SYSTEMS AND METHODS FOR CONTROLLING ENZYMATIC REACTIONS

Abstract

The present invention relates to a method for sequencing a nucleic acid, comprising: providing a sample comprising a nucleic acid; contacting the sample with a DNA-binding molecule comprising a DNA dye; contacting the sample with an insertional enzyme complex to produce labeled nucleic acid fragments, wherein the insertional enzyme complex is inhibited by the DNA-binding molecule; and sequencing the labeled nucleic acid fragments to produce sequence reads; wherein the sample comprises primary nucleic acids and secondary nucleic acids, wherein the primary nucleic acids comprise nuclear DNA and the secondary nucleic acids comprise mitochondrial DNA (mtDNA) or extrachromosomal DNA, and wherein the DNA-binding molecule preferentially binds to secondary nucleic acids over primary nucleic acids.

Description

SYSTEMS AND METHODS FOR CONTROLLING ENZYMATIC REACTIONS Field The systems, methods, and compositions provided herein pertain to assays for selectively controlling enzymatic reactions. Specifically, the aspects described herein relate to methods for inhibiting, reducing, or eliminating secondary DNA sequence reads from open chromatin sequencing, whole-genome sequencing, or targeted sequencing. Background Enzymes are useful tools in molecular biology and genomics because they can perform a diverse number of steps across a broad range of applications, from genome editing and genomic assays to sequencing, pharmaceuticals, and diagnostics. Both naturally occurring and genetically engineered enzymes have experienced an explosion in applications and development over the past decade. A key focus has been on specificity and efficiency, with a primary emphasis on improving the enzyme system. However, enzyme systems exhibit off-target effects, which complicates the analysis of results. Summary This description relates to systems, methods, and compositions for selectively controlling enzymatic reactions by labeling confounding substrates, thereby blocking the enzyme's ability to interact with the substrate and thus reducing or eliminating the noise or error that would typically be present in the enzymatic reaction. Some embodiments provided herein relate to nucleic acid libraries comprising primary sequence reads obtained from sequencing, such as sequence reads from an assay for transposase-accessible chromatin sequencing (ATAC-seq) for nuclear DNA. In some embodiments, the nucleic acid libraries include sequence reads from an assay for whole-genome sequencing or chromosomal DNA sequencing.In some models, nucleic acid libraries do not include or have a reduced representation of secondary sequence reads, such as those from mitochondrial DNA (mtDNA). In some models, nucleic acid libraries are linked to bacterial DNA, plasmids, or extrachromosomal DNA. Some embodiments provided in this description relate to methods for sequencing a nucleic acid without sequencing or with reduced sequencing of secondary nucleic acids. In some embodiments, the methods include providing a sample comprising a nucleic acid, contacting the sample with a DNA-binding molecule, contacting the sample with an enzyme insertion complex to produce labeled nucleic acid fragments, and sequencing the labeled nucleic acid fragments to produce sequence reads. Some of the embodiments provided in this description relate to methods for inhibiting, eliminating, or reducing a secondary DNA sequence read, such as mitochondrial DNA (mtDNA) sequence reads. In some embodiments, the methods include providing a sample comprising secondary nucleic acids and primary nucleic acids, contacting the sample with a DNA-binding molecule that binds, RQ / rnn / i 7n7 / E / YL preferably to secondary nucleic acids, such as mtDNA, and perform DNA transposition in open chromatin, where secondary nucleic acids are not transposed or are transposed with reduced efficiency. Brief description of the figures Figure 1 is a schematic illustrating the modification of a target to control the specificity of an enzyme. All substrates (1, 2, or 3) are substrates for enzyme (5). Substrate 3 modified by 4 is not a substrate for enzyme (5) due to modification (4). Modification (4) can be a DNA spot, affinity mark, molecule, ligand, enzyme, peptide, or other modification. Figures 2A–2C represent bar graphs showing that increasing amounts of Hoechst dye reduce mtDNA reads in transposition experiments, thereby eliminating or reducing unwanted mtDNA reads. From left to right, the Hoechst dye concentrations are 8 pm (Figure 2A), 80 pm (Figure 2B), and 800 pm (Figure 2C). Figures 3A–3C depict DNA gels showing the transposition efficiency of various DNA-staining dyes. Figure 3A shows Hoechst staining and SYBR Gold, Figure 3B shows staining with Sytox Orange and Pico Green, and Figure 3C shows Qubit staining or no staining. High molecular weight DNA products are indicative of inefficient transposition. Inhibition is observed with both SYBR Gold and Sytox Orange at concentrations greater than 100 pm. Figure 4 shows the results for several dyes tested, including Hoechst (100 pm), SYBR Gold (at 100 pm and 10 pm), Sytox Orange (at 100 pm), Pico Green (at 100 pm), Qubit (at 100 pm or 10 pm), and no dye. The results indicate that only the selected dyes are suitable for reducing or eliminating secondary DNA sequence reads. Figure 5 represents the Hoechst staining results at 8 pm, 80 pm and 800 pm for various amounts of time (2 minutes or 20 minutes). Detailed description The following detailed description refers to the accompanying figures, which form part of it. In the figures, similar symbols typically identify similar components, unless the context indicates otherwise. The illustrative embodiments described in the detailed description, the figures, and the claims are not intended to be limiting. Other embodiments may be used, and other changes may be made, without departing from the spirit or scope of the subject matter presented herein. It will be readily understood that the aspects of this description, as generally described herein and illustrated in the figures, may be arranged, substituted, combined, separated, and designed in a wide variety of different configurations, all of which are explicitly contemplated herein. The modalities of the systems, methods, and compositions provided in the present description relate to the control of enzymatic reactions by preventing an enzyme from binding to confounding substrates, such as a substrate to which the enzyme would normally bind, but which prevents the proper analysis of a substrate of interest. RQ / rnn / i 7n7 / E / YL Traditional enzymatic reactions lack the specificity needed to analyze differences between closely related substrates. For example, nucleic acid enzymes poorly discriminate between various types of nucleic acids, such as mitochondrial DNA (mtDNA) compared to nuclear DNA. As a result, traditional enzymatic reactions provide results for both the target analyte and off-target analytes, thus confounding the results and increasing start-up time, cost, and complexity of the analysis. However, in many applications, controlling the selectivity of enzymatic reactions is desirable. A modality is a system and method for reducing, inhibiting, or eliminating unwanted targets; in this way, it specifically targets only the analyte of interest. Figure 1 schematically represents the concept of enzyme-substrate binding. In Figure 1, an enzyme 5 is capable of recognizing and binding different substrates 1, 2, and 3, which are then enzymatically catalyzed by the enzyme. However, substrate 3 is modified by modification 4 so that enzyme 5 does not recognize or bind to substrate 3. Figure 1 represents methods and systems in a generic scheme.In the modalities provided herein, the concept is described in terms of a transposase and nucleic acids, specifically in terms of a primary DNA sequence read (which is a read of the sequence of a DNA of interest, including, for example, nuclear DNA) and a secondary DNA sequence read (which is a read of an unwanted DNA, including, for example, mitochondrial DNA (mtDNA) or extrachromosomal DNA). However, it should be understood that the general methods and systems are applicable to other enzyme / substrate systems. The modalities of the systems, methods, and compositions enhance the specificity of the enzymatic reactions and, in this way, improve enzyme analysis by reducing off-target effects. For example, this approach can be applied so that specific stains, or DNA-binding molecules, can be delivered to certain targets using well-known affinity marks. These affinity marks can include antibody conjugates and DNA hybridization probes to block unwanted enzyme activity. By specifically blocking certain types of DNA, but not others, the unwanted off-target effects encountered with certain enzymes can be reduced. Alternatively, specific affinity marks (“blockers”) can be used to deliver enzymes to specific targets. Such applications can include blocking the off-target activity of widely used proteins, such as CRISPR enzymes. As used in this description, a DNA-binding molecule refers to a molecule that can bind to all DNA but has preferential access to certain DNA due to accessibility determined by a variety of factors, including, for example, the size, charge, or hydrophobicity of the DNA-binding molecule. The result is that certain types of DNA are preferentially blocked, while others