NUCLEIC ACID-BASED DETECTION METHODS
Patent Information
- Application Number
- MX2021002166
- Authority / Receiving Office
- MX · MX
- Patent Type
- Patents
- Current Assignee / Owner
- Priority Date
- 2018-08-23
- Filing Date
- 2021-02-23
- Publication Date
- 2026-02-25
- Estimated Expiration
- 2039-08-22
AI Technical Summary
Current aptamer-based assays lack sensitivity and precision, particularly in detecting and quantifying target molecules, and there is a need for assays that can substitute aptamers against different target molecules with minimal reoptimization.
The use of nucleic acid molecules, such as aptamers, which undergo conformational changes upon binding to target molecules, leading to displacement from an immobilization oligonucleotide and subsequent recapture by complementary capture oligonucleotides, creating a concentration-dependent signal format for enhanced sensitivity and accuracy.
This approach enables highly sensitive and accurate detection and quantification of target molecules, allowing for universal assays that can substitute aptamers without reoptimization and can be applied in various formats like lateral flow devices and ELONA assays.
Abstract
Description
NUCLEIC ACID-BASED DETECTION METHODS TECHNICAL FIELD OF THE INVENTION The embodiments of the present invention relate to an apparatus and methods for detecting and / or quantifying a target residue in a sample, comprising the use of a recapture event based on a nucleic acid molecule. In particular, though not exclusively, certain embodiments of the present invention relate to apparatus and assays comprising the displacement of an immobilized nucleic acid molecule to form a target nucleic acid molecule complex and the detection of a subsequent recapture event of the target nucleic acid complex or the nucleic acid molecule alone. Other aspects and embodiments are described herein. BACKGROUND OF THE INVENTION Aptamers are small, artificial ligands, including DNA, RNA, or single-stranded polypeptide molecules, capable of binding to specific target residues of interest with high affinity and specificity. Aptamers are considered alternatives to antibodies for use as diagnostic and / or therapeutic agents. Furthermore, aptamers have also shown promise as antibody replacements in many analytical applications in the fields of environmental and food research, as well as in clinical diagnostics. Currently, aptamers are obtained through an iterative screening process of a partially randomized library of candidate oligonucleotides using affinity-based partitioning against the target residue of interest. Aptamers exhibit high structural stability over a wide range of pH and temperatures, making them ideal reagents for a broad spectrum of in vitro, in vivo, and ex vivo applications. In 1990, two independent groups, Tuerk & Gold (1990, Science 249, 505–510) and Ellington & Szostak (1990, Nature 346, 818–822), developed an in vitro method that mimics the evolutionary process for identifying high-affinity aptamers. This process is known as in vitro selection. It exploits fundamental concepts of evolution, using variation, selection, and replication to achieve high affinity and target specificity from an initial pool of degenerate nucleic acid molecules (i.e., oligonucleotides). Typically, for the selection of nucleic acid aptamers (DNA or RNA oligonucleotides), variation is achieved by synthesizing a degenerate library of short oligonucleotides (approximately 10¹⁴ different sequences), ranging in size from about 20 to about 100 nucleotides.Each oligonucleotide qq Lznn / Lznz / E / YiAi generally comprises an internal random region flanked by primer regions for subsequent amplification by a suitable amplification reaction, e.g., polymerase chain reaction (PCR) for DNA, or reverse transcription polymerase chain reaction (RT-PCR) followed by in vitro transcription reactions for RNA. Current aptamer selection methods involve incubating the nucleic acid pool with the immobilized target molecule(s) under conditions that allow nucleic acid molecules to bind to the target molecules, followed by extensive washing to remove low-affinity or non-binding sequences. The bound nucleic acid molecules are then eluted and amplified using PCR or another amplification method. The amplified nucleic acid molecules then form the starting material for the next round of in vitro selection. This process is repeated several times until one or more nucleic acid aptamers are enriched, binding tightly and specifically to the target molecule(s). Recent technical advances in the preparation of randomized libraries and in affinity-based partitioning methods have resulted in aptamers with antibody-equivalent affinities. Aptamers have been produced against a wide range of target molecules, including inorganic components, small organic molecules, proteins, peptides, nucleic acids, carbohydrates, and cells. As such, aptamers can be used to detect and quantify the amount of a specific product in a given sample. Aptamers offer several advantages over antibodies, including ease of in vitro synthesis, flexible modification, broad target ranges, reusability, and high thermal and chemical stability. As a result, aptamers are being used in place of antibodies in a number of assays and detection methods. For example, aptamers are now being used instead of antibodies in assays such as ELISA (enzyme-linked immunosorbent assay). When aptamers are used instead of antibodies, the resulting assay is often called ELONA (enzyme-linked oligonucleotide assay), ELASA (enzyme-linked aptamer sorbent assay), ELAA (enzyme-linked aptamer assay), or a similar name.The incorporation of aptamers into these ELISA-type assay platforms can result in increased sensitivity, enable the detection of a greater number of analytes—including analytes for which no antibodies are available—and a broader range of results, since aptamers can be conjugated with multiple indicator molecules, including fluorophores and quenching molecules. Other disadvantages associated with the use of antibodies include, for example, inappropriate aggregation and complications associated with antibody labeling and / or production. Aptamers have also been used in several other assay formats, such as lateral flow devices, biosensors, and similar assay formats. However, there remains a need for assays incorporating aptamers with good sensitivity and accuracy. QQ Lznn / Lznz / E / YILI The embodiments of the present invention aim to overcome the problems associated with the prior art. BRIEF DESCRIPTION OF THE INVENTION The present invention relates to assays that utilize the combination of displacement of nucleic acid molecules (e.g., aptamers) from a support and the subsequent recapture of said nucleic acid molecules by hybridization with complementary oligonucleotides (e.g., capture oligonucleotides). Advantageously, higher amounts of a target molecule can lead to the displacement of more nucleic acid molecules from the support. In turn, this can lead to a greater number of nucleic acid molecules being recaptured. As such, certain embodiments of the invention provide highly sensitive and accurate assays that utilize a concentration- and / or gain-dependent signal format. Advantageously, the capture oligonucleotides can be configured to hybridize with nucleic acid sequences common to any aptamer obtained from the universal aptamer selection library as described herein. As such, certain embodiments of the invention provide universal assays that allow aptamer substitution against different target molecules with little or no reoptimization. Several aspects and embodiments are described herein. In a first aspect of the present invention, an apparatus is provided for detecting the presence, absence, or level of a target molecule in a sample, the apparatus comprising: a) a first region comprising: i) a support; and ii) an immobilization oligonucleotide; and iii) a nucleic acid molecule having a binding affinity for a target molecule, wherein the nucleic acid molecule is configured to form a complex with the target molecule, wherein the immobilization oligonucleotide or the nucleic acid molecule is directly or indirectly bound to the support, and further wherein the immobilization oligonucleotide comprises a nucleic acid sequence that is at least partially complementary to a nucleic acid sequence of the nucleic acid molecule and wherein the nucleic acid molecule is capable of hybridizing with the immobilization oligonucleotide; the apparatus further comprises: b) an additional region comprising QQ Lznn / Lznz / E / YILI (i) a carrier; and (ii) a capture oligonucleotide directly or indirectly linked to the carrier, wherein the capture oligonucleotide comprises a nucleic acid sequence that is complementary to: (1) a nucleic acid sequence of the nucleic acid molecule, wherein the capture oligonucleotide is configured to hybridize with the nucleic acid sequence of the nucleic acid molecule when it forms a complex with the target molecule to capture the nucleic acid-molecule-target molecule complex. (2) a nucleic acid sequence of the immobilizing oligonucleotide, wherein the capture oligonucleotide is configured to hybridize with the immobilizing oligonucleotide to capture the immobilizing oligonucleotide. Therefore, in certain configurations, the device uses a nucleic acid molecule that is configured to bind to a target molecule. Appropriately, the nucleic acid molecule binds with high affinity and specificity to the target molecule. Appropriately, in the absence of the target molecule, the nucleic acid molecule is attached directly or indirectly to a support for immobilization. The nucleic acid molecule can bind by hybridization to an immobilization oligonucleotide, which is itself attached directly or indirectly to the support. Alternatively, the nucleic acid molecule itself can bind directly or indirectly (e.g., via a linker) to the surface of the support. In this modality, the immobilization oligonucleotide is configured to hybridize with a portion of the nucleic acid molecule. In this modality, the disruption of the interaction between the immobilization oligonucleotide and the target-binding nucleic acid is measured as an indirect measure of the presence of a target molecule. Certain embodiments of the present invention utilize the ability of a nucleic acid molecule, for example, an aptamer, to undergo a conformational change upon binding to its target molecule. This conformational change causes the nucleic acid molecule to dissociate from the immobilizing oligonucleotide, thereby releasing either the immobilizing oligonucleotide or the nucleic acid molecule in complex with the target molecule, depending on which is bound to the support. If the target molecule is not present, the nucleic acid molecule does not undergo the conformational change and thus remains hybridized with the immobilizing oligonucleotide. In certain embodiments, the apparatus comprises a linker molecule attached to the support and wherein the linker molecule is configured to hybridize with the nucleic acid molecule, and further wherein the immobilization oligonucleotide is configured to hybridize with the nucleic acid molecule when the nucleic acid molecule is hybridized with the linker molecule. QQ Lznn / Lznz / E / YILI Appropriately, a linker molecule is attached to the support and where the linker molecule is configured to hybridize with the immobilization oligonucleotide and further where the nucleic acid molecule is configured to hybridize with the immobilization oligonucleotide when the immobilization oligonucleotide hybridizes with the linker molecule. Furthermore, certain embodiments of the present invention utilize a recapture event in which the nucleic acid molecule, when complexed with the target molecule or the released immobilization oligonucleotide, is captured by a capture oligonucleotide. The recapture event can then allow the detection of the presence of the target molecule and, optionally, also the quantity of the target molecule. In certain embodiments, the capture oligonucleotide comprises a nucleic acid sequence that is at least partially complementary to a nucleic acid sequence of the nucleic acid molecule, wherein the capture oligonucleotide is configured to hybridize with the nucleic acid sequence of the nucleic acid molecule when it forms a complex with the target molecule to capture the nucleic acid-molecule-target molecule complex. In an alternative embodiment, the capture oligonucleotide comprises a nucleic acid sequence that is at least partially complementary to a nucleic acid sequence of the immobilization oligonucleotide, wherein the capture oligonucleotide is configured to hybridize with the nucleic acid sequence of the immobilization oligonucleotide. In some embodiments, the nucleic acid molecule comprises at least one fixed nucleic acid sequence region. The fixed nucleic acid sequence region may be a primer region. In certain embodiments, the capture oligonucleotide comprises a nucleic acid sequence that is complementary to the fixed nucleic acid sequence region of the nucleic acid molecule. In certain embodiments, the fixed nucleic acid sequence region can be a sequence used universally in the design of an aptamer library, such that each aptamer selected from the library comprises the fixed nucleic acid sequence. Therefore, the apparatus can be designed with a capture oligonucleotide capable of hybridizing to multiple aptamers, each aptamer having one or more regions with the same predetermined nucleic acid sequence while also being specific for a different target molecule. In certain embodiments, the nucleic acid molecule comprises a first fixed nucleic acid sequence region and a second nucleic acid sequence region. Therefore, the first nucleic acid molecule can be a forward primer and the second nucleic acid molecule can be a reverse primer. In certain embodiments, the first fixed nucleic acid sequence region is located in a 5' end region of the nucleic acid molecule. QQ Lznn / ίZΖΠZ / Β / YΙΛΙ nucleic and the second fixed nucleic acid sequence region is located in a 3' end region of the nucleic acid molecule. In certain modalities, the capture oligonucleotide is able to hybridize with the first region of fixed nucleic acid sequence or a part thereof, or the second region of fixed nucleic acid sequence or a part thereof. In certain embodiments, the apparatus further comprises a detection means for detecting the formation of a complex comprising the capture oligonucleotide and the immobilization oligonucleotide or the nucleic acid molecule. In certain embodiments, the linker molecule is a DNA or RNA molecule or a mixed DNA / RNA molecule, wherein optionally the linker molecule comprises one or more modified nucleotides. In certain embodiments, the apparatus comprises a lateral flow testing device. Appropriately, the first region comprises a sample receiving region. In certain embodiments, the apparatus further comprises a flow path between the first region and the additional region. In certain embodiments, the flow path comprises a membrane, for example, a nitrocellulose, a polyethylene (PE), a polytetrafluoroethylene (PTFE), a polypropylene (PP), a cellulose acetate (CA), a polyacrylonitrile (PAN), a polyimide (PI), a polysulfone (PS), a polyethersulfone membrane (PES), or an inorganic membrane comprising aluminum oxide (Al2O3), silicon oxide (SiO2), and / or zirconium oxide (ZrO2). In certain embodiments, the first region comprises a sample application zone, where optionally the sample