGTTCAAGGCCTCCTTTGGGAGCACACGAGGCTACCATGGCTGCAGCAAGAAGGC CCTGGTCTTCCTGTTTACGTTCTTGTCAGAACTCGTGCCTTTTGAGTCTCCCCGGTACCTGCAGGTGC AC ATTCTCCACCCACCCCCCTGGTTCCCAGCAAGTACCGCTCCCTCCTCACAGACTACATCTCATTGGC CAAGACACGGCTGGCCGACCTCAAGGTTTCTATAGAAAACATGGGACTCTACGAGGATTTGTCATCA qi yni η / ηζηζ / Ε / γ GCTGGGGACATTACTGAGCCCCACAGCCAAGCTCTTCAGGATGTTGAAAAGGCCATCATGGTGTTTG AGCATACGGGGAACATCCCAGTCACCGTCATGGAGGCCAGCATATTCAGGAGGCCTTACTACGTGTC CCACTTCCTCCCCGCCCTGCTCACACCTCGAGTGCTCCCCAAAGTCCCTGACTCCCGTGTGGCGTTT ATAGAGTCTCTGAAGAGAGCAGATAAAATCCCCCCATCTCTGTACTCCACCTACTGCCAGGCCTGCT CTGCTGCTGAAGAGAAGCCAGAAGATGCAGCCCTGGGAGTGAGGGCAGAACCCAACTCTGCTGAGG AGCCCCTGGGACAGCTCACAGCTGCACTGGGAGAGCTGAGAGCCTCCATGACAGACCCCAGCCAG CGTGATGTTATATCGGCACAGGTGGCAGTGATTTCTGAAAGACTGAGGGCTGTCCTGGGCCACAATG AGGATGACAGCAGCGTTGAGATATCAAAGATTCAGCTCAGCATCAACACGCCGAGACTGGAGCCAC GGGAACACATTGCTGTGGACCTCCTGCTGACGTCTTTCTGTCAGAACCTGATGGCTGCCTCCAGTGT CGCTCCCCCGGAGAGGCAGGGTCCCTGGGCTGCCCTCTTCGTGAGGACCATGTGTGGACGTGTGC TCCCTGCAGTGCTCACCCGGCTCTGCCAGCTGCTCCGTCACCAGGGCCCGAGCCTGAGTGCCCCAC ATGTGCTGGGGTTGGCTGCCCTGGCCGTGCACCTGGGTGAGTCCAGGTCTGCGCTCCCAGAGGTG GATGTGGGTCCTCCTGCACCTGGTGCTGGCCTTCCTGTCCCTGCGCTCTTTGACAGCCTCCTGACCT GTAGGACGAGGGATTCCTTGTTCTTCTGCCTGAAATTTTGTACAGCAGCAATTTCTTACTCTCTCTGC AAGTTTTCTTCCCAGTCACGAGATACTTTGTGCAGCTGCTTATCTCCAGGCCTTAT TAAAAAGTTTCAG TTCCTCATGTTCAGATTGTTCTCAGAGGCCCGACAGCCTCTTTCTGAGGAGGACGTAGCCAGCCTTT CCTGGAGACCCTTGCACCTTCCTTCTGCAGACTGGCAGAGAGCTGCCCTCTCTCTCTGGACACACAG AACCTTCCGAGAGGTGTTGAAAGAGGAAGATGTTCACTTAACTTACCAAGACTGGTTACACCTGGAG CTGGAAATTCAACCTGAAGCTGATGCTCTTTCAGATACTGAACGGCAGGACTTCCACCAGTGGGCGA TCCATGAGCACTTTCTCCCTGAGTCCTCGGCTTCAGGGGGCTGTGACGGAGACCTGCAGGCTGCGT GTACCATTCTTGTCAACGCACTGATGGATTTCCACCAAAGCTCAAGGAGTTATGACCACTCAGAAAAT TCTGATTTGGTCTTTGGTGGCCGCACAGGAAATGAGGATATTATTTCCAGATTGCAGGAGATGGTAG CTGACCTGGAGCTGCAGCAAGACCTCATAGTGCCTCTCGGCCACACCCCTTCCCAGGAGCACTTCCT CTTTGAGATTTTCCGCAGACGGCTCCAGGCTCTGACAAGCGGGTGGAGCGTGGCTGCCAGCCTTCA GAGACAGAGGGAGCTGCTAATGTACAAACGGATCCTCCTCCGCCTGCCTTCGTCTGTCCTCTGCGG CAGCAGCTTCCAGGCAGAACAGCCCATCACTGCCAGATGCGAGCAGTTCTTCCACTTGGTCAACTCT GAGATGAGAAACTTCTGCTCCCACGGAGGTGCCCTGACACAGGACATCACTGCCCACTTCTTCAGGG GCCTCCTGAACGCCTGTCTGCGGAGCAGAGACCCCTCCCTGATGGTCGACTTCATACTGGCCAAGT GCCAGACGAAATGCCCCTTAATTTTGACCTCTGCTCTGGTGTGGTGGCCGAGCCTGGAGCCTGTGCT GCTCTGCCGGTGGAGGAGACACTGCCAGAGCCCGCTG CCCCGGGAACTGCAGAAGCTACAAGAAG GCCGGCAGTTTGCCAGCGATTTCCTCTCCCCTGAGGCTGCCTCCCCAGCACCCAACCCGGACTGGC TCTCAGCTGCTGCACTGCACTTTGCGATTCAACAAGTCAGGGAAGAAAACATCAGGAAGCAGCTAAA GAAGCTGGACTGCGAGAGAGAGGAGCTATTGGTTTTCCTTTTCTTCTTCTCCTTGATGGGCCTGCTGT CGTCACATCTGACCTCAAATAGCACCACAGACCTGCCAAAGGCTTTCCACGTTTGTGCAGCAATCCT CGAGTGTTTAGAGAAGAGGAAGATATCCTGGCTGGCACTCTTTCAGTTGACAGAGAGTGACCTCAGG CTGGGGCGGCTCCTCCTCCGTGTGGCCCCGGATCAGCACACCAGGCTGCTGCCTTTCGCTTTTTAC AGTCTTCTCTCCTACTTCCATGAAGACGCGGCCATCAGGGAAGAGGCCTTCCTGCATGTTGCTGTGG ACATGTACTTGAAGCTGGTCCAGCTCTTCGTGGCTGGGGATACAAGCACAGTTTCACCTCCAGCTGG qi yni η / ηζηζ / Ε / γ CAGGAGCCTGGAGCTCAAGGGTCAGGGCAACCCCGTGGAACTGATAACAAAAGCTCGTCTTTTTCTG CTGCAGTTAATACCTCGGTGCCCGAAAAAAGAGCTTCTCACACGTGGCAGAGCTGCTGGCTGATCGTG GGGACTGCGACCAGAGGTGAGCGCCGCCCTCCAGAGCAGACAGCAGGCTGCCCCTGACGCTGAC CTGTCCCAGGTGAGCGCCGCCCTCCAGAGCAGACAGCAGGCTGCCCCTGACGCTGAC CTGTCCCAGGCCTGTCCCAGGCCT8; either ATGTCCGACTCGTGGGTCCCGAACTCCGCCTCGGGCCAGGACCCAGGGGGCCGCCGGAGGGCCTG GGCCGAGCTGCTGGCGGGAAGGGTCAAGAGGGAAAAATATAATCCTGAAAGGGCACAGAAATTAAA GGAATCAGCTGTGCGCCTCCTGCGAAGCCATCAGGACCTGAATGCCCTTTTGCTTGAGGTAGAAGGT CCACTGTGTAAAAAATTGTCTCTCAGCAAAGTGATTGACTGTGACAGTTCTGAGGCCTATGCTAATCA TTCTAGTTCATTTATAGGCTCTGCTTTGCAGGATCAAGCCTCAAGGCTGGGGGTTCCCGTGGGTATTC TCTCAGCCGGGATGGTTGCCTCTAGCGTGGGACAGATCTGCACGGCTCCAGCGGAGACCAGTCACC CTGTGCTGCTGACTGTGGAGCAGAGAAAGAAGCTGTCTTCCCTGTTAGAGTTTGCTCAGTATTTATTG GCACACAGTATGTTCTCCCGTCTTTCCTTCTGTCAAGAATTATGGAAAATACAGAGTTCTTTGTTGCTT GAAGCGGTGTGGCATCTTCACGTACAAGGCATTGTGAGCCTGCAAGAGCTGCTGGAAAGCCATCCC GACATGCATGCTGTGGGATCGTGGCTCTTCAGGAATCTGTGCTGCCTTTGTGAACAGATGGAAGCAT CCTGCCAGCATGCTGACGTCGCCAGGGCCATGCTTTCTGATTTTGTTCAAATGTTTGTTTTGAGGGGA TTTCAGAAAAACTCAGATCTGAGAAGAACTGTGGAGCCTGAAAAAATGCCGCAGGTCACGGTTGATG TACTGCAGAGAATGCTGATTTTTGCACTTGACGCTTTGGCTGCTGGAGTACAGGAGGAGTCCTCCAC TCACAAGATCGTGAGGTGCTGGTTCGGAGTGTTCAGTGGACACACGCTTGGCAGTGTAATTTCCACA GATCCTCTGAAGAGGTTCTTCAGTCATACCCTGACTCAGATACTCAC TCACAGCCCTGTGCTGAAAGC ATCTGATGCTGTTCAGATGCAGAGAGAGTGGAGCTTTGCGCGGACACACCCTCTGCTCACCTCACTG TACCGCAGGCTCTTTGTGATGCTGAGTGCAGAGGAGTTGGTTGGCCATTTGCAAGAAGTTCTGGAAA CGCAGGAGGTTCACTGGCAGAGAGTGCTCTCCTTTGTGTCTGCCCTGGTTGTCTGCTTTCCAGAAGC GCAGCAGCTGCTTGAAGACTGGGTGGCGCGTTTGATGGCCCAGGCATTCGAGAGCTGCCAGCTGGA CAGCATGGTCACTGCGTTCCTGGTTGTGCGCCAGGCAGCACTGGAGGGCCCCTCTGCGTTCCTGTC ATATGCAGACTGGTTCAAGGCCTCCTTTGGGAGCACACGAGGCTACCATGGCTGCAGCAAGAAGGC CCTGGTCTTCCTGTTTACGTTCTTGTCAGAACTCGTGCCTTTTGAGTCTCCCCGGTACCTGCAGGTGC ACATTCTCCACCCACCCCTGGTTCCCAGCAAGTACCGCTCCCTCCTCACAGACTACATCTCATTGGC CAAGACACGGCTGGCCGACCTCAAGGTTTCTATAGAAAACATGGGACTCTACGAGGATTTGTCATCA GCTGGGGACATTACTGAGCCCCACAGCCAAGCTCTTCAGGATGTTGAAAAGGCCATCATGGTGTTTG AGCATACGGGGAACATCCCAGTCACCGTCATGGAGGCCAGCATATTCAGGAGGCCTTACTACGTGTC CCACTTCCTCCCCGCCCTGCTCACACCTCGAGTGCTCCCCAAAGTCCCTGACTCCCGTGTGGCGTTT ATAGAGTCTCTGAAGAGAGCAGATAAAATCCCCCCATCTCTGTACTCCACCTACTGCCAGGCCTGCT CTGCTGCTGAAGAGAAGCCAGAAGATGCAGCCCTGGGAGTGAGGGCAGAACCCAACTCTGCTGAGG AGCCCCTGGGACAGCTCACAGCTGCACTG GGAGAGCTGAGAGCCTCCATGACAGACCCCAGCCAG CGTGATGTTATATCGGCACAGGTGGCAGTGATTTCTGAAAGACTGAGGGCTGTCCTGGGCCACAATG AGGATGACAGCAGCGTTGAGATATCAAAGATTCAGCTCAGCATCAACACGCCGAGACTGGAGCCAC GGGAACACATTGCTGTGGACCTCCTGCTGACGTCTTTCTGTCAGAACCTGATGGCTGCCTCCAGTGT CGCTCCCCCGGAGAGGCAGGGTCCCTGGGCTGCCCTCTTCGTGAGGACCATGTGTGGACGTGTGC Ql 7ΠΙ η / η7Π7 / Ε / Υ TCCCTGCAGTGCTCACCCGGCTCTGCCAGCTGCTCCGTCACCAGGGCCCGAGCCTGAGTGCCCCAC ATGTGCTGGGGTTGGCTGCCCTGGCCGTGCACCTGGGTGAGTCCAGGTCTGCGCTCCCAGAGGTG GATGTGGGTCCTCCTGCACCTGGTGCTGGCCTTCCTGTCCCTGCGCTCTTTGACAGCCTCCTGACCT GTAGGACGAGGGATTCCTTGTTCTTCTGCCTGAAATTTTGTACAGCAGCAATTTCTTACTCTCTCTGC AAGTTTTCTTCCCAGTCACGAGATACTTTGTGCAGCTGCTTATCTCCAGGCCTTATTAAAAAGTTTCAG TTCCTCATGTTCAGATTGTTCTCAGAGGCCCGACAGCCTCTTTCTGAGGAGGACGTAGCCAGCCTTT CCTGGAGACCCTTGCACCTTCCTTCTGCAGACTGGCAGAGAGCTGCCCTCTCTCTCTGGACACACAG AACCTTCCGAGAGGTGTTGAAAGAGGAAGATGTTCACTTAACTTACCAAGACTGGTTACACCTGGAG CTGGAAATTCAACCTGAAGCTGATGCTCTTTCAGATACTGAACGGCAGGACTTCCACCAGTGGGCGA TCCATGAGCACTTTCTCCCTGAGTCCTCGGCTTCAGGGGGCTGTGACGGAGACCTGCAGGCTGCGT GTACCATTCTTGTCAACGCACTGATGGATTTCCACCAAAGCTCAAGGAGTTATGACCACTCAGAAAAT TCTGATTTGGTCTTTGGTGGCCGCACAGGAAATGAGGATATTATTTCCAGATTGCAGGAGATGGTAG CTGACCTGGAGCTGCAGCAAGACCTCATAGTGCCTCTCGGCCACACCCCTTCCCAGGAGCACTTCCT CTTTGAGATTTTCCGCAGACGGCTCCAGGCTCTGACAAGCGGGTGGAGCGTGGCTGCCAGCCTTCA GAGACAGAGGGAGCTGCTAATGTACAAACGGATCCTCCTCCGCCTGCCT TCGTCTGTCCTCTGCGG CAGCAGCTTCCAGGCAGAACAGCCCATCACTGCCAGATGCGAGCAGTTCTTCCACTTGGTCAACTCT GAGATGAGAAACTTCTGCTCCCACGGAGGTGCCCTGACACAGGACATCACTGCCCACTTCTTCAGGG GCCTCCTGAACGCCTGTCTGCGGAGCAGAGACCCCTCCCTGATGGTCGACTTCATACTGGCCAAGT GCCAGACGAAATGCCCCTTAATTTTGACCTCTGCTCTGGTGTGGTGGCCGAGCCTGGAGCCTGTGCT GCTCTGCCGGTGGAGGAGACACTGCCAGAGCCCGCTGCCCCGGGAACTGCAGAAGCTACAAGAAG GCCGGCAGTTTGCCAGCGATTTCCTCTCCCCTGAGGCTGCCTCCCCAGCACCCAACCCGGACTGGC TCTCAGCTGCTGCACTGCACTTTGCGATTCAACAAGTCAGGGAAGAAAACATCAGGAAGCAGCTAAA GAAGCTGGACTGCGAGAGAGAGGAGCTATTGGTTTTCCTTTTCTTCTTCTCCTTGATGGGCCTGCTGT CGTCACATCTGACCTCAAATAGCACCACAGACCTGCCAAAGGCTTTCCACGTTTGTGCAGCAATCCT CGAGTGTTTAGAGAAGAGGAAGATATCCTGGCTGGCACTCTTTCAGTTGACAGAGAGTGACCTCAGG CTGGGGCGGCTCCTCCTCCGTGTGGCCCCGGATCAGCACACCAGGCTGCTGCCTTTCGCTTTTTAC AGTCTTCTCTCCTACTTCCATGAAGACGCGGCCATCAGGGAAGAGGCCTTCCTGCATGTTGCTGTGG ACATGTACTTGAAGCTGGTCCAGCTCTTCGTGGCTGGGGATACAAGCACAGTTTCACCTCCAGCTGG CAGGAGCCTGGAGCTCAAGGGTCAGGGCAACCCCGTGGAACTGATAACAAAAGCTCGTCTTTTTCTG CTGCAGTTAATACCTCGGTGCCCGAAAAAGAGCT TCTCACACGTGGCAGAGCTGCTGGCTGATCGTG GGGACTGCGACCCAGAGGTGAGCGCCGCCCTCCAGAGCAGACAGCAGGCTGCCCCTGACGCTGAC CTGTCCCAGGAGCCTCATCTCTTCTGATGA (SEQ ID NO: 36). The present disclosure includes plasmids that comprise an expression