CONTROLLABLE TRANSCRIPTION
Patent Information
- Application Number
- MX2019006025
- Authority / Receiving Office
- MX · MX
- Patent Type
- Patents
- Current Assignee / Owner
- Priority Date
- 2016-11-24
- Filing Date
- 2019-05-23
- Publication Date
- 2026-05-19
- Estimated Expiration
- 2037-11-24
AI Technical Summary
Current methods for controlling gene expression in human cells, particularly in pluripotent stem cells, face challenges such as random integration leading to variegated expression or silencing of inducible cassettes, posing risks of oncogenic events and limiting the ability to achieve controlled transcription levels.
A method involving targeted insertion of an inducible cassette into specific genomic safe anchor sites (GSHs) using a dual-target system, where a transcriptional regulatory protein is introduced at a first site and the inducible cassette is introduced at a second site, allowing controlled transcription through an inducible promoter regulated by the transcriptional regulatory protein.
This approach reduces the risk of epigenetic silencing, enables homogeneous cell populations with controlled transcription levels, and allows for stable expression of genetic material, facilitating efficient direct programming of pluripotent stem cells into mature cell types.
Abstract
Description
CONTROLLABLE TRANSCRIPTION DESCRIPTIVE MEMORANDUM The present invention relates to a stable method for introducing at least one inducible cassette into a cell and enabling controlled transcription from within that inducible cassette. The method can be used for any cell type from any eukaryotic organism, but it has particular application in the introduction of inducible cassettes into pluripotent stem cells, such as animal or human pluripotent stem cells (hPSCs). The inducible cassette is inserted in a controlled manner, ensuring that the genetic material it contains is not silenced or subjected to adverse influences from the insertion site, and that the transcription of the genetic material is controlled. BACKGROUND OF THE INVENTION Stem cell research holds great promise for investigating human development, regenerative medicine, disease modeling, drug discovery, and cell transplantation. Furthermore, stem cell-derived cells allow researchers to study the physiological and pathological responses of human cell populations that are not readily accessible. This often involves studying genes (and other forms of regulatory mechanisms encoded in non-protein-coding RNAs - nRNAs). Unfortunately, the controllable transcription or expression of genetic information in human cells has proven particularly challenging. Moreover, many key aspects of regenerative medicine, disease modeling, drug discovery, and cell transplantation require the manipulation and fabrication of mature human cell types from readily available sources. Controlling transgene expression in human cells is fundamental to biological research. However, this has proven challenging in human cells. Furthermore, there is a real need for the in vitro derivation of many highly desirable human cell types in sufficient quantity and quality for drug discovery and regenerative medicine. Because targeted differentiation of stem cells into desired cell types is often challenging, other approaches have emerged, including the direct reprogramming of cells into the desired cell types.In particular, direct reprogramming, as a method for directly converting pluripotent stem cells, including hPSCs, into mature cell types, has been recognized as a powerful strategy for human cell derivation. This reprogramming involves the QPCQ ) n / RI Π7 / 3 / YILI forced expression of key lineage transcription factors (or non-coding RNAs, including incRNA and microRNAs) to convert the stem cell into a particular type of mature cell. Also in this context, the controllable expression of genetic information in human cells has been challenging. Currently available direct programming protocols rely heavily on lentiviral cell transduction, resulting in variegated expression or complete silencing of randomly inserted inducible cassettes. This necessitates additional purification steps to isolate a subpopulation expressing the required transcription factors. Thus, further refinements of these methods are clearly required. Aside from the inducible expression of transgenes, it is highly desirable to be able to control the reduction of gene expression and the silencing of genes or other coding sequences in cells, to enable loss-of-function studies. Loss-of-function studies in stem cells and mature cell types provide a unique opportunity to study the mechanisms that regulate human development, disease, and physiology. However, current techniques do not allow for the easy and efficient manipulation of gene expression. Current techniques for introducing material such as inducible short hairpin RNAs (shRNAs) into stem cells to activate the reduction of gene expression suffer from many of the drawbacks seen with the direct reprogramming discussed earlier, such as transgene silencing and position effects that limit activity.Thus, there is a need for inducible gene deactivation and reduction of gene expression in genes in stem cells that allow studies of loss of function in stem cells. Any refinements to the above methods must ensure stable transcription of the genetic material contained within the inducible cassette, such as a transgene, that is resistant to silencing and other negative influences related to the integration site. Silencing can be induced by multiple epigenetic mechanisms, including DNA methylation or histone modifications. With the methods of the previous technique based on lentiviral transduction, the resulting cells are a heterologous population with the transgene fully, partially, or silenced. Clearly, this is undesirable for many applications. Viral vectors exhibit a tendency to integrate their genetic material into transcriptionally active regions of the genome, thereby increasing the potential for oncogenic events due to insertional mutagenesis. For many applications, it is desirable to control the transcription of genetic material inserted into a cell, so that an inducible cassette can be switched on as needed and transcribed at specific levels, including high levels. This cannot be achieved if the insertion of the inducible cassette is random in the genome. The inventors have thus developed a method to allow the stable introduction of an inducible cassette into a cell's genome, while being able to control the transcription of that cassette. This has benefits in any cell type where it is desired to introduce an inducible cassette and control the transcription of the inserted genetic material, particularly in pluripotent stem cells. The inducible cassette can contain any transcription-capable genetic material, for example, a transgene or a non-coding RNA (ncRNA). The material included within the inducible cassette will be determined by the desired effects on the stem cell, including transgene expression, reduction of gene expression, or gene inactivation. BRIEF DESCRIPTION OF THE INVENTION The inventors have found that it is possible to insert an inducible cassette and control the transcription of the genetic material within that cassette using a dual-target system for secure genomic anchoring. This method is highly desirable because it reduces the risk of epigenetic silencing of the inserted genetic material and allows for the creation of a homogeneous population of cells that transcribe the inducible cassette. The present invention relates to a method for controlling the transcription of a genetic sequence in a cell, comprising the following steps: a) the targeted insertion of a gene encoding a transcriptional regulatory protein into a first genetic secure anchoring site; and b) targeted insertion of an inducible cassette into a second genetic secure anchoring site, wherein said inducible cassette comprises said genetic sequence operatively linked to an inducible promoter and said promoter is regulated by the transcriptional regulatory protein; where the first and second genetic secure anchoring sites are different. Integration of the inducible cassette specifically into genomic secure anchoring sites (GSHs) is preferred over random insertion into the genome. GSHs have been previously defined as intragenic or extragenic regions of the human genome that are capable of accommodating the predictable expression of newly integrated DNA without adverse effects on the host cell or organism. A useful secure anchor should allow sufficient transcription of the inserted genetic sequence to produce desired levels of the protein (via further translation) or non-coding RNA. Also, a GSH should not predispose cells to malignant transformation or alter cellular functions (Sadelain et al., 2012, Nature Reviews Cancer, 12(1), 51-8. doi:10.1038 / nrc3179). The first genetic secure anchoring site is used to introduce a gene that QPCQ 1 n / RI Π7 / Ί / YILI encodes at least one transcriptional regulatory protein. A transcriptional regulatory protein (or transcription factor) increases the gene transcription of a gene. Most transcriptional regulators are DNA-binding proteins that bind to enhancers or proximal promoter elements operatively attached to the gene. In some respects, the transcriptional regulatory protein is constitutively expressed and is permanently expressed in a cell. The transcriptional regulatory protein can thus be operatively bound to a constitutive promoter. Constitutive promoters direct gene expression uniformly in most tissues and cells at all stages of growth and development. Constitutive promoters confer high levels of gene expression when used in the methods of the present invention. Additional genetic material, including genes, can be inserted into the first GSH molecule containing the transcriptional regulatory protein. These genes may include one or more markers, such as green fluorescent protein (GFP), which can be used to show, for example, that the transcriptional regulatory protein has been successfully inserted. Other options include genes that allow gene editing, such as Cas9 and derivatives or CasL and derivatives, and reporter sequences that can be used to test for endogenous or exogenous expression of specific genes in the cell. The second GSH molecule is used to introduce an inducible cassette in which the desired genetic sequence is operatively linked to an inducible promoter. This promoter allows transcription only when properly induced by the transcriptional regulatory protein. The transcriptional regulatory protein can be controlled by a substance delivered exogenously to the cell. Thus, the presence of the exogenous substance can either permit or block the expression of the inducible promoter. An example of such controllable expression is the Tet-ON system, which is further described herein. Additional inducible cassettes can be inserted into additional GSHs; these GSHs are different from the first and second GSHs mentioned above. One or more genetic sequences can be transcribed in a controlled manner from within the second and / or additional GSH cassette. In fact, the inducible cassette can contain 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 genetic sequences that are to be inserted into the GSH cassette and whose transcription is to be induced in a controlled manner. The genetic sequence(s) to be inserted into the GSH(s) are present within the inducible cassette, operatively linked to an inducible promoter. These genetic sequences can be any suitable sequences capable of being transcribed into RNA once promoter activity has been induced. Suitable genetic sequences include, but are not limited to, transgenes (protein-coding genes in which the QPCQ 7 n / A Lnz / q / YILI RNA produced is messenger RNA (mRNA) translated into a polypeptide), non-coding RNA (ncRNA - including but not limited to shRNA, antisense RNA (sRNA), guide RNA (gRNA), microRNA (miRNA), small interfering RNA (siRNA), trans-acting RNA (siRNA), antagomires, aptamers, miRNA sponges, and any other functional RNA). Inducible cassettes may include additional genetic material to be inserted into the second or additional GSH. This additional genetic material may include one or more markers, such as green fluorescent protein (GFP), to indicate that transcription is occurring. Alternatively, or additionally, genes such as antibiotic or drug resistance genes may allow for the selection of successfully inserted inducible cassettes. Furthermore, it may be desirable to inducibly express a particular gene to study its function or sequences that interfere with its function. Similarly, it may be desirable to express genes to enhance or inhibit the biological functions of the cell or to influence cells elsewhere in the body, including the expression of growth factors, peptide hormones (including insulin), and so on. Technically, insertions into the first and / or second GSH can occur on one chromosome or on both chromosomes. GSH exists at the same genetic loci on both chromosomes of diploid organisms. Insertion within both chromosomes is advantageous because it can allow for an increased level of transcription of the inserted genetic material within the inducible cassette, thus achieving particularly high levels of transcription. GSH insertions can be controlled. Controlled, targeted insertion of genetic material into a specific GSH can be achieved by generating a specific, customized double-strand break (DSB) within the GSH. The genetic material can then be introduced using any suitable mechanism, such as homologous recombination. Any method for creating a genome-specific DSB can be used, but preferred systems include CRISPR / Cas9 and modified versions thereof, ZFNs, and the TALEN system. Furthermore, the insertion of the transcriptional regulator and / or inducible cassette can be designed to be reversible, and the inserted genetic material can be removed and / or replaced with an alternative transcriptional regulator / inducible cassette as appropriate. Methods for replacing the transcriptional regulator and / or inducible cassette are part of the invention. Such replacement can be useful when a cell culture has been successfully modified with a transcriptional regulator and / or inducible cassette, and it is desirable to replace the transcriptional regulator and / or inducible cassette. This takes advantage of the already successful insertion and may allow for larger insertions to be made. To realize this aspect of the invention, the insertions can include dissociable sequences to allow the removal of all or part of the insertion. QPCQ 1 n / RI Π7 / Ί / YΙΛΙ GSH, such as a portion of the insertion. Preferred methods of removal or replacement include recombinant approaches. Furthermore, the invention relates to suitable vectors for the insertion of the transcriptional regulator and / or inducible cassette into the GSH. In one aspect, the present invention provides a method for controlling the expression of a transgene in a cell, comprising the following steps: a) the targeted insertion of a gene encoding a transcriptional regulatory protein into a first genetic secure anchoring site; and b) the targeted insertion of a transgene operatively linked to an inducible promoter into a second genetic secure anchoring site, wherein said inducible promoter is regulated by the transcriptional regulatory protein; where the first and second genetic secure anchoring sites are different. In this aspect of the invention, the previously described inducible cassette comprises a transgene operatively linked to an inducible promoter. In this aspect of the invention, the desired genetic sequence included within the inducible cassette is a transgene, preferably a protein-coding gene. Thus, the transcription and translation (expression) of the transgene can be controlled within the cell. The advantage of the present method is that it allows for the overexpression of the transgene, if required. Furthermore, in this aspect of the invention, an additional identical or different transgene can be inserted into an additional GSH, which is different from the first and second GSH. That transgene is operatively linked to an inducible promoter as described above. In one aspect, the present invention provides a method for controlling the transcription of a non-coding RNA in a cell, comprising the following steps: a) the targeted insertion of a gene encoding a transcriptional regulatory protein into a first genetic secure anchoring site; and b) the targeted insertion of an inducible cassette into a second genetic secure anchoring site, wherein said inducible cassette comprises DNA encoding a non-coding RNA sequence operatively bound to an inducible promoter and said promoter is regulated by the transcriptional regulatory protein; where the first and second genetic secure anchoring sites are different. Furthermore, in this aspect of the invention, an additional identical or different inducible cassette can be inserted into an additional GSH, which is different from the first and second GSH. This inducible cassette may comprise DNA encoding a non-coding RNA sequence or any other genetic sequence operatively linked to an inducible promoter, and said promoter is regulated by the transcriptional regulatory protein. QPCQ 7 n / A Lnz / q / YILI More specifically, this method allows for the reduction of gene expression of an endogenous gene in the cell. Thus, the present invention provides a method for reducing the transcription and / or translation of an endogenous gene in a cell, comprising the following steps: a) the targeted insertion of a gene encoding a transcriptional regulatory protein into a first genetic secure anchoring site; and b) the targeted insertion of an inducible cassette into a second genetic secure anchoring site, wherein said inducible cassette comprises DNA encoding a non-coding RNA sequence operatively linked to an inducible promoter and said promoter is regulated by the transcriptional regulatory protein and wherein said non-coding RNA sequence suppresses the transcription or translation of an endogenous gene; where the first and second genetic secure anchoring sites are different. Furthermore, in this aspect of the invention, an additional identical or different inducible cassette can be inserted into an additional GSH, which is different from the first and second GSH. This inducible cassette may comprise DNA encoding a non-coding RNA sequence or any other genetic sequence operatively linked to an inducible promoter, and said promoter is regulated by the transcriptional regulatory protein. In any aspect or modality, the endogenous gene can encode a protein or a non-coding RNA. In the two preceding aspects of the invention, the inducible cassette(s) comprise DNA encoding a non-coding RNA, i.e., an RNA that is functional but not translated into protein. This non-coding RNA can be any suitable RNA, such as those discussed previously, but is preferably short hairpin RNA (shRNA). In the last aspect of the invention, the non-coding RNA can effect the reduction of gene expression in any suitable manner, by blocking transcription or translation of the gene or by preventing expression altogether. Ultimately, the expression of said gene is reduced or blocked, but the gene