application zone comprises a sample application pad. In certain embodiments, the support of the first region comprises an immobilization zone comprising the immobilization oligonucleotide or the nucleic acid molecule directly or indirectly bound to it. In certain embodiments, the immobilization zone comprises nonwoven fibers, for example, cellulose fibers, glass fibers, silicon carbide fibers, polymer fibers, animal fibers (for example, wool, silk), carbon fibers, mineral fibers, and / or microfibers. In certain embodiments, the immobilization zone comprises woven fibers. In certain embodiments, the first region is provided upstream of the additional region. In certain embodiments, the additional region comprises a capture zone in which the capture oligonucleotide binds directly or indirectly to the carrier. In certain embodiments, the additional region comprises a plurality of capture zones, each capture zone comprising a capture oligonucleotide directly or indirectly attached to the support, wherein each capture oligonucleotide may be the same or may be different. QQ Lznn / Lznz / E / YILI In certain embodiments, the apparatus further comprises a control zone located downstream of the first region, wherein the control zone comprises an additional capture oligonucleotide. In certain embodiments, the apparatus comprises a plurality of control zones, each control zone comprising a capture oligonucleotide, wherein each capture oligonucleotide is either the same or different. Appropriately, each capture oligonucleotide in the respective control zones is configured to bind to a different molecule. In certain embodiments, the apparatus may comprise a plurality of nucleic acid molecules, each nucleic acid molecule being specific for a different target molecule. In certain embodiments, each nucleic acid molecule comprises one or more, for example, two fixed nucleic acid sequence regions that are the same for more than one nucleic acid molecule. In certain embodiments, each nucleic acid molecule comprises the same fixed nucleic acid sequence region or regions, allowing the use of the same capture oligonucleotide to capture each nucleic acid molecule regardless of the nature of the target molecule. Each nucleic acid molecule may comprise a different detection medium to allow for separate detection, such that the apparatus may be suitable for use in a multiplex assay format. In certain embodiments, the apparatus further comprises a housing that encloses the first region and the additional region. The housing may also include a sample introduction port. In certain embodiments, the housing further comprises a window adjacent to the detection zone and optionally to the control zone. In certain embodiments, the support for the first region and / or the additional region is independently selected from a bead, a microtiter assay plate or other assay plate, a strip, a membrane, a film, a gel, a chip, a microparticle, a nanoparticle, a nanofiber, a nanotube, a micelle, a micropore, a nanopore, and a biosensor surface. In certain embodiments, the first region may be contained in a first container and the additional region may be contained in an additional container. Appropriately, the solid phase of the first region and the additional region are contained in a strip. Appropriately, the strip further comprises a flow path between the first region and the additional region. In certain forms, the apparatus also comprises one or more of the following: a) an absorbent pad, b) a membrane, for example, a nitrocellulose membrane; c) one or more competing molecules; and qq Lznn / Lznz / E / YiAi d) one or more control molecules. In certain embodiments, the apparatus further comprises a container configured to accommodate at least one end portion of the strip and the sample. The container includes a sample introduction region. In certain embodiments, the immobilization oligonucleotide and / or the capture oligonucleotide is selected from a DNA molecule, an RNA molecule, a mixed DNA / RNA molecule, a modified DNA molecule, and a modified RNA molecule. In certain embodiments, the apparatus comprises a plurality of immobilization oligonucleotides, a plurality of capture oligonucleotides, and a plurality of nucleic acid molecules. In some embodiments, the nucleic acid molecule is an aptamer. Appropriately, aptamer is selected from a double-stranded aptamer, a single-stranded aptamer, and an aptamer that is double-stranded in at least a portion of its length. In certain embodiments, the nucleic acid molecule and / or the immobilization molecule comprises a detectable tag. In certain modalities, the detectable tag is selected from a fluorophore, a nanoparticle, a quantum dot, an enzyme, a radioactive isotope, a predefined sequence portion, a biotin, a dethiobiotin, a thiol group, an amine group, an azide, an aminoallyl group, a digoxigenin, an antibody, a catalyst, a colloidal metallic particle, a colloidal non-metallic particle, an organic polymer, a latex particle, a nanofiber, a nanotube, a dendrimer, a protein, and a liposome. In certain modalities, the detectable tag is an enzyme, where optionally the enzyme is selected from horseradish peroxidase, alkaline phosphatase, urease, and βgalactosidase. In certain modalities, the sample is a selected biological sample of whole blood, leukocytes, peripheral blood mononuclear cells, plasma, serum, sputum, breath, urine, semen, saliva, meningeal fluid, amniotic fluid, glandular fluid, lymph, nipple aspirate, bronchial aspirate, synovial fluid, joint aspirate, cells, a cell extract, feces, tissue, tissue biopsy, and cerebrospinal fluid. In certain modalities, the sample is derived from an agricultural or industrial product or by-product, an environmental sample, water, a food product, a sample from a production process, an animal product, a plant product, and a bacterial product. In certain modalities, the target molecule is selected from a small organic or inorganic molecule, a cell, a protein, a peptide, an amino acid, a carbohydrate, a lipid, a virus, a microorganism, a tissue section, an ion, a nucleotide, a nucleotide derivative, and a nucleic acid. QQ Lznn / Lznz / E / YILI In a further aspect of the present invention, a method is provided for detecting the presence, absence, or level of a target molecule in a sample, the method comprising: a) interact a sample with a complex comprising: i) an immobilization oligonucleotide; and i) a nucleic acid molecule, wherein the immobilization oligonucleotide and / or the nucleic acid molecule are directly or indirectly attached to a support, the immobilization oligonucleotide comprising a nucleic acid sequence that is at least partially complementary to a nucleic acid sequence of the nucleic acid molecule and wherein the nucleic acid molecule is capable of hybridizing with a portion of the immobilization oligonucleotide; where the nucleic acid molecule has a binding affinity to a target molecule and, furthermore, where the nucleic acid molecule is configured to form a complex with the target molecule; b) if the target molecule is present in the sample, dissociate the nucleic acid molecule from the immobilizing oligonucleotide complex to form a target molecule-nucleic acid molecule complex; and (c) providing a capture oligonucleotide comprising a nucleic acid sequence that is complementary to a nucleic acid sequence of the nucleic acid molecule or is at least partially complementary to a nucleic acid sequence of the nucleic acid molecule, wherein the nucleic acid molecule or the immobilizing oligonucleotide is capable of hybridizing with a portion of the capture oligonucleotide; and d) detect the presence or absence of the target molecule. In certain embodiments, the method further comprises, if a target molecule is present in the sample, forming a target molecule-nucleic acid oligonucleotide capture molecule complex. In certain embodiments, the method further comprises quantifying the amount of target molecule in the sample. In certain modalities, the detection of the target molecule comprises photonic detection, electronic detection, acoustic detection, electrochemical detection, electro-optical detection, enzymatic detection, chemical detection, biochemical detection, or physical detection. In certain embodiments, step (a) is carried out under conditions effective to allow binding between the target molecule and the nucleic acid molecule. In certain embodiments, the step of detecting the presence or absence of the target molecule comprises detecting the hybridization of the nucleic acid molecule or the immobilization oligonucleotide with the capture oligonucleotide. In certain modalities, the method includes biofilm interferometry (BLI). In certain embodiments, the method comprises a step of determining the displacement of a nucleic acid molecule from a nucleic acid molecule immobilization oligonucleotide complex. In certain embodiments, the method further comprises detecting the hybridization of a nucleic acid-target molecule complex with a capture oligonucleotide. In certain embodiments, the method comprises incubating the nucleic acid-target molecule complex and the immobilized capture oligonucleotide for at least 2 minutes, for example, 3, 4, 5 minutes or more, before the step of detecting the hybridization of a nucleic acid-target molecule complex with the capture oligonucleotide. In certain embodiments, the capture oligonucleotide is immobilized, for example, on a surface of a BLI probe. In certain embodiments, the method comprises surface plasmon resonance (SPR). Certain embodiments of the present invention can provide the advantage of detecting small molecules that are not normally detectable. In particular, using systems such as BLI (which might not normally be sensitive enough for detection), certain embodiments of the present invention involve the displacement of nucleic acid molecules from an immobilizing oligonucleotide, which gives a much stronger signal than a signal generated by the binding of a small molecule. BRIEF DESCRIPTION OF THE DRAWINGS Certain embodiments of the present invention will be described in more detail below, with reference to the accompanying drawings in which: Figure 1 is a schematic representation of a first region of an apparatus according to certain modalities of the present invention; Figure 2 is a schematic representation of an apparatus according to some embodiments of the present invention; Figure 3 is a schematic representation of a nucleic acid molecule for use in the apparatus and methods according to certain embodiments of the present invention. Specifically, the nucleic acid molecule comprises at least one fixed capture sequence (black bar) that is complementary to an immobilization oligonucleotide and / or a capture oligonucleotide sequence. These sequences are used to immobilize the nucleic acid molecule, either alone or in complex with a target molecule, and / or to hybridize with the capture oligonucleotide in the recapture event. In certain forms, the immobilization oligonucleotide has a linker (dotted line) to reduce steric hindrance from the primer and / or additional support. qq Lznn / Lznz / E / YiAi The nucleic acid molecule also comprises two fixed 'primer sequences' (black bars) used to amplify the library by PCR, etc. One (or both) of these primer regions can be modified with a fluorophore (circle) or other functional residue (nanoparticle, quantum dot, enzyme, etc.) to enable detection of the nucleic acid molecule as required by the assay. The primer regions can also be used as capture regions to hybridize with the capture oligonucleotide in the recapture event. Figure 4 is a schematic representation of an apparatus and method according to certain embodiments of the present invention in which an ELONA test is performed. Figure 5 is a graph illustrating the BioLayer interferometry response curves at different stages of the aptamer displacement assay according to certain embodiments of the present invention. A first aptamer was immobilized on the streptavidin-coated probe using a complementary biotinylated immobilization oligonucleotide. After several washing steps, the probe was incubated with the target molecule. Binding to the target causes aptamer displacement, observed as a dissociation signal. Figure 6 provides data showing the BioLayer interferometry response curves at different steps of the aptamer recapture assay method. First, the biotinylated capture oligonucleotides revFOR (green) and REV (pink) were immobilized on streptavidin-coated probes, respectively. After several washing steps, the probes were incubated with the aptamer-target complexes obtained from the aptamer displacement assay in Figure 5. Aptamer recapture is considered an increasing signal as the aptamer-target complex binds to the immobilized capture oligonucleotide. Figure 6 indicates that any fixed primer region can be used to recapture the aptamer-target molecule complex. Figures 7A to 7D show ELISA-type assays demonstrating concentration-dependent recapture. Each of Figures 7A to 7D shows the fluorescence of recaptured aptamers (labeled FAM) (y-axis) versus the amount of incoming aptamer (x-axis) incubated with a plate pre-immobilized with a 'capture oligo'. When no 'capture oligo' is present ('0', dotted line), no aptamer is recaptured. As the amount of capture oligo increases, more aptamer is recaptured, and more fluorescence is observed. Pre-immobilization of the ELISA plate with a biotinylated capture oligo enables the concentration-dependent recapture of aptamers. Aptamers can be recaptured by either the 5' or 3' ends (forward and backward in Figures 7A and 7C, and 7B and 7D, respectively).The data also show that aptamers can be recaptured at any of the pH values of the common buffer used in displacement assays; pH 6.8 (Fig. 7A and 7B) and pH 7.4 (Fig. 7C and 7D). Figures 8A to 8D also show ELISA-type assays that demonstrate a QQ Lznn / Lznz / E / YILI concentration-dependent recapture. Figures 8A to 8D each show the fluorescence of recaptured aptamers (labeled FAM) (y-axis) versus the amount of capture oligo incubated with the plate (x-axis). Each series (circles, diamonds, triangles, and squares) represents a different amount of fluorescently labeled aptamer (50, 10, 2, and 0 pmol of aptamer, respectively). At the highest amount of aptamers (50 pmol, circles), a clear trend can be seen for each of the regulators and with both capture oligos. This shows that the aptamer end (5' in Figs. 8A and 8C or 3' in 8B and 8D) can be used for recapture, and that the pH of the regulator does not have a significant impact on binding. Concentration-dependent recapture is observed with an increasing amount of biotinylated capture oligo pre-immobilized on the plate.Saturation is reached when the amount of aptamer reaches the same amount as the pre-immobilized biotinylated capture oligo. Figures 9A to 9D show the results of an ELONA-type assay. They illustrate the measured fluorescence signals representing the amount of aptamer displaced from a surface upon binding to a target small molecule at four different concentrations of test substrates / matrices (human plasma, milk, river water, and simulated urine at concentrations of 0%, 10%, 25%, and 40% v / v, respectively). The data were plotted after correction by subtracting the fluorescence from the control wells of the '0 μM target molecule'. Concentration-dependent binding between the target molecule and the aptamer is observed at the four different concentrations of tested substrates / matrices. Figures 10A to 10D