cassette or transfer cassette described herein. In particular embodiments, the plasmid is pCCL-PGKFANCA-WPRE* or pCCL-PGK-FANCAW-82-RO (SEQ ID NO: 25). In some embodiments, the gene therapy vector is a self-limiting LV. In a specific embodiment of any of the expression cassettes and gene therapy vectors described herein, the transfer cassette is a pCCL-SIN-cPPT / CTS-hPGK-hFANCA-WPRE of the description Ql 7ΠΙ η / η7Π7 / Ε / Υ comprising or consisting of the following sequence, or a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity with respect to SEQ ID NO: 24. SEQ ID NO: 24 corresponds to the plasmid pCCL-PGK-FANCA-WPRE*. SEQ ID NO: 25 corresponds to the plasmid pCCL-PGK-FANCAW-82-RO. In one embodiment, a FANCA gene is delivered via a lentiviral (LV) vector. The FANCA LVs described herein use a self-inactivating lentiviral (LV) vector. In one embodiment, the FANCA LV comprises a human phosphoglycerate (PGK) gene promoter. The safety properties of this vector have been markedly improved compared to gamma-retroviral vectors already used in the clinic, which harbor strong viral promoters. In certain embodiments, the lentiviral vector is PGK-FANCA.WPRE*LV, which comprises the gene transfer cassette comprising the sequences described in SEQ ID NO: 24. The PGK-FANCA-WPRE* gene expression cassette portion LV comprises the human PGK promoter, the FANC cDNA coding sequence, and the WPRE*; and corresponds to nucleotides 3541 of 9178 of SEQ ID NO: 24. The portion of the PGK-FANCA-WPRE*LV transfer cassette ranges from approximately the 5' LTR (U5) to approximately the 3' LTR (U5) of sequence. With respect to SEQ ID NO: 24, nucleotides 1586-1789 of SEQ ID NO: 24 comprise the human CMV immediate premature promoter. Nucleotides 2031-2156 of SEQ ID NO: 24 comprise the HIV1 psi packaging signal. Nucleotides 2649-2882 of SEQ ID NO: 24 comprise the RRE element of HIV1. Nucleotides 3378-3495 of SEQ ID NO: 24 comprise the HIV cPPT / CTS element. Nucleotides 3541-4051 of SEQ ID NO: 24 comprise the hPGK promoter. Nucleotides 4078-8445 of SEQ ID NO: 24 comprise the human FANCA-A cDNA. Nucleotides 8502-9178 of SEQ ID NO: 24 comprise the mutated WPRE element. Nucleotides 9262-9495 of SEQ ID NO: 24 comprise the 3' LTR delta U of HIV. In certain embodiments, the lentiviral vector is pCCL-PGK-FANCAW-82-RO, which comprises the gene transfer cassette comprising the sequences described in SEQ ID NO: 25. The gene expression cassette portion of pCCL-PGK- FANCAW-82-RO comprises the human PGK promoter, the FANC cDNA coding sequence, and the WPRE*; and corresponds to nucleotides 2335 of 7888 of SEQ ID NO: 25. The portion of the transfer cassette of pCCL-PGK-FANCAW-82-RO ranges from approximately the 5' LTR (U5) to approximately the 3' LTR (U5 ) of the sequence. With respect to SEQ ID NO: 25, nucleotides 1-577 of SEQ ID NO: 25 comprise the human CMV immediate early promoter. Nucleotides 889-933 of SEQ ID NO: 25 comprise the HIV1 psi packaging signal. Nucleotides 1296-253 of SEQ ID NO: 25 comprise the RRE element of HIV1. Nucleotides 2176-2191 of SEQ ID NO: 25 comprise the HIV cPPT / CTS element. Nucleotides 2335-2845 of SEQ ID NO: 25 comprise the hPGK promoter. Nucleotides 2872-7242 of SEQ ID NO: 25 comprise the human FANCA-A cDNA. Nucleotides 7293-7888 of SEQ ID NO: 25 comprise the mutated WPRE element. Nucleotides 8056-8289 of SEQ ID NO: 25 comprise the 3' LTR delta U of HIV. In yet another embodiment, the lentiviral vector contains the following elements: (i) the main qi / ni n / nznz / E / v chain of the lentiviral vector derived from the initial pCCLsin-cppt-hPGK-eGFP-WPRE (Dull et al, 1998 J. Virol 72 (11), 9873-9880). The pCCL backbone uses a heterologous CMV-HIV 5' LTR to obtain high levels of viral RNA transcription in producer cells. Such a heterologous LTR makes the construction independent of the need to use the HIV Tat protein for the production of the rHIV particles and is therefore a safety feature. The U3 region of the 3' LTR contains a 400 bp deletion as described in (Zufferey et al J Virol, 1998) which confers autoinactivation properties to the vector; (ii) the human codon-optimized FANCA gene cDNA (4368 bp, GenBank accession number: X_99226 or as described herein) encoding the FANCA protein (1455 AA) under the control of the human PGK promoter . The promoter has already been characterized by its stable activity in vivo and by improved safety properties, compared to other promoters already used in gene therapy; and (iii) a mutated version of the woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) that is deleted in the 3' region of a protein X coding sequence and any residual ORF as described by Schambach et al. (Gene therapy, 2006; 13, 641-645) or WPRE*. In certain embodiments, the FANCA LVs described herein use an autoinactivating lentiviral (LV) vector. In one embodiment, the FANCA LV comprises a human phosphoglycerate (PGK) gene promoter. The safety properties of this vector have been markedly improved compared to gamma-retroviral vectors already used in the clinic, which harbor strong viral promoters. In one embodiment, a FANCA gene is delivered via a lentiviral vector. In certain embodiments, the lentiviral vector is PGK-FANCA.WPRE*LV. Gene therapy vectors encapsulating the polynucleotide cassettes of the present disclosure can be produced using standard methodology. For example, in the case of LV virions, an LV expression vector according to the invention can be introduced into a producer cell with subsequent introduction of an LV helper construct, where the helper construct includes LV coding regions capable of expressed in the producer cell and that complement LV helper functions absent in the LV vector. Additional helper virus and / or vectors are then introduced into the producer cell, wherein the helper virus and / or additional vectors provide complementary functions to support efficient LV virus production. The producer cells are then cultured to produce the LV. These steps are carried out using a standard methodology. In particular embodiments, the plasmids depicted in Figures 38-41 are used to produce the gene therapy vectors. Any suitable method of producing viral vector particles for delivery of the subject polynucleotide cassettes may be used, including, but not limited to, those described in the examples below. Any concentration of infectious viral vector particles suitable for efficiently transducing mammalian cells may be prepared for contact with mammalian cells in vitro or in vivo. For example, the virus particles can be formulated with a concentration of 108 infectious units per ml or more, eg, 5x108 infectious units per mL; 109 infectious units per mL; 5 x 109 infectious units per mL, 1010 infectious units per mL, qi and ni η / ηζηζ / Ε / γ 5x1010 infectious units per mL; 1011 infectious units per mL; 5 x1011 infectious units per mL; 1012 infectious units per mL; 5x1012 infectious units per mL; 1013 infectious units per mL; 1.5 x1013 infectious units per mL; 3x1013 infectious units per mL; 5x1013 infectious units per mL; 7.5x1013 infectious units per mL; 9x1013 infectious units per mL; 1 x 1014 infectious units per mL, 5 x 1014 infectious units per mL or more, but typically not more than 1 x 1015 infectious units per mL. In preparing the subject LV gene therapy vectors, any host cells may be employed to produce LV virions including, for example, mammalian cells (eg, 293 cells), insect cells (eg, SF9), microorganisms and yeast. The host cells may also be packaging cells in which the LV rep and cap genes are stably maintained in the host cell or producer cells in which the LV vector genome is stably maintained and packaged. Illustrative packaging and producer