itself remains intact. Alternatively, the non-coding RNAs comprising the inducible cassette sequence may include RNAs that can be used for gene inactivation of an endogenous gene in a cell, notably to replace or disrupt the gene itself. Suitable non-coding RNAs that could be used for this aspect of the invention include elements of the CRISPR / Cas9 platform, more particularly guide RNAs (gRNAs) that are directed to target the endogenous gene. Thus, in one aspect, the present invention provides a method for the gene deactivation of an endogenous gene in a cell, comprising the following steps: QPCQ 1 n / RI Π7 / 3 / YILI a) the targeted insertion of a gene encoding a transcriptional regulatory protein and a gene encoding Cas9 or a derivative thereof into a first genetic secure anchoring site; and b) the targeted insertion of an inducible cassette into a second genetic secure anchoring site, wherein said inducible cassette comprises a guide RNA operatively linked to an inducible promoter and said promoter is regulated by the transcriptional regulatory protein and wherein said gRNA sequence is targeted to the endogenous gene; where the first and second genetic secure anchoring sites are different. Furthermore, in this aspect of the invention, an additional identical or different inducible cassette can be inserted into an additional GSH, which is different from the first and second GSH. This inducible cassette can comprise any genetic sequence operatively linked to an inducible promoter, and this promoter is regulated by the transcriptional regulatory protein. Thus, in the previous aspect of the invention, the transcription of the gRNA is induced in a controlled manner. In a further aspect, the present invention provides a method for reducing the transcription and / or translation of an endogenous gene in a cell, comprising the following steps: a) the targeted insertion of a gene encoding a transcriptional regulatory protein into a first allele of a genetic secure anchoring site; and b) the targeted insertion of an inducible cassette into a second allele of the same genetic secure anchoring site, wherein said inducible cassette comprises DNA encoding a non-coding RNA sequence operatively bound to an inducible promoter and said promoter is regulated by the transcriptional regulatory protein and wherein said non-coding RNA sequence suppresses transcription or translation of an endogenous gene. Furthermore, the present invention provides a method for the gene deactivation of an endogenous gene in a cell, comprising the following steps: a) the targeted insertion of a gene encoding a transcriptional regulatory protein and a gene encoding Cas9 or a derivative thereof into a first allele of a genetic secure anchoring site; and b) the targeted insertion of an inducible cassette into a second allele of the same genetic secure anchoring site, wherein said inducible cassette comprises a guide RNA operatively bound to an inducible promoter and said promoter is regulated by the transcriptional regulatory protein and wherein said gRNA sequence is targeted to the endogenous gene. These gene deactivations or one-step gene expression reductions are novel and may form part of the invention. orc 1 n / RI Π7 / Ί / YΙΛΙ In one aspect, the present invention provides a method for the direct programming of pluripotent stem cells, comprising the steps of: a) the targeted insertion of a gene encoding a transcriptional regulatory protein into a first genetic secure anchoring site; and b) the targeted insertion of an inducible cassette into a second genetic secure anchoring site, wherein said inducible cassette comprises a genetic sequence encoding a lineage-key transcription factor operatively bound to an inducible promoter, said inducible promoter being regulated by the transcriptional regulatory protein; and wherein said first and second genetic secure anchoring sites are different. Additional inducible cassette(s) can be inserted into additional GSHs other than the first and second GSH. Direct programming of pluripotent stem cells into specific mature cell types is highly desirable and can be achieved using the dual-targeting platform of the present invention. Specific methods for certain cell types are described below. In one aspect, the present invention provides a method for the production of myocytes from pluripotent stem cells, comprising the steps of: a) the targeted insertion of a gene encoding a transcriptional regulatory protein into a first genetic secure anchoring site; and b) the targeted insertion of the MYOD1 gene operatively linked to an inducible promoter at a second genetic secure anchoring site, wherein said inducible promoter is regulated by the transcriptional regulatory protein; wherein said first and second genetic secure anchoring sites are different, and culturing said cells in the presence of retinoic acid. The MY0D1 gene encodes the Myogenic Differentiation 1 protein. Preferably, retinoic acid (RA) is all trans RA. In another aspect, the present invention provides a method for the production of myocytes from pluripotent stem cells expressing MYOD1, comprising culturing said cells in the presence of retinoic acid. Preferably, the AR is all trans AR. Preferably, the cells overexpress MYOD1. In a further aspect, the present invention provides a method for the production of oligodendrocytes from pluripotent stem cells, comprising the steps of: a) the targeted insertion of a gene encoding a transcriptional regulatory protein into a first genetic secure anchoring site; and QPCQ ! n / RI Π7 / 3 / YILI b) the targeted insertion of any combination of the genes SOX 10, OLIG2, NKX2.2, and NKX6.2 operatively linked to an inducible promoter into a second gene secure anchor site, wherein said inducible promoter is regulated by the transcriptional regulatory protein; wherein said first and second gene secure anchor sites are different, The genes SOX-IO, OLIG2, NKX2.2, and NKX6.2 encode the transcription factors SOX10, OLIG2, NKX2.2, and NKX6.2, respectively. BRIEF DESCRIPTION OF THE FIGURES Figures 1A to 1ID show the validation of an optimized, secure-genomic-anchored, double-targeted overexpression system. Figure 1A shows the design of the gene targeting vectors for the hROSA26 and AAVS1 loci. HAR: homology arm; SA: splice acceptor; 724: ribosomal skipping signal; Neo: neomycin resistance gene; Puro: puromycin resistance gene; pA: polyadenylation signal; CAG: constitutively active CAG promoter; rtTA: third-generation rtTA; TRE: Tet-sensitive element; EGFP: enhanced green fluorescent protein. Figure 1B shows EGFP induction and rescue kinetics (Figure 1C) in EGFP expressing hESCs detected by flow cytometry (median fluorescence intensity, MFI). Results are from two biological replicates per time point and are expressed as mean ± SEM. All values were normalized to the maximum fluorescence intensity after 5 days of doxycycline (referred to as day 0 in the figure).Figure 1D shows the dose-response of doxycycline for EGFP overexpression in EGFP-expressing hESCs after 5 days of doxycycline induction. Results are from two biological replicates per condition and are expressed as mean ± SEM. All values were normalized to the maximum fluorescence intensity measured in the experiment. EGFP expression levels in constitutive GSH-directed CAG-EGFP hPSCs and inducible GSH-directed TRE-EGFP hPSCs after doxycycline induction. Wild-type hPSCs and non-induced TRE-EGFP cells were included as negative controls. Figures 2A to 2D provide an overview of the experimental approach and results for the rapid single-step conversion of hPSCs into neuronal cells (α-neurons) following doxycycline (dox) treatment. Figure 2A is a schematic representation of this conversion, in which cells transformed according to the invention with NGN2 are induced to differentiate into neuronal cells after dox treatment. Figure 2B demonstrates the time course of the direct programming of α-neuron generation from hPSCs, documented by quantitative RT-PCR analysis, which reveals the temporal expression pattern of pan-neuronal (MAP2, SYP), forebrain (BRN2, FOXG1), and neuronal glutamatergic (VGLUT2, GRIA4) marker genes. The cells were analyzed on the specified days of doxycycline treatment. Values are shown with respect to the endogenous maintenance gene PBGD and were normalized to pluripotency conditions.The results are from three biological replicates per time point and are expressed as mean ± SEM. Figure 2C shows the quantification of β31-tubulin-positive neuronal cells (TUBB3) by immunostaining in hESC-derived α-neurons after one week of induction. Undifferentiated cells were used as a negative control (Control), and the numbers are reported for α-neuron generation in newly isolated hESC-expressing NGN2 cells and after 25 passes (+P25). Figure 2D shows cell images representing the time course of direct programming of α-neuron generation from hESCs via serial phase-contrast imaging, illustrating morphological changes. Figures 3A to 3D illustrate the direct programming of hPSCs into skeletal myocytes. Figure 3A shows a schematic of the rapid, single-step conversion of hPSCs into skeletal myocytes by inducible overexpression of MYOD1 and treatment with retinoic acid. Figure 3B shows quantitative RT-PCR analysis of the temporal expression pattern of myocyte marker genes during i-myocyte generation from hPSCs. All values are shown relative to hPSCs. Results are from three biological replicates per time point and are expressed as mean ± SEM. Figures 3C and 3D show the quantification of MHC-positive cells by flow cytometry ten days after induction, demonstrating that OPTi-MYOD1 hPSCs retain their myogenic potency even after extended culture periods and periods (p) following targeted integration of the MYOD1 system.Undifferentiated cells were used as a negative control (Control), and figures are reported for i-Myocyte generation in freshly isolated OPTi-MYODl hESCs, or in the same cells after 50 passes (+P50). Figures 4A to 4F illustrate the targeting strategy for the dual GSH target Tet-ON overexpression system. Figure 4A depicts the experimental workflow for sequential targeting of the hROSA26 and AAVS1 sites on hPSCs. Key: Cas9n: S. pyogenes D10A nickase mutant Cas9 endonuclease; ZFN: zinc finger nuclease; Neo: neomycin; Puro: puromycin; rtTA: third-generation reverse tetracycline transactivator. This represents an inducible EGFP (i-EGFP) expression system. Figure 4B represents a schematic of the hROSA26 targeting strategy. Figure 4C represents the AAVS1 targeting strategy. The key to figures 4B and 4C: R26-prom: ROSA26 site promoter (THUMPD3-AS1 gene); AAV-prom: AAVS1 site promoter (PPP1R12C gene); ZFN: zinc finger nucleases; 5'-HAR / 3'-HAR: homology arm in the 5' / 3' direction.SA: splice acceptor; T2A: T2A peptide; pA: polyadenylation signal; CAG: CMV early enhancer, a hybrid promoter of chicken β-actin and rabbit β-globin; TRE: Tet-sensitive element; EGFP: enhanced green fluorescent protein. Figure 4D represents the schematic of the strategy. QPCQ 7 n / A Lnz / q / YILI genotyping used to identify hPSC lines targeting hROSA26 and AAVS1 correctly; GSH-prom: GSH promoter (hROSA26 and AAVS1, respectively); WT: wild type; inducible cassette: complete exogenous sequence integrated after targeting. Place PCR: PCR expanded the target site with both primers binding exclusively to genomic DNA outside the genomic sequence corresponding to the homology arms. Note that due to its high GC content, the CAG promoter cannot be amplified by routine PCR. Therefore, correct insertion of the expression cassette containing CAG results in the loss of a PCR amplicon. The presence of a wild-type band indicates the presence of untargeted alleles; the loss of the wild-type band indicates homozygous targeting. 5'-INT / 3'-INT: PCRs: The PCRs expanded the 5'- and 3'- insertion sites, respectively.Properly sized PCR amplicons indicate successful integration. 3'BB PCR: The PCR expanded the homology arm / main structure junction of the targeting vector. The presence of a PCR product indicates nonspecific integration outside the donor plasmid target. Figure 4E is a gel photograph showing the genotyping results for heterozygous (HET) and homozygous (HOM) H9 hESCs targeting selected hROSA26-CAG-rtTA. Figure 4F is a gel photograph showing the genotyping results for heterozygous (HET) and homozygous (HOM) H9 hESCs targeting selected AAVS1-TRE-EGFP. lkb+: 1kb plus DNA ladder; WT: wild-type hESCs; PL: targeting plasmid; H2O: water control. Figures 5A to 5E illustrate the development of an optimized inducible overexpression platform (OPTi-OX) based on double GSH targeting of hPSCs. Figure 5A shows inducible H9 EGFP hESCs targeted for double GSH grouped into four experimental clusters depending on whether one or both alleles at the hROSA26 and AAVS1 loci, respectively, were successfully targeted. Figure 5B shows the detection of the rtTA protein by Western blot in successfully targeted heterozygous and homozygous H9 hROSA26-CAG-rtTA hESCs. Human ESCs carrying a second-generation rtTA at a random genomic position were included as a control sample; α-tubulin: charge control. Figure 5C represents flow cytometry analysis of representative examples of the various inducible EGFP hESCs targeted for double GSH (Figure 5A).Figure 5D shows the median fluorescence intensity (MFI) of EGFP expression in the various GSH-directed, inducible EGFP hESCs described in Figure 5A. Cells were analyzed by flow cytometry under control conditions (no doxycycline, CTR) or after 5 days of doxycycline (DOX) treatment. Each data point represents an individual clonal line. CAG-EGFP hESCs and wild-type (WT) hESCs were included for comparison. Statistical analysis of the doxycycline-treated groups (n=4–5, as indicated) showed that EGFP expression levels were highest in clones. QPCQ 1 Π / RI Π7 / 3 / YILI of double homozygotes (one-way ANOVA with Dunnett post-hoc test; F (2, 10) = 25.34, p=0.0001; **** p<0.0001; ** p=0.0026). This condition was selected for further experiments. Figure 5E shows the percentage of EGFP+ cells in the various double GSH i-EGFP-directed hESCs described in Figure 5(A). Figures 6A to 6D characterize the OPTi-OX platform in hPSCs and during germ layer differentiation. Figure 6A shows the flow cytometry analysis of EGFP levels in live hPSCs successfully targeted and after differentiation in all three germ layers following five days of doxycycline treatment. Acquisition settings were established to include high levels of induced EGFP expression (DOX). Non-induced control (CTR) populations are located directly to the left of the axis. Figures 6B and 6C summarize the flow cytometry plots in Figure 6A, including median fluorescence intensity (MFI) and the percentage of EGFP+ cells.Figure 6D shows a bar chart of the quantitative RT-PCR results of EGFP mRNA expression levels from homozygous pluripotent stem cells and after differentiation into the three germ layers. WT: wild type; Figure 7 is the characterization of human α-neurons. The quantitative RT-PCR results demonstrate a rapid downregulation of the pluripotency factors NANOG and OCT4 with doxycycline treatment. Figure 8 shows AR signaling during myocyte induction. This figure displays qPCR analysis of the six retinoids and retinoid receptors during myocyte induction, demonstrating the expression of RARa, RARP, and all three RXR isoforms, but not RARy, throughout the entire course of i-myocyte induction. A is α, B is β, and G is y. Figures 9A to 9C characterize the development of OPTi-MYODl hESCs in human i-myocytes. Figure 9A shows the time course of direct programming of OPTi-MYODl hESCs in induced myocytes. Morphological changes were documented with automated phase-contrast images acquired every 30 minutes using a Nikon BioStation IM time-step system. Scale bars: 200pm. Figure 9B presents qPCR results demonstrating the rapid downregulation of the pluripotency factors NANOG and OCT4 with doxycycline treatment of OPTi-NGN2 hESCs (left graph). The five major human skeletal myocyte-specific heavy chain isoforms (encoded by the MYH gene family) are strongly upregulated during direct myocyte programming (right graph).These include the two isoforms that are expressed during embryonic and postnatal muscle development (embryonic isoform MYH3; neonatal isoform MYH8) and three isoforms that are normally expressed in adult human skeletal muscle [MYH7 in slow-twisting (type I) fibers; MYH2 in fast-twisting fatigue-resistant (type Ha) fibers; and MYH1 in fatigue fibers. QPCQ ! n / RI η7 / Ί / YILI rapid (type IIx)]. In contrast, MYH4, which represents the constituent MHC isoform in rapidly twisting, rapidly fatigued myocyte fibers in cats, is not expressed in significant amounts in humans (<1%) and is not induced throughout the time course of direct programming. Figure 9C depicts that induced skeletal myocytes express a wide range of typical marker proteins, including F-Actin (visualized via AlexaFluor488-conjugated Phalloidin toxin), Neural Cell Adhesion Molecule (NCAM), Desmin (DES), Myosin Heavy Chain (MYH), Titin (TTN), α-Actinin (ACTN2), and Troponin T (TNNT), but not the myoblast progenitor markers PAX3 and PAX7. All samples were counterstained with myogenin (MYOG). Scale bars: 50pm. DAPI: nuclear staining. Figure 10 shows three graphs representing the qPCR results for total MYOD1, endogenous MYOD1, and MYOG 2 days post-induction of OPTi-MYOD1 hPSCs with different doxycycline concentrations. The qPCR results are shown 48 h post-induction with different doxycycline concentrations. Expression is plotted against the endogenous maintenance gene PBGD. Figure 11 is a representation of the Tet-ON system. Tet-ON consists of two components: The activator cassette, shown at the top, contains a constitutive promoter (cP) that drives the expression of rtTA (Reverse Tetracycline Trans-Activator). rtTA is a fusion protein consisting of a mutant form of the prokaryotic Tet repressor (TetR) and the transcriptional trans-activator domain VP16 (derived from the herpes simplex virus). The responder domain, shown in the background, consists of an inducible promoter (TRE, Tet-Sensitive Element) and the gene of interest. The TRE is an artificial promoter sensitive to rtTA. It comprises seven tet operons in series (tetO7) and a minimal strong CMV promoter (mCMV), which is not active on its own and only recruits the transcriptional machinery upon the binding of rtTA to the seven tet operons.Doxycycline, a tetracycline derivative, is required for the binding of the mutant TetR to the TRE, leading to the expression of the inducible cassette, in this case EGFP. (pA: polyadenylation signal). Figures 12A to 12D illustrate the direct programming of hPSCs into oligodendrocytes. Figure 12A depicts a schematic of the experimental approach for the rapid conversion of OPTI-OLIG2-SOX10 hPSCs into oligodendrocyte lineage cells (i-OPCs and i-OLs). Figure 12B shows the quantification of BrdU-positive cells after three serial passes every four days and concomitant BrdU pulses, each lasting four days (P = pass number). Figure 12C shows the quantitative RT-PCR analysis of the temporal expression pattern of genes encoding myelin-associated proteins (CNP, MAG, MBP, MOG, and PLP) during the generation of i-OLs from hPSCs. OPTI-OLIG2-SOX10 hPSCs were induced in supplemental