illustrate the measured fluorescence signals representing the amount of fluorescent aptamer recaptured by the immobilized 'capture oligonucleotide' (for REV) in 4 different concentrations of test substrates / matrices (human plasma, milk, river water, and simulated urine, at concentrations of 0%, 10%, 25%, and 40% v / v, respectively). The graphs show raw data from the fluorescence measurements; and Figures 11A and 11B show the results of combined displacement and recapture assays in a single trial. Aptamers were displaced after the first plate (Fig. 11A) and then recaptured on the second plate (Fig. 11B) pre-immobilized with biotinylated capture oligo. The same aptamer and target were tested in a variety of common matrices (plasma, river water, milk, and urine) to demonstrate the versatility of this platform. DETAILED DESCRIPTION OF THE INVENTION Additional features of certain embodiments of the present invention are described below. The practice of the modalities of the present invention will be used, unless otherwise specified. QQ Lznn / ίZΖΠZ / Β / YΙΛΙ indicates otherwise, conventional techniques of molecular biology, microbiology, recombinant DNA technology, and immunology, which are within the technique. More general molecular biology, recombinant DNA technology, microbiology, and immunological techniques can be found in Sambrook et al., Molecular Cloning: A Laboratory Manual (2001), Coid Harbor-Laboratory Press, Coid, Spring Harbor, NY, or Ausubel et al., Current Protocols in Molecular Biology (1990), John Wiley and Sons, NY. Unless otherwise defined, the technical and scientific terms used herein have the same meaning that would normally be understood by a person skilled in the art to which this disclosure pertains. For example, the Concise Dictionary of Biomedicine and Molecular Biology, Juo, Pei-Show, 2nd ed., 2002, CRC Press; The Dictionary of Cell and Molecular Biology, 31st ed., Academic Press; and the Oxford University Press provide the person skilled in the art with a general dictionary of many of the terms used in this specification. Units, prefixes, and symbols are denoted in their accepted International System of Units (SI) form. Numerical ranges are inclusive of the numbers defining the range. Unless otherwise stated, amino acid sequences are written from left to right in the amino-to-carboxyl orientation, and nucleic acid sequences are displayed from left to right in the 5'-to-3' orientation. The invention will now be explained in more detail by means of non-limiting examples of specific embodiments. In the example experiments, standard reagents and contamination-free buffers are used. In the first aspect of the present invention, an apparatus is provided for detecting the presence, absence, or level of a target molecule in a sample, the apparatus comprising: a) a first region comprising: i) a support; and i) an immobilization oligonucleotide; i) a nucleic acid molecule having a binding affinity for a target molecule, wherein the nucleic acid molecule is configured to form a complex with the target molecule, wherein the immobilization oligonucleotide or the nucleic acid molecule is directly or indirectly bound to the support, and further wherein the immobilization oligonucleotide comprises a nucleic acid sequence that is at least partially complementary to a nucleic acid sequence of the nucleic acid molecule and wherein the nucleic acid molecule is capable of hybridizing with the immobilization oligonucleotide; the apparatus further comprises: b) an additional region comprising i) a support; and QQ Lznn / Lznz / E / YILI i) a capture oligonucleotide directly or indirectly linked to the support, wherein the capture oligonucleotide comprises a nucleic acid sequence that is complementary to: (1) a nucleic acid sequence of the nucleic acid molecule, wherein the capture oligonucleotide is configured to hybridize with the nucleic acid sequence of the nucleic acid molecule when it forms a complex with the target molecule to capture the nucleic acid-molecule-target molecule complex. (2) a nucleic acid sequence of the immobilizing oligonucleotide, wherein the capture oligonucleotide is configured to hybridize with the immobilizing oligonucleotide to capture the immobilizing oligonucleotide. In a further aspect of the present invention, a method is provided for detecting the presence, absence, or level of a target molecule in a sample, the method comprising: a) interact a sample with a complex comprising: i) an immobilization oligonucleotide; and i) a nucleic acid molecule, wherein the immobilization oligonucleotide and / or the nucleic acid molecule are directly or indirectly attached to a support, the immobilization oligonucleotide comprising a nucleic acid sequence that is at least partially complementary to a nucleic acid sequence of the nucleic acid molecule and wherein the nucleic acid molecule is capable of hybridizing with a portion of the immobilization oligonucleotide; where the nucleic acid molecule has a binding affinity to a target molecule and, furthermore, where the nucleic acid molecule is configured to form a complex with the target molecule; b) if the target molecule is present in the sample, dissociate the nucleic acid molecule from the immobilizing oligonucleotide complex to form a target molecule-nucleic acid molecule complex; and (c) providing a capture oligonucleotide comprising a nucleic acid sequence that is complementary to a nucleic acid sequence of the nucleic acid molecule or is at least partially complementary to a nucleic acid sequence of the nucleic acid molecule, wherein the nucleic acid molecule or the immobilizing oligonucleotide is capable of hybridizing with a portion of the capture oligonucleotide; and d) detect the presence or absence of the target molecule. In certain embodiments, the method comprises contacting the hybridized nucleic acid molecule with a target molecule. In certain embodiments, the qq Lznn / Lznz / E / YiAi method comprises contacting the nucleic acid molecule and the immobilization oligonucleotide with a sample comprising a target molecule. When the nucleic acid molecule comes into contact with a target molecule, a nucleic acid-target complex forms by binding the nucleic acid molecule to the target molecule. This binding event results in the destabilization and disruption of the hybridization described above. Consequently, the nucleic acid molecule is displaced from the immobilizing oligonucleotide. In certain formulations, the nucleic acid molecule is immobilized on a surface by hybridization with the immobilization oligonucleotide. Binding of the target molecule induces a conformational change in the nucleic acid molecule, resulting in its displacement from the immobilization oligonucleotide and, consequently, displacement from the surface. The embodiments of the present invention relate to apparatus and methods for detecting the presence and / or absence of a target molecule in a sample using a nucleic acid molecule. As used herein, nucleic acid molecule and aptamer are used interchangeably to refer to a non-natural nucleic acid molecule that has a desirable effect on a target molecule. For nucleic acid aptamers, for example, a distinction is made between DNA aptamers formed from single-stranded DNA (ssDNA) and RNA aptamers formed from single-stranded RNA (ssRNA). Aptamers can exhibit a high binding capacity to the target molecule, and their affinity is often high compared to antibodies with a similar function. Aptamers are characterized by the formation of a specific three-dimensional structure that depends on the nucleic acid sequence.The three-dimensional structure of an aptamer arises from intramolecular Watson-Crick base pairing, Hoogsteen base pairing (quadruplex), oscillating pair formation, or other non-canonical base interactions. This structure allows aptamers, analogous to antigen-antibody binding, to precisely bind to target structures. A particular nucleic acid sequence within an aptamer can, under defined conditions, have a three-dimensional structure that is specific to a defined target structure. The nucleic acid aptamers described herein may comprise naturally occurring or non-naturally occurring nucleotides and / or base derivatives (or combinations thereof). In certain embodiments, the nucleic acid molecule comprises one or more modifications such that it comprises a chemical structure other than deoxyribose, ribose, phosphate, adenine (A), guanine (G), cytosine (C), thymine (T), or uracil (U). The nucleic acid molecule may be modified at the nucleobase, the pentose sugar, or the phosphate backbone. In some forms, the nucleic acid molecule comprises one or more Modified nucleotides. Exemplary modifications include, for example, nucleotides comprising alkylation, arylation or acetylation, alkoxylation, halogenation, an amino group, or another functional group. Examples of modified nucleotides include 2'-fluoro, 2'-NH2-, 2'-OCH3-, and 2'-O-methoxyethyl ribonucleotides, which are used for RNA aptamers. The nucleic acid molecule may be wholly or partially phosphorothioate or DNA, phosphoradithioate or DNA, phosphoroselenoate or DNA, phosphoradiselenoate or DNA, blocked nucleic acid (LNA), peptide nucleic acid (PNA), N3'-P5' phosphoramidate RNA / DNA, cyclohexene nucleic acid (CeNA), tricyclo DNA (tcDNA) or spiegelmer, or the phosphoramidate morpholine (PMO) components (see also Chan et al., Clinical and Experimental Pharmacology and Physiology (2006) 33, 533-540). Some modifications allow nucleic acid molecules to be stabilized against nucleic acid cleavage enzymes. In aptamer stabilization, a distinction can generally be made between subsequent modification of the aptamers and selection with already modified RNA / DNA. Stabilization does not affect the affinity of the modified RNA / DNA aptamers but prevents their rapid breakdown in an organism or biological solutions by RNases / ADNases. An aptamer is referred to as stabilized in the context of the present invention if its half-life in biological serums is greater than one minute, preferably greater than one hour, and more preferably greater than one day. Aptamers can also be modified with indicator molecules, which, in addition to detecting the labeled aptamers, can also contribute to increased stability. A desirable action includes, for example, binding to the target molecule, catalytically altering the target molecule, reacting with the target molecule in a manner that modifies or alters the target or functional activity of the target molecule, covalently binding to the target molecule, and facilitating a reaction between the target molecule and another molecule. In the context of the embodiments of the present invention, a desirable action is the binding of a target molecule with high affinity. In one modality, the action is the specific binding affinity for a target molecule, wherein the target molecule is a three-dimensional chemical structure other than a polynucleotide that binds to the nucleic acid ligand through a mechanism that is independent of Watson / Crick base pairing or triple helix formation, wherein the aptamer is not a nucleic acid having the known physiological function of being bound by the target molecule. Aptamers of a target molecule can be selected using known processes. For example, an aptamer can be prepared using the SELEX method and an improved version thereof (e.g., Ellington & Szostak, (1990) Nature, 346, 818-822; Tuerk & Gold, (1990) Science, 249, 505-510). In the SELEX method, by establishing strict selection conditions, increasing the number of rounds, or using a competitor substance, the aptamer is concentrated and selected. QQ Lznn / Lznz / E / YILI is an aptamer that exhibits a higher binding potential for the target molecule. Therefore, by adjusting the number of SELEX rounds and / or changing the competitive condition, aptamers with different binding strengths, aptamers with different binding modes, and aptamers with the same binding strength or binding mode but different base sequences can be obtained in some cases. The SELEX method comprises a PCR amplification process; by inducing a mutation using manganese ions and similar substances in the process, it is possible to perform SELEX with greater diversity. The variability of a gene library is, for example, in the range of approximately 10¹⁵ different molecules. From the gene library of single-stranded DNA or RNA nucleic acid molecules, those that bind best to the target are cycled enriched through selection steps along various cycle pathways and amplification steps. Each aptamer selection cycle essentially comprises the following sub-steps: a) binding of the nucleic acid molecule library to the target; b) separate nucleic acid molecules bound to the target from those not bound; c) recover the nucleic acid molecules that bind to the target; d) amplify the recovered nucleic acid molecules (e.g., PCR for DNA molecules, reverse transcription PCR for RNA molecules); and e) preparation of relevant single-stranded nucleic acids from the amplified product (e.g., purification of ssDNA, in vitro RNA transcription). After each cycle, the pool of selected and enriched nucleic acid molecules is used as starting material for the next cycle. Typically, 8 to 12 cycles are run, although this number varies depending on the target type, the selection method, and the efficiency of the selection. In certain formulations, the method involves analyzing the nucleic acid sequence of an aptamer identified as binding to the target molecule with high affinity. After sequence analysis, aptamers (including variants, mutants, fragments, and derivatives thereof) can be prepared using conventional DNA and RNA synthesis techniques familiar to those skilled in the technique. Furthermore, the binding properties of individual aptamers to the target molecule can be investigated. In certain formulations, at least one randomized region is flanked at the 5' and 3' ends by primer regions. The primer regions serve as primer binding sites for PCR amplification of the selected library and aptamers. In certain modalities, the nucleic acid molecules used in the apparatus and methods are selected from a universal aptamer selection gene library that is designed QQ Lznn / Lznz / E / YILI such that any aptamer resulting from this selection process requires little or no adaptation to become any of the listed assay formats. In certain embodiments, the universal aptamer selection library consists of the following functional parts: a 5' primer sequence, at least one hybridization / capture region (complementary to an immobilization oligonucleotide), at least one randomized region, and a 3' primer sequence. Once selected, the nucleic acid molecule can be further modified, for example, by removing one or both primer sequences before use. In certain embodiments, and as described above, the fixed primer sequences can be used as the capture sequence.Therefore, in certain formulations, the capture oligonucleotide comprises a nucleic acid sequence that is complementary to one of the primer sequences in the nucleic acid molecule. This allows the development of methods and devices that use a capture oligonucleotide comprising the same nucleic acid sequence regardless of the target molecule to be detected. Aptamers are easily altered because they allow for chemical synthesis. For aptamers, by predicting the secondary structure using the MFOLD program, or by predicting the spherical structure using X-ray or NMR analysis, it is possible to predict to some extent which nucleotide can be substituted