cells are derived from SF-9, 293, A549 or HeLa cells. LV vectors are purified and formulated using standard techniques known in the art. In certain embodiments, the present invention includes a cell comprising a gene expression cassette, gene transfer cassette, or gene therapy vector described herein. In related embodiments, the cell is transduced with a gene therapy vector that comprises an expression cassette described herein or has an expression cassette described herein integrated into the cell's genome. In certain embodiments, the cell is a cell that is used to produce a viral gene therapy vector, e.g. For example, a packaging cell. In other embodiments, the cell is a cell to be delivered to a subject to provide the subject with the gene product encoded by the expression cassette. Thus, in certain embodiments, the cell is autologous to the subject to be treated or was obtained from the subject to be treated. In other embodiments, the cell is allogeneic to the subject to be treated or was obtained from a donor other than the subject to be treated. In particular embodiments, the cell is a mammalian cell, e.g. For example, a human cell. In certain embodiments, the cell is a blood cell, an erythrocyte, a hematopoietic progenitor cell, a bone marrow cell, e.g. eg, a lineage-depleted bone marrow cell, a hematopoietic stem cell (eg, CD34+), or a committed hematopoietic erythroid progenitor cell. In particular embodiments, the cell is a CD34+ cell obtained from a subject to be treated with the cell after it is transduced with a gene therapy vector described herein. In a particular embodiment, the cell is a FACD34+ cell obtained from a subject diagnosed with FA. In some embodiments, the methods described herein result in therapeutic benefit, e.g. eg, prevent the development of a disorder, stop the progression of a disorder, reverse the progression of a disorder, etc. For example, in one embodiment, the disorder is BMF. In one embodiment, the disorder is thrombocytopenia. In another embodiment, the disorder is leukopenia. In one embodiment, the disorder is pancytopenia. In one embodiment, the disorder is neutropenia. In another embodiment, the disorder is anemia. In some embodiments, the subject method comprises the step of detecting that a therapeutic benefit qi jm η / ηζηζ / Ε / γ has been achieved. One of skill in the art will appreciate that such measures of therapeutic efficacy will be applicable to the particular disease being modified and will recognize the appropriate detection methods to use to measure therapeutic efficacy. In another embodiment, the present invention includes a method of treating a disease in a subject in need thereof comprising providing to the subject an effective amount of either or both of a CD34-enriched cell population with high stringency and a CD34-enriched cell population with low stringency, either or both of which have been contacted with a gene therapy vector, e.g. eg, a viral vector, which expresses a therapeutic gene product in cells. In particular embodiments, either or both of a high stringency CD34-enriched cell population and a low stringency CD34-enriched cell population are autologous to the subject. In certain embodiments, the cells are erythroid cells, eg. eg, hematopoietic stem cells or committed hematopoietic erythroid progenitor cells. In some embodiments, the cell is a bone marrow cell, e.g. eg, a lineage-depleted bone marrow cell. In particular embodiments, the method is used to treat FA and the viral vector is an LV comprising an expression construct described herein comprising a human PGK promoter operably linked to a FANCA gene cDNA or coding sequence and a mutated wPRE described herein. In particular embodiments, the cells are provided to the subject parenterally, e.g. eg, through intravenous injection. In another embodiment, the present invention includes a method of treating AF in a subject in need thereof, comprising providing the subject with an effective amount of a CD34-enriched cell population with high stringency and / or a CD34-enriched cell population with low stringency. autologous stringency of stem cells transduced with an LV vector expressing a FANCA cDNA in the cells, wherein the LV vector comprises a human PGK promoter operably linked to a FANCA cDNA or coding sequence and a mutated wPRE sequence described in the present memory. In particular embodiments, the cells are hematopoietic stem cells or committed hematopoietic erythroid progenitor cells, e.g. For example, bone marrow cells. In particular embodiments, the cells are provided to the subject parenterally, e.g. eg, through intravenous injection. Expression of the transgene using the subject transgene is expected to be robust. Consequently, in some instances, expression of the transgene, e.g. eg, as detected by measuring levels of the gene product, by measuring therapeutic efficacy, etc. can be observed two months or less after administration, e.g. eg, 4, 3 or 2 weeks or less after administration, eg 1 week after administration of the subject composition. Expression of the transgene is also expected to persist over time. Consequently, in some instances, expression of the transgene, e.g. eg, as detected by measuring levels of the gene product, by measuring therapeutic efficacy, etc. can be observed 2 months or more after administration of the subject composition, e.g. eg 4, 6, 8 or 10 months or more, in some instances 1 year or more, eg 2, 3, 4 or 5 years, in certain instances 5+ years. In certain embodiments, the method comprises the step of detecting expression of the transgene in the cells or in the subject, wherein the expression is enhanced relative to the expression of a cassette of qi and ni η / ηζηζ / Ε / γ polynucleotides that are not comprises the one or more improved elements of the present description. Typically, expression will be enhanced 2-fold or more relative to expression from a control, ie, a control polynucleotide cassette, e.g. eg, as known in the art, eg 3 times, 4 times or 5 times or more, in some instances 10 times, 20 times or 50 times or more, e.g. eg, 100 times, as evidenced by e.g. eg, earlier detection, higher levels of gene product, stronger functional impact on cells, etc. In some modalities, the dose of cells that patients receive per infusion will be that obtained from the transduction process. In various preferred embodiments, at least about 1x101, 1x102, 1x103, 1x104, 1x105, 1x106, 1x107, 1x108 or more high stringency CD34-enriched cells / KG of patient weight are infused into the patient. In various preferred embodiments, at least about 1x101, 1x102, 1x103, 1x104, 1x105, 1x106, 1x107, 1x108 or more low stringency CD34-enriched cells / KG of patient weight are infused into the patient. In some modalities, between 1x106 and 4x106 CD34-enriched cells with high stringency / Kg of patient weight are infused into the patient. In other modalities, 3x105 and 4x106 CD34-enriched cells with high stringency / Kg of patient weight are infused into the patient. In some modalities, between 1x106 and 4x106 CD34-enriched cells with high stringency / Kg of patient weight are infused into the patient. In other modalities, 3x105 and 4x106 CD34-enriched cells with high stringency / Kg of patient weight are infused into the patient. In some embodiments, the cells will be infused into the patient as a single dose. In other embodiments, cells will be administered to the patient in multiple doses (eg, high stringency and low stringency CD34-enriched cell populations are administered sequentially once or multiple times). Transduced cells can be infused immediately after the transduction process is complete. In particular embodiments, the transduced