oligodendrocyte medium with PDGFaa and FGF2. After one week of induction, the mitogens were removed to allow terminal differentiation. All values are shown with QPCQ 7 n / A Lnz / q / YILI with respect to the endogenous maintenance gene PBGD were normalized to pluripotency conditions. Results are from 2 to 3 biological replicates per time point and are expressed as mean ± SEM. Figure 12D shows the quantification of CNP- and PLP-positive cells by immunostaining in i-oligodendrocytes derived from OPTI-OLIG2-SOX10 hPSCs after 20 days of induction. Undifferentiated cells were used as a negative control, and figures are reported for i-oligodendrocytes in freshly isolated OPTI-NGN2 hPSCs and after 50 passes (+P50). Figure 13 is a schematic representation of the principles of the present invention. Essentially, it depicts insertion into two different genetic secure anchoring sites at the core of the present invention. One insertion controls the expression of the genetic sequence within the inducible cassette at a second insertion. Additional genetic material can be included in polycistronic vector constructs as shown. Furthermore, more than two genetic secure anchoring sites can be targeted, so that multiple inducible cassettes or other genetic material can be placed under the control of the modulator positioned at the first GSH site. Figures 14A to 14F are representations of the results showing the development of an inducible gene expression reduction system based on double GSH targeting of hSPCs. Figure 14A shows the experimental setup: H1-H1 promoter, TO tet operon, tetR-tetracycline repressor. Figure 14B is a schematic of the transgenic alleles generated to obtain hESCs expressing an EGFP reporter transgene that could be silenced using an inducible EGFP shRNA. Figure 14C shows EGFP expression in the absence or presence of tetracycline for 5 days in hESCs targeted with the indicated combinations of inducible EGFP shRNA and tetR (STD = standard wild-type, OPT = optimized codon). Doubly targeted hESCs that did not carry the EGFP shRNA were used as negative controls. ns=p>0.05 (not significant), **=p>0.01, ***=p>0.001 VS same tetR line without tet and without RNAsh.Figure 14D is a representative Western blot for tetR in ROSA26-directed hESCs expressing STD or OPT tetR. HET = heterozygote targeting, HOM = homozygote targeting. hESCs with random integration of STD tetR are shown as a positive reference, while WT h9 hESCs are negative controls. TUB4A4A is a loading control. Various amounts of protein were loaded to facilitate quantitative comparison. Figure 14E: EGFP reduction of gene expression and rescue kinetics in OPTiKD EGFP hESCs measured by flow cytometry (MFI) and qPCR (mRNA). Results are from two independent cultures per time point. Figure 14F: Tetracycline dose-response curve for EGFP gene expression reduction in OPTiKD EGFP hESCs. The mean maximum inhibitory concentration (IC50) is reported. Results are from 2 independent cultures per dose, and the mean is shown. Figures 15A, 15B, and 15C validate the ROSA26 and AAVS1 orc1 n / RI Π7 / 3 / YILI sites as bona fide GSH. Figure 15A illustrates the experimental approach behind the generation of GSH EGFP reporter hPSCs to test GSH expression during differentiation. Neurons, oligodendrocytes, and astrocytes were obtained in bulk cultures containing a mixture of these cell lineages, while all other cell types were generated individually. Figure 15B is a schematic of the transgenic EGFP reporter alleles of ROSA26 and AAVS1. R26-prom: ROSA26 site promoter; AAV-prom: AAVS1 site promoter; 5'-HAR / 3'-HAR: homology arm in the 5' / 3' direction. SA: splice acceptor; T2A: self-dissociating T2A peptide; Neo: neomycin resistance; Puro: puromycin resistance; pA: polyadenylation signal; CAG: CAG promoter; EGFP: enhanced green fluorescent protein.Figure 15C: EGFP expression in the absence or presence of tetracycline for 5 days in target hESCs with the indicated combinations of inducible EGFP shRNA and tetR (standard wild-type tetR, STDtetR, or optimized codon tetR, OPTtetR). Doubly targeted hESCs not carrying EGFP shRNA were used as negative controls. Results are for 2 to 3 individual lines per condition (Table 1). ns=p>0.05 (not significant), **=p<0.01,***=p<0.001 vs. same tetR line without tet and without shRNA (ANOVA with post-hoc Holm-Sidak comparisons). Figures 16A to 16D are a generation of EGFP reporter hESCs from ROSA26 and AAVS1. Figure 16A: Schematic of the ROSA26 targeting approach and genotyping strategies used to identify correctly targeted lines. Cas9n: Mutant Cas9 endonuclease of D10A nickase from S. pyogenes.R26-prom: Promoter site of ROSA26 (THUMPD3-AS1 gene); 5'-HAR / 3'-HAR: Homology arm in the 5' / 3' direction; transgene: Integrated region after gene targeting; Place PCR: PCR product of the wild-type ROSA26 site (indicating a non-target allele); Place PCR / Allele Loss: PCR product of the target allele / fail PCR if the transgene contains the GC-rich CAG promoter (indicative of the expected transgene targeting); 5' INT / 3' INT PCR: PCR product of the 5' / 3' end integration region of the transgene (indicative of the expected transgene targeting); 5' BB / 3' BB PCR: PCR product of the 5' / 3' end vector backbone (indicative of non-target plasmid integration). Appreciate that a similar targeting and genotyping strategies were applied for targeting the AAVS1 site.Figure 16B: Schematic of the transgenic ROSA26 alleles generated to test the best strategy for constitutive EGFP (enhanced green fluorescent protein) expression. ENDO-EGFP: EGFP driven by the endogenous ROSA26 promoter (R26-prom; targeting vector pR26-Puro_ENDO-EGFP); EFla-EGFP: EGFP driven by the elongation factor la promoter (targeting vector pR26-Neo_EFla-EGFP); CAG-EGFP: EGFP driven by the CAG promoter (targeting vector pR26-Neo_CAG-EGFP); SA: acceptor. QPCQ 1 Π / RI Π7 / 3 / YILI splicing; Puro: puromycin resistance (puromycin N-acetyltransferase); Neo: neomycin resistance (neomycin phosphotransferase II); pA: polyadenylation signal. Figure 16C: Flow cytometry quantification of the percentage of EGFP-positive cells (EGFP+; gate shown), and of the median EGFP fluorescence intensity (MFI) in representative ROSA26-EGFP reporter hESC clonal lines, or wild-type H9 hESCs. Figure 16D: Percentage of EGFP-positive cells in ROSA26-EGFP reporter hESCs. Results are for 3 clones with ROSA26 heterozygous targeting by condition. Figure 17 is a validation of the optimized inducible gene expression reduction platforms after hPSC differentiation. The graph shows EGFP expression measured by qPCR in the absence (CTR) or presence of tetracycline for 5 days (TET) in the indicated cell types derived from EGFP OPTiKD (kD) and sOPTiKD (siKD) hESCs. EGFP levels are reported relative to control conditions in the same line for each individual lineage. Abbreviations indicate the lineages described in Figure 15 (pluri: undifferentiated). Results are from two independent cultures per condition. Figures 18A to 18D illustrate the development of an inducible CRISPR / Cas9 platform optimized for hPSCs. Figure 18A shows the experimental approach for generating inducible gene-knockout (KO) hPSCs. Figure 18B represents a schematic of the cloning procedure for generating AAVS1 targeting vectors with an inducible gRNA cassette. Figure 18C shows the transgenic alleles generated to obtain hESCs expressing an EGFPd2 reporter transgene that could be gene-knocked out by CRISPR / Cas9 using an inducible EGFP gRNA (sOPTiKO EGFP hESCs). Bsd: blasticidin resistance; EGFPd2: destabilized EGFP. Figure 18D: Flow cytometry quantification of the inducible gene deactivation kinetics of EGFPd2 in sOPTiKO cells from Figure 19C (RNAg2 - TO) and B (RNAg3 - 2TO). The percentage of EGFP-positive cells was monitored daily after tetracycline addition.The results are from 2 independent crops. Figures 19A to 19E show the development of an optimized inducible CRISPR / Cas9 gene-switching platform in hESCs. (Figures 19A to 19D) represent representative flow cytometry for EGFPd2 expression in EGFPd2 sOPTiKO homozygous hESCs carrying the indicated combinations of gRNA (2 or 3) and the inducible promoter (TO or 2TO, see Figure 19E). Targeting vectors: pAAV-Puro_s¡KOEGFP-2 (Figure 19A), pAAV-Puro_s¡KO2TO-EGFP-2 (Figure 19B), pAAV-Puro_s¡KO-EGFP-3 (Figure 19C), pAAV-Puro_s¡KO-2TO-EGFP-3 (Figure 19D). The cells were cultured in the presence of tetracycline (TET) for 5 days, or maintained under control conditions (CTR) in the absence of tetracycline. Note that the histograms have been normalized so that the area under the curve equals 1 (100%) for all samples presented, to facilitate direct visual comparison. Figure 19E: Sequences of QPCQ 1 n / RI Π7 / Ί / YILI are inducible H1 Pol III promoter nucleotides for the sOPTiKO system containing one or two tet operons (H1-TO and H1-2TO, respectively). Key sequence features are highlighted. Restriction enzyme cleavage sites used for gRNA cloning are shown (Figure 18B). DSE: distal sequence element; PSE: proximal sequence element; TETO2: tet operon; +1: RNA transcription start site. Figures 20 to 33 are representations of the maps of several plasmids used within the Examples of this application. These are: 20) pSpCas9n(BB)_R26-R 21) pSpCas9n(BB)_R26-L 22) pR26_CAG_EGFP 23) pR26_CAG_rtTA 24) pZFN-AAVSl-L-ELD (left zinc finger nudease) 25) pZFN-AAVSl-R-KKR (right zinc finger nudease) 26) pAAV_CAG_EGFP (donor) 27) pR26-Neo_CAG-OPTtetR (optimized codon tetR hROSA26 addressing) 28) pAAV-PuroJKD (inducible RNAsh AAVS1 targeting) 29) pAAV-Neo_CAG-Cas9 (Cas9 AAVS1 addressing) 30) pAAV-Puro_s¡KO (inducible gRNA targeting of AAVS1) 31) pAAV-Puro_s¡KO-2TO (inducible gRNA targeting of AAVS1, version with 2 tet operons in the promoter) 32) pAAV_TRE-EGFP (inducible overexpression of EGFP, bound) 33) pAAV_TRE-MYOD1 (muscle-inducible MYOD1 overexpression) DETAILED DESCRIPTION OF THE INVENTION The inventors have developed a method that is useful for the inducible transcription of genetic sequences contained within inducible cassettes in eukaryotic cells, and specifically pluripotent stem cells and their progeny. It is particularly applicable to the direct programming of pluripotent stem cells via the overexpression of inducible cassettes within the stem cell, which promotes the development of a particular type of mature cell. Furthermore, it is also applicable to the reduction of gene expression or gene deactivation of endogenous functions within the cell to study the loss of function or to alter cellular functions or behavior in these cells. The reduction of gene expression or gene deactivation can be applied to genes that encode proteins or to DNA sequences that encode non-coding RNA. QPCQ 1 fi / A 107 / 3 / YILI target by the methods of the present invention either by gene deactivation or by reduction of gene expression. This method is based on at least double-targeting of secure attachment sites in the stem cell genome, with the system for induced transcription divided across two or more GSH molecules. However, this method is not limited to stem cells and can be used to modify the genome of any cell type, for example, in research or gene therapy. In the methods of the invention, a GSH molecule is modified to contain a transcriptional regulator required to induce transcription of the genetic sequence contained within the inducible cassette inserted into a different GSH molecule elsewhere in the genome. The transcriptional regulator is preferably constitutively expressed. It is preferred that an exogenous substance / agent be supplied to control the activity of the transcriptional regulatory protein and thus control the expression of the inducible cassette.Since at least two separate GSH sites are used in the method of the invention, there are a total of four possible insertion sites, as each GSH site exists on both chromosomes of a diploid organism. This increases the amount of possible transcription of the cell if all four sites are modified using the method of the invention. An example of several results of targeted insertion is shown in Figure 5A. Furthermore, the method of the invention uses at least two different GSH sites. It is understood that additional GSH sites could be used to introduce additional transcriptional regulators, inducible cassettes, or any other genetic material, including, but not limited to, selectable markers, antibiotic or drug resistance genes, CRISPR / Cas9-related genes, or genes of unknown function. Thus, the present invention relates to a method for controlling the expression of a genetic sequence inserted into a cell, comprising the following steps: a) the targeted insertion of a genetic sequence encoding a transcriptional regulatory protein into a first genetic secure anchoring site; and b) the directed insertion of an inducible cassette into a second genetic secure anchoring site, wherein said inducible cassette comprises said genetic sequence operatively linked to an inducible promoter, and said promoter is regulated by the transcriptional regulatory protein; wherein the first and second genetic secure anchoring sites are different. Furthermore, in this aspect of the invention, an additional identical or different inducible cassette can be inserted into an additional GSH, which is different from the first and second GSH. That inducible cassette is as described herein. Insertions specifically within genetically secure anchoring sites are preferred over random genome integration, as it is expected to be a more frequent modification. QPCQ 1 fi / AI Π7 / 3 / YILI is safe from the genome, and is less likely to lead to unwanted side effects such as silencing of natural gene expression or causing mutations that lead to cancerous cell types. A genetic safe anchoring (GSH) site is a location within the genome where a gene or other genetic material can be inserted without any harmful effects on the cell or the inserted genetic material. Ideally, a GSH site is one where the expression of the inserted gene sequence is not disrupted by cross-reading of neighboring genes, and where the expression of the inducible cassette minimizes interference with the endogenous transcription program. More formal criteria have been proposed to help determine whether a particular location is a GSH site (Papapetrou et al., 2011, Nature Biotechnology, 29(1), 738. doi:10.1038 / nbt.l717).These criteria include a site that is (i) 50 kb or more from the 5' end of any gene, (ii) 300 kb or more from any cancer-related gene, (iii) 300 kb or more from any microRNA (miRNA), (iv) located outside a transcription unit, and (v) located outside ultraconserved regions (UCRs). It may not be necessary to meet all of these proposed criteria, as the GSH already identified does not meet all of them. It is thought that a suitable GSH will meet at least 2, 3, 4, or all of these criteria. Additional sites can be identified by searching for sites where viruses integrate naturally without disrupting natural gene expression. Any suitable GSH may be used in the method of the invention, provided that the site allows the insertion of genetic material without harmful effects on the cell and permits the transcription of the inserted genetic material. Those skilled in the art may use these simplified criteria to identify a suitable GSH, and / or the more formal criteria established above. For the human genome, many GSH sites have been identified, including the AAVS1 site, the hROSA26 site, and the CLYBL gene. The CCR5 gene and the HPRT gene have also been proposed as potential GSHs, and further research may identify one or more of these as GSHs in the human genome. The adeno-associated virus integration site 1 (AAVS1) is located within the gene for the regulatory protein phosphatase 1 subunit 12C (PPP1R12C) on human chromosome 19, which is uniformly and ubiquitously expressed in human tissues. This site serves as a specific integration site for AAV serotype 2 and was thus identified as a potential GSH site. AAVS1 has proven to be a favorable environment for transcription, as it comprises an open chromatin structure and native chromosomal insulators that allow inducible cassettes to resist silencing. There are no known adverse cellular effects resulting from disruption of the PPP1R12C gene. Furthermore, an inducible cassette inserted into this site QPCQ ! n / RI Π7 / Ί / YΙΛΙ remains transcriptionally active in many different cell types. Thus, AAVS1 is considered a GSH and has been widely used for targeted transgenesis in the human genome. The hROSA26 site has been identified based on sequence analogy with mouse GSH (ROSA26 reverse-oriented splicing acceptor site #26). Although the orthologous site has been identified in humans, this site is not commonly used for inducible cassette insertion. The present inventors have developed a targeting system specifically for the hROSA26 site and were thus able to insert genetic material into this location. The hROSA26 site is on chromosome 3 (3p25.3) and can be found in the Ensembl database (GenBank:CR624523). The exact genomic coordinates of the integration site are 3:9396280-9396303:Ensembl. The integration site falls within the open reading frame (ORF) of the long non-coding RNA of THUMPDJ^reverse strand.Since the hROSA26 site has an endogenous promoter, the inserted genetic material can take advantage of that endogenous promoter, or alternatively, it can be inserted operatively linked to a promoter. Intron 2 of the beta-citrate lyase (CLYBL) gene, located on the long arm of chromosome 13, was identified as a suitable GSH site because it is one of the identified integration sites of interest for phage-derived ph1C31 integrase. Studies have shown that inducible cassettes randomly inserted at this site are stable and expressible. Insertion of inducible cassettes into this GSH site has been shown not to alter local gene expression (Cerbibi et al., 2015, PLOS One, DOLIO.1371). CLYBL thus provides a GSH site that may be suitable for use in the present invention. CCR5, located on chromosome 3 (position 3p21.31), is a gene that encodes the main co-receptor of HIV-1. Interest in using this site as a GSH site arises from the null mutation in this gene, which appears to have no adverse effects but predisposes to resistance to HIV-1 infection. Zinc finger nucleases targeting the third exon have been developed, thus enabling the insertion of genetic material at this location. Since the natural function of CCR5 has yet to be elucidated, the site remains an apparent GSH site that may be useful for the present invention. The hypoxanthine-guanine phosphoribosyltransferase (HPRT) gene encodes a transferase enzyme that plays a central role in the generation of purine nucleotides through the purine salvage pathway. Therefore, further work is needed to ensure that insertions at this site do not disrupt normal cell function. However, it has been proposed as a GSH site. Insertions at this site may be more applicable to mature cell types, such as for gene therapy modification. GSH has been identified in other organisms and includes the ROSA26 and HRPT sites. QPCQ ! n / RI Π7 / □ / YILI and Hippll (Hll) in mice. Mammalian genomes can include GSH sites based on attP pseudosites. For such sites, hiC31 integrase, the phage-derived recombinase from Streptomyces, has been developed as a non-viral insertion