are accessible to enzymatic systems that can generate sequencing libraries. Thus, in some modalities, differential access to DNA is permitted for certain types of DNA by binding with the DNA-binding molecule, so that the DNA becomes less active toward enzymatic reactions. For example, a DNA smear does not enter the nucleus but can enter mtDNA, thereby preferentially blocking the mtDNA. Some of the features described herein refer to a nucleic acid library. In some features, the nucleic acid library includes sequence reads obtained from the chromatin sequencing assay. RQ / rnn / Lznz / B / Yi transposases accessible (ATAC-seq) to a primary DNA (such as nuclear DNA) but does not include, or includes reduced amounts of, off-target nucleic acid sequence reads (a secondary DNA), such as mtDNA. In some embodiments, secondary DNA sequence reads are eliminated, reduced, or inhibited due to DNA-binding molecules that preferentially bind to the secondary DNA. In some embodiments, the DNA-binding molecule comprises a DNA dye, an affinity mark, a ligand, an enzyme, a peptide, or a biomolecule. In some embodiments, the DNA dye comprises Hoechst dye, SIBR Gold, Sytox Orange, Pico Green, or Qubit. In some embodiments, the nucleic acid library is generated from a cell population, a single cell, a population of cell nuclei, or a single cell nucleus. As used in this description, a “nucleic acid library” is an intentionally created collection of nucleic acids that can be prepared synthetically or biosynthetically in a variety of different formats (e.g., libraries of soluble molecules; and libraries of oligonucleotides attached to resin beads, silica chips, or other solid supports). Furthermore, the term “array” is intended to include those nucleic acid libraries that can be prepared by staining nucleic acids of essentially any length (e.g., from 1 to approximately 1000 nucleotide monomers in length) onto a substrate. An array can refer to a population of different microfeatures, such as microfeatures comprising polynucleotides, that are associated or bound to a surface in such a way that the different microfeatures can be distinguished from one another according to their relative location. An individual feature of an array may include a single copy of a microfeature, or multiple copies of the microfeature may be present as a population of microfeatures within an individual feature of the array. The population of microfeatures within each feature is typically homogeneous, with only one type of microfeature. Therefore, multiple copies of a single nucleic acid sequence may be present within a feature, for example, in multiple nucleic acid molecules that have the same sequence.In some modes, a heterogeneous population of microfeatures may be present in a feature. In some modes, a feature may include only a single type of microfeature. In some modes, a feature may include a plurality of different types of microfeatures, such as a mixture of nucleic acids having different sequences. Neighboring features in an array may be distinct from one another. Features may be adjacent to one another or separated by a space. In modes where features are separated, neighboring sites may be separated, for example, by a distance less than 100 pm, 50 pm, 10 pm, 5 pm, 1 pm, 0.5 pm, 100 nm, 50 nm, 10 nm, 5 nm, 1 nm, 0.5 nm, or any distance within a range of either of the above distances.The arrangement of features in an array can also be understood in terms of center-to-center distances between neighboring features. A useful arrangement in the invention may have neighboring features with a center-to-center separation less than approximately 100 pm, 50 pm, 10 pm, 5 pm, 1 pm, 0.5 pm, 100 nm, 50 nm, 10 nm, 5 nm, 1 nm, 0.5 nm, or any distance within a range of either of the foregoing distances. In some embodiments, the distance values ​​described herein may represent an average distance between neighboring features in an array. As such, not all neighboring features need fall within the specified range unless specifically indicated otherwise, e.g., by means of a symbol. RQ / rnn / i 7n7 / E / YL is a specific statement that the distance constitutes a threshold distance between all neighboring features of an array. The modalities may include arrays that have features at a range of densities.Illustrative density ranges for certain modalities include from approximately 10,000,000 features / cm2 to approximately 2,000,000,000 features / cm2; from approximately 100,000,000 features / cm2 to approximately 1,000,000,000 features / cm2; from approximately 100,000 features / cm2 to approximately 10,000,000 features / cm2; from approximately 1,000,000 features / cm2 to approximately 5,000,000 features / cm2; from approximately 10,000 features / cm2 to approximately 100,000 features / cm2; from approximately 20,000 features / cm2 to approximately 50,000 features / cm2; from approximately 1000 particles / cm2 to approximately 5000 particles / cm2, or any density within a range of any two of the above densities. As used in this description, “surface” may refer to a portion of a substrate or support structure that is accessible for contact with reagents, beads, or analytes. The surface may be substantially flat or level. Alternatively, the surface may be rounded or contoured. Illustrative contours that may be included on a surface are wells, depressions, pillars, ridges, channels, or the like.Illustrative materials that may be used as a substrate or support structure include glass, such as modified or functionalized glass; plastics, such as acrylic, polystyrene or a copolymer of styrene and another material, polypropylene, polyethylene, polybutylene, polyurethane, or Teflon; polysaccharides or crosslinked polysaccharides, such as agarose or sepharose; nylon; nitrocellulose; resin; silica or silica-based materials, including silicon and modified silicon; carbon fiber; metal; inorganic glass; optical fiber bundles; or a number of other polymers. A single material or a mixture of several different materials may form a useful surface in the invention. In some embodiments, a surface comprises pores. As used in this description, "bead" may refer to a small body made of a rigid or semi-rigid material. The body may have a characteristic shape, for example, as a sphere, oval, microsphere, or other recognized particle shape, regardless of whether it has regular or irregular dimensions. Example materials useful for beads include glass, such as modified or functionalized glass; plastic, such as acrylic, polystyrene or a copolymer of styrene and another material, polypropylene, polyethylene, polybutylene, polyurethane, or Teflon; polysaccharides or crosslinked polysaccharides, such as agarose or sepharose; nylon; nitrocellulose; resin; silica or silica-based materials, including silicon and modified silicon; carbon fiber; metal; inorganic glass; optical fiber bundles; or a number of other polymers.Illustrative beads include controlled-pore glass beads, paramagnetic beads, thoria sol beads, Sepharose beads, nanocrystals, and others known in the art. Beads can be fabricated from biological or non-biological materials. Magnetic beads are particularly useful due to the ease of manipulation of magnetic beads using magnets. Beads used in certain modalities can have a diameter, width, or length from 0.1 µm to 100 µm. The bead size can be selected to be smaller and thus have higher density, while maintaining sufficient signal for analyzing features. As used herein, “hybridization,” “hybridization,” or grammatical equivalents thereof, may refer to a reaction in which one or more polynucleotides react to form a complex that is formed, al. RQ / rnn / i 7n7 / E / YL, at least in part, is held together by hydrogen bonds between the bases of the nucleotide residues. Hydrogen bonding can occur through Watson-Crick base pairing, Hoogstein bonding, or any other sequence-specific mechanism. The complex may consist of two strands forming a double helix, three or more strands forming a multistrand complex, a single self-hybridizing strand, or any combination thereof. The strands may also be cross-linked or otherwise held together by forces other than hydrogen bonding. As used herein, “extending,” “extension,” or any grammatical equivalent thereof may refer to the addition of dNTPs to a primer, polynucleotide, or other nucleic acid molecule by an extending enzyme, such as a polymerase. For example, in some embodiments described herein, the resulting extended primer includes sequence information from a nucleic acid. While some embodiments are described as performing extension by using a polymerase, such as a DNA polymerase or reverse transcriptase, extension may be performed in any other manner known in the art. For example, extension may be performed by ligating oligonucleotides together, such as oligonucleotides that have been hybridized to a strand of interest. As used in this description, “ligation” or “ligand” or other grammatical equivalents may refer to the joining of two nucleotide chains by means of a phosphodiester bond. Ligation may include chemical bonding. Such a reaction may be catalyzed by a ligase. A ligase refers to a class of enzymes that catalyzes this reaction with the hydrolysis of ATP or a similar triphosphate. As used in this description, “polynucleotide” and “nucleic acid” can be used interchangeably and can refer to a polymeric form of nucleotides of any length, whether ribonucleotides or