cells are stored or frozen prior to use, while in certain embodiments they are provided to the subject immediately or shortly after they are transduced, eg. eg, in one hour, two hours, four hours or eight hours. After it integrates, the cells express the therapeutic protein (eg, human FANCA protein). The transduced FA cells are genetically corrected and therefore capable of activating the FA pathway by monoubiquitination of FANCD2 and FANCI. These proteins migrate to areas of DNA damage, and in cooperation with other DNA repair proteins, promote DNA repair in these cells, as occurs in healthy cells. As described in further detail in the Examples, in vitro preclinical data with BM samples from human AF patients have already demonstrated the efficacy of FANCA LV in correcting the phenotype of these cells. In one embodiment, at least 1 to 4 x 106 corrected CD34+ cells (eg, FANCA-transduced HSCs) are administered per kilogram of patient weight, e.g. eg, to restore hematopoiesis in a patient with unconditioned AF. In some embodiments, the transduced cells are infused or administered to the patient immediately after transduction. In other qi jm η / ηζηζ / Ε / γ modalities, the transduced cells are frozen before being infused or administered to the patient. Genetic correction of HSCs from patients with AF, with subsequent autologous transplantation of these cells (haematopoietic gene therapy), is a good alternative for patients with AF, particularly those who lack an HLA-identical sibling. In one embodiment, hematopoietic gene therapy is the preferred treatment regimen for a patient who lacks an HLA-identical sibling. In another embodiment, hematopoietic gene therapy is a preferred treatment regimen for a patient who has an HLA-identical sibling. Compositions and formulations Certain aspects of the disclosure relate to a system or combination of a high stringency CD34-enriched cell population and a low stringency CD34-enriched cell population, either or both of which have been transduced with a gene therapy vector. Some embodiments comprise a combination of high stringency CD34-enriched and low stringency CD34-enriched cell populations, either or both of which have been transduced with a lentiviral vector containing a human FANC gene, e.g. eg FANCA, FANCC or FANCG, or a nucleic acid sequence encoding a FANC protein, including functional fragments and variants thereof. Some modalities comprise a combination of high stringency CD34-enriched and low stringency CD34-enriched cell populations, either or both of which have undergone gene editing or gene repair, such as a CRISPR-type gene editing system, TALEN, zinc finger or meganuclease. Some modalities comprise a combination of high stringency CD34-enriched and low stringency CD34-enriched cell populations that have been transduced with a lentiviral (or other viral) vector containing a transgene associated with a disease or condition, such as a disorder of immunodeficiency. In some aspects of the disclosure, formulations are provided for the treatment of a disease or condition. The formulations may comprise cell population(s) enriched for CD34 at high stringency or cell population(s) enriched for CD34 at low stringency or both, together with a physiologically acceptable carrier or carrier pharmaceutically acceptable as described herein. Formulations may comprise high stringency CD34-enriched cell population(s) or low stringency CD34-enriched cell population(s) or both, wherein one or both cell populations are are transduced with a gene therapy vector and express or are capable of expressing a therapeutic agent, together with a physiologically acceptable carrier or pharmaceutically acceptable carrier as described herein. The present invention includes pharmaceutical compositions and formulations comprising either or both of a high stringency CD34-enriched cell population and a low stringency CD34-enriched cell population, gene therapy vector as described herein and a carrier, diluent or pharmaceutically acceptable excipient. The subject high stringency CD34-enriched cell population and / or a subject low stringency CD34-enriched cell population can be combined with useful pharmaceutically acceptable carriers, diluents, and reagents qi and ni η / ηζηζ / Ε / γ to prepare a formulation that is generally safe, non-toxic and desirable, and includes excipients that are acceptable for use in primates. Examples of such excipients, carriers, or diluents include, but are not limited to, water, saline, Ringer's solutions, dextrose solution, and 5% human serum albumin. Supplementary active compounds can also be incorporated into the formulations. Solutions or suspensions used for formulations may include a sterile diluent such as water for injection, saline, dimethyl sulfoxide (DMSO), fixed oils, polyethylene glycols, glycerin, propylene glycol, or other synthetic solvents; antibacterial compounds such as benzyl alcohol or methyl parabens; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid (EDTA); buffers such as acetates, citrates or phosphates; detergents such as Tween 20 to prevent caking; and compounds for tonicity adjustment such as sodium chloride and dextrose. The pH can be adjusted with acids or bases, such as hydrochloric acid or sodium hydroxide. In particular embodiments, the formulations are sterile. In some embodiments, CD34-enriched cell populations are produced in accordance with current good manufacturing practices. Produced in accordance with current good manufacturing practice means that the formulation prepared for administration is sufficiently safe to allow administration to a human subject in accordance with applicable government regulations and authorizations. Applicable regulations and authorizations will generally require that the formulation meet pre-approved acceptance criteria for identity, concentration, quality and purity. Acceptance criteria include limits, ranges, or other suitable numerical measurements of test results used to determine whether a formulation complies with current good manufacturing practice. A specification establishes the analytical procedures that are used to assess conformance to acceptance criteria. Formulations can be evaluated in batches. A lot is a specific quantity of a formulation evaluated to ensure compliance with the acceptance criteria. The formulations can be included in a container, package or dispenser, e.g. eg syringe e.g. eg, a pre-filled syringe, together with instructions for administration. Where necessary or beneficial, the formulations may include a local anesthetic such as lidocaine to decrease pain at an injection site. The therapeutically effective amounts of cells within the formulations may be greater than 102 cells, greater than 103 cells, greater than 104 cells, greater than 105 cells, greater than 106 cells, greater than 107 cells, greater than 108 cells, greater than 103 cells, greater than 1010 cells, or greater than 1011. In formulations described herein, cells are generally in a volume of one liter or less, 500 ml or less, 250 ml or less, or 100 ml or less. Consequently, the density of cells administered is typically greater than 104 cells / ml, 107 cells / ml, or 108 cells / ml. The formulations described herein can be prepared for administration by, for example, injection, infusion, perfusion, or lavage. Therapeutically effective amounts qi and ni η / ηζηζ / Ε / γ for administration may include greater than 102 cells, greater than 103 cells, greater than 104 cells, greater than 105 cells, greater than 106 cells, greater than 107 cells, greater than 108 cells, greater than 109 cells, greater than 1010 cells or greater than 1011. In particular embodiments, a minimum