or deleted, where to insert a new nucleotide, and so on. A predicted aptamer with the new sequence can be easily synthesized chemically, and its activity can be determined using an existing assay system. The aptamers for use in the apparatus and methods of certain embodiments of the present invention can be synthesized by methods known per se in the art. One of the synthesis methods is a method that uses an RNA polymerase. The target RNA can be obtained by chemically synthesizing DNA having the target sequence and an RNA polymerase promoter sequence, followed by in vitro transcription using the same as a template and according to a known method. It can be synthesized using DNA polymerase. DNA containing a target sequence is chemically synthesized, and using it as a template, amplification is performed using a known polymerase chain reaction (PCR) method. This is then single-stranded using a known method of polyacrylamide electrophoresis or enzymatic treatment. When a modified aptamer is synthesized, the efficiency of the elongation reaction can be increased by using a polymerase with a mutation at a specific site. The resulting aptamer can then be easily purified using a known method. Aptamers can be synthesized in large quantities using chemical synthesis methods such as the amidite method, the phosphoramidite method, and similar methods. The synthesis method is well-known, and as described in Nucleic Acid (Vol. 2)1 [Synthesis and QQ Lznn / Lznz / E / YILI Analysis of Nucleic Acid (Editor: Yukio Sugiura, Hirokawa Publishing Company) and similar publications. In fact, a synthesizer such as OligoPilotlOO, OligoProcess, and similar instruments manufactured by GE Healthcare Bioscience are used. Purification is performed using a known method such as chromatography and similar techniques. Target molecule The apparatus and methods described herein are for use in detecting the presence or absence and / or quantifying the amount of a target molecule in a sample. The term target molecule, as used herein, refers to a molecule that may be found in an analyzed sample and that is capable of binding to a nucleic acid molecule described herein. In some modalities, the target molecule is an organic molecule. In some modalities, the target molecule is a soluble antigen, a cell surface antigen, or an antigen associated with a micelle, liposome, or particle. In one modality, the target molecule is an antigen. In some modalities, the target molecule may be a protein, a polypeptide, a peptide, a ganglioside, a lipid, a phospholipid, a carbohydrate, a small molecule, or a nucleic acid molecule. In certain modalities, a soluble antigen can be a protein, a peptide, an enzyme, a cytokine, a soluble cancer marker, an inflammation-associated marker, a hormone and / or a soluble molecule derived from a virus, bacteria or fungus, for example, a toxin or an allergen. In some modalities, the antigen is an antigen associated with the microorganism. As used herein, the term microorganism-associated antigen should be understood as a protein or a fragment thereof encoded by the viral, bacterial, or fungal genome. In certain cases, the antigen is a marker for cancer (or tumor). Generally, a tumor marker can be found in bodily fluids, such as blood or urine, or in body tissues. Tumor markers can be expressed or overexpressed in cancer and are usually indicative of a particular pathological process. Non-limiting examples of a cell surface antigen according to the invention are a receptor, a cell surface marker, a microorganism-associated antigen, or a receptor ligand. In some modalities, the target molecule is a small molecule. In certain modalities, the small molecule is a therapeutic agent, for example, a chemotherapeutic agent such as Lznn / Lznz / E / YiAi used in cancer treatment. Sample The target molecule may be included in a sample. The sample is a selected biological sample of whole blood, leukocytes, peripheral blood mononuclear cells, plasma, serum, sputum, breath, urine, semen, saliva, meningeal fluid, amniotic fluid, glandular fluid, lymph, nipple aspirate, bronchial aspirate, synovial fluid, joint aspirate, cells, a cell extract, feces, tissue, tissue biopsy, and cerebrospinal fluid. The sample may include blood, serum, interstitial fluid, cerebrospinal fluid, brain fluid, tissue exudates, macerated tissue samples, ceiling solutions, intracellular compartments, groundwater, or other biological and environmental samples. Samples may be unaltered or may be pretreated prior to analysis, for example, by filtering, diluting, concentrating, regulating, or otherwise treating them. A sample is properly a provided or sampled material that is believed to contain one or more target molecules of interest, e.g., a small molecular analyte or analytes of interest, and is to be tested for the presence of the target. The sample can be, for example, a clinical sample, a food sample, a water sample, or a sample of other environmental sampling material. In certain embodiments, the sample comprises a target molecule and a buffer solution. In certain embodiments, the sample is pretreated, for example, by mixing, the addition of enzymes or markers, or it is purified. In certain modalities, the sample may also be any biological material isolated from individuals, for example, tissues and biological fluids, including, but not limited to: blood, skin, plasma, serum, lymph, urine, cerebrospinal fluid, tears, swabs, tissue samples, organs, and tumors. In certain modalities, components of cell cultures are also included in the samples. This document describes other exemplary target molecules and samples. immobilization oligonucleotide Appropriately, the immobilization oligonucleotide comprises a nucleic acid sequence that is configured to hybridize with a nucleic acid sequence of the nucleic acid molecule in at least a portion of its length. In certain embodiments, the immobilization region of the nucleic acid molecule is hybridized in at least a portion of itself with an immobilization region of the oligonucleotide. The terms hybrid and hybridization as used herein mean QQ Lznn / Lznz / E / YILI form a Watson-Crick base-pairing-based interaction between a fixed region within the aptamer library and a complementary sequence within the immobilizing oligonucleotide, under conventional hybridization conditions, preferably under rigorous conditions, as described, for example, in Sambrook et al., Molecular Cloning, A Laboratory Manual, 3rd Ed. (2001) Coid Spring Harbor Laboratory Press, Coid Spring Harbor, NY. The immobilizing oligonucleotide, or a portion thereof, is configured to form a double-stranded duplex structure with the immobilization region, or a portion thereof, of the nucleic acid molecule. In some embodiments, the immobilizing oligonucleotide is between approximately 10 and approximately 20 nucleotides in length, for example, 10, 11, 12, 13, 14, 15, 16, 1, 18, 19, or 20 nucleotides in length. The immobilizing oligonucleotide may comprise a nucleic acid sequence that is complementary to a fixed sequence of the nucleic acid molecule. Thus, in some embodiments, the immobilizing oligonucleotide may be a universal oligonucleotide in that it can be configured to hybridize with a sequence that may be included in a plurality of nucleic acid molecules. A schematic representation is provided in Figure 3. In certain modalities, the nucleic acid molecule and the immobilization oligonucleotide are incubated under conditions sufficient for the nucleic acid molecule or a portion thereof to hybridize with the immobilization oligonucleotide. A person skilled in the art will understand that the conditions necessary for hybridization to occur will vary between reactions. In certain embodiments, the method comprises heating a mixture of the nucleic acid molecule and the immobilizing oligonucleotide, for example, to at least approximately 80°C, for example, 85°C, 86°C, 87°C, 88°C, 89°C, or 90°C for at least approximately 1 minute, for example, 2 minutes, 3 minutes, 4 minutes, 5 minutes, or longer. The method may further comprise cooling the nucleic acid molecule and the immobilizing oligonucleotide to a temperature below approximately 10°C, for example, 9°C, 8°C, 7°C, 6°C, 5°C, 4°C, or lower. In some embodiments, hybridization is performed before immobilization of the immobilization oligonucleotide on the support. In an alternative embodiment, the immobilization oligonucleotide is attached to the support before hybridization of the nucleic acid molecule with the immobilization oligonucleotide. The immobilization oligonucleotide and / or nucleic acid molecule can bind to the support of the first region. The binding can be direct or indirect, for example, through a linker or other linking residue. In certain embodiments, the immobilizing oligonucleotide comprises a linker portion. The linker portion may be selected from biotin, thiol, and amine. The immobilizing oligonucleotide qq Lznn / Lznz / E / YiAi may further comprise a splicing molecule, for example, a splicing molecule selected from a polynucleotide molecule, a C6 splicing molecule, a C12 splicing molecule, another C-length splicing molecule, a hexaethylene glycol molecule, a hexanediol, and / or a polyethylene glycol. The linker can be, for example, a biotin linker. In certain embodiments, the aptamer can be conjugated with avidin. Further details on linkers can be found in this document. In certain embodiments, the linker and / or the linking molecule is a photoscintable molecule, for example, 5-bromouracil and / or 5-iodouracil. In certain embodiments, the immobilizing oligonucleotide and / or nucleic acid molecule can be modified for attachment to the support surface. For example, the immobilizing oligonucleotide can be attached via a silane linkage. Alternatively or additionally, the immobilizing oligonucleotide / nucleic acid molecule can be succinylated (e.g., to attach the immobilizing oligonucleotide to glass derivatized with aminophenyl or aminopropyl). Appropriately, the support is aminophenyl or aminopropyl derivatized. In certain embodiments, the immobilizing oligonucleotide / nucleic acid molecule comprises an NH2 modification (e.g., to attach the oligonucleotide to epoxy silane or isothiocyanate-coated glass). Appropriately, the support surface is coated with an epoxysilane or isothiocyanate.In certain forms, the immobilization oligonucleotide and / or nucleic acid molecule are modified with hydrazide to bind to an aldehyde or epoxide molecule. Support The apparatus in certain embodiments comprises a first region comprising a support. The support may comprise a solid-state support, such as a membrane or a bead. The support may be a two-dimensional support, for example, a microplate, or a three-dimensional support, for example, a bead. Therefore, in certain embodiments, the support may comprise at least one magnetic bead. In alternative embodiments, the support may comprise at least one nanoparticle, for example, gold nanoparticles or the like. In further embodiments, the support of the first region comprises a microtiter assay plate or other assay plate, a strip, a membrane, a film, a gel, a chip, a microparticle, a nanofiber, a nanotube, a micelle, a micropore, a nanopore, and a biosensor surface. In certain embodiments, the biosensor surface may be a probe tip surface, a biosensor flow channel, or the like.In certain embodiments, the additional region comprises a support. The supports of the first and other regions may be a continuous element. Alternatively, the supports of the first and other regions may be separate elements. The particularly suitable materials from which one can manufacture a QQ Lznn / Lznz / E / YILI supports include, for example, inorganic polymers, organic polymers, glasses, organic and inorganic crystals, minerals, oxides, ceramics, metals, especially precious metals, carbon, and semiconductors. A particularly suitable organic polymer is a polystyrene-based polymer. Biopolymers, such as cellulose, dextran, agar, agarose, and Sephadex, which can be functionalized, particularly as nitrocellulose or cyanogen bromide Sephadex, can be used as polymers that provide a solid support. In certain embodiments, the immobilization oligonucleotide can be attached, directly or indirectly, to a magnetic bead, which may be, for example, carboxy-terminated, avidin-modified, epoxy-activated, or otherwise modified with a compatible reactive group. Examples of polymers are not limiting, and other molecules are conceivable. The immobilization of oligonucleotides to a support, for example, a solid-phase support, can be achieved in various ways and in any manner known to those skilled in the art for immobilizing DNA or RNA on solids. The immobilization of aptamers on nanoparticles is, for example, as described in WO2005 / 13817. For instance, a solid phase of paper or a porous material can be moistened with the liquid-phase aptamer, and the liquid phase is subsequently volatilized, leaving the aptamer on the paper or porous material. In certain embodiments, the support of the first and / or other region comprises a membrane, for example, a nitrocellulose, a polyethylene (PE), a polytetrafluoroethylene (PTFE), a polypropylene (PP), a cellulose acetate (CA), a polyacrylonitrile (PAN), a polyimide (PI), a polysulfone (PS), a polyethersulfone membrane (PES) or an inorganic membrane comprising aluminum oxide (Al2O3), silicon oxide (SiO2) and / or zirconium oxide (ZrO2). Materials particularly suitable for fabricating a support include, for example, inorganic polymers, organic polymers, glasses, organic and inorganic crystals, minerals, oxides, ceramics, metals (especially precious metals), carbon, and semiconductors. A particularly suitable organic polymer is a polystyrene-based polymer. Biopolymers such as cellulose, dextran, agar, agarose, and Sephadex, which can be functionalized, particularly as nitrocellulose or cyanogen bromide Sephadex, can be used as polymers that provide a solid support. Additional region The apparatus also comprises an additional region that includes a support. The support for the other region may be the same as, or different from, the support for the first region. The additional region may be contained in a different vessel or apparatus than the first region. QQ Lznn / Lznz / E / YILI The additional region also includes a capture oligonucleotide directly or indirectly attached to the additional support. The capture oligonucleotide may comprise the same sequence as the immobilization oligonucleotide. Alternatively, the capture oligonucleotide may comprise a different sequence than the immobilization oligonucleotide. The additional region may comprise a plurality of capture oligonucleotides that bind to the nucleic acid molecule at a different sequence. The capture oligonucleotide, or a portion thereof, is configured to form a double-stranded duplex structure with a sequence of the nucleic acid molecule or the immobilizing oligonucleotide. In some embodiments, the capture oligonucleotide is between approximately 10 and approximately 20 nucleotides in length, for example, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides in length. The capture oligonucleotide may comprise a nucleic acid sequence that is complementary to a fixed sequence of the nucleic acid molecule or the immobilizing oligonucleotide. Therefore, in some embodiments, the immobilizing oligonucleotide may be a universal oligonucleotide in that it can be configured to hybridize with a sequence that may be included in a plurality of nucleic acid molecules.In