deoxyribonucleotides. Therefore, these terms include single-stranded, double-stranded, or multi-stranded DNA or RNA.Examples of polynucleotides include a gene or gene fragment, whole genomic DNA, genomic DNA, epigenomic DNA, genomic DNA fragment, mitochondrial DNA (mtDNA), nuclear DNA, ribosomal DNA, exon, intron, messenger RNA (mRNA), regulatory RNA, transfer RNA, ribosomal RNA, non-coding RNA (ncRNA) such as PIWI-interacting RNA (piRNA), small interfering RNA (siRNA), and long non-coding RNA (incRNA), small hairpin RNA (shRNA), small nuclear RNA (snRNA), microRNA (miRNA), small nucleolar RNA (snoRNA), and viral RNA, ribozyme, cDNA, recombinant polynucleotide, branched polynucleotide, plasmid, vector, DNA isolated from any sequence, RNA isolated from any sequence, nucleic acid probe, primer, or copy amplified from any of the above.A polynucleotide can include modified nucleotides, such as methylated nucleotides and nucleotide analogs, including nucleotides with non-natural bases, and nucleotides with modified natural bases, such as aza or deaza-purines. A polynucleotide can be composed of a specific sequence of four nucleotide bases: adenine (A), cytosine (C), guanine (G), and thymine (T). Uracil (U) can also be present, for example, as a natural replacement for thymine when the polynucleotide is RNA. Uracil can also be used in DNA. The term "nucleic acid sequence" can refer to the alphabetical representation of a polynucleotide or any nucleic acid molecule, including its bases. RQ / rnn / i 7n7 / E / YL natural and non-natural. In addition, DNA can contain non-natural base pairs (UBPs). A UBP is an engineered subunit (or nucleobase) of DNA that is created in a laboratory and does not occur in nature. As used herein, a primary nucleic acid is a nucleic acid of interest. In some embodiments, the primary nucleic acid is nuclear DNA. The primary nucleic acid may be any nucleic acid that is to be analyzed in a sample. As used herein, a secondary nucleic acid is a nucleic acid present in a sample but not the nucleic acid of interest and is therefore an interference in the context of the analysis of a nucleic acid of interest. In some embodiments, the secondary nucleic acid is mitochondrial DNA (mtDNA) or extrachromosomal DNA. The secondary nucleic acid may be any nucleic acid present in a sample but not the target of the analysis and which is preferred to be inhibited, reduced, or eliminated from the analysis in order to analyze the nucleic acid of interest more efficiently and accurately.Extrachromosomal DNA is any DNA found outside the nucleus of a cell. It is also known as extranuclear DNA or cytoplasmic DNA. A nucleic acid may contain phosphodiester bonds and may include other types of backbones comprising, for example, phosphoramide, phosphorothioate, phosphorodithioate, O-methylphosphoroamidite, and peptide nucleic acid backbones and bonds. A nucleic acid may contain any combination of deoxyribo- and β-nucleotides, and any combination of bases, including uracil, adenine, thymine, cytosine, guanine, inosine, xanthan, hypoxanthan, isocytosine, isoguanine, and base analogs such as nitropyrrole (including 3-nitropyrrole) and nitroindole (including 5-nitroindole). In some forms, a nucleic acid may include at least one promiscuous base.A promiscuous base can pair with bases of more than one different base type and can be useful, for example, when included in oligonucleotide primers or inserts used for random hybridization in complex nucleic acid samples, such as genomic DNA samples. An example of a promiscuous base is inosine, which can pair with adenine, thymine, or cytosine. Other examples include hypoxanthine, 5-nitroindole, acyclic 5-nitroindole, 4-nitropyrazole, 4-nitroimidazole, and 3-nitropyrole. Promiscuous bases that can pair with bases of at least two, three, four, or more base types can also be used. An assay for transposase-accessible chromatin using sequencing (ATAC-seq) refers to a rapid and sensitive method of integrative epigenomic analysis. ATAC-seq captures open chromatin sites and reveals the interaction between open chromatin genomic locations, DNA-binding proteins, individual nucleosomes, and higher-order compaction in regulatory regions at nucleotide resolution. Classes of DNA-binding factors have been discovered that strictly avoid, can tolerate, or tend to overlap with nucleosomes. Using ATAC-seq, serial daily epigenomes of resting human T cells were measured and assessed from a proband using standard blood draws, demonstrating the feasibility of reading personal epigenomes on clinical timescales for monitoring health and disease.More specifically, ATAC-seq can be performed by treating single-cell chromatin with an insertional enzyme complex to produce labeled fragments of genomic DNA. In this step, the chromatin is labeled (e.g., fragmented and labeled in the same reaction) using an insertional enzyme, such as Tn5 or MuA, which cleaves the genomic DNA into open regions within the chromatin and adds adapters to both ends of the fragments. In some modalities, the application is whole-genome sequencing or epigenomic profiling. RQ / rnn / Lznz / E / Yi Whole-genome sequencing (WGS) refers to a method for reading the genome using multiple sequences, such as 10x, 20xy, and 40x formats, for whole-genome sequencing using next-generation sequencing. Targeted sequencing refers to methods or assays that determine the DNA sequence of selected genes or DNA loci in a sample, for example, sequencing a selected group of cancer-related genes. In some cases, conditions can be adjusted to obtain a desirable level of insertion into the chromatin (e.g., insertion occurring, on average, every 50 to 200 base pairs in open regions). The chromatin used in the method can be prepared by any suitable method. In some embodiments, nuclei can be isolated, and the chromatin can be further purified, for example, from the nuclear envelope. In other embodiments, the chromatin can be isolated by contacting isolated nuclei with the reaction regulator. In these embodiments, the isolated nuclei can be contacted with the reaction regulator (comprising insertion enzyme complexes and other necessary reagents), which allows the insertion enzyme complexes to access the chromatin.In these methods, the process may involve isolating nuclei from a cell population and combining the isolated nuclei with transposase and adapters. This combination results in nuclear lysis to release the chromatin and produce the adapter-labeled fragments of genomic DNA. Unlike other methods (e.g., ChlP-SEQ methods), the chromatin does not require cross-linking. In some methods, the enzymatic reactions occur directly within the cells. After the chromatin has been fragmented and labeled to produce labeled fragments of genomic DNA, at least some of the adapter-labeled fragments are sequenced to produce a plurality of sequence reads. The fragments can be sequenced using any suitable method. For example, the fragments can be sequenced using the Illumina reversible terminator method, the Roche pyrosequencing method (454), Life Technologies ligation sequencing (SOLID platform), or the Life Technologies Ion Torrent platform. Examples of such methods are described in the following references: Margulies et al. (Nature 2005 437: 376-80); Ronaghi et al. (Analytical Biochemistry 1996 242:84-9); Shender et al. (Science 2005 309: 1728-32); Imelfort et al. (Brief Bioinform. 2009 10: 609-18); Fox et al. (Methods Mol Biol. 2009; 553: 79-108); Appleby et al. (Methods Mol Biol. 2009; 513:19-39) and Morozova et al. (Genomics.2008 92: 255-64), which are incorporated herein as a reference for general method descriptions and specific method steps, including all starting materials, library preparation methods, reagents, and end products for each step. As would be evident, forward and reverse sequencing primer sites compatible with a selected next-generation sequencing platform can be added to the ends of the fragments during the amplification step. In certain modalities, the fragments can be amplified using PCR primers that hybridize to the marks added to the fragments, where the primer used for PCR has 5' tails compatible with a particular sequencing platform. Methods for performing ATAC-seq are set out in PCT application no.PCT / US2014 / 038825, which is incorporated in its entirety into this description by reference. RQ / rnn / i zoz / e / yl The term “chromatin,” as used in this description, refers to a complex of molecules that includes proteins and polynucleotides (e.g., DNA, RNA), as found in the nucleus of a eukaryotic cell. Chromatin is composed in part of histone proteins that form nucleosomes, genomic DNA, and other DNA-binding proteins (e.g., transcription factors) that bind, generally, to genomic DNA. In some modalities, the methods described herein also include further analysis of the target nucleic acid of interest. This analysis may include, for example, DNA analysis, RNA analysis, protein analysis, labeling, nucleic acid amplification, nucleic acid sequencing, nucleic acid library preparation, continuity-preserving transposition (CPT-seq), combinatorial single-cell indexed sequencing (SCIseq) or single-cell genome amplification, whole-genome sequencing from single cells or from a cell population, epigenomics, or any combination thereof. DNA analysis refers to any technique used to amplify, sequence, or otherwise analyze DNA. DNA amplification can be performed using PCR