tool because it has the ability to integrate a plasmid containing an inducible cassette carrying an attB site into attP pseudosites. GSHs are also present in plant genomes, and the modification of plant cells may form part of the present invention. GSHs have been identified in rice genomes (Cantos et al, Front. Plant Sci., 26 June 2014, Volume 5, Article 302, http: / / dx.doi.org / 10.3389 / fDls.2014.00302). In the methods of the invention, the insertions occur in different GSH molecules; thus, at least two GSH molecules are required for the method of the invention. The first GSH molecule is modified by the insertion of a transcriptional regulatory protein. The second GSH molecule is modified by the insertion of an inducible cassette comprising a genetic sequence operatively linked to an inducible promoter. Other genetic material containing either or both of these elements may also be inserted. The genetic sequence operatively linked to an inducible promoter within the inducible cassette is preferably a DNA sequence. The genetic sequence(s) of the inducible cassette preferably encode an RNA molecule and are thus capable of being transcribed. Transcription is controlled using the inducible promoter. The RNA molecule can have any sequence, but is preferably an mRNA encoding a protein, a shRNA, or a gRNA. The first GSH site can be any suitable GSH site. Optionally, it is a GSH site with an endogenous promoter that is constitutively expressed, which will result in the inserted transcriptional regulatory protein being constitutively expressed. A suitable GSH site is hROSA26 for human cells. Alternatively, the inserted transcriptional regulatory protein is operatively bound to a promoter, preferably a constitutive promoter. A constitutive promoter can be used in conjunction with an insertion at the hROSA26 site. A transcriptional regulatory protein is a protein that binds to DNA, preferably specifically to a DNA sequence located at or near a promoter, and either facilitates the binding of the transcription machinery to the promoter, thus allowing transcription of the DNA sequence (a transcriptional activator), or blocks this process (a transcriptional repressor). These entities are also known as transcription factors. The DNA sequence to which a transcriptional regulatory protein binds is called a transcription factor binding site or response element, and these are found at or near the promoter of the regulated DNA sequence. Transcriptional activator proteins bind to a response element and promote gene expression. These proteins are preferred in the methods described herein. QPCQ ! Π / Α I Π7 / 3 / YΙΛΙ invention for controlling the expression of the inducible cassette. Transcriptional repressor proteins bind to a response element and prevent gene expression. Transcriptional regulatory proteins can be activated or deactivated by a number of mechanisms, including the binding of a substance, interaction with other transcription factors (e.g., homo- or heterodimerization) or co-regulatory proteins, phosphorylation, and / or mediation. The transcriptional regulator can be controlled by activation or deactivation. If the transcriptional regulatory protein is a transcriptional activator protein, it is preferable that the transcriptional activator protein require activation. This activation can occur through any suitable means, but it is preferred that the transcriptional regulatory protein be activated by adding an exogenous substance to the cell. The delivery of an exogenous substance to the cell can be controlled, and thus the activation of the transcriptional regulatory protein can be controlled. Alternatively, an exogenous substance can be delivered to deactivate a transcriptional regulatory protein, and then the supply can be withdrawn to activate the transcriptional regulatory protein. If the transcriptional regulatory protein is a transcriptional repressor protein, it is preferable that the transcriptional repressor protein require inactivation. Thus, a substance is supplied to prevent the transcriptional repressor protein from repressing transcription, thereby allowing transcription to proceed. Any suitable transcriptional regulatory protein can be used, preferably one that is either activatable or deactivatable. Ideally, an exogenous substance should be able to be supplied to control the transcriptional regulatory protein. These transcriptional regulatory proteins are also called inducible transcriptional regulatory proteins. Tetracycline-Controlled Transcriptional Activation (TCTA) is an inducible gene expression method where transcription is reversibly initiated or switched off in the presence of the antibiotic tetracycline or one of its derivatives (e.g., doxycycline, which is more stable). In this system, the transcriptional activator protein is tetracycline-sensitive transcriptional activator protein (rtTA) or a derivative thereof. rtTA is capable of binding to DNA at specific Teto operator sequences. Many repeats of these Teto sequences are located in the 5' direction of a minimal promoter (such as the CMV promoter), which together form a tetracycline response element (TRE). There are two forms of this system, depending on whether the addition of tetracycline or a derivative activates (Tet-On) or deactivates (Tet-Off) the rtTA protein. QPCQ 1 Π / RI Π7 / Ί / YΙΛΙ In a Tet-Off system, tetracycline or a tetracycline derivative binds to rtTA and deactivates it, rendering it unable to bind to TRE sequences and thus preventing the transcription of TRE-controlled genes. This system was first described in Bujard et al. (1992). Proc. Nati. Acad. Sci. USA 89 (12): 5547-51. The Tet-On system comprises two components: (1) the constitutively expressed tetracycline-sensitive transcriptional activator protein (rtTa) and the rtTa-sensitive inducible promoter (Tet-Sensitive Element, TRE). This TRE can be bound by tetracycline or its more stable derivatives, including doxycycline (dox), resulting in the activation of rtTa, allowing it to bind to TRE sequences and induce the expression of TRE-controlled genes. The use of this system may be preferred in the method of the invention. This system is represented in Figure 11. Thus, the transcriptional regulatory protein may be tetracycline-sensitive transcriptional activator protein (rtTA), which can be activated or deactivated by the antibiotic tetracycline or one of its derivatives, administered exogenously. If the transcriptional regulatory protein is rtTA, then the inducible promoter inserted at the second GSH site includes the tetracycline response element (TRE). The exogenously administered substance is the antibiotic tetracycline or one of its derivatives. Modified rtTa variants and proteins can be used in the methods of the invention; these include Tet-On Advanced Transactivator (also known as rtTA2S-M2) and Tet-On 3G (also known as rtTA-V16, derived from rtTA2S-S2). The tetracycline response element (TRE) typically consists of seven repeats of the 19-bp bacterial Teto sequence separated by spacer sequences, along with a minimal promoter. Variants and modifications of the TRE sequence are possible, as the minimal promoter can be any suitable promoter. Preferably, the minimal promoter shows no expression or minimal expression in the absence of rtTa binding. The inducible promoter inserted into the second GSH molecule can thus comprise a TRE. A modified tetracycline-controlled system is the T-REx™ System (Thermofisher Scientific), in which the transcriptional regulatory protein is a transcriptional repressor protein, TetR. The components of this system include (i) an inducible promoter comprising a strong human cytomegalovirus (CMV) immediate early promoter and two tetracycline operator 2 sites (TetO2), and a Tet repressor (TetR). The TetO2 sequences consist of two copies of the 19-nucleotide sequence 5'-TCCCTATCAGTGATAGAGA-3' separated by a 2-base-pair separator. In the absence of tetracycline, the Tet repressor forms a homodimer that binds with extremely high affinity to each TetO2 sequence in the inducible promoter, preventing transcription of the promoter. Upon addition, tetracycline binds with high affinity to each Tet repressor homodimer, rendering it unable to bind to the Tet repressor. QPCQ ! Π / RI Π7 / 3 / YILI Tet operator. The Tet repressor:tetracycline complex then dissociates from the Tet operator and allows induction of expression. In this case, the transcriptional regulatory protein is TetR and the inducible promoter comprises two TetO2 sites. The exogenously supplied substance is tetracycline or a derivative thereof. The invention further relates to an optimized codon tetR (OPTtetR). This can be used in any method described herein, or for any additional use where inducible promotion is desirable. This entity was generated using multiparameter optimization of the bacterial tetR cDNA sequence. The OPTtetR allows a tenfold increase in tetR expression when compared to the standard sequence (STDtetR). Homozygous tetR OPTtetR expression was sufficient to prevent shRNA leakage while preserving the induction of gene expression reduction in the Examples. The sequence for OPTtetR is included herein, with the standard sequence shown for comparison. Sequences with at least 75%, 80%, 85% or 90% homology to this sequence are claimed in this way, more particularly 91, 92, 93, 94, 95, 96, 97 or 99% homology.The residues shown to have changed between STDtetR and OPTtetR have been indicated in the sequences, and it is preferred that these residues not change in any OPTtetR derivative since they are thought to be important for the enhanced properties. Any derivative could optionally retain these modifications at the indicated positions. Other inducible expression systems are known and can be used in the method of the invention. These include the Agilent Technologies Inducible Complete Control System. This system is based on the insect homone ecdysone or its analog ponasterone A (ponA), which can activate transcription in mammalian cells transfected with both the gene for the ecdysone receptor DrosophHa me / ongaster (EcR) and an inducible promoter comprising a binding site for the ecdysone receptor. The EcR is a member of the retinoid-X receptor (RXR) family of nuclear receptors. In humans, the EcR forms a heterodimer with RXR that binds to the ecdysone-sensitive element (EcRE). In the absence of PonA, transcription is repressed by the heterodimer. Thus, the transcriptional regulatory protein can be a repressor protein, such as an ecdysone receptor or a derivative thereof. Examples of the latter include Agilent Technologies' synthetic VgEcR receptor, which is a fusion of EcR, the DNA-binding domain of the glutocorticoid receptor, and the transcriptional activation domain of Herpes Simplex Virus VP16. The inducible promoter comprises the EcRE sequence or modified versions thereof along with a minimal promoter. The modified versions include Agilent Technologies' E / GRE recognition sequence, in which the sequence mutations have been made. The E / GRE recognition sequence comprises inverted half-site recognition elements for the retinoid-X receptor (RXR) and GR-binding domains.In all permutations, the exogenously supplied substance is ponasterone A, which removes the repressive effect of EcR or its derivatives on the inducible promoter, and allows transcription to take place. Alternatively, inducible systems can be based on the synthetic steroid mifepristone as the exogenously supplied substance. In this scenario, a hybrid transcriptional regulatory protein is inserted, which is based on the DNA-binding domain of the yeast GAL4 protein, a truncated ligand-binding domain (LBD) of the human progesterone receptor, and an activation domain (AD) of the human NF-κB. This hybrid transcriptional regulatory protein is available from Thermo Fisher Scientific (Gene Switch™). Mifepristone activates the hybrid protein, allowing transcription of the inducible promoter comprising GAL4 5' activating sequences (UAS) and the adenovirus Elb TATA box. This system is described in Wang, Y. et al. (1994) Proc. Nati. Acad. Sci. USA 91, 8180-8184. The transcriptional regulatory protein can thus be any suitable regulatory protein, either an activator or a repressor. Suitable transcriptional activator proteins include tetracycline-sensitive transcriptional activator protein (rtTa) or the hybrid Gene Switch transcriptional regulatory protein. Suitable repressor proteins include the Tet-Off version of rtTa, TetR, or EcR. Transcriptional regulatory proteins can be modified or derivatized as required. The inducible promoter may comprise elements suitable for binding to or interacting with the transcriptional regulatory protein. The interaction of the transcriptional regulatory protein with the inducible promoter is preferably controlled by the exogenously supplied substance. The exogenously administered substance can be any suitable substance that binds to or interacts with the transcriptional regulatory protein. Suitable substances include tetracycline, ponasterone A, and mifepristone. Thus, the insertion of the gene encoding a transcriptional regulatory protein into the first GSH provides the control mechanism for the expression of the inducible cassette that operatively binds to the inducible promoter and inserts into a different second GSH site. The gene for the transcriptional regulatory protein can be provided for insertion with other genetic material. This material includes genes for markers or reporter molecules, such as genes that induce visually identifiable characteristics, including fluorescent and luminescent proteins. Examples include the gene encoding green fluorescent jellyfish protein (GFP), which causes cells expressing it to glow green under blue / UV light; luciferase, which catalyzes a reaction with luciferin to produce light; and the red fluorescent protein encoded by the dsRed gene. These marker or reporter genes are useful because their presence The QPCQ ! Π / RI Π7 / 3 / YILI reporter protein confirms the expression of the first GSH protein, indicating successful insertion. Selectable markers may also include antibiotic or other drug resistance genes. Reporter gene markers or sequences can also be introduced to study the expression of endogenous (or exogenous) genes. This includes Cas proteins, such as CasL and Cas9, which enable the excision of genes of interest, as well as Cas fusion proteins that mediate changes in the expression of other genes, for example, by acting as transcriptional enhancers or repressors. Furthermore, non-inducible expression of molecular tools may be desirable, including optogenetic tools, nuclear receptor fusion proteins such as tamoxifen-inducible ERT systems, and designer receptors activated exclusively by designer drugs.Furthermore, sequences encoding signaling factors that alter the function of the same cell, a neighboring cell, or even distant cells in an organism, including autocrine or paracrine hormone factors, can be co-expressed from the same GSH as the transcriptional regulatory protein. In addition, the extra genetic material may include sequences that encode non-coding RNA, as discussed herein. Examples of such genetic material include genes for miRNAs, which can function as a genetic switch. It is preferred that the gene encoding the transcriptional regulatory protein be operationally linked to a constitutive promoter. Alternatively, the first GSH can be selected so that it already has a constitutive promoter that can also drive the expression of the transcriptional regulatory protein gene and any associated genetic material. Constitutive promoters ensure sustained, high-level gene expression. Commonly used constitutive promoters include those of human β-actin (ACTB), cytomegalovirus (CMV), elongation factor-α (EFα), phosphoglycerate kinase (PGK), and ubiquitin C (UbC).The CAG promoter is a strong synthetic promoter frequently used to drive high levels of gene expression and was constructed from the following sequences: (C) the cytomegalovirus (CMV) early enhancer element, (A) the promoter, first exon and first intron of the chicken beta-actin gene, and (G) the splice acceptor of the rabbit beta-globin gene. In addition, the transcriptional regulator, plus any additional genetic material, can be provided along with the dissociable sequences. These sequences are sequences recognized by an entity capable of specifically cutting DNA, and include restriction sites, which are the target sequences for restriction enzymes or sequences for recognition by other DNA dissociation entities, such as nucleases, recombinases, ribozymes, or artificial constructs. At least one dissociable sequence may be included, but preferably two or more are present. These dissociable sequences can be at any suitable point in the insertion, so that a selected portion of the insertion, or the entire insertion, can be selected. QPCQ 1 n / RI ηζ / Ί / YILI selectively removes GSH. The method can thus be extended to the removal and / or replacement of the GSH insertion or a portion thereof. The dissociable sites can thus flank the part or all of the insertion that may be desirable to remove. The transcriptional regulator and / or additional genetic material can be removed using this method. A portion of the insertion can be any part up to 99% of the insertion - i.e. 1-99%, 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 10% or less than 10%. It may be preferable for the portion of the insertion flanked by the dissociable sites to include the constitutive promoter. Alternatively, the constitutive promoter is not included in the portion flanked by the dissociable sequences. A preferred dissociable sequence is the loxP site for Cre recombinase, as it allows for direct replacement of the removed insertion. Alternatively, or in addition, the dissociable sequence is the rox site for Dre recombinase. It is preferred that the insertion into the first GSH molecule occur at both locations in the genome, so that each allele is modified by the insertion. This allows for greater expression of the gene encoding the transcriptional regulator and any associated genetic material. The second GSH site can be any suitable GSH site. It may be preferable that the second GSH site not be associated with an endogenous promoter, so that expression of the inserted inducible cassette is solely under the control of the transcriptional regulatory protein. An inducible cassette contains a desired genetic sequence, preferably a DNA sequence, to be transferred into a cell. The introduction of an inducible cassette into the genome has the potential to change the phenotype of that cell, either by adding a genetic sequence that enables gene expression or by reducing gene expression / inactivating endogenous gene expression. The methods of the invention provide the controllable transcription of the genetic sequence(s) within the inducible cassette into the cell. The desired genetic sequence for insertion is preferably a DNA sequence that encodes an RNA molecule. The RNA molecule can be of any sequence, but it is preferably either coding or non-coding RNA. Coding or messenger RNA encodes polypeptide sequences, and transcription of that RNA leads to the expression of a protein within the cell. Non-coding RNA can be functional and may include, but is not limited