an alternative embodiment, the capture oligonucleotide may comprise a nucleic acid sequence that is complementary to an immobilization oligonucleotide sequence. Detectable tags In certain embodiments, the nucleic acid molecule comprises a detectable tag. In certain embodiments, the capture oligonucleotide comprises a detectable molecule. In certain embodiments, the detectable tag is a fluorescent residue, e.g., a fluorescent / extinguishing compound. Fluorescent / extinguishing compounds are known in the art; see, e.g., Mary Katherine Johansson, Methods in Molecular BioL 335: Fluorescent Energy Transfer Nucleic Acid Probes: Designs and Protocols, 2006, Didenko, ed., Humana Press, Totowa, NJ, and Marras et al., 2002, Nud. Acids Res. 30, 1122 (both incorporated herein by reference). In addition, residues that result in an increase in the detectable signal when they are close to each other can be used as alternative labels in the apparatus and methods described herein, e.g., as a result of fluorescence resonance energy transfer (FRET'j; suitable pairs include, but are not limited to, fluoroscein and tetramethylrhodamine; rhodamine 6G and malachite green; and FITC and thiosemicarbazole, to name a few. In certain modalities, the detectable tag is selected from a fluorophore, a nanoparticle, a quantum dot, an enzyme, a radioactive isotope, a predefined sequence portion, biotin, dethiobiotin, a thiol group, an amine group, an azide, an aminoallyl group, digoxigenin, an antibody, a catalyst, a colloidal metallic particle, a colloidal non-metallic particle, an organic polymer, a latex particle, a nanofiber, a QQ Lznn / ίZΖΠZ / Β / YΙΛΙ nanotube, a dendrimer, a protein and a liposome. In certain modalities, the detectable tag is an enzyme, where optionally the enzyme is selected from horseradish peroxidase, alkaline phosphatase, urease, and βgalactosidase. In certain modalities, the nature of the detection means will depend on the detectable label used. For example, in certain modalities, the label may be detectable by virtue of its color, e.g., gold nanoparticles. A color can be detected quantitatively using an optical reader or a camera, e.g., a camera with imaging software. In certain modalities, if the detectable label is a fluorescent label, e.g., a quantum dot, the detection means may comprise a fluorescent strip reader configured to record the fluorescence intensity, e.g. In modalities where the detectable tag is an enzymatic tag, the detection means may be an electrochemical detector. The detection tag may further comprise enzymes such as horseradish peroxidase (HRP), alkaline phosphatase (APP), or similar, to catalytically reverse a substrate to give an amplified signal. In certain embodiments, the method comprises detecting the formation of the nucleic acid molecule-target molecule complex. As described herein, when the aptamer comes into contact with the target, an aptamer-target complex is formed by binding the aptamer to the target. The binding event can be detected, for example, visually, optically, photonically, electronically, acoustically, optoacoustically, by mass spectrometry, electrochemically, electro-optically, spectrometrically, enzymatically, or otherwise chemically, diochemically, or physically. In certain embodiments, the nucleic acid molecule may comprise a detection molecule, for example, a tag. Exemplary tags are visual, optical, photonic, electronic, acoustic, optoacoustic, mass spectrometry, electrochemical, electro-optical, spectrometric, enzymatic, or otherwise physically, chemically, or diochemically detectable. In one embodiment of the method, the tag is detected by luminescence, UV / VIS spectroscopy, enzymatically, electrochemically, or radioactively. Luminescence refers to the emission of light. In the method according to certain embodiments of the invention, photoluminescence, chemiluminescence, and dioluminescence are used, for example, for tag detection. In photoluminescence or fluorescence, excitation occurs by photon adsorption.Examples of fluorophores include, for example, disdenzimidazole, fluorescein, acridine orange, Cy5, Cy3 or propidium iodide, which can be covalently coupled to aptamers, tetramethyl-6-cardioxylodamine (TAMRA), Texas red (TR), rhodamine, Alexa Fluor dyes (et al. Fluorescent dyes of different wavelengths from different companies). qq Lznn / Lznz / E / YiAi Other labels include catalysts, colloidal metallic particles (e.g., gold nanoparticles), non-metallic colloidal particles, quantum dots, organic polymers, latex particles, nanofibers (particularly carbon), nanotubes (particularly carbon nanotubes), dendrimers, proteins, or liposomes containing signal-generating substances. Colloidal particles can be detected calorimetrically. In certain modes, the detectable molecule is an enzyme. In some modes, the enzyme can convert substrates into colored products, for example, peroxidase, green fluorescent protein (GFP), luciferase, β-galactosidase, or alkaline phosphatase. For example, the colorless substrate X-gal is converted by the activity of β-galactosidase into a blue product whose color is visually detectable. An enzyme detection and marker system mentioned above uses alkaline phosphatase. With alkaline phosphatase (APP), several detection methods are possible, as exemplified below: electrochemical detection: substrate phenyl phosphate, the enzymatic reaction of phenol forms APP, which is connected to the phenol sensor (e.g., electrochemical measurement of the color reaction): substrate p-nitrophenyl phosphate, the enzymatic reaction of APP forms p-nitrophenol, which is yellow; fluorescence detection: substrate 4-methylumbelliferonyl phosphate: the enzymatic reaction of APP forms a methylumbelliferonyl residue, which fluoresces after excitation; chemiluminescence detection: In addition, APP selectively converts 5-bromo-4-chloro-3-indolyl phosphate (BCIP or X-phosphate) and nitro blue tetrazolium salt (NBT). The dyes precipitate in the vicinity of the AP molecules and stain the surroundings of the bound compounds dark purple. Peroxidase catalysis, for example, involves the oxidation of ABTS (2,2'-azino-bis-[3-ethylbenzothiazoline-6-sulfonic acid]) in the presence of H₂O₂. Due to the enzyme's stability and the large number of potential substrates, horseradish peroxidase is preferred. Other enzymatic markers that catalyze the generation of detectable products include chloramphenicol acetyltransferase (CAT) and glutathione S-transferase (GST). In certain modalities, the detectable molecule is a radioactive isotope. Detection can also be carried out using radioactive isotopes labeled with the aptamer, preferably 3H, 14C, 32P, 33P, 35S, or 1251, more preferably 32P, 33P, or 1251. In scintillation counting, the radioactive radiation emitted by the radioactively labeled aptamer-target complex is measured indirectly. The scintillating substance is stimulated by the radioactive radiation. During the transition to the ground state, the excitation energy is released again as flashes of light, which are amplified and counted by a photomultiplier. In certain formulations, the detectable molecule is selected from digoxigenin and biotin. Therefore, aptamers can also be labeled with digoxigenin or biotin, which bind, by For example, an aptamer can bind to antibodies or streptavidin, which may in turn carry a marker, such as an enzyme conjugate. The prior covalent bonding (conjugation) of an aptamer to an enzyme can be achieved in several known ways. Aptamer binding can also be detected radioactively in a radioactive immunoassay (RIA) using radioactive isotopes, preferably 1251, or by fluorescence in a fluoroimmunoassay (FIA) using fluorophores, preferably fluorescein or FITC. The apparatus may further comprise a sample introduction region. The sample introduction region may comprise a port and may be provided upstream of the first region. In certain configurations, the device may also include: a) one or more competing molecules; and b) one or more control molecules. In a certain modality, the competing molecules are defined quantities of nonspecific and / or negative target molecules that allow discrimination with the sample. In a certain modality, control molecules are defined quantities of target molecules that allow comparison with the sample. In another modality, the control molecule can be a non-functional DNA / RNA sequence (control DNA / RNA sequence) that is complementary to a control capture molecule located in a control zone (described below). Hybridization of the control DNA / RNA sequence with the control capture molecule would demonstrate the assay's primary functionality. Apparatus The apparatus according to the first aspect of the present invention can be provided in various forms. In some embodiments, the apparatus can be a biosensor. Biosensors are available in many different forms. In a further aspect, the invention relates to a biosensor comprising an aptamer according to the invention. In certain embodiments, the biosensor comprises the following elements: a first region comprising the nucleic acid molecule and a transducer that converts the binding event between a nucleic acid molecule and a target molecule into an electrically quantifiable signal. The first region may be contained within a vessel, probe, or similar device. In addition, the apparatus may also include other elements, such as a signal processing device, output electronics, a display device, a data processing device, a data memory device, and interfaces with other devices. QQ Lznn / Lznz / E / YILI From a sample that is brought into contact with the biosensor, for example a complex mixture containing the target molecule, the target molecule can be identified by the specific binding of the nucleic acid molecule. The sensitivity of the sensor can be influenced by the transducer used. The nucleic acid-target molecule complex that binds to the capture oligonucleotide (or, in other configurations, the binding of the immobilization oligonucleotide to the capture oligonucleotide) can be converted by the transducer into an electronically usable signal. The transducer converts the signal from the binding event, which is proportional to the concentration of the target molecule in the sample, into an electrically quantifiable measurement signal. The signaling occurs due to the molecular interaction between the nucleic acid molecule and the target molecule. With a biosensor according to certain embodiments of the present invention, qualitative, quantitative, and / or semi-quantitative analytical information can be obtained. The apparatus, according to certain embodiments, may be particularly suitable for use in food, water, and environmental analysis, and water treatment, especially of drinking water and wastewater, in diagnostics, and for use in hospitals and healthcare facilities. In certain modalities, the first and / or additional region may comprise the transducer surface, and the transducer may detect the release and recapture events described in this document. The recapture of the target molecule-nucleic acid molecule complex can be measured, for example, using optical, microgravimetric, thermal, or acoustic transducers. Measurements using optical transducers can be based on photometric principles, detecting, for example, changes in color intensity or luminescence. Optical methods include the measurement of fluorescence, phosphorescence, bioluminescence, chemiluminescence, infrared transitions, and light scattering. Optical methods also include the measurement of layer thickness changes when the target is bound to an aptamer. Layer thickness changes can be measured, for example, using surface plasmon resonance (SPR), biolayer interferometry (BLI), or reflectometric interference spectroscopy (RIfS).In addition, interference in thin layers (reflection interference spectroscopy) and the change in the evanescent field can be measured. Acoustic transducers utilize the frequency shifts of a piezoelectric quartz crystal, which detects highly sensitive mass changes that occur when the target is bound to an aptamer. The quartz crystal is placed in an oscillating electric field, and its resonant frequency is measured. A mass change on the surface of the quartz crystal, for example, due to the reaction of the analyte with the receptor previously immobilized on the crystal surface, causes a change in the resonant frequency, which can then be quantified. QQ Lznn / Lznz / E / YILI Electrochemical transducers can, for example, measure the change in the concentration of redox-active markers on the electrode surface, or the change in the concentration of redox-active substrates or products, for example, consumed or formed in the enzymatic reaction of an enzyme marker. Thermal transducers measure the heat of the aptamer-target binding reaction. In certain embodiments, the instrument is a BLI (Biolayer Interferometry) instrument or a similar instrument. In certain embodiments, the first region is contained within a biosensor probe. The additional region containing the capture oligonucleotide is contained within a second biosensor probe. The first probe is incubated with the sample. If the target molecule is present in the sample, the nucleic acid molecule is displaced from the immobilization oligonucleotide complex to form a target molecule-nucleic acid molecule complex. As a result, the nucleic acid sequence is displaced from the probe and is present in the sample. The displacement of the nucleic acid molecule produces a quantifiable reduction in the signal and can be measured by BLI. The second probe is then incubated with the sample containing the nucleic acid-target molecule complex.The recapture of the nucleic acid molecule or the nucleic acid-target molecule complex gives a quantifiable association signal and can be measured by BLI. Depending on the design, the measuring device can provide qualitative, quantitative, and / or semi-quantitative analytical information about the object being measured. The detection means can be, for example, a portable meter that can be used on-site, such as a lightweight pocket-sized meter. In certain embodiments, the apparatus includes a lateral flow device. For example, the biosensor may be a lateral flow device. Lateral flow devices may also be referred to as lateral flow tests, lateral flow assays, and lateral flow immunoassays. Figure 2 is a schematic representation of a lateral flow device 1. The lateral flow device comprises a first region 13 comprising a support 7 to which an immobilization oligonucleotide 5 is attached. The immobilization oligonucleotide is configured to hybridize to a nucleic acid molecule, for example, an aptamer 3, over a portion of its sequence. A sample is introduced into the first region. The sample is appropriately a liquid. If the sample comprises a target molecule 9, the aptamer binds to the target molecule and undergoes a conformational change, resulting in the aptamer dissociating from the immobilizing oligonucleotide. The target molecule-aptamer complex 11 is then released into solution. Appropriately, the lateral flow device comprises a flow path from the first region to an additional region 15. The target molecule-aptamer complex flows from the first region to the QQ Lznn / ίΖΠΖ / Β / ΥΙΛΙ following region. The other region 15 adequately comprises a test region that includes a capture oligonucleotide 13. The capture oligonucleotide 13 comprises a nucleic acid sequence that is complementary to a sequence of the aptamer when the aptamer is in complex with the target molecule. The aptamer, when