techniques. DNA analysis may also include non-PCR-based sequencing techniques for non-target DNA (e.g., metagenomics). As a non-limiting example, DNA analysis may include sequencing the hypervariable region of 16S rDNA (ribosomal DNA) and using sequencing for species identification through DNA. In some modalities, the DNA may include purified DNA. RNA analysis refers to any technique used to amplify, sequence, or otherwise analyze RNA. The same techniques used to analyze DNA can be used to amplify and sequence RNA. RNA, which is less stable than DNA, is the translation of DNA in response to a stimulus. Therefore, RNA analysis can provide a more accurate picture of the metabolically active members of a community and can be used to provide information about the community function of organisms in a sample. Nucleic acid sequencing refers to the use of sequencing to determine the order of nucleotides in a nucleic acid molecule, such as DNA or RNA. In some modalities, DNA analysis may also include methods that do not require or use amplification.The term “sequencing”, as used in the present description, refers to a method by which the identity of at least 10 consecutive nucleotides (e.g., the identity of at least 20, at least 50, at least 100, or at least 200 or more consecutive nucleotides) of a polynucleotide is obtained. The terms “next-generation sequencing” or “high-throughput sequencing” or “NGS” generally refer to high-throughput sequencing technologies that include, but are not limited to, massively parallel distinctive sequencing, high-throughput sequencing, ligation sequencing (e.g., SOLID sequencing), semiconductor ion-proton sequencing, DNA nanoball sequencing, single-molecule sequencing, and nanopore sequencing, and may refer to the sequencing-by-synthesis or parallelized ligation sequencing platforms currently used by Illumina, Life Technologies, or Roche, etc.Next-generation sequencing methods may also include nanopore sequencing methods or electronic detection-based methods such as the Ion Torrent technology marketed by Life Technologies or the single-molecule fluorescence-based method marketed by Pacific Biosciences and / or BGI Microfluidics. RQ / rnn / i 7n7 / E / YL Illustrative sequencing techniques include targeted sequencing, single-molecule real-time sequencing, electron microscopy-based sequencing, transistor-mediated sequencing, direct sequencing, random shotgun sequencing, dideoxy Sanger termination sequencing, targeted sequencing, exon sequencing, whole-genome sequencing, hybridization sequencing (e.g., in an array such as a microarray), pyrosequencing, capillary electrophoresis, gel electrophoresis, double sequencing, cycle sequencing, single-base extension sequencing, solid-phase sequencing, high-throughput sequencing, parallel massively parallel random shotgun sequencing, emulsion PCR, low-temperature denaturing-PCR co-amplification (COLD-PCR), multiplex PCR, sequencing using reversible dye terminator, paired-end sequencing, and near-termination sequencing.exonuclease sequencing, ligation sequencing, short read sequencing, single molecule sequencing, sequencing by synthesis, real-time sequencing, reverse terminator sequencing, ion semiconductor sequencing, nanoball sequencing, nanopore sequencing, 454 sequencing, Solexa Genome Analyzer sequencing, miSeq (Illumina), HSeq 2000 (Illumina), HSeq 2500 (Illumina), Illumina Genomic Analyzer (Illumina), Ion Torrent PGM™ (Life Technologies), MinlON™ (Oxford Nanopore Technologies), Real-Time SMRT™ Technology (Pacific Biosciences), anchored probe ligation (cPAL™) (Complete Genomics / BGI), SOLID® sequencing, MS-PET sequencing, mass spectrometry, and a combination of these. In some modalities, sequencing comprises detecting the sequencing product by using an instrument, for example, but not limited to, an ABI PRISM® 377 DNA sequencer, an ABI PRISM® 310, 3100,3100-Avant, 3730, or 3730x1 genetic analyzer, an ABI PRISM® 3700 DNA analyzer, or an Applied Biosystems SOLID™ system (all from Applied Biosystems), a genomic sequencer system 20 (Roche Applied Science), or a mass spectrometer. In certain modalities, sequencing comprises emulsion PCR. In certain modalities, sequencing comprises a high-throughput sequencing technique. In certain modalities, sequencing comprises whole-genome sequencing. In certain modalities, sequencing comprises massively parallel sequencing (e.g., massively parallel shotgun sequencing). In alternative modalities, sequencing comprises targeted sequencing. Protein analysis refers to the study of proteins, and may include proteomic analysis, determination of post-translational modification of proteins of interest, determination of protein expression levels, or determination of protein interactions with other molecules, including with other proteins or nucleic acids. As used herein, the term "tagged" refers to the modification of DNA by a transposome complex comprising the transposase enzyme in complex with adaptors comprising a transposon terminal sequence. The tack results in the simultaneous fragmentation of the DNA and the ligation of the adaptors to the 5' ends of both strands of double-stranded fragments. After a purification step to remove the transposase enzyme, additional sequences may be added to the ends of the adapted fragments, for example, by PCR, ligation, or any other suitable methodology known to those skilled in the art. Contiguity-preserving transposition sequencing (CPT-seq) refers to a sequencing method that preserves contiguity information by using transposase to maintain fragment association. RQ / rnn / i 7n7 / E / YL of adjacent template nucleic acid in the target nucleic acid. For example, CPT can be carried out on a nucleic acid, such as DNA. The CPT nucleic acid can be captured by hybridizing complementary oligonucleotides that have unique indices or barcodes and immobilized on a solid support. In some embodiments, the oligonucleotide immobilized on the solid support may further comprise primer-binding sites, unique molecular indices, in addition to the barcodes. Advantageously, such use of transposomes to maintain the physical proximity of fragmented nucleic acids increases the likelihood that fragmented nucleic acids from the same original molecule, e.g., chromosome, will receive the same unique barcode and index information from the oligonucleotides immobilized on a solid support.This will result in a contiguous sequencing library with unique barcodes. The contiguous sequencing library can then be sequenced to derive information from contiguous sequences. As used in this description, the term “contiguity information” refers to a spatial relationship between two or more DNA fragments based on shared information. The shared aspect of the information may be with respect to adjacent, compartmental, and distance spatial relationships. Information regarding these relationships facilitates hierarchical assembly or mapping of sequence reads derived from the DNA fragments. This contiguity information improves the efficiency and accuracy of such assembly or mapping because traditional assembly or mapping methods used in conjunction with conventional shotgun sequencing do not account for the relative genomic origins or coordinates of individual sequence reads as they relate to the spatial relationship between the two or more DNA fragments from which the individual sequence reads were derived. Therefore, according to the methods described herein, contiguity information can be captured using short-range contiguity methods to determine adjacent spatial relationships, mid-range contiguity methods to determine compartmental spatial relationships, or long-range contiguity methods to determine distance spatial relationships. These methods facilitate the accuracy and quality of DNA sequence assembly or mapping and can be used with any sequencing method, such as those described herein. Contiguity information includes the genomic origins or relative coordinates of individual sequence reads with respect to the spatial relationship between the two or more DNA fragments from which the individual sequence reads were derived. In some modalities, contiguity information includes sequence information from non-overlapping sequence reads. In some modalities, contiguity information of a target nucleic acid sequence is indicative of haplotype information. In some modalities, contiguity information of a target nucleic acid sequence is indicative of genomic variants. Single-cell indexed combinatorial sequencing (SCI-seq) is a sequencing technique for simultaneously generating thousands of single-cell libraries for a variety of analyses, including, for example, whole genome, methylation, RNA, simultaneous DNA and RNA, or Hi-C, or other library analyses or any combination of these. RQ / rnn / i 7n7 / E / YL A transposition reaction is a reaction in which one or more transposons are inserted into target nucleic acids at random or near-random sites. The components in a transposition reaction include a transposase (or another enzyme capable of cleaving and labeling a nucleic acid as described herein, such as an integrase) and a transposon element comprising a double-stranded transposon terminal sequence that binds to the transposase (or other enzyme as described herein) and an adaptor sequence attached to one of the two transposon terminal sequences. One strand of the double-stranded transposon terminal sequence is transferred to one strand of the target