to: microRNA, small interfering RNA, Piwi-interacting RNA, antisense RNA, small nuclear RNA, small nucleolar RNA, small Cajal body RNA, Y-RNA, enhancer RNAs, guide RNA, ribozymes, small hairpin RNA, small temporary RNA, trans-acting RNA, and subgenomic messenger RNA. Non-coding RNA may also be referred to as functional RNA.Many types of RNA are regulatory in nature and, for example, can downregulate gene expression by being complementary to a portion of an mRNA or DNA molecule. MicroRNAs (miRNAs; 21 to 22 nucleotides) are found in eukaryotes and act through interfering RNA (RNAi), where an effector complex of miRNA and enzymes can dissociate the complementary mRNA, block the mRNA from being translated, or accelerate its degradation. Another type of RNA, small interfering RNAs (siRNAs; 20 to 25 nucleotides), act through interfering RNA in a manner similar to miRNAs. Some miRNAs and siRNAs can mediate the genes they target, thereby decreasing or increasing the transcription of those genes. Animals have Piwi-interacting RNAs (piRNA; 29 to 30 nucleotides) that are active in germline cells and are thought to be a defense against transposons.Many prokaryotes have CRISPR RNAs, a regulatory system similar to interfering RNA, and this system includes guide RNA (gRNA). Antisense RNAs are widespread; most deregulate a gene, but a few are transcription activators. Antisense RNA can act by binding to an mRNA, forming double-stranded RNA that is enzymatically degraded. There are many long non-coding RNAs that regulate genes in eukaryotes; one such RNA is Xist, which coats an X chromosome in female mammals and inactivates it. Thus, there are a multitude of functional RNAs that can be employed in the methods of the present invention. Thus, the inducible cassette may contain a genetic sequence that is a gene encoding a protein. This gene may not be naturally present in the cell, or it may occur naturally in the cell, but controllable expression of that gene is required. Alternatively, the inducible cassette may be a mutated, modified, or corrected version of a gene present in the cell, particularly for gene therapy or the derivation of disease models. The inducible cassette may thus contain a transgene from a different organism of the same species (i.e., a diseased / mutated version of a human gene, or a wild-type human gene) or be from a different species. In any aspect or modality, the genetic sequence contained within the inducible cassette can be a synthetic sequence. The inducible cassette can include any suitable genetic sequence that one wishes to insert into the cell's genome. Therefore, the genetic sequence can be a gene that codes for a protein product or a sequence that is transcribed into ribonucleic acid (RNA) that has a function (such as small nuclear RNA (snRNA), antisense RNA, microRNA (miRNA), small interfering RNA (siRNA), transfer RNA (tRNA), and other non-coding RNAs (ncRNA), including CRISPR-RNA (crRNA) and guide RNA (gRNA)). The inducible cassette can thus contain any genetic sequence whose transcription is to be controlled within the cell. The genetic sequence chosen will depend on the cell type and the intended use of the cell after modification, as discussed later. orc in / R i ηζ / Ί / υιλι For example, in gene therapy methods, it may be desirable to provide the wild-type gene sequence as a component of the inducible cassette. In this scenario, the gene sequence can be any gene that encodes a human or animal protein. Examples of protein-coding genes include the human β-globin gene, the human lipoprotein lipase (LPL) gene, the human Rab escort 1 protein encoded by the CHM gene, and many more. Alternatively, the inducible cassette can express growth factors, including BDNF, GDF, NGF, IGF, FGF, and / or enzymes that can cleave pro-peptides to form active forms. Gene therapy can also be achieved by expressing an inducible cassette containing a gene sequence that encodes an antisense RNA, a microRNA, a siRNA, or any type of RNA that interferes with the expression of another gene within the cell. Alternatively, if the cell is a stem cell, the inducible cassette may include a genetic sequence encoding a key lineage-specific master regulator, abbreviated here as master regulator. Master regulators may be one or more of the following: transcription factors, transcriptional regulators, cytokine receptors, or signaling molecules, and the like. A master regulator is an expressed gene that influences the lineage of the cell that expresses it. A network of master regulators may be required to determine a cell's lineage. As used herein, a master regulator gene that is expressed early in a developmental lineage or cell type participates in specifying that lineage by regulating multiple genes in the 3' direction, either directly or through a cascade of gene expression changes.If expressed, the master regulator has the ability to re-specify the fate of cells destined to form other lineages. Examples of master regulators include the myogenic transcription factor MyoD and the hematopoietic transcription factor SCL. Specifically, master regulators include, but are not limited to: Neural lineages: Oligodendrocytes: SOXIO, OLIG2, NKX2.2, NKX6.2; Astrocytes: NFIA, NFIB, and SOX9; Neurons: Asdl, neurogenin, and NeuroD, Pax6, Neurog2, Ascll, Dlx2, and NeuroDl; Hematopoietic cells, including erythrocytes and megakaryocytes: GATA1, FLI1, and TAL1 Mesenchymal lineages: Skeletal muscle: MYOD; Cardiomyocytes: Gata4, Mef2c, Baf60c, and Tbx5; Bone: L-Myc (RXOL), Runx2, Osterix, and Oct4; Cartilage: c-Myc, Klf4, and SOX9; and Brown adipocytes: C / EBR-β and c-Myc Endoderm Types of pancreatic cells: PDXl and GATA6. Stem cells: Epiblast SC: Oct4, Sox2, Klf4 and c-Myc Alternatively, or in addition, the genetic sequence or additional genetic material may be genes whose function requires investigation, so that controllable expression can be observed to determine the effect of expression in the cell; the gene may include growth factors and / or cytokines. QPCQ ¡ Π / RI Γ>7 / 3 / YILI so that the cells can be used in cell transplantation; and / or the gene can be components of a reporter assay. Furthermore, the genetic sequence may encode non-coding RNA whose function is to reduce the expression of an endogenous gene or DNA sequence that encodes non-coding RNA in the cell. Alternatively, the genetic sequence may encode the guide RNA for the CRISPR-Cas9 system to effect gene inactivation of the endogenous gene. The methods of the invention thus extend to methods of reducing the expression of endogenous gene expression within a cell. The methods are as previously described, and the inducible cassette comprises a genetic sequence encoding a non-coding RNA operatively linked to an inducible promoter, wherein the non-coding RNA suppresses the expression of said endogenous gene. The non-coding RNA can suppress gene expression by any suitable means, including interfering RNA and antisense RNA. Thus, the genetic sequence can encode a shRNA that can interfere with the messenger RNA for the endogenous gene. The reduction in endogenous gene expression can be partial or complete - i.e., expression can be 50, 55, 65, 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100% reduced compared to the cell before induction of non-coding RNA transcription. The methods of the invention also extend to methods of gene inactivation of endogenous genes within a cell, by virtue of the CRISPR-Cas9 system, although any other suitable gene inactivation systems may be used. In this scenario, it is preferred that the Cas9 genes be constitutively expressed, and thus they are included in the first GSH cassette along with the gene for the transcriptional regulator. The genetic sequences encoding the gRNAs can be included in the inducible cassette, which is inserted into the second GSH cassette. The gRNA is a short synthetic RNA composed of a scaffold sequence required for Cas9 binding and a targeting sequence of approximately 20 nucleotides that defines the genomic target to be modified. Thus, the genomic target of Cas9 can be changed simply by altering the targeting sequence present in the gRNA.Although the primary use of this system is to design a gRNA to target an endogenous gene for gene inactivation, it can also be modified to selectively activate or repress target genes, purify specific DNA regions, and even provide DNA imaging. All possible uses are being considered. The inducible cassette includes a genetic sequence operatively linked to an inducible promoter. A promoter is a nucleotide sequence that initiates and regulates the transcription of a polynucleotide. An inducible promoter is a nucleotide sequence where the expression of a genetic sequence operatively linked to the promoter is controlled by an analyte. QPCQ 1 Π / AI Π7 / 3 / YILI co-factor, regulatory protein, etc. In the case of the present invention, control is exercised by the transcriptional regulatory protein. The term promoter or control element is intended to include full-length promoter regions and functional segments (e.g., controls transcription or translation) of these regions. Operationally linked refers to an arrangement of elements where the components thus described are configured to perform their normal function. Thus, a given promoter operatively linked to a genetic sequence is capable of effecting the expression of that sequence when the appropriate enzymes are present. The promoter need not be contiguous with the sequence, as long as it functions to direct its expression.Thus, for example, untranslated but still transcribed intervention sequences may be present between the promoter sequence and the genetic sequence, and the promoter sequence may still be considered operationally bound to the genetic sequence. The term "operationally bound" here refers to any separation or orientation of the promoter element and the genetic sequence within the inducible cassette that allows the initiation of transcription of the inducible cassette upon recognition of the promoter element by a transcription complex. In addition, other genetic material may also be operatively linked to the inducible promoter. This additional genetic material may include genes, RNA-coding sequences, or genetic material such as marker or reporter genes. This additional genetic material has been discussed previously. In some circumstances, it may be desirable to include a suicide gene in the inducible cassette, even if the genetic sequence itself is not a suicide gene for cancer gene therapy. The suicide gene may use the same inducible promoter within the inducible cassette, or it may be a separate inducible promoter to allow for separate control. This gene may be useful in gene therapy scenarios where it is desirable to be able to destroy donor / transfected cells if certain conditions are met.Suicide genes are genes that express a protein that causes the cell to undergo apoptosis, or alternatively, they may require an externally supplied cofactor or codrug to function. The cofactor or codrug can be converted by the suicide gene product into a highly cytotoxic entity. Furthermore, the inducible cassette may include dissociable sequences. These sequences are recognized by an entity capable of specifically cutting DNA and include restriction sites, which are the target sequences for restriction enzymes or sequences for recognition by other DNA dissociation entities, such as nucleases, recombinases, ribozymes, or artificial constructs. At least one dissociable sequence may be included, but preferably two or more are present. These dissociable sequences may be located at any suitable point in the cassette, so that a selected portion of the cassette, or the entire cassette, can be selectively removed from the GSH. The method can thus be extended to the removal and / or replacement of the cassette or a portion thereof from the GSH. The dissociable sites may QPCQ 1 Π / RI Π7 / Ί / YΙΛΙ thus flanking part / all of the genetic sequence that may be desirable to remove. The method may result in the removal of the inducible cassette and / or additional genetic material. A portion of the cassette can be any part up to 99% of the cassette - i.e. 199%, 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 10% or less than 10%. It may be preferable for the portion of the insertion flanked by the dissociable sites to include the promoter operatively linked to the genetic sequence. Alternatively, the promoter operatively linked to the genetic sequence is not included in the portion flanked by the dissociable sequences. A preferred dissociable sequence is the loxP site for Cre recombinase, as it allows for direct replacement of the removed insertion. Alternatively, or in addition, the dissociable site can be the rox site for Dre recombinase. The transcriptional regulatory protein and the inducible cassette, along with any associated genetic material, are inserted into different GSH within the cell's genome. GSH insertions are preferably made specifically within the GSH sequence, as previously described. Any suitable technique can be used to insert a polynucleotide into a specific sequence, and many are described in the technique. Suitable techniques include any method that introduces a break at the desired location and allows recombination of the vector in space. Thus, a crucial first step for target-site-specific genomic modification is the creation of a double-strand break (DSB) in the DNA at the genomic site to be modified. Various cellular repair mechanisms can be exploited to repair the DSB and introduce the desired sequence. These include non-homologous end joining (NHEJ) repair, which is more prone to error, and donor DNA template-mediated homologous recombination (HR) repair, which can be used to insert inducible cassettes. There are many techniques to enable site-specific, customized generation of DSBs in the genome. Many of these involve the use of customized endonucleases, such as zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), or the clustered regularly interspaced short palindromic repeats / CRISPR-associated protein (CRISPR / Cas9) system (Gaj, T, efa / ZFN, TALEN, and CRISPR / Cas-based methods for genome engineering / 'Trends Biotechnol, 31:397-405, July 2013). Zinc finger nucleases are artificial enzymes generated by fusing a zinc finger DNA-binding domain to the nuclease domain of the restriction enzyme FokI. FokI has a nonspecific dissociation domain that must dimerize to dissociate DNA. This means that two ZFN monomers are required to enable dimerization of the FokI domains and to dissociate DNA. The DNA-binding domain can be engineered to QPCQ 1 Π / RI Π7 / 3 / YILI, designed to target any genomic sequence of interest, is a tandem arrangement of Cys2His2 zinc fingers, each of which recognizes three contiguous nucleotides in the target sequence. The two binding sites are separated by 5–7 bp to allow optimal dimerization of the FokI domains. The enzyme is thus able to dissociate DNA at a specific site, and target specificity is increased by ensuring that two proximal DNA binding events must occur to achieve double-strand breakage. Transcription activator-like effector nucleases, or TALENs, are dimeric transcription factor / nucleases. They are produced by fusing a TAL effector DNA-binding domain to a DNA dissociation domain (a nuclease). Transcription activator-like effectors (TALEs) can be engineered to bind to virtually any desired DNA sequence, so that when combined with a nuclease, the DNA can be cleaved at specific locations. TAL effectors are proteins secreted by the bacterium Xanthomonas, whose DNA-binding domain contains a highly conserved repeat sequence of 33 to 34 amino acids with the 12th and 13th amino acids diverging. These two positions are highly variable and show a strong correlation with specific nucleotide recognition.This direct relationship between amino acid sequence and DNA recognition has allowed the design of specific DNA-binding domains for selecting a combination of repeated segments containing appropriate residues at the two variable positions. TALENs are thus constructed from arrays of 33 to 35 amino acid modules, each of which targets a single nucleotide. By selecting the module array, almost any sequence can be targeted. Again, the nuclease used can be FokI or a derivative thereof. Three types of CRISPR mechanisms have been identified, of which type II is the most studied. The CRISPR / Cas9 system (type II) uses the Cas9 nuclease to create a double-strand break in DNA at a site determined by a short guide RNA. The CRISPR / Cas system is a prokaryotic immune system that confers resistance to foreign genetic elements. CRISPRs are segments of prokaryotic DNA containing short repeats of base sequences. Each repeat is followed by short segments of protospacer DNA from previous exposures to foreign genetic elements. CRISPR spacers recognize and cut the exogenous genetic elements using interfering RNA. The CRISPR immune response occurs through two steps: CRISPR-RNA (crRNA) biogenesis and crRNA guided interference. crRNA molecules are composed of a variable sequence transcribed from the protospacer DNA and a CRISPR repeat.Each crRNA molecule then hybridizes with a second RNA, known as the CRISPR trans-activating RNA (tracrRNA), and together these two eventually form a complex with the Cas9 nuclease. The coding section of the crRNA's protospacer DNA directs Cas9 to dissociate complementary target DNA sequences, if they are adjacent to each other. Short sequences known as protospacer-adjacent motifs (PAMs) are known as QPCQ 7 n / A Lnz / q / YILI. This natural system has been engineered and exploited to introduce DSB breaks at specific sites in genomic DNA, among many other applications. In particular, the Streptococcus pyogenes type II CRISPR system can be used. In its simplest form, the CRISPR / Cas9 system comprises two components that are delivered to the cell to provide genome editing: the Cas9 nudease itself and a small guide RNA (gRNA). The gRNA is a fusion of a custom site-specific crRNA (targeted to the target sequence) and a standardized tracrRNA. Once a DSB has been produced, a donor template homologated to the target site is supplied; the DSB can be repaired by homology-directed repair (HDR) path allowing for precise insertions. Derivatives of this system are also possible. Mutant forms of Cas9, such as Cas9D10A, with only nickase activity are available. This means that it only dissociates one strand of DNA and does not activate NH1. In contrast, when provided with a homologous repair template, DNA repairs are performed via only the high-fidelity HDR pathway. Cas9D10A (Cong L., et al. (2013) Science, 339, 819-823) can be used in paired Cas9 complexes designed to generate adjacent nicks in DNA in conjunction with two sgRNAs complementary to the adjacent area on opposite strands of the target site, which can be particularly advantageous. The elements for creating double-strand DNA breaks can be introduced into one or more vectors such as plasmids for expression in the cell. Thus, any method of creating specific double-strand breaks in the genome to effect the insertion of an inducible gene / cassette may be used in the method of the invention. It may be preferred that the method for inserting the inducible gene / cassette utilize one