dose is 2 x 106 cells / kg subject body weight. In some embodiments, the pharmaceutical composition provided herein comprises a therapeutically effective amount of either or both of a high stringency CD34-enriched cell population and a low stringency CD34-enriched cell population described herein in admixture with a carrier. and / or pharmaceutically acceptable carrier, eg, saline, phosphate buffered saline, phosphate and amino acids, polymers, polyols, sugar, buffers, preservatives, and other proteins. Illustrative amino acids, polymers and sugars and the like are octylphenoxy polyethoxy ethanol compounds, polyethylene glycol monostearate compounds, polyoxyethylene sorbitan fatty acid esters, sucrose, fructose, dextrose, maltose, glucose, mannitol, dextran, sorbitol, inositol, galactitol, xylitol , lactose, trehalose, bovine or human serum albumin, citrate, acetate, Ringer's and Hank's solutions, cysteine, arginine, carnitine, alanine, glycine, lysine, valine, leucine, polyvinylpyrrolidone, polyethylene and glycol. Preferably this formulation is stable for at least six months at 4°C. In some embodiments, the pharmaceutical composition provided herein comprises a buffer, such as phosphate buffered saline (PBS) or sodium phosphate / sodium sulfate, tris buffer, glycine buffer, sterile water, and other buffers known for the skilled in the art such as those described by Buena et al. (1966) Biochemistry 5:467. The pH of the buffer in which the pharmaceutical composition comprising the tumor suppressor gene contained in the adenoviral vector delivery system may be in the range of 6.5 to 7.75, preferably 7 to 7.5, and most preferably, 7.2 to 7.4. All publications mentioned herein are incorporated herein by reference to describe and disclose the methods and / or materials in connection with which the publications are mentioned. This description shall be deemed to supersede any description in an incorporated publication to the extent of any inconsistency. It is further noted that claims can be written to exclude any optional elements. As such, this statement is intended to serve as the underlying background for the use of such proprietary terminology such as "solely," "only," and the like in connection with the mention of claim elements, or the use of a "negative" limitation. . The publications described herein are provided for disclosure only prior to the filing date of the present application. In addition, the publication dates provided may be different from the actual publication dates and may need to be confirmed independently. Because FA-A is the most frequent complementation group in FA patients (Casado et., 2007, Taniguchi et., 2006), the Examples focus on vectors that express the FANCA gene and / or the marker gene. EGFP; however, other FANCA genes can be used to treat other complementation groups qi jm η / ηζηζ / Ε / γ in a similar way The description is further described in the following Examples, which do not limit the scope of the description described in the claims Examples Example 1 Treatment of patient with CD34-enriched cell populations with high and low stringency Patient 1 presented with Fanconi anemia. Next, patient 1 underwent mobilization using G-CSF and plerixafor and subsequently two apheresis collections on successive days. Relative to other AF patients in the same clinical trial, patient 1 had moderate mobilization of CD34 cells, indicated by peripheral blood analysis of circulating CD34 cells, with mobilization kinetics similar to other patients. After the two apheresis collections, the collected HSPCs were divided into two biological peripheral blood samples. High Stringency CD34 Selection: The first biological sample was enriched by selecting for CD34+ cells under high stringency conditions using the Miltenyi Biotec CliniMACS® System in enrichment mode with Miltenyi Biotec CD34 Enrichment Reagent, as described in US patent no. 8,727,132. Selection of CD34 with high stringency resulted in 29.0% yield of CD34+ cells and 36% relative purity. Low stringency CD34 selection: The second biological sample was enriched by selecting for CD34+ cells under low stringency conditions using a modification of the depletion mode of the Miltenyi Biotec CliniMACS® System. Briefly, the second biological sample was labeled with the Miltenyi Biotec CD34 reagent. The sample was then loaded onto the column using the depletion mode program for the instrument. After bulk loading the sample with the magnet ON, the cell collection bag (used in the normal operation of the instrument to collect target cells) was removed and not used for stem cell transplantation. The bag of non-target cells was attached, then the magnet was turned OFF and an elution buffer was applied to the instrument which caused the CD34+ cells to elute toward the bag of non-target cells. The cell population collected in the non-target cell bag was maintained and designated as the CD34-enriched cell population with low stringency. Selection of CD34 with low stringency resulted in 54.5% yield of CD34+ cells with 5.8% relative purity. The low purity is due to other types of hematopoietic cells that were not purified from the CD34+ cells during the selection process. The results are summarized in Tables 1A and 1B. Qlyni n / nznz / B / Y Table 1 A: Before enrichment with CD34 AF Af TNC % CD34 Total CD34 CD34 / kg Pt no. 1 1 1.36E+10 0.15 2.04E+07 1.46E+06 2 2.30E+10 0.1 2.30E+07 1.64E+06 Table 1B: After CD34 enrichment After enrichment with CD34 FA Af Enriq. with CD34 TNC CD34 % Total CD34 CD34 / kg Yield of CD34 Pt no. 1 1 Low 1.92E+08 5.8 1.11 E+07 7.95E+05 54.5 2 High 1.85E+07 36 6.66E+06 4.76E+05 29.0 qi yni η / ηζηζ / Ε / γ Cell counts and cell purity of starting CD34+ and resulting cell populations from a patient with Fanconi-A anemia Af: apheresis TNC: total nuclear cell count Low: Modified CliniMACS Depletion Schedule High: Standard CliniMACS CD34 Enrichment Program Subsequently, both the high stringency CD34-enriched cell population and the low stringency CD34-enriched cell population were individually transduced with a recombinant gene therapy vector (PGK-FANC-WPRE*) (SEQ ID NO: 25) encoding the FANCA gene product, and the resulting genetically modified cells were designated Product 1.1 and Product 1.2, respectively. Product 1.1 and Product 1.2 were mixed together and then administered to Patient 1 by continuous intravenous infusion over 10-30 minutes while monitoring clinical indicators. Patient 1 exhibited the fastest or nearly the fastest selection graft incorporation kinetics in vivo of all AF patients transplanted at participating institutions. The early stabilizing trends of hematopoietic lineages that had declined in this patient with AF before transplantation is a compelling endpoint of clinical success, which was unexpectedly achieved by this approach to treatment. Five other AF patients received transplants with standard CD34 selection strategies and none showed graft incorporation kinetics comparable to that of patient 1. Without wishing to be bound by theory, it is believed that mixing of high stringency (Product 1.1) and low stringency (Product 1.2) CD34-enriched cell populations confers a selective advantage in vivo to gene-modified FA hematopoietic cells and results in a progressive increase in gene-modified cells over time. Product 1.1 (high stringency CD34-enriched cell population) is believed to provide the majority of cells engineered with genes contributing to hematopoiesis and Product 1.2 (low stringency CD34-enriched cell population) is believed to have facilitated the incorporation of blunt graft and hematopoietic repopulation by means of Product 1.1. Example 2 Comparative Efficacy of