nucleic acid, while the complementary transposon terminal sequence strand is not transferred (a non-transferred transposon sequence). The adaptor sequence may include one or more functional sequences or components (e.g.,, primer sequences, anchor sequences, universal sequences, sword regions or index mark sequences) as needed or desired. Transposon-based technology can be used to fragment DNA, for example, as exemplified in the workflow for the FLEXIBLE and NEXTERA™ XT DNA Sample Preparation Kits (Illumina, Inc.), where target nucleic acids, such as genomic DNA, are treated with transposome complexes that simultaneously fragment and label (tagged) the target, thereby creating a population of fragmented nucleic acid molecules labeled with unique adaptor sequences at the ends of the fragments. An insertional enzyme complex, as used herein, refers to a complex comprising an insertional enzyme and two adaptor molecules (the transposon marks) that combine with polynucleotides to cleave and add adaptors to the polynucleotides. Therefore, an insertional enzyme complex may be a “transposome complex” composed of at least one transposase (or other enzyme as described herein) and a transposon recognition sequence. In some such systems, the transposase binds to a transposon recognition sequence to form a functional complex capable of catalyzing a transposition reaction. In some respects, the transposon recognition sequence is a terminal sequence of double-stranded transposons.The transposase binds to a transposase recognition site on a target nucleic acid and inserts the transposon recognition sequence into the target nucleic acid. In some such insertion events, a strand of the transposon recognition sequence (or end sequence) is transferred to the target nucleic acid, resulting in a cleavage event. Illustrative transposition procedures and systems that can be readily adapted for use with the transposases of the present description are described, for example, in PCT Publication No. WO10 / 048605, U.S. Patent Publication No. 2012 / 0301925, U.S. Patent Publication No. 2012 / 13470087, or U.S. Patent Publication No. 2013 / 0143774, each of which is incorporated herein by reference in its entirety. Example transposases that may be used with certain modalities provided in this description include (or are encoded by): Tn5 transposase (see Reznikoff et al., Biochem. Biophys. Res. Commun. 1999, 266, 729-734), Sleeping Beauty (SB) transposase, Vibrio harveyi (transposase characterized by Agilent and used in the SureSelect QXT product), MuAy transposase and a Mu transposase recognition site comprising the terminal sequences R1 and R2 (Mizuuchi, K., Cell, 35:785, 1983; Savilahti, H., et al., EMBO J., 14:4893, 1995), Staphylococcus aureus Tn552 (Colegio, O. et al., J. Bacteriol., 183:2384-8, 2001; Kirby, C. and Colleagues, Mol. Microbiol., 43:173-86,2002), Ty1 (Devine & Boeke, Nucleic RQ / rnn / i 7n7 / E / YL Acids Res., 22:3765-72,1994 and PCT publication no. WO95 / 23875), transposon Tn7 (Craig, NL, Science, 271:1512,1996; Craig, NL, Curr. Top. Microbiol. Immunol., 204:27-48,1996), Tn / O and IS10 (Kleckner n. et al., Curr. Top. Microbiol. Immunol., 204: 49-82, 1996), mariner transposase (Lampe, DJ et al., EMBO J., 15: 5470-9, 1996), Tc1 (Plasterk, RH, Curr. Top. Microbiol. Immunol., 204:125-43,1996), P element (Gloor, GB, Methods Mol. Biol., 260: 97-114, 2004), Tn3 (Ichikawa & Ohtsubo, J. Biol. Chem., 265:18829-32,1990), bacterial insertion sequences (Ohtsubo & Sekine, Curr. Top. Microbiol. Immunol. 204:1-26,1996), retrovirus (Brown et al.; Proc. Nati. Acad. Sel. USA, 86: 2525-9,1989) and yeast retrotransposon (Boeke & Corees, Ann. Rev. Microbiol. 43: 403-34, 1989). Further examples include IS5, Tn10, Tn903, IS911, and engineered versions of transposase family enzymes (Zhang et al., (2009) PLoS Genet. 5:e1000689. Epub Oct. 16; Wilson C. et al. (2007) J. Microbiol.Methods 71: 332-5), each of the references cited in this description with respect to the transposase is incorporated herein as a reference in its entirety. The methods described herein may also include combinations of transposases and not just a single transposase. In some embodiments, the transposase is a Tn5, MuA, or Vibrio harveyi transposase, or an active mutan of these. In other embodiments, the transposase is a Tn5 transposase or an active mutan of this transposase. In some embodiments, the Tn5 transposase is a hyperactive Tn5 transposase (see, for example, Reznikoff et al., PCT publication no. WO2001 / 009363, U.S. patents nos. 5,925,545, 5,965,443, 7,083,980, and 7,608,434, and Goryshin and Reznikoff, J. Biol. Chem. 273: 7367, 1998), or an active mutan of these. In some aspects, Tn5 transposase is a Tn5 transposase as described in PCT publication WO2015 / 160895, which is incorporated herein by reference. In some embodiments, Tn5 transposase is a fusion protein. In some embodiments, the Tn5 transposase fusion protein comprises a Ts (Tsf) melt elongation factor mark.In some embodiments, the Tn5 transposase is a hyperactive Tn5 transposase comprising mutations at amino acids 54, 56, and 372 relative to the wild-type sequence. In some embodiments, the hyperactive Tn5 transposase is a fusion protein, optionally where the fused protein is the Ts elongation factor (Tsf). In some embodiments, the recognition site is a Tn5-type transposase recognition site (Goryshin and Reznikoff, J. Biol. Chem., 273:7367, 1998). In one embodiment, a transposase recognition site that forms a complex with a hyperactive Tn5 transposase is used (e.g., EZ-Tn5™ Transposase, Epicentre Biotechnologies, Madison, WI). In some embodiments, the Tn5 transposase is a wild-type Tn5 transposase. In any of the methods, compositions, or systems described herein, the transposon includes a transposon terminal sequence. In some methods, the transposon terminal sequence is a mosaic-type (ME) terminal sequence. In some methods, the DNA is labeled, where the DNA is tagged with a label that includes a specific transposon sequence, such as an ME sequence. Therefore, the DNA is differentiated from the RNA in the sample based on the specific transposon sequence. In any of the modalities of the methods, compositions, or systems described herein, the transposon includes an adapter sequence. Adapter sequences may comprise one or more functional sequences or components selected from the group consisting of primer sequences, anchor sequences, universal sequences, cleaver regions, index sequences, capture sequences, barcode sequences, cleavage sequences, sequencing-related sequences, and combinations thereof. In some In RQ / rnn / i 7n7 / E / YL modalities, an adapter sequence comprises a primer sequence. In other modalities, an adapter sequence comprises a primer sequence and an index or barcode sequence. A primer sequence may also be a universal sequence. This description is not limited to the types of adapter sequences that could be used, and an experienced technician will recognize additional sequences that could be used for library preparation and next-generation sequencing. A universal sequence is a region of nucleotide sequence that is common to two or more nucleic acid fragments. Optionally, the two or more nucleic acid fragments may also have regions of sequence difference.A universal sequence that may be present in different members of a plurality of nucleic acid fragments may allow the replication or amplification of multiple different sequences using a single universal primer that is complementary to the universal sequence. Adaptors include nucleic acids, such as single-stranded nucleic acids. Adaptors may include short nucleic acids that are less than, greater than, or equal to approximately 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100 nucleotides in length, or a range in between. In either modality, the adapter sequence or transposon terminal sequences, including A14-ME, ME, B15-ME, ME', A14, B15, and ME, are provided below: A14-ME: 5'-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-3' (SEC. WITH NÚM. DE IDENT.: 1). B15-ME: S'-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG-S' (SEC. WITH NÚM. DE IDENT.: 2). ME1: 5'-phos-CTGTCTCTTATACACATCT-3' (SEQ ID NO: 3). A14: 5'-TCGTCGGCAGCGTC-3' (SEC. WITH NÚM. DE IDENT.: 4). B15: 5'-GTCTCGTGGGCTCGG-3' (SEC. WITH NÚM. DE IDENT.: 5). ME: AGATGTGTATAAGAGACAG (SEC. WITH NÚM. DE IDENT.: 6). In some embodiments, the primer sequences include preparing the gene libraries for sequencing. In some embodiments, the primer sequence is either a P5 primer sequence or a P7 primer sequence. The P5 and P7 primers are used on the surface of commercially available flow cells marketed by Illumina, Inc., for sequencing on various Illumina platforms. The primer sequences are described in U.S. Patent Publication No. 2011 / 0059865 A1, which is incorporated herein by reference in its entirety. Examples of P5 and P7 primers, which may have an alkyne 5' terminus, include the following: P5: AATGATACGGCGACCACCGAGAUCTACAC (SEC. WITH IDENT. NO. 7). P7: CAAGCAGAAGACGGCATACGAG*AT (SEC. WITH IDENT. NO. 8). and derivatives or analogues thereof. In some examples, the P7 sequence includes a modified guanine at the G* position, for example, an 8-oxo-guanine. In other examples, the asterisk (*) indicates that the bond between G* and the adjacent 3' A is a phosphorothioate bond. In some examples, the P5 and / or P7 primers include non-natural linkers. Optionally, one or both of the P5 and P7 