or more of the ZFN, TALEN, and / or CRISPR / Cas9 systems or any derivative thereof. Once the DSB has been formed by any appropriate means, the inducible gene / cassette for insertion can be delivered in any suitable way as described below. The inducible gene / cassette and associated genetic material form the donor DNA for DNA repair in the DSB and are inserted using standard cellular repair machinery / pathways. How the break is initiated will alter which pathway is used to repair the damage, as noted above. The transcriptional regulatory protein and the inducible cassette can be supplied for the method of the invention in separate vectors. A vector is a nucleic acid molecule, such as a DNA molecule, used as a vehicle to artificially carry genetic material into a cell. The vector is generally a nucleic acid sequence consisting of an insert (such as an inducible cassette or gene for a regulatory protein). QPCQ 1 Π / AI Π7 / 3 / YILI transcriptional) and a longer sequence that serves as the main structure of the vector. The vector can be in any suitable format, including plasmids, minicircles, or linear DNA. The vector comprises at least the gene for the transcriptional regulator or inducible cassette operatively linked to an inducible promoter, along with the minimal sequences to allow insertion of the genes into the relevant GSH. Optionally, the vectors also possess an origin of replication (ori) that allows amplification of the vector, for example, in bacteria. In addition, or alternatively, the vector includes selectable markers such as antibiotic resistance genes, genes for colored markers, and suicide genes. Examples of the vectors used in the examples are shown in Figures 20 to 33. The cell used in the method of the invention can be any human or animal cell. It is preferably a mammalian cell, such as a cell from a rodent, such as mice and rats; marsupials, such as kangaroos and koalas; non-human primates, such as bonobos, chimpanzees, lemurs, gibbons, and apes; camelids, such as camels and llamas; livestock, such as horses, pigs, cows, buffalo, bison, goats, sheep, deer, reindeer, donkeys, bulls, yaks, chickens, ducks, and turkeys; and domestic animals, such as cats, dogs, rabbits, and guinea pigs. The cell is preferably a human cell. In certain respects, the cell is preferably from a livestock animal. The type of cell used in the method of the invention will depend on the application of the cell once the insertion of the genetic material into the GSH site is completed. When the goal is to produce mature cell types from progenitor cells, the cell being modified is a stem cell, preferably a pluripotent stem cell. Pluripotent stem cells have the potential to differentiate into almost any cell in the body. There are many sources of pluripotent stem cells. Embryonic stem cells (ES cells) are pluripotent stem cells derived from the inner cell mass of a blastocyst, an early-stage pre-implantation embryo. Induced pluripotent stem cells (PSCs) are adult cells that have been genetically reprogrammed to an embryonic stem cell-like state by being forced to express genes and factors important for maintaining the defining properties of embryonic stem cells.In 2006, it was demonstrated that the introduction of four specific genes encoding transcription factors could convert adult cells into pluripotent stem cells (Takahashi, K; Yamanaka, S (2006), Cell 126 (4): 663-76), but subsequent work has reduced / iterated the number of genes required. Oct-3 / 4 and certain members of the Sox gene family have been identified as potentially crucial transcriptional regulators involved in the induction process. Additional genes, including certain members of the Klf family, the Myc family, Nanog, and LIN28, may also be involved. QPCQ 1 Π / RI Π7 / Ί / YΙΛΙ increase induction efficiency. Examples of genes that may be contained in reprogramming factors include Oct3 / 4, Sox2, Soxl, Sox3, Soxl5, Soxl7, Klf4, Klf2, c-Myc, NMyc, L-Myc, Nanog, Lin28, Fbxl5, ERas, ECAT15-2, Tcll, beta-catenin, Lin28b, Salll, Sall4, Esrrb, Nr5a2, Tbx3 and Glisl, and these reprogramming factors can be used alone, or in combination with two or more of the same. When the goal is to produce stem cells with reduced gene expression or gene inactivation for further research, such as developmental or gene function studies, the modified cell can be a stem cell, preferably a pluripotent stem cell, or a mature cell type. Sources of pluripotent stem cells are discussed above. If cells modified by inserting an inducible cassette are to be used in a human patient, it may be preferable for the cell to be an iPSC derived from that individual. This use of autologous cells could eliminate the need for cell matching to a recipient. Alternatively, commercially available iPSCs, such as those from WiCell® (WiCell Research Institute, Inc., Wisconsin, USA), may be used. Alternatively, the cells may be tissue-specific stem cells, which can also be autologous or donated. Suitable cells include epiblast stem cells, induced pluripotent stem cells, and other tissue-specific stem cells. In certain procedures, it may be preferable to use an embryonic stem cell or stem cell line. Numerous embryonic stem cell lines are now available; for example, WA01 (H1) and WA09 (H9) can be obtained from WiCell, and KhES-1, KhES-2, and KhES-3 can be obtained from the Institute for Frontier Medical Sciences, Kyoto University (Kyoto, Japan). It may be preferable for the embryonic stem cell to be derived without destruction of the embryo, particularly when the cells are human, since such techniques are readily available (Chung, Young et al., Cell Stem Cell, Volume 2, Issue 2, 113-117). Stem cell lines derived without destroying an embryo are also available. In one respect, the invention does not extend to any of the methods involving the destruction of human embryos. A preferred aspect of the present invention is the direct programming of pluripotent stem cells into mature cell types. Thus, the method of the invention can be used to manufacture mature cell types from pluripotent stem cells. In this aspect of the invention, the inducible cassette for insertion into the second GSH receptor is preferably one or more master regulators as previously discussed. These inducible cassettes can enable the cell to be programmed into a particular lineage, and different inducible cassettes will be used to direct QPCQ 1 Π / RI Π7 / Ί / YΙΛΙ Differentiation into mature cell types. Any type of mature cell is considered, including but not limited to nerve cells, myocytes, osteocytes, chondrocytes, epithelial cells, secretory cells, and / or blood cells. The inventors of this application have developed a rapid, efficient, and scalable method for generating virtually any type of mature cell. This simple and inexpensive method will be of particular value to regenerative medicine. Previous direct programming techniques used the Tet-On system, but attempted to include all the material in a single vector / site (the all-in-one Tet-On) or tried to insert the inducible cassette into one AAVS1 allele and the control system into the other AAVS1 allele (DeKelver et al., 2010, Genome Res., 20, 1133-43 and Qian et al., 2014, Stem Cells, 32, 1230-8). Surprisingly, the double GSH targeting method developed and described here has many unforeseen advantages. There is no potential promoter interference between the gene inserted in the first GSH and the genetic sequence of the inducible cassette inserted in the second GSH.Second, it allows for the insertion of large vector payloads, as less material is required at each site. Third, the method maximizes the number of safely inserted copies. Fourth, it allows for greater design flexibility. Finally, it allows for the insertion of additional genetic material, including reporter genes and miRNA switches. The method of the invention has proven to be a robust and efficient way to fabricate mature cells from pluripotent cells. Once the gene has been inserted into the first GSH and the inducible cassette comprising a transgene has been inserted into the second GSH, the pluripotent stem cells can be cultured to allow direct programming. These culture conditions may be specific to the type of pluripotent stem cell used, or they may depend on the final type of mature cell. Whatever the culture conditions used, the exogenous substance will control the expression of the genetic sequence within the inducible cassette; and it may either be supplied continuously and then withdrawn to induce transcription or supplied as transcription if required, depending on its mode of action, as discussed previously. If the goal is to program a stem cell, it can be advantageous to provide that cell with extracellular cues to aid differentiation, in conjunction with supplying inducible cassettes that encode master regulators. Cell reprogramming strategies can be enhanced by combining overexpression of the master regulator or transcription factor with extracellular signaling cues. Thus, it may be possible to systematically search for pro-differentiation factors by modulating the major signaling cascades involved in the development of that particular type of mature cell. An example of this is seen in the orco in / R i ηζ / Ί / υιλι Example 3. In one aspect, the present invention provides a method for the production of myocytes from pluripotent stem cells, comprising the steps of: a) the targeted insertion of a gene encoding a transcriptional regulatory protein into a first genetic secure anchoring site; and b) the targeted insertion of the MYOD1 gene operatively linked to an inducible promoter at a second genetic secure anchoring site, wherein said inducible promoter is regulated by the transcriptional regulatory protein; wherein said first and second genetic secure anchoring sites are different, and culturing said cells in the presence of retinoic acid. The MYOD1 gene encodes the Myogenic Differentiation 1 protein. Preferably, retinoic acid (RA) is all trans RA. In another aspect, the present invention provides a method for the production of myocytes from pluripotent stem cells expressing MYOD1, comprising culturing said cells in the presence of retinoic acid. Preferably, the AR is all trans AR. Preferably, the cell overexpresses MYOD1. In a further aspect, the present invention provides a method for the production of oligodendrocyte myocytes from pluripotent stem cells, comprising the steps of: a) the targeted insertion of a gene encoding a transcriptional regulatory protein into a first genetic secure anchoring site; and b) the targeted insertion of the SOX 10 gene operatively linked to an inducible promoter at a second gene secure anchor site, wherein said inducible promoter is regulated by the transcriptional regulatory protein; wherein said first and second gene secure anchor sites are different, and culturing said cells in the presence of retinoic acid. The cells used for this can be animal or human cells. If the cells are animal, it is preferred that the animal be a livestock animal as previously defined. The SOX-10 gene encodes the SOX-10 transcription factor. Preferably, retinoic acid (RA) is all trans-RA. When the cell used in the methods of the invention is pluripotent, the resulting cell can be a lineage-specific stem cell, progenitor cell, or a mature cell type with the desired properties, due to the expression of a master regulator. These lineage-specific stem cells, progenitor cells, or mature cells can be used in QPCQ ! n / RI Π7 / Ί / YΙΛΙ any suitable method. For example, mature cells can be used directly for transplantation into a human or animal body, as appropriate for the cell type. Alternatively, the cells can form a test material for research, including the effects of drugs on gene expression and the interaction of drugs with a particular gene. Research cells may involve the use of an inducible cassette with a genetic sequence of unknown function, to study the controllable expression of that genetic sequence. In addition, it can enable the cells to be used to produce large quantities of desirable materials, such as growth factors or cytokines. In a different aspect, cells can be used in tissue engineering. Tissue engineering involves generating tissue that could be used to replace tissues or even entire organs in a human or animal. Tissue engineering methods are well-known to experts in the field, but they include the use of a scaffold (an extracellular matrix) to which cells are applied to generate tissues / organs. These methods can be used to generate a trachea, bladder, liver, pancreas, stomach, intestines, blood vessels, heart tissue, bone, bone marrow, mucous tissue, nerves, muscle, skin, artificial kidneys, or any other tissue or organ. Methods for generating tissues can include additive manufacturing, also known as three-dimensional (3D) printing, which can involve directly printing cells to form tissues.The present invention thus provides a method for generating tissues using the cells produced as described in any aspect of the invention. Tissues generated using cells produced according to the methods of the present invention can be used for transplantation into the human or animal body. Alternatively, if the cells are from an animal, the tissues can be used for cultured meat. The primary cell type for cultured meat is myocytes. This tissue may, however, involve the use of a combination of cell types produced according to the methods of the invention. These may include myocytes (muscle cells), blood vessel cells, blood cells, and adipocytes (fat cells). If the intended use of the engineered tissue is for cultured meat, then the cells may be taken from a livestock animal. The methods of the invention can also be performed on cells that are not pluripotent stem cells, for a variety of reasons, including research, gene therapy including genetic vaccines, production of in vitro disease models and production of non-human in vivo models. The cells used in the method of the invention can thus be any type of adult stem cell; these are unspecialized cells that can develop into many, but not all, cell types. Adult stem cells are undifferentiated cells. Adult stem cells are cells found throughout the body that divide to replace dying cells and regenerate damaged tissues. Also known as somatic stem cells, they are not pluripotent. Adult stem cells have been identified in many organs and tissues, including the brain, bone marrow, peripheral blood, blood vessels, skeletal muscle, skin, teeth, heart, intestines, liver, ovarian epithelium, and testes. To label a cell as a somatic stem cell, the expert must demonstrate that a single adult stem cell can generate a line of genetically identical cells that then give rise to all the appropriate differentiated cell types of the tissue.To experimentally confirm that a purported adult stem cell is indeed a stem cell, the cell must either give rise to genetically identical stem cells in culture, or a purified population of these cells must repopulate the tissue after transplantation in an animal. Suitable cell types include, but are not limited to, neural, mesenchymal, and endodermal stem and precursor cells. Alternatively, the cells used can be a mature cell type. These cells are differentiated and specialized and are not capable of developing into a different cell type. Mature cell types include, but are not limited to, nerve cells, myocytes, osteocytes, chondrocytes, epithelial cells, secretory cells, and / or blood cells. Mature cell types could be any cell in the human or animal body. Somatic stem cells and mature cell types can be modified according to the present invention and then used for applications such as gene therapy or genetic vaccination. Gene therapy can be defined as the intentional insertion of foreign DNA into the nucleus of a cell for therapeutic purposes. This definition includes the provision of a gene or genes to a cell to provide a wild-type version of a faulty gene, the addition of genes for RNA molecules that interfere with the expression of a target gene (which may be defective), the provision of suicide genes (such as the herpes simplex virus enzymes thymidine kinase (HSV-tk) and cytosine deaminase (CD) that convert the harmless prodrug ganciclovir (GCV) into a cytotoxic drug), DNA vaccines for immunization or cancer therapy (including adoptive cell immunotherapy), and any other provision of genes to a cell for therapeutic purposes. Typically, the method of the invention can be used to insert a desired genetic sequence into a cell for transcription, preferably for expression, particularly in DNA vaccines. DNA vaccines typically encode a modified form of DNA from an infectious organism. These vaccines are administered to a subject where they express the selected protein from the infectious organism, initiating an immune response against that protein, which is typically protective. DNA vaccines can also encode a tumor antigen in a cancer immunotherapy approach. QPCQ 1 Π / Α I Π7 / 3 / ΥΙΛΙ A DNA vaccine may comprise a nucleic acid sequence that encodes an antigen for the treatment or prevention of a number of conditions including but not limited to cancer, allergies, toxicity, and infection by a pathogen such as, but not limited to, fungi, viruses including Human Papillomavirus (HPV), HIV, HSV2 / HSV1, Influenza Virus (types A, B, and C), Polio Virus, RSV Virus, Rhinovirus, Rotavirus, Hepatitis A Virus, Measles Virus, Parainfluenza Virus, Mumps Virus, Varicella-Zoster Virus, Cytomegalovirus, Epstein-Barr Virus, Adenovirus, Rubella Virus, Human T-cell lymphoma virus type I (HTLV-I), Hepatitis B Virus (HBV), Hepatitis C Virus (HCV), Hepatitis D Virus, Varicella Virus, Zika Virus, Marburg Virus, and Ebola Virus; bacteria including Meningococcus, Haemophilus influenzae (type b); and parasitic pathogens.DNA vaccines can comprise a nucleic acid sequence that encodes an antigen from any suitable pathogen. The antigen can be from a pathogen responsible for a human or veterinary disease, and in particular, it can be from a viral pathogen. DNA vaccines inserted into GSH may also comprise a nucleic acid sequence encoding tumor antigens. Examples of tumor-associated antigens include, but are not limited to, cancer antigens such as members of the MAGE family (MAGE 1, 2, 3, etc.), NY-ESO-I, and SSX-2; differentiation antigens such as tyrosinase, gplOO, PSA, Her-2, and CEA; self-mutated antigens; and viral tumor antigens such as E6 and / or E7 of oncogenic HPV types. Additional examples of particular tumor antigens include MART-I, Melan-A, p97, beta-HCG, GalNAc, MAGE-I, MAGE-2, MAGE-4, MAGE-12, MUGI, MUC2, MUC3, MUC4, MUC18, CEA, DDC, PIA, EpCam, melanoma antigen gp75, Hker 8, high molecular weight melanoma antigen, Kl 9, Tyrl, Tyr2, pMel 17 gene family members, c-Met, PSM (prostate mucin antigen), PSMA (prostate-specific membrane antigen), prostate secretory protein, alpha-fetoprotein, CA 125 antigen, CA 19.9, TAG-72, BRCA-I y BRCA-2. The inserted genetic sequence can produce other types of therapeutic DNA molecules. For example, these DNA molecules can be used to express a functional gene when a person has a genetic disorder caused by a dysfunctional version of that gene. Examples of such diseases include Duchenne muscular dystrophy, cystic fibrosis, Gaucher disease, and adenosine deaminase (ADA) deficiency. Other diseases where gene therapy may be useful include inflammatory, autoimmune, chronic, and infectious diseases, including disorders such as AIDS, cancer, neurological diseases, cardiovascular disease, hypercholesterolemia, various blood disorders including anemias, thalassemia, and hemophilia, and emphysema.For the treatment of solid tumors, genes encoding toxic peptides (i.e., chemotherapeutic agents such as ricin, diphtheria toxin, and cobra venom factor), tumor suppressor genes such as p53, and genes encoding other genes can be expressed. QPCQ 1 Π / Α I Π7 / 3 / YΙΛΙ mRNA sequences that are antisense to transforming oncogenes, antineoplastic peptides such as tumor necrosis factor (TNF) and other cytokines, or transdominant negative mutants of transforming oncogenes. Other types of therapeutic DNA molecules are also considered. For example, DNA molecules that are transcribed can be inserted into an active, non-coding RNA form, such as a small interfering RNA (siRNA). The methods of the invention thus extend to methods of reducing endogenous gene expression or deactivating endogenous genes using non-coding RNAs within the inducible cassette. Thus, the method of the invention can be used to specifically and stably insert a genetic sequence into the inducible cassette, which can then be transcribed in a controllable manner. This has many advantages in somatic stem cells and mature cell types. It allows for more tightly regulated gene therapy approaches, ensuring that critical genes are not disrupted and permitting the inducible cassette's expression to be switched off if any adverse effects occur. It also allows for gene expression reduction or gene deactivation of the closely regulated endogenous gene to investigate gene function and development. The invention extends to cells produced by the method of the invention. The cells can be defined as being modified at a first genomic secure attachment site to include a transcriptional regulatory protein and at a second genetic secure attachment site to include a genetic sequence operatively linked to an inducible promoter that is regulated by the transcriptional regulatory protein. The two GSH molecules are different and distinct. Preferably, the cells are homozygous at both insertion sites. All elements are as previously described. Cells produced according to any of the methods of the invention have applications in diagnostic and therapeutic methods. The cells can be used in vitro to study cell development, provide a testing system for new drugs, enable the development of research methods, scrutinize therapeutic regimens, provide diagnostic tests, and the like. These uses are part of the present invention. Alternatively, the cells can be transplanted into a human or animal patient for diagnostic or therapeutic purposes. The use of the cells in therapy is also included in the present invention. The cells can be allogeneic (i.e., mature cells removed, modified, and returned to the same individual) or from a donor (including a stem cell line). All documents mentioned as references herein are hereby incorporated for reference purposes. QPCQ 1 Π / RI Π7 / 3 / YILI Sequences: AAVS1 - NCBI GenBank S51329.1 SEQ ID No 1 : Sequence of Tet02 19n SEQ ID No 2: Genomic sequence of the hROSA insertion site SEQ ID No 3 : STDtetR-nls (nucleotide) and SEQ ID No 4 - STDtetR-nls (amino acid) SEQ ID No 5 : OPTtetR-nls (nucleotide) and SEQ ID No6 - OPTtetR-nls (amino acid) SEQ ID No 7 to 80: Primers from Table 3. SEQ ID No 81: Figure 18B AAVS1 FWD; SEQ ID No 82: Fig 18B AAVS1 REV SEQ ID No 83: Figure 18B FWD tracer; SEQ ID No 84: Fig 18B REV tracer SEQ ID No 85: Figure 19E HI POL3 FWD; SEQ ID No 82: Fig 19E HI POL3 REV This is the genomic sequence of the insertion site of hROSA26; includes the 5' homology arm, the cut site (bolded), and the 3' homology arm: (SEQ ID NO 2) GCTCGAAACCGGACGGAGCCATTGCTCTCGCAGAGGGAGGAGCGCTTCCGGCTAGCCTTGTCGCCGATTG GCCGTTTCTCCTCCCGCCGTGTGTGAAAACACAAATGGCGTATTCTGGTTGGAGTAAAGCTCCTGTCAGTTAC GCCGTCGGGAGTACGCAGCCGCTTAGCGACTCTCGCGTTGCCCCCTGGGTGGGGGGGTAGGTAGGGGGG TGTAGAGATGCTGGGTGTGCGGGCGCGGCCGGCCTCCTGCGGCGGGAGGGGAGGGTCAGTGAAATCGGCTC TGGCGCGGGCGTCCCCCCTCCCCTTCCTCGGGGAGTCGGTTTACCCGGCCTGCTTGTCTTCGAC ACCTGATTGGCTGTCGAAGCTGTGGGACCGGGCCCTTGCTACTGGCTCGAGTCTCACATGAGCGAAACCACT GCGCGGGGCGCGGGGTGGCGGGGAGGCGGGCGTTGGTACGGTCCTCCCCGAGGCCGAGCGCCAGTGT CTGGCCCCGCGCCCCTGCGCAACGTGGCAGGAAGCGCGCGCTGGAGGCGGGGCGGGCTGCCGGCCGAGAC TTCTGGATGGCGGCGGCCGCGCTCCGCCCCGGGTTCCCCACCGCCTGAAGGGCGAGACAAGCCCGACCTGCT ACAGGCACTCGTGGGGGTGGGGGAGGAGCGGGGGTCGGTCCGGCTGGTTTGTGGGTGGGAGGCGCTTGTT CTCCAAAAACCGGCGCGAGCTGCAATCCTGAGGGAGCTGCGGTGGAGGAGGTGGAGAGAAGGCCGCACCCTTCTGGGCAGGGGGAGGGGAGTGCCGCAATACCTTTATGGGAGTTCTCTGCTGCCrCCCGTCTTGTAAGGACC GCCCTGGGCCTGGAAGAAGCCCTCCCTCCTTTCCTCCTCGCGTGATCTCGTCATCGCCTCCATGTCGAGT CGCTTCTCGATTATGGGCGGGATTCTTTTGCCTAGGCTTAAGGGGCTAACTTGGTCCCTGGGCGTTGCCCT GCAGGGGAGTGAGCAGCTGTAAGATTTGAGGGGCGACTCCGATTAGTTTATCTTCCCACGGACTAGAGTTGG TGTCGAGGTTATTGTAATAAGGGTGGGGTAGGGAAATGGAGCTTAGTCATTCACCTGGGGCTGATTTTATGC AACGAGACTGCGGATTATCACTACTTATCATTTTTGGAGCATTTTTCTAGAGACAGACATAAAGCATGATCAC CTGAGTTTTATACCATTTGAGACCCTTGCTGCACCACCAAAGTGTAGCATCAGGTTAAATCTTAATAGAAAAA TTTTAGCTTTTGCTTGAGAAACCAGTGCTTCCCTCCCTCACCCTCTCTCCCCAGGCTCTCTACCCCTTTGCATC CCTACCAGGCATCTTAGCAACTCTCACTCATACTTGATCCCATTTTCCATTTGTTGTACTTGCTCCTCTAGTAT TCAGACATAGCACTAGCTTTCTCCCTCTCTTGATCTTGGGTAGCCTGGTGTCTCGCGAAACCAGACAGATTGG TTCCACCACAAATTAAGGCTTGAGCTGGGGCTTGACTCTTACCCAGCAGTGCTTTTATTCCTCCCTAGTTCAC orco i n / R i ηζ / Ί / υιλι GTTCTTAAATGTTTATCTTGATTTTCATTTTATCCTTTTTCCTTAGCTGGGATTCTGTCCCTGACCGTCTTCAC AGTCCAGGTGATCTTGACTACTGCTTTACAGAATTGGATCTGAGGTTAGGCAACATCCCTTTTTCTTCC TCTAAATACCTCATTTCTGTCTTACCA STDtetR-nls: (SEQ ID No. 3 and 4) Nudeotide and amino acid sequences of the tetracycline-sensitive repressor protein (tetR) containing an N-terminal SV40 nuclear localization signal (nls, highlighted in gray). Sequences are reported either before or after codon optimization (STDtetR and OPTtetR, respectively). The dots indicate the synonymous mutations introduced in the OPTtetR. ATGCCAAAAAAGAAGAGGAAGGTATCTAGATTAGATAAAfi^TAAAGTGATTAACAGCGCATTAGAGC KFKKKRKV See KLDKSKVINS ON LEL TGCTrñATGAGGTCGGAATCGAAGGTTTAACAACCCGTAAACTCGCCCAGAAGCTAGGTGTAGCA LNEVG LNEVG ΡCLA R'E* GCCTACÁTrGTÁTT&GCATCTAAAÁAATAAGCGGGCl'TFGCTCGACGCCTTAfíCCATTSAGATGTTA ΡΪΧ» S ERVEN E RAL LOALAIEML GATAGGCACCATACTCACTTTTT^CCTTTAAGGGGAAAGCTGGCAAGATTTTrTACGTAATAACG > R Η ETHPCPLEGESWS β FLR Η NA CTAAAAGTTTTAGATGTGCTTT^TAAGTCCATACGATACGAGGATTGAGTTGATT KSFROALL with HRDGAKV Ξ LGTRP TACAGAAAAACAGTATGAAACTGTCGAAAATCAAT'TAGQCTT'TTTATGC-C.AAC AAGGT'Z'TTTCACTA TEKQXETLESQLAFXiCSeGFSL· GAGAATGCATOATATGCACTCA^GCTGTGGGGGATTTTACTTTAGGTTGCGTATTAGGGAGGANA BaATTAGAT. YAI.SAVGHFTLGCVLEDQE AGCKTCAAGTC<^TAAAGAAGAAAG <R3AAACACCTACTACTGATAGTATGCCGCCATTATTACGACA HQVAKEERETPS XDSMPPX.LRQ AfíCTATCi^TTATTTGA'TCACCAAGGTGCAGAGCCAGCCTTCTTATTOGGCC'TTGAATTGATCATA ΑΙΕΙ> ΡΒΗβ£ΑΕΡΑΡΐ4 Ρβ1«ΕΣίΙ I TGCGGATTAGAAAAACAACTTAAA^GrGAAAGTGGGTCTCCGCGGTAA CGI» EK fi LKCESGSPR * QPCQ ! n / RI Π7 / Ί / ΥΙΛΙ The sequence for the optimized tetR: OPTtetR-nls (SEQ ID NO 5 and 6): VV * F 'β. V-·· Λ Γ Μ η V * kj* ATGCCCMeAAAXAGCGGAAGGTGTCCCGGCTGGACAAGAGCAAACTGATCAACíxGCCCCeTGGAAC MPKKKRKVSRLPKQVIKSALEX. L· Η E* VGIEG '1 / T* TRK ' LA 2 X *L> GVE 2 gccl\accctgtactggcacgtgaa^ac^gcggcíccctgctggacgc:cc!?isgccatcgagatgctg PT '¿ Ϊ W Η VK '» KR to *¿ LBA ¿ 'to Ϊ *SM ¿ GAC€GGCACCACACACACrrTTTGCCCCCTGGAAGGCGAAAGCrGGCAGGACTTCCTGCGGAACAACG D 'r B Η 'Τ HFCP '¿ Ε GESWQB 'p ¿ RNNA CCAÁGAGeTTCAGATGCGCCCTC«TGAGCCACCGGC^CGGCG.CCAi\ÁGTGCACCTGGÍSCACCAGACC KSF \ CALL 's HRBGAKVHL 'fi TRP caccgagaagcagtacgagacagtggaaaaccaqztggccttcctgtgccagcagggcttcagcctg TEKQ ¥ ETL 'l NQI» AFLCQQGFSL· GAAAACGCCCTGTACGCCCTGAGCGCCGTGGGCCAOTT'TACaCTGGGCTGCGTGCTGGAAGATCAGG IN ¿ Ϊ AL 's AVGHFT ¿ GCVLEBQE AACACeAGGlPCGCCAAAGj\ <SGAAAGAGAGACAC'CCACCACCGí.CAGCA(rGCCCCC!CCTGC'I’GA.GACA E 'g VA 'k 1 's R ”s: 't F Φ Τ BE 'tt F 'p '¿ ¿ R g GGCCATeGAGCTGTTCGATCATCAAGGCGCCGAGCCCGCCTTCCTGTTCGGCCTGGAAC'rGATCATC 'a IELF *D ag GA 'e FAF ¿ FGL *E ¿ II SGGGGCGTCGÁGAAGC^GCTGxAAGTGCGÁGAGCGGGI'C'CCCCáGÁÍ^GA CG '¿ EKQLKC 'e S *GSFR '*' QPCQ ! n / RI Π7 / 3 / ΥΙΛΙ The invention will now be described in relation to the following non-limiting examples: EXAMPLES Materials and Methods used in the Examples: hPSC maintenance culture and germ layer differentiation Feeder-fed and serum-free hESC cultures (H9 line; WiCell) and hiPSC cultures were performed (Cheung et al, Nat. Biotechnol. 30,165-173 (2012)). Briefly, cells were placed on plates in culture dishes coated with gelatin / MEF medium [the MEF medium consisted of Advanced DMEM / F12 (90%, Gibco), fetal bovine serum (10%, Gibco), L-Glutamine (1 mM, Gibco), 2-Mercaptoethanol (0.1 mM, Sigma-Aldrich), and Penicillin / Streptomycin (1%, Gibco)], and cultured in chemically defined medium [CDM, consisting of IMDM (50%, Gibco), F12 (50%, Gibco), concentrated lipids (100x, Gibco), monothioglycerol (450 μM, Sigma-Aldrich), insulin (7 pg / ml, Roche), transferrin (15 pg / ml, Roche), bovine serum albumin fraction V (5 mg / ml), and Penicillin / Streptomycin]. (1%)] supplemented with 10ng / ml Activin-A and 12ng / ml FGF2. The cells were passed in small batches using collagenase every 5 to 6 days. Differentiation of hPSCs into germ layers was induced in adherent hESC cultures according to previously published directed differentiation protocols for endoderm, lateral plate mesoderm, and neuroectoderm (Touboul, T. et al. Hepatology 51, 1754-1765 (2010), Cheung et al., (2012) and Douvaras, P. et al. Stem Cell Reports 3, 250-259 (2014).) Briefly, the definitive endoderm was derived by culturing hPSCs for 3 days in CDM-PVA (without insulin) supplemented with FGF2 (20 ng / ml), Activin-A (10 ng / ml), BMP4 (10 ng / ml, Marko Hyvonen, Dept. of Biochemistry, University of Cambridge), and LY-294002 (10 μM, Promega) 3. For neuroectoderm derivation, hPSCs were cultured for 6 days in CDM-BSA supplemented with SB-431542 (10 μM, Tocris), LDN-193189 (0.1 μM, Tocris) and AR (0.1 μM, Sígma) 4. Lateral plate mesoderm was obtained by culturing hPSCs for 36 h in CDMPVA supplemented with FGF2 (20 ng / ml), lOng / ml BMP4 (R&D), and LY294002 (10μM), and for 3.5 subsequent days in CDM-PVA supplemented with FGF2 (20ng / ml) and BMP4 (50ng / ml). Differentiation of hESCs. Differentiation was initiated in adherent hESC cultures 48 h after the initial passages. Medium changes were generally performed daily, and volumes were adjusted for cell density. Mature cell types were obtained using methods previously described in this technique. The mature cell types obtained included neural cells, osteocytes, chondrocytes, smooth muscle cells, cardiac fibroblasts, cardiomyocytes, intestinal cells, pancreatic cells, hepatocytes, cholangiocytes, and lung cells. Gene targeting constructs and molecular donation The design and construction of the hROSA26 gRNA and Cas9n expression plasmids are described here: A CRISPR / Cas9n-based strategy was used to specifically target the hROSA26 site and to insert inducible cassettes using homologous recombination. To induce a genomic DSB at the correct integration site, a CRISPR / Cas9 nickase system was designed. In contrast to the commonly used wild-type Cas9 nuclease, which is guided by a single gRNA at its genomic target site, the mutant D10A Cas9 nickase (Cas9n) is guided by a pair of gRNAs appropriately designed to simultaneously introduce single-strand breaks into both strands of the target DNA. This strategy effectively doubles the number of bases required for genome editing and thus increases specificity. The CRISPR Design Tool network-based software was used to define potential target sites for crRNA-guided nucleases that are close to the integration site.Within a sequence range of 250 bp around the target site (125 bp at each site of the actual integration site), the top hit yielded a pair of gRNAs that collectively achieved a high-quality score of 97, with no prediction of off-target effects. The gRNAs [gRNA-A 5'-GTCGAGTCGCTTCTCGATTA-(TGG)-3' and gRNA-B 5'GGCGATGACGAGATCACGCG-(AGG)-3' (PAM sites in parentheses)] were synthesized de novo and ligated into expression vectors. The final plasmids encode either of the two gRNAs, respectively, and the Cas9n D10A mutant (Figures 20 and 21). A donor plasmid was constructed that serves as a template DNA to facilitate homology-directed repair of a Cas9n-induced DSB. Two arms were generated. QPCQ ! Π / RI Π7 / Ί / YΙΛΙ of OSA26 homology by high-fidelity PCR amplification. Genomic DNA isolated from H9 hESCs served as a template. The 5' and 3' homology arms were 904 bp and 869 bp in length, respectively. Both were subsequently inserted into the multiple cloning site of the pUC19 vector. To target the hROSA26 locus, cells were transfected with the plasmid, the gRNA / Cas9n construct, and the EGFP donor plasmid (Figure 22). The pR26_CAG-rtTA targeting vector (Figure 23) was constructed by cloning the coding sequence of a third-generation rtTA (PCR-amplified from pLVX-Tet3G) into the BamHI / MIuI sites of pR26_CAG-EGFP, thereby replacing the EGFP sequence. The AAVS1 ZFN expression plasmids were generously donated by Dr. Kosuke Yusa (Wellcome-Trust Sanger Institute). The inducible EGFP AAVSl targeting vector was constructed by Gibson Assembly (New England Biolabs) in which three inserts were ligated into the EcoRI / HindIII sites of the multiple cloning site of the pUC19 vector (Thermo Fisher Scientific): The first insert comprised the 5' homology arm of AAVSl, a splice acceptor, a T2A site, and the puromycin resistance cassette (PCR-amplified from pTRE-EGFP; addgene 22074, deposited by Rudolf Jaenisch). The second insert contained the inducible TRE3G promoter (PCR-amplified from pLVX-TRE3G).The third insert comprised the expression of the EGFP cassette and the AAVS1 homology arm in the 3' direction (PCR-amplified pTRE-EGFP; addgene 22074, deposited by Rudolf Jaenisch). The resulting plasmid was named pAAV_TRE-EGFP (Figure 32). The targeting vectors pAAV_TRE-NGN2 and pAAV_TRE-MYOD1 (Figure 33) were constructed by cloning the coding sequence NGN2 and MYOD1, respectively (NGN2: PCR amplified from pLVX-TRE-NGN2, gift of Oliver Brüstle; MYOD1: PCR amplified from a commercially available cDNA plasmid, Open Biosystems MHS6278-202832821, Accession: BC064493, Clone ID: 5022419) into the Spel / EcoRI sites of pAAV_TRE-EGFP, thereby replacing the EGFP sequence. Additional plasmids were also created using similar methods, and all the plasmids used are depicted in Figures 20 to 33. These plasmids were either created or generously donated. The plasmids used in the examples include (in order from Figures 20 to 33): pSpCas9n(BB),_R26-R, pSpCas9n(BB) (the combination of these two plasmids is predicted to induce a specific double-strand break in the intron between exons 1 and 2 of THUMPDS3AS1 on chromosome 3 (ROSA26 site)),_R26-L, pR26_CAG_EGFP, pR26_CAG_rtTA, pZFN-AAVSl-LELD (left zinc finger nuclease), pZFN-AAVSl-R-KKR (right zinc finger nuclease), pAAV_CAG_EGFP (donor), pR26-Neo_CAG-OPTtetR (optimized codon-optimized hROSA26 terR targeting), pAAV-Puro_¡KD (targeting of AAVSl of inducible RNA), pAAVNeo_CAG-Cas9 (Cas9 targeting AAVSl), pAAV-Puro_s¡KO (inducible gRNA targeting AAVSl), pAAV-Puro_s¡KO-2TO (inducible gRNA targeting AAVSl, version QPCQ 1 fi / AI Π7 / 3 / YΙΛΙ with 2 tet operons in the promoter), pAAV_TRE-EGFP (inducible overexpression of EGFP, bound) and pAAV_TRE-MYODl (inducible overexpression of MYOD1 for muscle). Gene targeting Targeting of the hROSA26 and AAVS1 sites for gene expression reduction and gene inactivation was performed by nucleofection. Human pluripotent stem cells (PSCs) were dissociated into single cells using TrypLE Select (Gibco), and 2 x 10⁶ cells were nucleofected (1000 pi of reaction volume; total of 12 pg of DNA, which was divided equally between the two gRNA / Cas9n plasmids and the targeting vector) using the Lonza P3 Primary Cell 4D-Nucleofector X Kit and the CA-137 cycle of the Lonza 4D-Nucleofector System. Nucleofected hPSCs were plateped onto multidrug-resistant (DR4) mouse embryonic fibroblasts and cultured in KSR medium [consisting of Advanced DMEM / F12 (80%), gene-killing serum replacer (20%, Gibco), L-Glutamine (1 mM), 2-Mercaptoethanol (0.1 mM) and Penicillin / Streptomycin (1%)] supplemented with FGF2 (4ng / ml, Department of Biochemistry, University of Cambridge).Y-27632 (5 μM, Tocris) was added for 24 h before and after nucleofection to promote cell survival. After 3 to 6 days, neomycin-resistant hPSCs were selected by adding G418 (50 pg / ml, Sigma-Aldrich) for 7 to 10 days. Subsequently, individual clones were selected, expanded under feeder-free conditions, and finally analyzed by genotyping. Targeting of the AAVS1 site was also performed by lipofection. Human PSCs were seeded under feed-free conditions in 6-well plates and transfected 48 h post-infection. Transfection was performed on Opti-MEM (Gibco) supplemented with Lipofectamine 2000 (10 µL / well, Thermo Fisher Scientific) and a total of 4 pg of DNA (divided equally between the two AAVS1 ZFN plasmids and the targeting vector) for 24 h. After 3–5 days, resistant hPSCs were selected by adding puromycin (1 pg / ml, Sigma-Aldrich) for 5–8 days. Subsequently, individual clones were selected, expanded, and analyzed by genotyping. Antibiotic resistance can be used to select clonal lines. Drug-resistant hPSC clones from targeting experiments were investigated by genomic PCR to verify site-specific inducible cassette integration, to determine the number of target alleles, and to exclude off-target integrations. PCRs were performed using LongAmp Taq DNA Polymerase (New England Biolabs). Table 2 reports the initial combinations used for the various targeting vectors. The results of all targeting experiments are summarized in Table 1. Karyotype analysis was performed using standard G-banding techniques (Medical Genetics Service, Cambridge). University Hospitals). To prepare human PSCs for chromosome analysis, cells were incubated in fresh culture medium supplemented with Y-27632 (5 μM, Tocris) and KaryoMAX Colcemid (100 ng / ml, Gibco) for 4 h at +37°C. Subsequently, the cells were harvested as single cells, washed, and pelleted. Nuclear swelling and chromosome dissemination were achieved by treatment with 0.055 M hypotonic KCl solution for 5–10 min. Finally, the cells were fixed with methanol and glacial acetic acid (3:1 ratio). For OPTiKD, AAVS1 targeting was performed by lipofection as previously described. Briefly, hPSCs were seeded in feed-free, 6-well plates and transfected 48 h post-pass with 4 pg of DNA (divided equally between the two AAVS1 ZFN plasmids and the targeting vector) using 10 pg per well of Lipofectamine 2000 in Opti-MEM medium (Gibco) for 24 h, all according to the manufacturer's instructions. After 4 days, 1 pg ml⁻¹ of Puromycin was added to the culture medium, and individual clones were selected and expanded after 7–10 days of selection. For a single OPTiKO site, AAVS1 targeting was performed by nucleofection. hESCs pre-treated for 16 h with Y-27632 10 pM (Tocris) were dissociated into clusters of 2 to 8 cells using Accutase (Gibco), and 2 x 106 cells were nucleofected into 100 pl with a total of 12 pg of DNA (4 pg for each of the two ZFN plasmids, and 2 pg each of the two targeting vectors) using the Lonza P3 Primary Cell 4D-Nudeofector X kit and the CA-137 cycle in a Lonza 4D-Nudeofector system, all according to the manufacturer's instructions. Nucleo-affected hESCs were placed on plates over a feeder layer of irradiated DR4 (puromycin- and neomycin-resistant) mouse embryonic fibroblasts and cultured in KSR medium supplemented with 4 ng ml-1 FGF2 and Y-27632 10 pM (the latter only for the first 24 h).After 4 days, hPSC colonies carrying both the puromycin and neomycin resistance genes were selected for 7 to 10 days with 25 pg ml-1 of Geneticin (G418 Sulfate, Gibco) and 0.5 pg ml-1 puromycin. Individual clones were then selected and expanded under feeder-free conditions. AAVS1-EGFP, ROSA26-EGFP, ROSA26-STDtetR, ROSA26-OPTtetR, and ROSA26-EGFPd2 hESCs were generated by lipofection (AAVS1 site) or nucleofection (ROSA26 site) of the targeting vectors with AAVS1 ZFN or ROSA26 CRISPR / Cas9n pairs (as previously described). 