in complex with the target molecule, is recaptured in the test region. The presence of the aptamer-target molecule complex in the test region can be detected and optionally quantified, thereby providing a measure of the presence and optionally the amount of target molecule in the sample. Appropriately, the lateral flow device comprises a control region, for example, a control line configured to confirm that the test is functioning. In addition, the lateral flow device appropriately comprises one or more target test lines. The lateral flow device may be in the form of a strip. Appropriately, the support comprises a membrane, for example, a nitrocellulose membrane. The membrane may be made of woven or non-woven material. The support may further comprise a pad, for example, an absorbent pad, to which the sample can be applied. Appropriately, the absorbent pad is configured to absorb the sample through the membrane. In certain embodiments, the absorbent pad comprises cellulose fibers. In certain forms of modality, the apparatus may also comprise a backing element adjacent to the support. The lateral flow assay can work as follows: The selected aptamers are immobilized on a support, for example, a conjugation pad, by hybridization with the complementary sequence on an immobilization oligonucleotide. The aptamer or the immobilization oligonucleotide is attached to the support. The binding of the target molecule induces a conformational change in the aptamer, resulting in the disruption of hybridization and its subsequent displacement from the immobilizing oligonucleotide. The displaced aptamers, in complex with the target molecule (or, alternatively, the immobilizing oligonucleotide), are carried along the LFD strip within the sample matrix. The displaced aptamers or the immobilizing oligonucleotide are recaptured by hybridization with a second, complementary immobilized oligonucleotide, forming a test line on the LFD. Additional aptamers can also be processed against other target molecules in the same sample and captured on other complementary oligonucleotide sequences immobilized on other test lines, resulting in a multiplexed LFD assay. A liquid sample suspected of containing a target for the aptamer identified using the method of certain embodiments of the present invention is applied to the first region in QQ Lznn / Lznz / E / YILI a location, or the strip is moistened with the sample at a site. This location may be referred to as the sample application zone / pad of the strip. The strip contains a matrix material through which the liquid sample medium and the target molecule suspended or dissolved therein can flow by capillary action from a sample application pad / zone to a detection zone where a detectable signal or the absence of such a signal indicates the presence or absence of the target. As described herein, a labeled aptamer is used, which can be any of the labels previously described. Preferably, a label is used that leads to a visually detectable signal in the detection zone of the test strip. The presence or absence of the target in the sample can be detected by the presence or absence of a labeled aptamer in the detection zone. In one embodiment, the support comprises a test strip. In certain embodiments, an enzyme-labeled aptamer is used. If the target molecule is present in the sample, it forms a complex with the enzyme-labeled aptamer, which flows along the strip to a detection zone containing a substrate for the enzyme label that is capable of producing a colored reaction in the presence of the enzyme label. In certain embodiments, the strip contains another zone in which the target is immobilized, so that a labeled aptamer that does not bind to the target due to the absence of a sufficient target in the sample is detected and is therefore prevented from reaching the detection zone. The support, for example, the test strip, can be made from any material that can be moistened with a sample and into which an aptamer can be inserted according to specific methods. Materials through which a sample and a target contained within them can flow by capillary action are particularly preferred. Examples include nitrocellulose, mixtures of nitrocellulose with polyester or cellulose, uncoated paper, porous paper, viscose filament, fiberglass, acrylonitrile or nylon copolymer, as well as all other materials commonly used in lateral flow assays. The test strip can already be used as such to detect the presence of a target in a sample. For use, the strip can be immersed in a sample, in the case of a lateral flow assay, for example, with only one end, which then serves as the first region, i.e., a sample application zone. Certain embodiments of the present invention relate to a lateral flow testing device comprising the test strip described above. In addition to the test strip, the device may comprise, for example, a housing in which the test strip is embedded and which preferably has an opening that can be closed to the sample application area of the test strip. In certain embodiments, the apparatus comprises a control zone (a zone that is separate from the detection zone, which demonstrates the overall functionality of the test strip). QQ Lznn / Lznz / E / YILI In one particular modality, the control region may comprise a control capture sequence that is complementary to a non-target binding control DNA / RNA sequence. Hybridization of the control DNA / RNA sequence with the control capture molecule would yield a positive signal that is distinct from the test signal and demonstrates the assay's primary functionality. In certain embodiments, the apparatus comprises at least one container. The first region may be contained in a first container, and the additional region may be contained in an additional container. In certain embodiments, the apparatus may be suitable for use in an ELONA assay. A schematic representation of an ELONA apparatus is shown in Figure 4. The apparatus 100 may comprise a first region 110 contained in a container 120. Another region 120 is contained in another container 130. A nucleic acid molecule 150 specific to a target molecule 170 is provided, immobilized by hybridization with an immobilizing oligonucleotide 160 in the first region. In certain embodiments, the immobilizing oligonucleotide is immobilized on the surface of the container 120. A sample, which may contain a target molecule, is added to the container.If the sample contains the target molecule, the target molecule binds to the aptamer, resulting in a conformational change that, in turn, causes the aptamer to displace from the immobilizing oligonucleotide. This is shown in Figure 4, second image from the top. After a predetermined time sufficient to allow the displacement to occur, the assay sample is transferred to an additional container 130 comprising a capture oligonucleotide immobilized on a well surface. The capture oligonucleotide comprises a sequence that is complementary to a nucleic acid sequence of the aptamer. A detection molecule 140, for example, a streptavidin-conjugated enzyme such as HRP, is captured on the aptamer (when the aptamer is biotinylated), thus enabling detection with an enzymatic substrate (for example, TMB). The lower section of Figure 4 illustrates an ELONA assay when the target molecule is not present in the sample. Selected aptamers are immobilized in the assay well by hybridization to the complementary sequence on the immobilization oligonucleotide (which is itself immobilized on a surface of the first container). The addition of non-target molecules to the sample has no effect on the aptamer, which remains immobilized on the immobilization oligonucleotide. The assay sample is transferred to the additional container, and no aptamers are captured on the capture oligonucleotide. The streptavidin-conjugated enzyme (e.g., HRP) is not captured, so no signal is measured with enzyme substrates (e.g., TMB). In another specific modality, the solid support and the aptamer form a microarray, or so-called DNA or RNA aptamer chip, which can be single-channel or multi-channel. In the In a QQ Lznn / Lznz / E / YILI microarray, one or more aptamers, as well as reference materials for basic signal compensation, can be arranged in an array at various measurement points. In a multichannel chip, this arrangement occurs in individual channels. Thus, parallel measurement of a sample, or with different aptamers, is possible, as is the parallel measurement of different analytes in a sample. In an additional aspect, the invention relates to a kit comprising an aptamer according to certain embodiments of the invention. Appropriately, the kit comprises an aptamer, for example, a labeled aptamer or an aptamer probe according to certain embodiments of the invention, and other components for the kit reaction or method to be carried out, for example, components for a planned enrichment detection, separation, and / or isolation procedures. Examples include regulator solutions, substrates for a color reaction, dyes, or enzyme substrates. In the kit, the aptamer may be provided in a variety of forms, for example, lyophilized or in a liquid medium. EXAMPLES The invention will now be explained in more detail by means of non-limiting examples of specific embodiments. In the example experiments, standard reagents and contamination-free buffers are used. EXAMPLE 1 Biosensor assay (aptamer-based assay for detecting small molecules using biolayer interferometry - BLIJ) Oligonucleotides and aptamers The assay was performed using nucleic acid molecules (DNA aptamers) specific to the chemotherapeutic drug imatinib. Aptamer A was 100 nucleotides long and included a 5' FAM (fluorescein) tag. The nucleotide sequence of Aptamer A is set out below: ATCCACGCTCI III ICTCCCCCCGCTATG TGAGGCTCGA 7TGTTCGGTGTGI III IAAAGGGTACAGATCCTG GGCGGGGGGCATTGAGGGTGACATAGG- 3' (SEO ID NO: 1) qq Lznn / Lznz / E / YiAi The underlined sequence refers to the first and second primer sites used for aptamer amplification but also for recapture of the displaced aptamer, and the italicized sequence refers to the aptamer immobilization region (i.e., the nucleic acid sequence of the aptamer capable of binding to at least a portion of the immobilization sequence). The aptamer was purified by HPLC prior to use and was manufactured by IDT, Belgium. For the assay, the aptamer is immobilized onto streptavidin-coated sensor probes using the biotinylated immobilization oligonucleotide comprising a 5' biotin tag and an internal HEGL spacer, ISP18. The immobilization oligonucleotide was purified by HPLC prior to use and was also manufactured by IDT, Belgium. The immobilization oligonucleotide contains a defined 12-nucleotide region (GATCGAGCCTCA, SEQ ID NO: 2) that is inversely complementary to a region of the aptamer (shown in italics), allowing hybridization between the two molecules. Furthermore, the immobilization oligonucleotide carries a 5' biotin tag linked via a hexaethylene glycol (HEGL) residue, which is responsible for coupling the immobilization oligonucleotide to the streptavidin-modified magnetic beads. To recapture the aptamer-target complexes, two different capture oligonucleotides were used: revFOR and REV. Both capture oligonucleotides contain defined 19-nucleotide regions that are complementary to the first and last regions of the aptamer, respectively, and allow hybridization between the aptamer and the capture oligonucleotides. revFOR was 19 nucleotides long and comprises a 5' biotin marker. The capture oligonucleotide was purified by HPLC before use and was manufactured by IDT, Belgium. REV was 19 nucleotides long and comprises a 3' biotin marker. The capture oligonucleotide was purified by HPLC before use and was manufactured by IDT, Belgium. The nucleotide sequences of the capture oligonucleotides are shown below: revFOR - 5'-GGAGAAAAAGAGCGTGGAT-3' (SEQ ID NO:3) REV-5'-CCTATGTCACCCTCAATGC-3' (SEQ ID NO:4). Regulators, target BB buffer (20 mM Tris-HCl, pH 7.6, 100 mM NaCl, 5 mM KCl, 2 mM MgCb, 1 mM CaCb, 0.01% Tween 20) served as a hybridization buffer. B&W buffer (5 mM Tris-HCl, pH 7.5, 0.5 mM EDTA, 1 M NaCl, 0.01% Tween 20) was used to immobilize biotinylated oligonucleotides on streptavidin-coated surfaces. PBS6 buffer (10 mM Na₂HP₂O₅, 2 mM KH₂PO₄, pH 6.0, 137 mM NaCl, 2.7 mM KCl, 2 mM MgCb, 1 mM CaCb, 0.01% Tween 20) served as a binding and washing buffer during the assay. The target molecule is a chemotherapeutic agent used to treat cancer (Imatinib). Stock solutions of 1 mg / ml were prepared in DMSO and stored until use at -20°C. QQ Lznn / Lznz / E / YILI Biolayer interferometry (BLI) measurements BLI is a label-free technology for measuring biomolecular interactions. It is an optical analytical technique that analyzes changes in the interference pattern of white light reflected from two surfaces: a ligand layer immobilized on the biosensor tip and an internal reference layer. Any change in the number of molecules bound to the biosensor tip causes changes in the interference pattern that can be measured in real time. Only molecules that bind to or dissociate from the biosensor can change the interference pattern and generate a response profile in the BLI sensor. Unbound molecules, changes in the refractive index of the surrounding medium, or changes in flow velocity do not affect the interference pattern.The displacement selection principle offers the possibility of developing detection assays based on duplex formation between the immobilization sequence of the selected aptamers and the immobilization oligonucleotide. The target-dependent conformational change leads to the release of the aptamer from the duplex structure. This change from the hybrid duplex stage to the displaced stage of the aptamer can be used to generate a recordable signal. The experiments described here were performed using BLItz or Octet QK instruments (ForteBio, Pall Life Sciences, USA). BLI aptamer displacement assay For the immobilization of aptamers on biosensor probes (Streptavidin-SA Dip & Read Biosensors, ForteBio, Pall Life Sciences, USA), 1.5 µM aptamers and 1 µM immobilization oligonucleotides were prehybridized in BB regulator by heating the mixture to 95°C for 10 minutes and immediately cooling it to 4°C for 5 minutes before mixing it with 2x B&W regulator in a 1:1 ratio. Streptavidin-coated probes were incubated with this prehybridization mixture for 5 minutes. Three wash steps (30 seconds, 120 seconds, 30 seconds) were performed with PBS6 regulator to remove loosely immobilized DNA material. The probes were then incubated with target solution (20 µM in PBS6) for 5 minutes. Target binding causes aptamer displacement, which is seen as a decrease in signal. The eluted aptamer-target complexes were recovered for subsequent steps in the recapture assay. Recapture of aptamer-target complexes analyzed by BLI The biotinylated capture oligonucleotides 'revFOR' and 'REV' were immobilized on separate biosensor probes by incubating a streptavidin-coated probe for 3 minutes with the revFOR and REV oligonucleotides (1 μM in B&W regulator), respectively. Three wash steps (30 seconds, 60 seconds, 30 seconds) were performed with PBS6 regulator to remove the Weakly immobilized oligonucleotide material was used to capture the probes. The probes were then incubated for 5 min with the target-evaded material (aptamer-target complexes) obtained from the aptamer displacement assay (see above). A positive response is recorded when the aptamer-target complexes are recaptured on the immobilized capture oligonucleotides. EXAMPLE 