primers may include a poly-T tail. The poly-T tail is usually located at the 5' end of the sequence shown above, for example, between the 5' base and an alkyne terminal unit, but in some cases, it may be located at the 3' end. The poly-T sequence may include any number of T nucleotides. RQ / rnn / i 7n7 / E / YL example, from 2 to 20. While primers P5 and P7 are provided as examples, it should be understood that any suitable primer can be used in the examples presented in this description. The index sequences containing the primer sequences, which include the P5 and P7 primer sequences, are used to add P5 and P7 to activate the library for sequencing. A nucleic acid-binding molecule is a molecule that preferentially binds to a nucleic acid, such as DNA or RNA. A nucleic acid-binding molecule, such as a DNA-binding molecule, may be specific to a certain type of nucleic acid, without binding to other types. For example, a DNA-binding molecule may preferentially bind to mtDNA but not bind, or bind only to a lesser extent, to other nucleic acids, such as nuclear DNA. Examples of nucleic acid-binding molecules include a dye or stain, a protein, an enzyme, a biomolecule, an affinity mark, a particle, a fluorescent marker, a peptide, a ligand, or another molecule capable of specifically binding to a nucleic acid.Therefore, in some examples, the nucleic acid-binding molecule is a Hoechst dye, a cyanine dye (which includes, for example, SYBR dyes such as SYBR green, SYBR gold, oxazole yellow, tlazol orange, PicoGreen, Safe green), 4',6-diamidino-2-phenylindole (DAPI), or Sytox dyes (which include, for example, Sytox green or Sytox orange). Other nucleic acid-binding molecules may include, for example, 7-AAD (7-amino-actinomycin D), acridine orange, acridine red, Alexa Fluor 594, R-phycoerythrin streptavidin Alexa Fluor 610 pH 7.2, R-phycoerythrin streptavidin Alexa Fluor 647 pH 7.2, Alexa Fluor 633, Alexa Fluor 647, Alexa Fluor 660, Alexa Fluor 680, Alexa Fluor 700, Alexa Fluor 750, alophycocyan i π a (APC), BOBO-3-DNA, BOBO-3, Bodipy 650 / 665-X, Cy5.5, Cy5, DDAO, Draq5, ethidium bromide, ethidium monoazide, ethidium homodimer, ethidium homodimer-1 (EthD-1), ethidium-1-DNA homodimer, ethidium-2 homodimer, LDS 751, LDS 751 (DNA), LOLO-1, MitoTracker red, Nile blue-EtOH, OIIGreen, quantification reagent dsDNA, POPO-1DNA, PO-PRO-1-DNA, propydiumiodide (Pl), propydiumiodide-DNA, Ribogreen, SYPRO Ruby, SYTO 60, SYTO 61, SYTO 62, SYTO 63, SYTO 64, Texas Red, TO-PRO-1-DNA, TO-PRO-3, TO-PRO-5, TOTO-1-DNA, TOTO-3, YO-PRO1-DNA, YO-PRO-3, YOYO-1, YOYO-1-DNA, and YOYO-3. These nucleic acid-binding molecules are illustrative molecules that may be used, and a person experienced in the field will recognize that any nucleic acid-binding molecule that discriminates between a target nucleic acid of interest and non-target nucleic acids may be used. Some embodiments provided in this description relate to a method for sequencing a nucleic acid. In some embodiments, the method includes providing a sample comprising a nucleic acid, contacting the sample with a DNA-binding molecule, contacting the sample with an enzyme insertion complex to produce labeled nucleic acid fragments, and sequencing the labeled nucleic acid fragments to produce sequence reads. In some embodiments, the sample is a cell population, a single cell, a population of cell nuclei, or a single cell nucleus. In some embodiments, the sample comprises mtDNA and nuclear DNA, and wherein the DNA-binding molecule binds to the mtDNA but not to the nuclear DNA. In some embodiments, the DNA-binding molecule comprises a DNA dye, an affinity mark, a ligand, an enzyme, a peptide, or a biomolecule.In some forms, the DNA stain comprises Hoechst, SIBR Gold, Sytox Orange, Pico Green, or Qubit stain. In some forms, the insertion enzyme complex is a transposome comprising a transposase. In some. In RQ / rnn / i 7n7 / E / YL modalities, sequencing is performed by ATAC-seq. In some modalities, ATAC-seq comprises ATAC-seq a grael or single-cell ATC-seq. In some modalities, the method inhibits, reduces, or eliminates mtDNA sequence reads. In some modalities, the nucleic acid binding molecule preferentially binds to a specific DNA sequence or sequences. Some embodiments provided herein relate to a method for inhibiting, reducing, or eliminating mtDNA sequence reads. In some embodiments, the method includes providing a sample comprising mtDNA and a nucleic acid of interest, contacting the sample with a DNA-binding molecule that binds preferentially to secondary DNA, such as mtDNA, and performing DNA transposition into open chromatin, where the secondary DNA, such as mtDNA, is not transposed. In some embodiments, the sample is a cell population, a single cell, a population of cell nuclei, or a single cell nucleus. In some embodiments, the DNA-binding molecule comprises a DNA dye, an affinity mark, a ligand, an enzyme, a peptide, or a biomolecule. In some embodiments, the DNA dye comprises Hoechst Dye, SIBR Gold, Sytox Orange, Pico Green, or Qubit.In some embodiments, DNA transposition is performed using ATAC-seq. In some embodiments, ATACseq comprises bulk ATAC-seq or single-cell ATAC-seq. In some embodiments, contact of the sample with the DNA-binding molecule blocks transposition in mtDNA. In some embodiments, the nucleic acid of interest comprises nuclear DNA. In some embodiments, the method also includes sequencing the nuclear DNA. As used herein, a sample includes any sample containing an analyte of interest. The sample may be a biological sample, such as a biological sample containing an analyte of interest, including, for example, whole blood, serum, interstitial fluid, lymph, cerebrospinal fluid, sputum, urine, feces, milk, sweat, tears, umbilical cord, peripheral blood, bone marrow, cells, or solid tissue. In some modalities, the sample is a cell population, a single cell, a population of cell nuclei, or a cell nucleus. The sample may be obtained from a subject, where it is desirable to analyze one or more analytes of interest from the subject. As used herein, a “subject” refers to an animal that is the object of treatment, observation, or experimentation. “Animal” includes cold-blooded and warm-blooded vertebrates and invertebrates, such as fish, shellfish, reptiles, and, particularly, mammals.“Mammal” includes, but is not limited to, mice, rats, rabbits, guinea pigs, dogs, cats, sheep, goats, cows, horses, primates such as monkeys, chimpanzees and apes and, particularly, humans. The sample may be a fluid or specimen obtained from an environmental source. For example, the fluid or specimen from the environmental source may be obtained from or derived from food products, food production, poultry, meat, fish, beverages, dairy products, water (including wastewater), ponds, rivers, reservoirs, swimming pools, soil, food processing and / or packaging plants, agricultural sites, hydroculture (including hydroponic food farms), pharmaceutical manufacturing plants, animal colony facilities, or any combination thereof. In some modalities, the sample is a fluid or specimen collected from or derived from a cell culture or a microbial colony. As used herein, “analyte,” “target analyte,” and “analyte of interest” are used interchangeably and refer to the analyte being measured in the methods and systems described herein. In some embodiments, the analyte may be a biomolecule. Non-limiting examples of biomolecules include RQ / rnn / i 7n7 / E / YL macromolecules, such as polynucleotides (e.g., DNA or RNA), proteins, lipids, and carbohydrates. In certain cases, the analyte may be hormones, antibodies, growth factors, cytokines, enzymes, receptors (e.g., neural, hormone, nutrient, and cell surface receptors) or their ligands, cancer markers (e.g., PSA, TNF-alpha), myocardial infarction markers (e.g., troponin, creatine kinase, and the like), toxins, drugs (e.g., drugs of addiction), metabolic agents (e.g., including vitamins), and the like. Non-limiting modalities of protein analytes include peptides, polypeptides, protein fragments, protein complexes, fusion proteins, recombinant proteins, phosphoproteins, glycoproteins, lipoproteins, oligonucleotide-labeled proteins, or the like. The target analyte can be a nucleic acid, such as nuclear DNA. Conversely, an off-target analyte is an analyte that would normally be analyzed using an enzymatic reaction, but is not the target analyte of interest. This results in both the analyte of interest and the off-target analyte being analyzed, thereby decreasing the accuracy and reliability of the results. An off-target analyte is an analyte that would prefer not to be analyzed. Therefore, the methods described herein are methods and compositions that eliminate, reduce, or inhibit the analysis of off-target analytes. The target nucleic acids may include a sample in which the average size of a nucleic acid in the sample is less than, greater than, or equal to approximately 2 kb, 1 kb, 500 bp, 400 bp, 200 bp, 100 bp, 50 bp, or a range between any two of the above sizes. In some modalities, the average size of a nucleic acid in the sample is less than, greater than, or equal to approximately 2000 nucleotides, 1000 nucleotides, 500 nucleotides, 400 nucleotides, 200 nucleotides, 100 nucleotides, 50 nucleotides, or a range between any two of the above sizes. As used herein, the term “reagent” describes an agent or a mixture of two or more agents useful for reacting with, interacting