Treatment with Lineage Depleted Cell Population Patient 2 presented with Fanconi anemia. A biological sample of peripheral blood from patient 2 was obtained by mobilized apheresis using procedures equivalent to those of Example 1. A lineage-depleted cell population was prepared by labeling the biological sample with the reagent CD3 / CD14 / CD16 / CD19 and depleting the labeled cell sample using the Miltenyi Biotec CliniMACS® System in depletion mode. Selection for lineage-depleted CD34 resulted in 56% yield of CD34+ cells with 1.6% relative purity. The low purity is due to other types of hematopoietic cells that were not purified from the CD34+ cells during the selection process. Yield and purity of CD34 cells were similar to those achieved with patient 1 in the low stringency CD34-enriched cell population. No high stringency CD34-enriched cell population was prepared. The lineage-depleted cell population was individually transduced with a recombinant gene therapy vector encoding the FANCA gene product and designated Product 2.1. Product 2.1 was administered to patient 2 by continuous intravenous infusion over 10-30 minutes while monitoring clinical indicators in cell numbers similar to those used with patient 1. Unlike patient 1, no gene-engineered cells could be detected in the blood of patient 2 six months after the transplant. Therefore, Product 2.1, which was believed to be similar to Product 1.2 alone, does not result in detectable hematopoietic recovery. Example 3 Modification of low stringency conditions for higher yield and treatment with the resulting cell populations Patient 3 presented with Fanconi anemia. A biological peripheral blood sample is obtained from patient 3 by mobilized apheresis using procedures equivalent to those of Example 1. After apheresis collection, the collected HSPCs are divided into two biological peripheral blood samples. High Stringency CD34 Selection: A first biological sample is enriched by selecting for CD34+ cells under high stringency conditions using the Miltenyi Biotec CliniMACS® System in enrichment mode with Miltenyi Biotec CD34 Enrichment Reagent, as described in Example 1. Selection for CD34 with high stringency results in greater than 20 7% yield of CD34+ cells and greater than 20 7% relative purity. The CD34 selection program is run on a CliniMACS® system using the sample as described above with the parameters indicated in Table 2. The process takes approximately 20-30 minutes. The “target cell bag” of the CliniMACS® system contains the CD34-enriched cell population with high stringency. qi / ni n / nznz / B / v Table 2 Program and sample input parameters Separation program ENRICHMENT 1.1 Tubing set (select from list) CliniMACS LS tubing set REF 16201 Cell concentration [*10° / mL] 180 | Min:20, Max: 400 Labeled Cell Frequency [%] 1 | Min: 1, Max: 80 Sample loading volume [mL] 150 | Min: 60, Max: 400 Calculated process parameters Processing time max. [min] 29 Labeled cells to process [-] 2.7E+08 Number of steps [-] 1 Process specifications Specifications inside Calculated process parameters - Display output Buffer required for process [mL] 1000 Bag size; Cell Collection Bag [mL] 150 Bag Size: Bag of Negative Fraction [mL] or Bag of Non-Target Cells [mL] 500 Bag Size: Buffer Waste Bag [mL] 500 Bag Size: Waste Bag Prime No. [mL] or Reapplication Bag [mL] no modification Additional Process Parameters Step Extension in Seconds 511 Step Extension in mL 85 οι yni η / ηζηζ / Ε / γ Low stringency CD34 selection: A second biological sample is enriched by selecting for CD34+ cells under low stringency conditions using a modification of the depletion mode of the Miltenyi Biotec CliniMACS® System as described in Example 1 with the modification intended for provide a higher yield of CD34+ cells relative to the low stringency enrichment applied to patient 1. Peripheral blood apheresis product, anticoagulated with anticoagulant citrate dextrose (ACD-A) solution, is provided in a total of 60x109 to 6x108 cells (when using one vial of Labeling Reagent). CD34) or a total of 120x109 to 12x108 cells (when two vials of CD34 Labeling Reagent are used). In a laminar flow hood under sterile conditions, cell count, cell viability, and count for subpopulations of CD3+, CD19+, or CD34+ cells are measured. The apheresis product is transferred to a transfer bag which is filled to a total volume of 600 mL with phosphate buffered saline (PBS). The contents are centrifuged at 230 G for 15 minutes and the supernatant is removed, 90 ml are left, to which 5 ml of immunoglobulin are added and subsequently mixed at room temperature for 10 minutes. One or two 7.5 mL vials of CliniMACS® CD34 reagent are injected into the bag, which is mixed and incubated with shaking for 30 minutes at room temperature. The cells are centrifuged at 230 G for 15 minutes and resuspended in 150 ml of PBS. The CD34 selection program is run on a CliniMACS® system using the sample as described above with the parameters indicated in Table 2. The process takes approximately 20-30 minutes. The program is stopped before any washing steps are carried out and the CD34-enriched cells and other non-specific cells are discharged into the "target cell bag". The “target cell bag” of the CliniMACS® system contains the CD34-enriched cell population with low stringency. The “non-target cell bag” of the CliniMACS® system contains non-target cells. Selection for CD34 with low stringency results in approximately 35% to 60% yield of CD34+ cells and approximately 10% to 30% relative purity. Subsequently, both the high stringency CD34-enriched cell population and the low stringency CD34-enriched cell population are transduced or combined and transduced individually with a recombinant gene therapy vector encoding the FANCA gene product as described in Example 1, and the resulting genetically modified cells are designated Product 3.1 and Product 3.2, respectively. If individually transduced product 3.1 and product 3.2 are mixed together and then administered to Patient 3 via intravenous bolus. Patient 3 shows rapid selection graft incorporation kinetics in vivo. This treatment protocol results in multilineage stabilization in hematopoiesis, neutrophils, erythrocytes, and platelets. Stabilization of hematopoietic lineages that had declined in patient 3 before transplantation is a compelling endpoint of clinical success. Ql 7ΠΙ η / η7Π7 / Ε / Υ Example 4 Gene therapy using CRISPR-Cas with CD34-enriched cell populations with high and low stringency Biological samples are taken from additional patients and CD34-enriched cell populations are prepared with high stringency and low stringency as described in Example 3. A recombinant gene therapy is created that is designed to deliver a gene editing system capable of repairing targeted an endogenous FANC gene. The gene editing system includes a Cas protein or a polynucleotide encoding a Cas protein; a gRNA; and a repair jig. The repair template comprises a sequence fragment that overlaps with known mutation(s) in a FANC gene (eg, FANCA) in the additional patients. One or both of the high stringency and low stringency CD34-enriched cell populations are contacted with the recombinant gene therapy vector and then mixtures of the two CD34-enriched cell populations are autologously transplanted into each of the two CD34-enriched cell populations. patients. Patients exhibit rapid selection graft incorporation kinetics in vivo. This treatment protocol results in multilineage increases in hematopoiesis, neutrophils, erythrocytes, and platelets. The recovery of hematopoietic lineages that had declined in patients before transplantation is a compelling endpoint of clinical success.