2 Microtiter plate-based fluorescence assay using aptamers to detect small molecules in different matrices / substrates (ELISA-type assay) Oligonucleotides and aptamers: The assay was performed using nucleic acid molecules (DNA aptamers) specific for the antibiotic moxifloxacin. The nucleotide sequence of the moxifloxacin-specific aptamer is set out below: 5'ATCCACGCTCI III ICTCCTGTATACGGGTGAGGCTCGATCGGT\ III ICTCCCTGGCTACATGTTGGATTGG AGGTCGGTGCATTGAGGGTGACATAGG-3' (SEQ ID NO: 5) The underlined sequence refers to the first and second primer sites used for aptamer amplification but also for recapture of the displaced aptamer, and the italicized sequence refers to the aptamer immobilization region (i.e., the nucleic acid sequence of the aptamer capable of binding to at least a portion of the immobilization sequence). The immobilization oligonucleotide (complementary to part of the aptamer) comprises a 5' biotin tag and an internal HEGLISP18 spacer. The immobilization oligonucleotide was purified by HPLC prior to use and was also manufactured by IDT, Belgium. For the assay, the aptamer is immobilized onto streptavidin-coated microtiter plates (MTPs) using the immobilization oligonucleotide. The immobilization oligonucleotide contains a defined 12-nucleotide region (GATCGAGCCTCA, SEQ ID NO: 2) that is complementary to a region of the aptamer, allowing hybridization between the two molecules. Furthermore, the immobilization oligonucleotide carries a 5' biotin tag linked via a hexaethylene glycol (HEGL) residue, which is responsible for coupling the immobilization oligonucleotide to the streptavidin-modified MTPs. To recapture the aptamer-target complexes, the revFOR capture oligonucleotide was used.The capture oligonucleotide contains defined regions of 19 nucleotides that are complementary to the first region of the aptamer (SEQ ID NO:3) and allow hybridization between the aptamer and the capture oligonucleotide (revFOR: had 19 nucleotides in length and comprises a 5' biotin marker). The capture oligonucleotide was purified by HPLC prior to use and was manufactured by IDT, qq Lznn / Lznz / E / YiAi. Belgium). In some embodiments, the capture oligonucleotide comprises a sequence as set out in SEQ ID. No. 4. Regulators, objective, matrices / substrates The BB buffer (20 mM Tris-HCl, pH 7.6, 100 mM NaCl, 2 mM MgCl₂, 1 mM CaC₂, 0.01% Tween 20) served as a binding, washing, and hybridization buffer during the assay. The B&W buffer (5 mM Tris-HCl, pH 7.5, 0.5 mM EDTA, 1 M NaCl, 0.01% Tween 20) was used to immobilize biotinylated oligonucleotides on streptavidin-coated surfaces. The target molecule, the antibiotic, was obtained from Sigma-Aldrich, USA. 5 mM antibiotic stock solutions were prepared in DMSO and stored at -20°C until use. The assays were performed on four different substrates / matrices: human plasma (HUMANPL32NCU2N, BioIVT, UK); milk (organic whole milk, Sainsbury's Supermarket), river water - filter sterilized, 0.22 µm filter, ESF-PV-25-022, CM Scientific, UK); simulated urine (urea 151.5 mM, NaCl 64 mM, 30 mM NaHzPOi, creatinine 8.85 mM, 50 mg / L BSA). Fluorescence measurements Fluorescent markers incorporated into aptamers allow for the quantification of aptamer DNA after different stages of the process, using a fluorescence plate reader assay. Fluorescein-labeled DNA (FAM) fluorescence measurements were performed on a BMG fluorescence plate reader (FLUOstar OPTIMA, BMG, UK) using the following measurement conditions: excitation 485 nm / emission 520 nm. Aptamer displacement assay (microtiter plate-based fluorescence assay) For the immobilization of aptamers on streptavidin-coated MTP (96-well Pierce streptavidin-coated plates, HBC, black plates with SuperBiock blocking regulator, Thermo Scientific, USA), 0.75 μM aptamers and 0.5 μM immobilization oligonucleotides were pre-hybridized in BB regulator by heating the mixture to 95°C for 10 minutes and immediately cooling to 4°C for 5 minutes before mixing with 2x B&W regulator in a 1:1 ratio. MTP microtiter plate 1 was incubated with this pre-hybridization mixture for 1 h at room temperature while shaking at 1000 rpm on an MTP shaker (IKA Schüttler MTS 4, IKA Werke GmbH & Co. KG, Germany). Immobilization efficiency was determined by comparing the inlet and outlet fluorescence before and after incubation, respectively. This allows for the calculation of the approximate amount of aptamer loaded. QQ Lznn / Lznz / E / YILI fluorescence measurements. The aptamer-loaded plate (MTP 1) was extensively washed with BB buffer to remove loose immobilized DNA before incubation for 1 h at room temperature (1000 rpm on an MTP shaker) with a target antibiotic gradient (200 μM, 40 μM, 8 μM, 1.6 μM, 0.32 pM, 0 pM) prepared in four different matrices (plasma, milk, river water, and simulated urine) at four concentrations (0%, 10%, 25%, and 40% v / v matrix in BB buffer). The target-evaded material (from MTP 1) was recovered, and the amount of target-binding aptamer was determined by fluorescence measurements. Results Corrected data for plasma and milk show good antibiotic concentration-dependent responses. A potentially nonspecific binding element was also observed at higher matrix concentrations. This does not affect the validity of the assay or the data; however, it indicates that the correct calibration standard would be needed if the assay is to be used to accurately quantify residues in these matrices. The data also show almost no signal difference for the different river water concentrations, suggesting that it has no effect on the assay. Corrected data for simulated urine show an antibiotic-dependent increase in signal, but the signal decreases with increasing sample concentrations. This does not affect the validity of the assay if the correct calibration standard is prepared. Recapture of aptamer-target complexes (fluorescence assay based on microtiter plates) The biotinylated capture oligonucleotide 'revFOR' was immobilized onto the streptavidin-coated surface of MTP 2 and incubated for 1 h at room temperature while shaking at 1000 rpm on an MTP shaker with 0.5 μM revFOR capture oligonucleotide in immobilization buffer. The capture oligonucleotide-loaded plate (MTP 2) was washed extensively with BB buffer to remove weakly immobilized DNA. The material eluted by the target from MTP 1 was transferred after the aptamer displacement assay (see above) to MTP 2 (immobilized with capture oligonucleotide) and incubated for 1 h at room temperature while shaking at 1000 rpm on an MTP shaker. The uncaptured material was removed from MTP 2 and the amount of recaptured aptamer was determined by fluorescence measurements (after washing to remove released aptamers and any remaining matrix). Results The data show that aptamers were recaptured in each matrix following QQ Lznn / Lznz / E / YILI showed the same target concentration-dependent trend as the input material. In plasma and milk, a clear matrix concentration effect was observed. Aptamers were recaptured in lower amounts at higher matrix concentrations. This does not affect the validity of the assay or the data; it simply shows that correct calibration standard curves would be needed if the assay is to be used to accurately quantify residues in these matrices. EXAMPLE 3 Concentration-dependent re-coupling assay The assay was performed using biotin-labeled moxifloxacin aptamer (1500 pmol) and recapture oligonucleotide (revFOR or REV, 3400 pmol) as described above. In Step 1, the recapture oligonucleotide was immobilized in a 96-well plate by first adding 200 µl of lx B / W regulator to each well. Serial dilutions of a biotinylated oligo mixture (340 µl 5x 'B&W' regulator, 3400 pmol of biotin-labeled oligo (direct or reverse), water to 1700 µl) were added across the wells and the plate was incubated on an orbital shaker (1000 rpm, room temperature, 1 hour). In a second step, an aptamer gradient was prepared across a 96-well plate at pH 6.8 or pH 7.4 in BB buffer, and the inlet fluorescence was determined. The plate from step (1) was washed in 3 x 200 µL of BB buffer at the appropriate pH (6.8 or 7.4). A 100 µL mixture from each well of the plate from step (2) was added to the corresponding wells of the washed plate from step (3), and the plate was incubated on an orbital shaker (1000 rpm, room temperature, 1 hour). The plate from step (4) was retrieved and 100 µL of unbound material was transferred to a new 96-well plate and the fluorescence of the unbound material was measured using a BMG plate reader. The plate from step (4) was washed with 3 x 200 µL of ice-cooled BB lx buffer (pH 6.8, 2-minute incubation) and the fluorescence of the material remaining on the plate surface was determined. Results The data were plotted to demonstrate the effect of increasing the pre-immobilized biotinylated oligo on the amount of aptamer bound (fluorescence). Figures 8A to 8D show that both the immobilized direct and reverse oligo are able to capture the FAM-labeled aptamer at the 5' or 3' ends, respectively. Figures 8A to 8D also show that the pH of the hybridization buffer has little effect. Each graph also shows that the plates reach a saturation point. For example, when 50 pmol of FAM-labeled aptamer is added, an increase in loading is observed up to 50 pmol of biotinylated oligo. Above this point, QQ Lznn / Lznz / E / YILI of this, no additional aptamer binds. 2 pmol of incoming aptamer is insufficient to see a trend. The data were also plotted to demonstrate the effect of increasing aptamer input on the amount of aptamer bound (fluorescence). Again, the results show that both the forward and reverse immobilized oligo are capable of capturing the FAM-labeled aptamer (Figures 7A to 7D). They also show that the pH of the hybridization regulator has little effect. Each plot also shows that increasing aptamer input leads to an increase in signal (and therefore binding). Again, comparison between datasets shows that the plates reach a saturation point. This is most clearly seen at the top of each set (50 pmol input) where clear saturation is observed at approximately 50 pmol of immobilized oligo. Conclusions • Aptamer recapture is possible in selection regulators at pH 6.8 and pH 7.4 (the most common regulators are used for the selection of small molecules). • Recapture depends on concentration and is linear when 50 pmol of biotinylated capture oligo is used per well. • Further optimization can be carried out to improve loading if necessary. EXAMPLE 4 Displacement and recapture trials Displacement and recapture assays were combined to demonstrate both components in a single assay. In this experiment, aptamers were hybridized with the immobilization oligo and immobilized on the surface of the microtiter plate (plate A). The aptamers were then displaced from the first plate (A) and subsequently recaptured on the second plate (B) after being pre-immobilized with the biotinylated capture oligo. The same aptamer and target were tested in a variety of common matrices (plasma, river water, milk, and urine) to demonstrate the versatility of this platform. Results In this assay, the amount of fluorescence-labeled aptamer retained on the plate (after target-induced displacement) is quantified and plotted against the target concentration (Figures 11A and 11B). The data show a clear loss of fluorescent signal dependent on the target concentration from the first plate (A), indicating that the qq Lznn / Lznz / E / YiAi aptamer has been displaced by the target (in each of the different matrices). The displaced aptamers are recaptured on the second plate, pre-immobilized with the biotinylated capture oligo(B). Again, a concentration-dependent increase in signals is observed for each of the matrices, suggesting that the matrix does not interfere with recapture. Conclusions • Aptamer displacement shows a concentration-dependent response in several different matrices. • The displaced aptamers can be recovered later in a second ELISA plate, pre-immobilized with the biotinylated capture oligo. • The presence of matrix (plasma, etc.) or of the target molecule does not interfere with recapture. Throughout the description and claims of this specification, the words "comply" and "contain" and variations thereof mean "including without restriction" and do not (and in fact do) exclude any other portions, additives, components, wholes, or steps. Throughout the description and claims of this specification, the singular encompasses the plural unless the context otherwise requires. In particular, where the indefinite article is used, the description should be understood as encompassing both plurality and singularity, unless the context otherwise requires. The features, elements, characteristics, or groups described in conjunction with a particular aspect, embodiment, or example of the invention are to be understood as applicable to any other aspect, embodiment, or example described herein unless incompatible with them. All features described in this specification (including any accompanying claims, abstracts, and drawings), and / or all steps of any method or procedure so described, may be combined in any combination, except for combinations where at least some of such features and / or steps are mutually exclusive. The invention is not restricted to the details of any foregoing embodiment.The invention extends to any novelty, or any novel combination, of the features described in this specification (including the attached claims, abstract and drawings), or any novelty, or any novel combination, of the steps of any method or procedure so described. The reader's attention is directed to all papers and documents that are simultaneously filed prior to this specification in connection with this application and that are open to public inspection with this specification, and the contents of all such papers and documents are incorporated herein by reference. QQ Lznn / Lznz / E / YILI NOVELTY OF THE INVENTION
Claims
1. An apparatus for detecting the presence, absence, or level of a target molecule in a sample, the apparatus comprising: a) a first region comprising: i) a support; and i) an immobilization oligonucleotide; and i) a nucleic acid molecule having a binding affinity for a target molecule, wherein the nucleic acid molecule is configured to form a complex with the target molecule, wherein the immobilization oligonucleotide or the nucleic acid molecule is directly or indirectly bound to the support, and further wherein the immobilization oligonucleotide comprises a nucleic acid sequence that is at least partially complementary to a nucleic acid sequence of the nucleic acid molecule and wherein the nucleic acid molecule is capable of hybridizing with the immobilization oligonucleotide; the apparatus further comprising: b) an additional region comprising i) a support;and ii) a capture oligonucleotide directly or indirectly linked to the support, wherein the capture oligonucleotide comprises a nucleic acid sequence that is at least partially complementary to a nucleic acid sequence of the nucleic acid molecule, wherein the capture oligonucleotide is configured to hybridize with the nucleic acid sequence of the nucleic acid molecule when it forms a complex with the target molecule to capture the nucleic acid-target molecule complex. 2 - The apparatus according to claim 1, further characterized in that the capture oligonucleotide is configured to hybridize with the nucleic acid sequence of the nucleic acid molecule when it forms a complex with the target molecule to capture the nucleic acid-molecule-target molecule complex.