with, diluting, or adding to a sample, and may include agents used in the assays described herein, including agents for lysis, nucleic acid analysis, nucleic acid amplification reactions, protein analysis, labeling reactions, ATAC-seq, CPT-seq, or SCI-seq reactions, or other assays. Therefore, reagents may include, for example, regulators, chemicals, enzymes, polymerases, primers smaller than 50 base pairs, template nucleic acids, nucleotides, labels, dyes, or nucleases.In some forms, the reagent includes lysozyme, proteinase K, random hexamers, polymerase (e.g., DNA polymerase Φ29, Taq polymerase, Bsu polymerase), transposase (e.g., Tn5), primers (e.g., P5 and P7 adapter sequences), ligase, catalytic enzyme, deoxynucleotide triphosphates, regulators, or divalent cations. As used herein, the terms “isolated,” meaning “to isolate,” “isolation,” “purified,” meaning “to purify,” “purification,” and their grammatical equivalents, as used herein, unless otherwise specified, refer to the reduction in the amount of at least one contaminant (such as a protein and / or nucleic acid sequence) from a sample or source (e.g., a cell) from which the material is isolated. Purification thus results in “enrichment,” for example, an increase in the amount of a desired protein and / or nucleic acid sequence in the sample. RQ / rnn / i 7n7 / E / YL The advantages of the methods and compositions described herein may include, for example, specific targeting of DNA of interest through open chromatin sequencing (ATAC-seq), reduction, inhibition, or elimination of unwanted mitochondrial sequence reads from the analysis, reducing or eliminating the need to separate unwanted targets, which provides less load on the separation methods, and reducing costs since unwanted information is not collected or analyzed. The methods can also be combined by controlling the enzyme's reactivity and selectivity. The compositions and methods described herein control enzyme activity and specificity by blocking specific targets. As someone experienced in the technique will appreciate, similar principles can also be applied to assays involving DNA, proteins, RNA, or any analyte of interest, or a combination of analytes. The embodiments of the systems and methods provided herein may be used in conjunction with a droplet partitioning system for the isolation of a sample within a droplet. As used herein, the term “partitioning” refers to separating a sample into a plurality of portions, or “partitions.” The partitions may be solid or fluid. In some embodiments, a partition is a solid partition, e.g., a microchannel. In some embodiments, a partition is a fluid partition, e.g., a droplet. In some embodiments, a fluid partition (e.g., a droplet) is a mixture of immiscible fluids (e.g., water and oil) or an emulsion. In some embodiments, a fluid partition (e.g., a droplet) is an aqueous droplet surrounded by an immiscible carrier fluid (e.g., oil).In other modalities, a fluid partition is an aqueous droplet that is physically or chemically separated from adjacent aqueous droplets, such that the contents of one droplet do not diffuse into adjacent droplets. For example, partitioning can be performed using a droplet generator (e.g., BioRad systems, Dolomite Microfluidics systems, Micronit Microfluidics systems, water-in-oil microfluidic devices, 10X Genomics systems, or any other suitable droplet partitioning system) to divide, isolate, and / or separately analyze a nucleic acid of interest. The embodiments of the systems and methods provided herein include kits containing transposition reagents and a first probe complementary to a first brand and a second probe complementary to a second brand, wherein the first and second probes are immobilized on a solid support. In some embodiments, the first and second probes comprise a barcode. In some embodiments, the first and second probes are a polyT probe. In some embodiments, the solid support is an etched surface, a well, an array, a flow cell device, a microfluidic channel, a bead, a magnetic bead, a column, a droplet, or a microparticle. Examples Example 1—Reduction of mitochondrial DNA reads The following example demonstrates a method of reducing mtDNA reads using ATAC-seq. A sample containing nuclear DNA and mtDNA was obtained. The sample was divided into several aliquots, and each aliquot was contacted with Hoechst 33258 dye at various concentrations, including 8 pm, 80 pm, and 800 pm. Subsequently, each aliquot was subjected to transposition and ATAC-seq, and the DNA reads were analyzed. RQ / rnn / i 7n7 / E / YL As shown in Figures 2A–2C, Hoechst dye selectively stained mtDNA, preventing transposition into mtDNA but allowing transposition of nuclear DNA. Table 1 summarizes the resulting reads shown in Figures 2A–2C. Increasing the concentrations of Hoechst dye resulted in decreased mtDNA reads using ATAC-seq. The methods and compositions can be used for bulk ATAC-seq or single-cell ATAC-seq to inhibit, reduce, or eliminate unwanted mtDNA sequence reads. RQ / rnn / i 7n7 / E / YL Table 1 Hoechst concentration (pm) 8 80 800 % mapped to gDNA (nuclear) 68% 89% 100% % mapped to mtDNA 32% 11% 0% In addition to performing transposition and ATAC-seq, the samples were also stained. Samples were stained with DAPI, and staining of mtDNA occurred, but not of actively transcribed regions (ATACs) of nuclear DNA. DAPI stained the DNA, but not in certain locations. RNA is transcribed in locations where DAPI does not stain. Differential staining of mtDNA and not the actively transcribed regions of nuclear DNA effectively inhibited transposition in mtDNA and thus improved the efficiency of ATAC-seq of nuclear DNA without unwanted off-target transposition. Example 2—Efficiency of several DNA-binding molecules The following example demonstrates a mode of mtDNA read reduction using ATAC-seq using various DNA-binding molecules. A sample containing nuclear DNA and mtDNA was obtained. The sample was divided into several aliquots, and each aliquot was contacted with a different dye at various concentrations. Five different dyes were used, including Hoechst (at concentrations of 50 pm, 25 pm, 12 pm, 6 pm, 3 pm, and 0.6 pm), SYBR Gold (at concentrations of 500 pm, 50 pm, 5 pm, 0.5 pm, and 0.1 pm), Sytox Orange (at concentrations of 500 pm, 50 pm, 5 pm, 0.5 pm, and 0.1 pm), PicoGreen (at concentrations of 100 pm, 10 pm, 1 pm, 0.1 pm, and 0.02 pm), and Qubit (at concentrations of 100 pm, 10 pm, 1 pm, 0.1 pm, and 0.02 pm), as shown in Figures 3A–3C. Another aliquot was prepared that was not exposed to any dye. Each aliquot was then subjected to Nextera transposition, and the products were visualized on a gel. Figure 3A shows the gel for Hoechst and SYBR Gold. Figure 3B shows the gel for Sytox Orange and PicoGreen, and Figure 3C shows the gel for Qubit and no dye.High molecular weight DNA products are indicative of inefficient transposition. Inhibition was observed for SYBR Gold and Sytox Orange at concentrations greater than 100 pm. Each aliquot was transposed, and DNA reads were analyzed, as shown in Figures 4 and 5. As shown in Figure 4, Hoechst 33258 did not alter ATAC-seq profiles (nucleosome positioning) and reduced mitochondrial DNA reads (as also shown in Figures 2A–2C). Hoechst allowed for relatively unbiased ATAC-seq profiling without changing nucleosome positioning. Some dyes, such as SYBR Gold, bound to DNA but affected nucleosome location (ATAC-seq) compared to the undyed control. As shown in Figure 5, specific mtDNA blocking increased the specificity of nuclear DNA sequencing.These results demonstrate that intercalated DNA-binding molecules can be used to control the enzyme transposition activity of DNA. This approach can be applied more generally, in which specific stains, or binding molecules, can be delivered to certain targets using well-known affinity tags, including antibody conjugates and DNA hybridization probes, to block unwanted enzyme activity. Alternatively, specific affinity tags (“blockers”) can be used to deliver enzymes to specific targets. Such applications might include blocking off-target activity of CRISPR enzymes. The term “comprising”, as used in this description, is synonymous with “including”, “containing”, or “characterized by”, and is inclusive or open and does not exclude additional unlisted method stages or elements. The foregoing description provides several methods and materials of the present invention. This invention is susceptible to modifications in methods and materials, as well as alterations in manufacturing methods and equipment. Such modifications will become evident to those skilled in the art from consideration of this description or from the practice of the invention described herein. Accordingly, this invention is not intended to be limited to the specific embodiments described herein, but rather to cover all modifications and alternatives that fall within the true scope and spirit of the invention. All references cited in this description, including but not limited to published and unpublished applications, patents, and bibliographic references, are incorporated herein by reference in their entirety and are hereby made part of this specification. To the extent that publications and patents or patent applications incorporated by reference contradict the description contained in this specification, this specification is intended to supersede and / or take precedence over any conflicting material.