Claims

1. A method for treating Fanconi anemia in a subject in need, comprising providing the subject with: (i) a high-strictness CD34-enriched cell population prepared from a first biological sample obtained from the subject by selecting CD34+ cells under high-strictness conditions; and (ii) a low-strictness CD34-enriched cell population prepared from a second biological sample obtained from the subject by selecting CD34+ cells under low-strictness conditions, wherein one or both of the high-strictness CD34-enriched cell population and / or the low-strictness CD34-enriched cell population were genetically modified by: (i) a recombinant gene therapy vector comprising a polynucleotide sequence encoding a Fanconi anemia complementation group (FANC) polypeptide or a functional variant or fragment thereof;or (i) a gene-editing system aimed at the direct repair of a mutated endogenous FANC gene, and wherein the first biological sample and the second biological sample are optionally the same biological sample.; 2. The method according to claim 1, further comprising: (a) preparing a high-strick CD34-enriched cell population from a first biological sample obtained from the subject by selecting CD34+ cells under high-strick conditions; (b) preparing a low-strick CD34-enriched cell population from a second biological sample obtained from the subject by selecting CD34+ cells under low-strick conditions; (c) genetically modifying one or both of the high-strick CD34-enriched cell population and / or the low-strick CD34-enriched cell population with: (i) the recombinant gene therapy vector comprising the polynucleotide sequence encoding the Fanconi anemia complementation group A (FANCA) polypeptide or a functional variant or fragment thereof;or (i) the gene editing system aimed at direct repair of the mutated endogenous FANC gene, and (d) providing the subject with the high-rigor CD34-enriched cell population and the low-rigor CD34-enriched cell population, and thereby treating Fanconi anemia.

3. The method according to claim 1 or 2, wherein the first biological sample and the second biological sample are each independently peripheral blood or bone marrow.

4. The method according to claim 1 or 2, wherein the first biological sample and the second biological sample are peripheral blood obtained after the subject has been treated with GCSF, plerifaxor, or a combination of G-CSF and plerifaxor.

5. The method according to claim 2, wherein selecting CD34+ cells under high-stricity conditions comprises applying the first biological sample to a capture matrix that binds to CD34+ cells, washing the capture matrix one or more times using a wash buffer, and eluting the CD34-enriched cell population under high-stricity conditions from the capture matrix using an elution buffer.

6. The method according to claim 2, wherein selecting CD34+ cells under low-strict conditions comprises applying the second biological sample to a capture matrix that binds to CD34+ cells, allowing an unbound fraction of the second biological sample to flow through the capture matrix, and eluting the low-strict CD34-enriched cell population from the capture matrix using an elution buffer.

7. The method according to claim 1 or 2, wherein the high-stricitude CD34-enriched cell population is genetically modified.

8. The method according to any of claims 1, 2, 6 or 7, wherein the low-rigor CD34-enriched cell population is genetically modified.

9. The method according to any of claims 1 to 8, wherein the percentage of CD34+ cells in the high-rigor CD34-enriched cell population is between two and four times greater than the percentage of CD34+ cells in the low-rigor CD34-enriched cell population.

10. The method according to any of claims 1 to 9, wherein the high-stricture CD34-enriched cell population comprises CD34+ cells with a purity of >20% or >30%.

11. The method according to any one of claims 1 to 10, wherein the low-strictness CD34-enriched cell population comprises CD34+ cells with a purity of <30%.

12. The method according to any one of claims 1 to 11, wherein the high-strictness CD34-enriched cell population comprises CD34+ cells with a yield of >20%.

13. The method according to any of claims 1 to 12, wherein the low-rigor CD34-enriched cell population comprises CD34+ cells with a yield of >35%.

14. The method according to any one of claims 1 to 3, wherein the recombinant gene therapy vector comprises a polynucleotide sequence comprising, in the following order from 5' to 3': (a) a eukaryotically active promoter sequence; and (b) a sequence encoding a human FANC gene polypeptide, or a functional fragment or variant thereof; wherein the sequence encoding the human FANC gene polypeptide or functional fragment or variant thereof is functionally linked to the eukaryotically active promoter sequence; and wherein the FANC gene is selected from FANCA, FANCC, and FANCG.

15. The method according to claim 1, wherein the gene-editing system comprises: (a) a Cas protein or a polynucleotide encoding a Cas protein; (b) a sgRNA; and (c) a repair template comprising a sequence comprising the FANC gene or a fragment thereof that overlaps with one or more mutations in the endogenous FANC gene, wherein the sgRNA is configured to guide the repair template to the FANC gene, wherein the FANC gene is selected from FANCA, FANCC, and FANCG, and wherein the gene-editing system is capable of targeted repair of an endogenous FANC gene.