3. The apparatus according to claim 2, further characterized in that it also comprises a detection means for detecting the nucleic acid molecule when it is in a complex with the capture oligonucleotide.
4. The apparatus according to claim 1, further characterized in that the nucleic acid molecule comprises at least one fixed nucleic acid sequence region, and wherein the capture oligonucleotide comprises a nucleic acid sequence that is complementary to the fixed nucleic acid sequence region of the nucleic acid molecule.
5. The apparatus according to claim 4, further characterized in that the nucleic acid molecule comprises a first fixed nucleic acid sequence region and a second nucleic acid sequence region, and wherein optionally, the first fixed nucleic acid sequence region is located in a region of the 5' end of the nucleic acid molecule and the second fixed nucleic acid sequence region is located in a region of the 3' end of the nucleic acid molecule.
6. The apparatus according to claim 1, further characterized in that it comprises a linker molecule attached to the support and wherein the linker molecule is configured to hybridize with the nucleic acid molecule, and further wherein the immobilization oligonucleotide is configured to hybridize with the nucleic acid molecule when the nucleic acid molecule hybridizes with the linker molecule or wherein the linker molecule is configured to hybridize with the immobilization oligonucleotide and further wherein the nucleic acid molecule is configured to hybridize with the immobilization oligonucleotide when the immobilization oligonucleotide hybridizes with the linker molecule.
7. The apparatus according to claim 6, further characterized in that it further comprises a detection means for detecting the formation of a complex comprising the capture oligonucleotide and the immobilization oligonucleotide or the nucleic acid molecule.
8. The apparatus according to any of claims 6 to 7, further characterized in that the linking molecule is a DNA or RNA molecule or a mixed DNA / RNA molecule, wherein optionally the linking molecule comprises one or more modified nucleotides.
9. The apparatus in accordance with any of the preceding claims, further characterized in that it comprises a lateral flow testing device.
10. The apparatus in accordance with any of the preceding claims, further characterized in that the first region comprises a sample receiving region.
11. The apparatus according to any of the preceding claims, further characterized in that it further comprises a flow path between the first region and the additional region, wherein the flow path optionally comprises a membrane, for example, a nitrocellulose, a polyethylene (PE), a polytetrafluoroethylene (PTFE), a polypropylene (PP), a cellulose acetate (CA), a polyacrylonitrile (PAN), a polyimide (PI), a polysulfone (PS), a polyethersulfone membrane (PES) or an inorganic membrane comprising aluminum oxide (Al2O3), silicon oxide (SiO2) and / or zirconium oxide (ZrO2).
12. The apparatus according to any of the preceding claims, further characterized in that the first region comprises a sample application zone, wherein the sample application zone optionally comprises a sample application pad.
13. The apparatus according to any of the preceding claims, further characterized in that the support of the first region comprises an immobilization zone comprising the immobilization oligonucleotide or nucleic acid molecule directly or indirectly bound, wherein the immobilization zone optionally comprises woven or non-woven fibers, wherein the non-woven fibers are optionally selected from cellulose fibers, glass fibers, silicon carbide fibers, polymer fibers, animal fibers (e.g., wool, silk), carbon fibers, mineral fibers and / or microfibers. 14.- The apparatus in accordance with any of the preceding claims, further characterized in that the first region is provided upstream of the additional region.
15. The apparatus according to the preceding claim, further characterized in that the additional region comprises a capture zone in which the capture oligonucleotide is attached indirectly or directly to the support, wherein optionally the additional region comprises a plurality of capture zones, each capture zone comprising a capture oligonucleotide attached directly or indirectly to the support, wherein each capture oligonucleotide may be the same or may be different.
16. The apparatus according to any of the preceding claims, further characterized in that it additionally comprises a control zone located downstream of the first region, wherein the control zone comprises an additional capture oligonucleotide, wherein optionally the apparatus comprises a plurality of control zones, each control zone comprising a capture oligonucleotide, wherein each capture oligonucleotide is the same or different.
17. The apparatus according to claim 16, further characterized in that each capture oligonucleotide in the respective control zones is configured to bind to a different molecule.
18. The apparatus according to any of the preceding claims, further characterized in that it additionally comprises a housing enclosing the first region and the additional region, wherein the housing optionally further comprises a sample introduction port and, furthermore, optionally, the housing further comprises a window adjacent to the detection zone and optionally to the control zone.
19. The apparatus according to any of claims 1 to 8, further characterized in that the support of the first region and / or the additional region is independently selected from a bead, a microtiter or other test plate, a strip, a membrane, a film, a gel, a chip, a microparticle, a nanoparticle, a nanofiber, a nanotube, a micelle, a micropore, a nanopore and a biosensor surface wherein optionally the first region is comprised in a first container and the additional region is comprised in an additional container.
20. The apparatus according to claim 19, further characterized in that the solid phase of the first region and the additional region are comprised in a strip wherein the strip optionally further comprises a flow path between the first region and the additional region QQ Lznn / Lznz / E / YILI.
21. The apparatus according to claim 20, further characterized in that it additionally comprises one or more of the following: a) an absorbance pad, b) a membrane, for example, a nitrocellulose membrane; c) one or more competing molecules; and d) one or more control molecules.
22. The apparatus according to any of claims 19 to 21, further characterized in that it additionally comprises a container configured to accommodate at least an end portion of the strip and the sample, wherein the container optionally comprises a sample introduction region.
23. The apparatus according to any of the preceding claims, further characterized in that the immobilization oligonucleotide and / or the capture oligonucleotide is selected from a DNA molecule, an RNA molecule, a mixed DNA / RNA molecule, a modified DNA molecule, and a modified RNA molecule.
24. The apparatus according to any of the preceding claims, further characterized in that it comprises a plurality of immobilization oligonucleotides, a plurality of capture oligonucleotides, and a plurality of nucleic acid molecules.
25. The apparatus according to any of the preceding claims, further characterized in that the nucleic acid molecule is an aptamer and is optionally selected from a double-stranded aptamer, a single-stranded aptamer, and an aptamer that is double-stranded in at least a portion of its length.
26. The apparatus according to any of the preceding claims, further characterized in that the nucleic acid molecule and / or the immobilization molecule comprise a detectable tag, wherein the detectable tag is optionally selected from a fluorophore, a nanoparticle, a quantum dot, an enzyme, a radioactive isotope, a predefined sequence portion, a biotin, a dethiobiotin, a thiol group, an amine group, an azide, an aminoallyl group, a digoxigenin, an antibody, a catalyst, a colloidal metal particle, a colloidal non-metal particle, an organic polymer, a latex particle, a nanofiber, a nanotube, a dendrimer, a protein, and a liposome, and further, optionally, wherein the detectable tag is an enzyme, and wherein said enzyme is selected from horseradish peroxidase, alkaline phosphatase, urease, and β-galactosidase.
27. The apparatus according to any of the preceding claims, further characterized in that the sample is a selected biological sample of whole blood, leukocytes, peripheral blood mononuclear cells, plasma, serum, sputum, breath, urine, semen, saliva, meningeal fluid, amniotic fluid, glandular fluid, lymph, nipple aspirate, bronchial aspirate, synovial fluid, joint aspirate, cells, a cell extract, feces, tissue, tissue biopsy, and cerebrospinal fluid.
28. The apparatus in accordance with any of the preceding claims, further characterized in that the sample is derived from an agricultural or industrial product or by-product, an environmental sample, water, a food product, a sample from a production process, an animal product, a plant product, and a bacterial product.
29. The apparatus according to any of the preceding claims, further characterized in that the target molecule is selected from a small organic or inorganic molecule, a cell, a protein, a peptide, an amino acid, a carbohydrate, a lipid, a virus, a microorganism, a tissue section, an ion, a nucleotide, a nucleotide derivative, and a nucleic acid.
30. A method for detecting the presence, absence, or quantity of a target molecule in a sample, the method comprising: a) interacting a sample with a complex comprising: i) an immobilizing oligonucleotide; and i) a nucleic acid molecule, wherein the immobilizing oligonucleotide and / or the nucleic acid molecule are directly or indirectly attached to a support, the immobilizing oligonucleotide comprising a nucleic acid sequence that is at least partially complementary to a nucleic acid sequence of the nucleic acid molecule and wherein the nucleic acid molecule is capable of hybridizing with a portion of the immobilizing oligonucleotide; wherein the nucleic acid molecule has a binding affinity for a target molecule and, furthermore, wherein the nucleic acid molecule is configured to form a complex with the target molecule;b) if the target molecule is present in the sample, dissociate the nucleic acid molecule from the complex with the immobilizing oligonucleotide to form a target molecule-nucleic acid molecule complex; and c) provide a capture oligonucleotide comprising a nucleic acid sequence that is at least partially complementary to a nucleic acid sequence of the nucleic acid molecule, wherein the nucleic acid molecule is capable of hybridizing with a portion of the capture oligonucleotide; and d) detect the presence or absence of the target molecule.
31. The method according to claim 30, further characterized in that it additionally comprises, if a target molecule is present in the sample, forming a target molecule-nucleic acid molecule-capture oligonucleotide complex.
32. The method in accordance with clause 30 or claim 31, further characterized in that the method additionally comprises quantifying the amount of target molecules in the sample.
33. The method according to any of claims 30 to 31, further characterized in that the detection of the target molecule comprises photonic detection, electronic detection, acoustic detection, electrochemical detection, electro-optical detection, enzymatic detection, chemical detection, biochemical detection or physical detection.
34. The method according to any of claims 30 to 33, further characterized in that step (a) is carried out under conditions effective to allow binding between the target molecule and the nucleic acid molecule.
35. The method according to any of claims 30 to 34, further characterized in that the step of detecting the presence or absence of the target molecule comprises detecting the hybridization of the nucleic acid molecule with the capture oligonucleotide.