Claims

1. A method for sequencing a nucleic acid, comprising: providing a sample comprising a nucleic acid; contacting the sample with a DNA-binding molecule; contacting the sample with an insertional enzyme complex to produce labeled nucleic acid fragments, characterized in that the insertional enzyme complex is inhibited by the DNA-binding molecule; and sequencing the labeled nucleic acid fragments to produce sequence reads.

2. The method of claim 1, characterized in that the sample is a population of cells, a single cell, a population of cell nuclei, or a single cell nucleus.

3. The method of any of claims 1-2, characterized in that the sample comprises primary nucleic acids and secondary nucleic acids, and wherein the DNA-binding molecule is preferentially bound to secondary nucleic acids over primary nucleic acids.

4. The method of claim 3, characterized in that the primary nucleic acids comprise nuclear DNA.

5. The method of claim 3, characterized in that the secondary nucleic acids comprise mitochondrial DNA (mtDNA) or extrachromosomal DNA.

6. The method of any of claims 1-5, characterized in that the DNA-binding molecule comprises a DNA dye, an affinity mark, a ligand, an enzyme, a peptide, or a biomolecule.

7. The method of claim 6, characterized in that the DNA dye comprises Hoechst dye, SYBR Gold, Sytox Orange, Pico Green, or Qubit.

8. The method of any of claims 1-7, characterized in that the insertional enzyme complex is a transposome comprising a transposase.

9. The method of any of claims 1-8, characterized in that the sequencing is performed by means of an assay for transposase accessible chromatin sequencing (ATAC-seq) or by whole genome sequencing.

10. The method of claim 9, characterized in that the ATAC-seq comprises bulk ATAC-seq or single-cell ATAC-seq.

11. The method of any of claims 1-10, characterized in that the method inhibits, reduces, or eliminates secondary sequence reads.

12. A method for inhibiting, reducing, or eliminating secondary sequence reads, comprising: providing a sample comprising primary nucleic acids and secondary nucleic acids; contacting the sample with a DNA-binding molecule that binds preferentially to secondary nucleic acids; and carrying out DNA transposition into open chromatin, characterized in that the secondary nucleic acids are not transposed or are transposed with less efficiency than the primary nucleic acids.

13. The method of claim 12, characterized in that the sample is a population of cells, a single cell, a population of cell nuclei, or a single cell nucleus.

14. The method of any of claims 12-13, characterized in that the DNA-binding molecule comprises a DNA dye, an affinity mark, a ligand, an enzyme, a peptide, or a biomolecule.

15. The method of claim 14, characterized in that the DNA dye comprises Hoechst dye, SYBR Gold, Sytox Orange, Pico Green, or Qubit.

16. The method of any one of claims 12-15, characterized in that the DNA transposition is performed using the assay for transposase accessible chromatin sequencing (ATAC-seq) or whole genome sequencing from gDNA or single cells.

17. The method of claim 16, characterized in that the ATAC-seq comprises bulk ATAC-seq or single-cell ATAC-seq.

18. The method of any of claims 12-17, characterized in that contact of the sample with the DNA-binding molecule blocks or reduces transposition in secondary nucleic acids.

19. The method of any of claims 12-18, characterized in that the primary nucleic acids comprise nuclear DNA.

20. The method of claim 19, further comprising sequencing nuclear DNA.

21. The method of any of claims 12-20, characterized in that the secondary nucleic acids comprise mitochondrial DNA (mtDNA) or extrachromosomal DNA.

22. A nucleic acid library comprising primary sequence reads obtained from DNA sequencing, characterized in that the nucleic acid library does not include, or has a reduced representation of, secondary sequence reads.

23. The nucleic acid library of claim 22, characterized in that the DNA sequencing is an assay for transposase-accessible chromatic sequencing (ATAC-seq) or an assay for whole genome sequencing for gDNA.

24. The nucleic acid library of any of claims 22-23, characterized in that the primary sequence reads are nuclear DNA sequence reads.

25. The nucleic acid library of any of claims 22-25, characterized in that the secondary sequence reads are mitochondrial DNA (mtDNA) sequence reads or extrachromosomal DNA sequence reads.

26. The nucleic acid library of any of claims 22-26, characterized in that the secondary sequence reads are reduced, inhibited, or eliminated due to the DNA-binding molecules preferentially binding to the secondary DNA.

27. The nucleic acid library of claim 26, characterized in that the DNA-binding molecule is capable of binding to a specific nucleic acid sequence to delete, reduce, or inhibit sequence reads or libraries for target nucleic acid regions.

28. The nucleic acid library of claim 26, characterized in that the DNA-binding molecule comprises a DNA dye, an affinity mark, a ligand, an enzyme, a peptide, or a biomolecule. RQ / rnn / i 7n7 / E / YL 29. The nucleic acid library of claim 28, characterized in that the DNA dye comprises Hoechst dye, SYBR Gold, Sytox Orange, Pico Green, or Qubit.

30. The nucleic acid library of any of claims 22-29, characterized in that the nucleic acid library is generated from a cell population, a single cell, a population of cell nuclei, or a single cell nucleus 5.