16. The method according to any of claims 1 to 15, wherein the method inhibits the development of, stops the progression of and / or reverses the progression of a hematological manifestation of Fanconi anemia in the subject, wherein the hematological manifestation of Fanconi anemia is optionally selected from one or more of: bone marrow failure, thrombocytopenia, leukopenia, pancytopenia, neutropenia and anemia.

17. The method according to claim 2, wherein the selection is carried out by bead-based magnetic selection.

18. The method according to claim 4, further comprising performing apheresis on peripheral blood one or more times.

19. The method according to any of claims 1 to 18, wherein the method generates a progressive increase in gene-modified Fanconi anemia cells over time.

20. The method according to any of claims 1 to 19, wherein the method causes the recovery of one or more hematopoietic lineages that had decreased in the subject prior to the administration of the high-rigor CD34-enriched cell population and the low-rigor CD34-enriched cell population to the subject.

21. The method according to claim 20, wherein the one or more hematopoietic lineages comprise one or more lymphocytes, eosinophils, neutrophils, erythrocytes, and platelets.

22. The method according to any of claims 1 to 19, wherein the method causes the recovery of one or more hematological parameters that had decreased in the subject before the administration of the high-rigor CD34-enriched cell population and the low-rigor CD34-enriched cell population to the subject.

23. The method according to claim 22, wherein the hematological parameter is hemoglobin. 24.A method for preparing genetically modified cells for the treatment of Fanconi anemia, comprising: (a) preparing a high-stricture CD34-enriched cell population from a first biological sample obtained from a subject by selecting CD34+ cells under high-stricture conditions; (b) preparing a low-stricture CD34-enriched cell population from a second biological sample obtained from a subject by selecting CD34+ cells under low-stricture conditions; and (c) genetically modifying one or both of the high-stricture CD34-enriched cell population and / or the low-stricture CD34-enriched cell population with a recombinant gene therapy vector for Fanconi anemia, wherein the gene therapy vector optionally comprises a polynucleotide encoding a Fanconi anemia complementation group (FANC) polypeptide or a functional variant or fragment thereof.

25. The method according to claim 24, wherein the first biological sample and the second biological sample are each independently peripheral blood or bone marrow.

26. The method according to claim 25, wherein the first biological sample and the second biological sample are peripheral blood obtained after the subject has been treated with GCSF, plerifaxor, or a combination of G-CSF and plerifaxor.

27. The method according to claim 24, wherein selecting CD34+ cells under high-stricity conditions comprises applying the first biological sample to a capture matrix that binds to CD34+ cells, washing the capture matrix one or more times using a wash buffer, and eluting the CD34-enriched cell population under high-stricity conditions from the capture matrix using an elution buffer.

28. The method according to claim 24, wherein selecting CD34+ cells under low-strict conditions comprises applying the second biological sample to a capture matrix that binds to CD34+ cells, allowing an unbound fraction of the second biological sample to flow through the capture matrix, and eluting the low-strict CD34-enriched cell population from the capture matrix using an elution buffer.

29. The method according to claim 24, wherein the cell population enriched with high rigor with CD34 is brought into contact with the recombinant gene therapy vector.

30. The method according to any of claims 24 to 29, wherein the low-rigor CD34-enriched cell population is brought into contact with the recombinant gene therapy vector.

31. The method according to any of claims 240 to 30, wherein the percentage of CD34+ cells in the high-rigor CD34-enriched cell population is between two and four times greater than the percentage of CD34+ cells in the low-rigor CD34-enriched cell population.

32. The method according to any of claims 24 to 31, wherein the high-stricity CD34-enriched cell population comprises CD34+ cells with a purity of >20% or >30%.

33. The method according to any of claims 24 to 32, wherein the low-rigor CD34-enriched cell population comprises CD34+ cells with a purity of <30%.

34. The method according to any of claims 24 to 33, wherein the high-stricity CD34-enriched cell population comprises CD34+ cells with a yield of >20%.

35. The method according to any of claims 24 to 34, wherein the low-rigor CD34-enriched cell population comprises CD34+ cells with a yield of >35%.

36. The method according to any of claims 24 to 35, wherein the recombinant gene therapy vector for Fanconi anemia comprises a polynucleotide sequence comprising, in the following 5' to 3' order: (a) a eukaryotically active promoter sequence; and (b) a sequence encoding a human FANC gene polypeptide, or a functional fragment or variant thereof; wherein the sequence encoding the human FANC gene polypeptide, or a functional fragment or variant thereof, is functionally linked to the eukaryotically active promoter sequence; and wherein the FANC gene is selected from FANCA, FANCC, and FANCG.

37. The method according to any of claims 24 to 35, wherein the recombinant gene therapy vector for Fanconi anemia comprises a gene editing system capable of targeted repair of an endogenous FANC gene, wherein the gene editing system comprises: (a) a Cas protein or a polynucleotide encoding a Cas protein; (b) a sgRNA; and (c) a repair template comprising a sequence comprising the FANC gene or a fragment thereof overlapping with one or more mutations in the endogenous FANC gene; wherein the sgRNA is configured to guide the repair template to the FANC gene; and wherein the FANC gene is selected from FANCA, FANCC, and FANCG.

38. The method according to claim 24, wherein the selection of (a) and / or (b) is carried out by bead-based magnetic selection.

39. The method according to claim 24 or claim 38, wherein the selection of (a) and / or (b) is carried out by using antibodies or functional fragments thereof that bind specifically to CD34.

40. The method according to claim 24 or claim 38, wherein the selection of (a) and / or (b) is carried out by using a flow rate of 10 to 20 mL / min.

41. A composition comprising: (a) a high-striction CD34-enriched cell population prepared from a first biological sample by selecting CD34+ cells under high-striction conditions; and (b) a low-striction CD34-enriched cell population prepared from a second biological sample by selecting CD34+ cells under low-striction conditions, wherein one or both of the high-striction CD34-enriched cell population or the low-striction CD34-enriched cell population are contacted with a recombinant gene therapy vector for Fanconi anemia.

42. The composition according to claim 41, wherein the first biological sample and the second biological sample are each independently peripheral blood or bone marrow.

43. The composition according to claim 41, wherein the first biological sample and the second biological sample are peripheral blood obtained from a subject after the subject has been treated with G-CSF, plerifaxor, or a composition of G-CSF and plerifaxor.

44. The composition according to any of claims 41 to 43, wherein the percentage of CD34+ cells in the high-rigor CD34-enriched cell population is between two and four times greater than the percentage of CD34+ cells in the low-rigor CD34-enriched cell population.

45. The composition according to any of claims 41 to 44, wherein the high-stricture CD34-enriched cell population comprises CD34+ cells with a purity of >20% or >30%.

46. ​​The composition according to any of claims 41 to 45, wherein the low-rigor CD34-enriched cell population comprises CD34+ cells with a purity of <30%.

47. The composition according to any of claims 41 to 46, wherein the high-stricture CD34-enriched cell population comprises CD34+ cells with a yield of >20%.

48. The composition according to any of claims 41 to 47, wherein the low-rigor CD34-enriched cell population comprises CD34+ cells with a yield of >35%.

49. The composition according to any of claims 41 to 48, wherein the high-stricitude CD34-enriched cell population is brought into contact with the recombinant gene therapy vector.

50. The composition according to any of claims 41 to 49, wherein the low-rigor CD34-enriched cell population is brought into contact with the recombinant gene therapy vector.

51. The composition according to any of claims 41 to 50, wherein the recombinant gene delivery vector comprises a polynucleotide sequence comprising, in the following order from 5' to 3': (a) a eukaryotically active promoter sequence; and (b) a sequence encoding a human FANCA polypeptide, or a functional fragment or variant thereof; wherein the sequence encoding the human FANC polypeptide, or a functional fragment or variant thereof, is functionally linked to the eukaryotically active promoter sequence; and wherein the FANC gene is selected from FANCA, FANCC, and FANCG.

52. A pharmaceutical composition comprising the composition according to any of claims 41 to 51 and a pharmaceutically acceptable carrier.