2 pg ml⁻¹ Blasticidin S-HCI (Gibco) was used for the pR26-Bsd_CAG-EGFPd2 plasmid. The generation of inducible EGFP overexpression hESCs carrying ROSA26-rtTA and AAVS1-TRE-EGFP transgenes is described elsewhere. Briefly, the cells were first targeted by the gene sequentially by nucleofection of pR26-Neo_CAG-rtTA with ROSA26 CRISPR / Cas9n plasmids, then by lipofection of pAAVPuro_TRE-EGFP with AAVS1 ZFN plasmids. hPSC target gene gel clonal lines were investigated by genomic PCR for QPCQ 1 Π / AI Π7 / 3 / YILI verify site-specific targeting, determine the number of target alleles, and exclude off-target integrations of the targeting plasmid (see Figure 16A). Overexpression of the inducible cassette Overexpression of inducible cassettes (EGFP, NGN2, MYOD1, and OLIG2-SOX10, respectively) was induced by adding doxycycline hyclate (Sigma-Aldrich) to the culture medium. Unless otherwise stated, doxycycline was used at a final concentration of 1 pg / ml. The doxycycline-containing medium was kept protected and changed every 24 hours. Cells expressing EGFP are hereby designated OPTi-EGFP, those expressing NGN2 are designated OPTi-NGN2, cells expressing MYOD1 are designated OPTi-MYOD1, and cells expressing OLIG2-SOX10 are designated OPTi-OLIG2-SOX10. Gene inactivation and reduction of gene expression of the inducible gene. Unless otherwise described in the legends of the Figures or Examples, tetracycline hydrochloride (sigma-Aldrich) at 1 pg / 1000 was used to induce the reduction of gene expression or gene inactivation of the gene. Induction of neurons Pluripotent OPTI-NGN2 cells were dissociated into single cells using TrypLE and plated on Matrigel-coated plates (35 pg / cm², Scientific Laboratory Supplies) at a density of 75,000 cells per well in a 12-well plate. Direct programming was initiated 24 to 48 hours post-division. Unless otherwise noted, induction was performed in DMEM / F12 (Gibco) supplemented with Glutamax (100x, Gibco), Non-Essential Amino Acids (100x, Gibco), 2-Mercaptoethanol (50 pM), Penicillin / Streptomycin (1%), and doxycycline (1 pg / ml). After 2 days of induction, the medium was changed to Neurobasal medium supplemented with Glutamax (100x), B27 (50x, Gibco), BDNF (10 ng / ml, Peprotech), NT3 (10 ng / ml, R8iD Systems), Penicillin / Streptomycin (1%), and doxycycline (1 pg / ml). Induction of skeletal myocytes Pluripotent OPTi-MYODl cells were dissociated into single cells using TrypLE and plated on gelatin-coated plates / MEF medium at a density of 100,000 cells per well in a 12-well plate. Direct programming was initiated 24 to 48 hours post-division. Unless otherwise noted, induction was performed in DMEM (Sigma-Aldrich) supplemented with L-glutamine (2 mM), 2-mercaptoethanol (50 pM), penicillin / streptomycin (1%), insulin (7 pg / ml), all-trans retinoic acid (1 pM, Sigma-Aldrich), and doxycycline (1 pg / ml). After 5 days of induction, the medium was supplemented with CHIR99021 (3 pM, Tocris) and heat-inactivated horse serum (2%, Gibco) to enhance maturation. QPCQ ! Π / RI Π7 / 3 / YΙΛΙ Pluripotent oodendrocytes (hPSCs) OLIG2-2A-SOX10 OPTi-OX were cultured in colonies on gelatin / MEF-coated plates. Before induction, they were treated with SB and LDN overnight. The following day, induction was initiated on CDM supplemented with doxycycline (1 pg / ml) and AR (0.1 μM). One day after induction, the cells were divided on CDM supplemented with AR (0.1 μM), PM (1 μM), and Y-27632 (5 μM), PDGFaa (20 ng / ml, Peprotech), and FGF2 (5 ng / ml) on PDDL / laminin-coated plates (100,000 cells per well of a 12-well plate). The next day the cells were changed to oligodendrocyte medium consisting of DMEM / F12, supplemented with Glutamax (100x), Non-Essential Amino Acids (100x), 2-Mercaptoethanol (1000x), Penicillin-Streptomycin (100x), N2 Supplement (100x), B27 Supplement (50x), Insulin 7 pg / ml (Marko Hyvonnen), T3 60 ng / ml (Sigma), Biotin 100 ng / ml (Sigma), db-cAMP 1 μM (Sigma).Oligodendrocyte medium was supplemented with doxorubicin (1 pg / ml), PDGFaa (20 ng / ml), FGF2 (5 ng / ml), AR (0.1 μM), and PM (1 μM). Seven days post-induction, AR and PM were removed. To maintain the induced cells in a proliterative state, the cells were passed every 4 days (75,000 cells per well of a 24-well plate) in the continuous presence of the mitogens PDGFaa and FGF2. For differentiation into proliferative oligodendrocyte precursors, PDGFaa and FGF2 were removed. Recombinant human NT3 (5 ng / μL, R&D Systems) was added to enhance cell survival. Quantitative real-time PCR (qPCR) RNA was extracted using the GenElute Mammalian Total RNA Miniprep Kit and the On-Column DNase I Digestion Kit (Sigma-Aldrich). cDNA synthesis was performed using the Maxima First Strand cDNA Synthesis Kit (Thermo Fisher Scientific). Applied Biosystems SYBR Green PCR Master Mix was used for qPCR. Samples were run on an Applied Biosystems 7500 Rapid PCR machine. All samples were analyzed in technical duplicates and normalized to the Porphobilinogen Deaminase 1 (PBGD) maintenance gene. The results were analyzed using the AACt method. See Table 3 for primer sequences. Flow cytometry For EGFP expression analysis, cells were harvested using TrypLE Select (Gibco) for 5 to 10 minutes at 37°C to obtain a single-cell suspension. After washing with PBS, the cells were resuspended in ice-cooled PBS supplemented with DAPI (10 pg / ml) and incubated for 5 minutes on ice. Cells were analyzed using a Cyan ADP flow cytometer to determine EGFP expression levels in viable (DAPI-negative) cells. For myosin heavy chain expression staining and analysis, cells were harvested using TrypLE Select (as for EGFP expression analysis) and washed once with QPCQ ! n / RI Π7 / Ί / YΙΛΙ Cells were plated with PBS, fixed, and permeabilized with Cytofix / Cytoperm solution (BD Biosciences). Subsequently, the cells were washed and blocked in Perm / Wash buffer (BD Biosciences) supplemented with 3% bovine serum albumin (BSA) at +4°C overnight. Staining with an anti-MYH antibody conjugated to PE (Table 4) was performed in Perm / Wash buffer for 1 hour at +4°C in the dark. After three washes with Perm / Wash buffer, the cells were analyzed by Cyan ADP flow cytometry to determine MHC expression levels. Data analysis was performed using FlowJo (v10) and GraphPad Prism (v6). Western Union Transfer Whole-cell protein was extracted using CelLytic M (Sigma-Aldrich) supplemented with a complete protease inhibitor (Roche) and subsequently quantified using the Rapid Protein Quantification Kit (Sigma-Aldrich). Protein electrophoresis was performed using NuPAGE LDS Sample Regulator and 4–12% NuPAGE Bis-Tris Precast Gels (Invitrogen). After protein transfer onto PVDF, membranes were blocked with PBS supplemented with 0.05% Tween-20 (PBST) in 4% milk per 1 h at room temperature and incubated overnight with primary antibodies in PBST in 4% milk. The membranes were washed with PBST, incubated with HRP-conjugated secondary antibodies (Sigma-Aldrich) in 4% milk PBST, incubated with ECL2 Western Pierce Transfer Substrate (Thermo Fisher Scientific), and exposed to Super RX X-ray Films (Fujifilm). Immunocytochemistry The cells were fixed in 4% paraformaldehyde (diluted in PBS) for 20 minutes at room temperature and subsequently washed three times with PBS. The cells were then blocked with 10% donkey serum (Sigma-Aldrich) and permeabilized with 0.3% Triton X-100 (diluted in PBS) for 20 minutes at room temperature. Subsequently, the cells were incubated with appropriately diluted primary antibodies (complementary experimental procedure) in 2% donkey serum and 0.1% Triton X-100 (diluted in PBS) at 4°C overnight. Triton-X was omitted throughout all steps when staining the PDGFRA, A2B5, and O4 surface antigens. After three washes with PBS, the cells were incubated for 1 hour at room temperature with corresponding donkey fluorophore conjugated secondary antibodies (Alexa Fluor 488, 555, 568, and / or 647) in PBS supplemented with 1% donkey serum.Nuclei were visualized with 4',6-diamidine-2-phenylindole (DAPI, Thermo Fisher Scientific). EGFP expression and immunostaining were imaged using a Zeiss LSM 700 confocal microscope (Leica). The percentage of β11-tubulin-positive cells was calculated by determining β11-tubulin expression in at least 50 DAPI-positive cells randomly selected from 3 fields of view of 3 biological replicates using an Olympus 1X71 inverted fluorescence microscope. Statistical analysis was performed using GraphPad Prism (v6). The number of replicates, the statistical test used, and the test results are described in the figure captions. Unless otherwise stated, data are presented as mean ± SEM. EXAMPLE 1 Dual EGFP addressing To develop an inducible overexpression platform in hPSCs, we sequentially targeted the two components of the Tet-ON system on two different GSHs. A constitutively expressed third-generation rtTA was targeted at the human ROSA26 site (hROSA26) using a CRISPR / Cas9n-based targeting strategy, and an inducible EGFP cassette was inserted into AAVS1 (Figure 1A; Figures 4A to 4C). Both hROSA26 and AAVS1 targeting were highly efficient (Figures 4D to 4F, Table 1) and did not affect hPSC genomic stability, self-renewal, or differentiation (data not shown), thus arguing against rtTA-dependent cell toxicity. Double-targeted GSH clones carrying either one or two copies of each of the two inducible cassettes were then selected (Figure 5A). Homozygous targeting of rtTA resulted in approximately twice the rtTA protein levels (Figure 5B), and also in a significant increase in EGFP levels after induction, when compared to heterozygous rtTA expression (Figures 5C to 5E). Furthermore, clones with homozygous targeting of the inducible EGFP cassette showed higher and more homogeneous EGFP levels compared to heterozygous targeting lines (Figures 5C to 5E). Importantly, all successfully targeted lines showed robust inducible EGFP expression, which was at least twenty times higher compared to the strong constitutive CAG promoter (Figure 1B, Figures 50 to 5E).Collectively, these results support our initial hypothesis that targeting two copies of both elements of the Tet-ON system could result in maximal expression after induction. Peak EGFP levels were reached approximately four days after induction, and expression was rapidly reversed upon doxycycline withdrawal (Figure 1C). Furthermore, EGFP expression could be titrated by adjusting the doxycycline dose (Figure 1D). Importantly, inducible EGFP expression was not only highly efficient in hPSCs but also during differentiation into germ layers (no color photographic data shown; data in Figures 6A–6D). Finally, and consistent with the known strong transcriptional control of Tet-ON systems. Third-generation QPCQ 1 Π / A I Π7 / 3 / YILI showed no detectable background expression of EGFP mRNA or protein in the absence of doxycycline, as determined by flow cytometry and qPCR, respectively (Figure 1B, Figure 6D). Most importantly, these results established that dual GSH targeting of the Tet-ON system is a powerful strategy for the optimal expression of inducible cassettes in hPSCs and their derivatives. EXAMPLE 2 Derivation of excitatory cortical neurons from hESC to hiPSC Previous studies showed that these cells can be readily derived by lentiviral overexpression of any of the bHLH pro-neuronal factors (ASCL1, NGN2, or NEUROD1) in hPSCs. Therefore, we generated OPTi-NGN2 hPSCs (Figure 2A, Table 1). Induction of NGN2 resulted in the rapid downregulation of pluripotency factors (Figure 7) and the initiation of a neuronal transcriptional program (Figure 2B). The induced cells exhibited neuronal processes as early as three days post-induction (data not shown). After one week, all cells displayed neuronal morphology and expressed pan-neuronal marker proteins, such as βIII-tubulin and MAP2 (Figure 2C). Quantitative RT-PCR revealed a strong induction of typical forebrain markers such as BRN2 and FOXG1, and of glutamatergic neurons including GRIA4 and VGLUT2 (Figure 2B), indicative of an excitatory cortical neuronal identity.Collectively, these results demonstrated a dramatic improvement in both speed and efficiency of neuron generation compared to traditional hPSC differentiation protocols, and a substantial increase in efficiency and purity compared to both transdifferentiation-based and lentiviral direct programming protocols. Similar results were obtained with OPTI-NGN2 hiPSCs, confirming the robustness of this method. Finally, we observed no drop in neuronal induction efficiency during extended culture periods of Opti-NGN2 hPSCs (>25 passes, Figure 2C). Overall, our results demonstrated that OPTI-NGN2 hPSCs can be used as an inexhaustible source of near-deterministic, virus-free, single-step, rapid, highly scalable, and unlimited neuron generation. EXAMPLE 3 Generation of skeletal myocytes The transcription factor MYOD1 is known to induce myogenic transdifferentiation when overexpressed in a variety of somatic cell types; however, the The ability of hPSCs to undergo direct myogenic programming induced by MYOD1 is currently under debate. We generated OPTi-MYOD1 hPSCs (Table 1), but noted that induction of MYOD1 expression after doxycycline treatment resulted in almost complete cell death within 3 to 5 days under a wide range of culture conditions that were previously suggested to facilitate the conversion of hPSCs into skeletal myocytes. Since it is widely established that cell reprogramming strategies can be enhanced by combining transcription factor overexpression with extracellular signaling cues, we performed a systematic screening for pro-myogenic factors by modulating the major signaling cascades involved in primitive trait formation, somitogenesis, and myogenesis.We found that the addition of all-trans retinoic acid (AR) in conjunction with MYOD1 overexpression resulted in rapid and almost complete conversion to myosin heavy chain (MHC) and myogenin-positive myocytes by day 5 post-induction. The AR effect was concentration-dependent and mediated through the AR receptor isoforms RARα and RAR3, consistent with the AR receptor expression pattern during developmental myogenesis (Figure 8). This effect is thought to be independent of the MYOD1 overexpression mechanism. The induced skeletal myocytes exhibited a typical elongated, spindle-like morphology, extensive cell fusion, and strong myogenic marker expression at both the mRNA and protein levels (Figure 3B, Figures 9A to 9C).The addition of nanomolar concentrations of acetylcholine (ACh) or the selective ACh receptor agonist carbachol resulted in complete muscle fiber contraction, demonstrating the functionality of the induced myocytes. Similar results were obtained with Opti-MYOD1 hiPSCs (data not shown). Importantly, the efficiency of myogenic induction did not decrease during extended culture periods (>50 passes, Figure 3D), thus demonstrating the robustness and reproducibility of this method. Finally, we noted that the levels of the inducible MYOD1 cassette were positively correlated with conversion efficiency, highlighting the importance of a robust gene supply and the superiority of this method over lentivirus-mediated reprogramming approaches (Figure 10).Above all, the OPTi-MYODl direct programming strategy is approximately seven times faster and five times more efficient than most of the most recent hPSC differentiation protocols into skeletal myocytes. Compared to previous direct programming protocols (Tanaka, A. et al. PLoS One 8, e61540 (2013) and Abujarour, R. et al. Stem CeHs Transí. Med. 3, 149-60 (2014)), it is more efficient (>95% vs 30-80%), free of randomly inserted inducible cassettes, chemically defined, fully reproducible, and more scalable. These findings demonstrate that this method of controlling inducible cassette expression in hPSCs can be used as an inexhaustible source for high-tech manufacturing QPCQ ! Π / RI Π7 / 3 / YILI offers high-performance, large-scale induction of homogeneous cell populations. The induction rate and purity of the desired target cells are currently unrivaled by other methods. EXAMPLE 4Oligodendrocyte precursor generation vs. OPTi-OX oligodendrocyte hPSCs carrying inducible 50X10 either alone or in combination with OLIG2 in the form of a bicistronic expression cassette. Although cells induced with 50X10 alone robustly expressed the oligodendrocyte precursor (OPC) marker O4 after 10 days of induction, these cells failed to differentiate further into myelin-expressing cells and progressively died. In contrast, cells doubly overexpressing OLIG2-SOX10 progressed readily from an O4-positive progenitor stage to a CNP / MBP-positive mature phenotype by 20 days post-induction. Furthermore, additional marker protein expression analysis confirmed that OPTi-OLIG2-SOX10 hPSCs were induced in oligodendrocyte medium (Douvaras et al.).In 2014, supplemented with the mitogens PDGFaa and FGF2, the cells first passed through an OPC-like stage in which they were highly proliferative and co-expressed PDGFRA, A2B5, and O4. These cells were highly proliferative and could be maintained for at least three passes (Figure 12B) when cultured in the presence of mitogens. We therefore called these cells i-OPCs, for induced OPCs. Notably, after removal of the mitogens and in the continuous presence of doxycycline, the i-OPCs readily differentiated in approximately one week into mature oligodendrocytes expressing the major myelin proteins CNP, PLP, MAG, MOG, and MBP (Figures 12C to 12D), which were capable of myelin sheath formation (data not shown).Collectively, these results demonstrated that the invention enabled the development of a novel, robust, and fast direct hPSC programming protocol for generating oligodendrocyte precursors and oligodendrocytes. QPCQ ! Π / RI Π7 / Ί / YΙΛΙ TABLE 1 Summary of genotyping results: Cell line Transgene lililí / iióhéii iBiálll iteilil / iilill gifts not on target. iéíiiii egrac (a) lililí clones liBilil liúiilii iiiilll iillili lililí clones lililí / llllill iBol / lis de diana (b) Iillili clones ΙβΙΙΙ lililí iilllil ilioríéá / s lililí lililí íH|fidéÍ|l / | lfl» not outside of target [%] (d) / / Oiélillll cia liii / il / lllil (e) ROSA 26 H9 rtTA 23 / 27 / 60* 2 / 3 / 1 * 13 / 07 / 1936 * 5 / 3 / 6 * 08 / 08 / 2014 * 1 / 0 / 3 * 39 / 30 / 28* 91 / 89 / 9 8* ROSA 26 iPSC rtTA 48 8 11 2 25 2 56 83 AAVS 1 H9 EGFP 12 / 12 / 2024 * 2 / 1 / 2 * 0 / 0 / 0 * 05 / 04 / 2011 * 0 / 1 / 4 * 6 / 5 / 7 * 50 / 50 / 46* 83 / 92 / 9 2* AAVS 1 H9 NGN2 6 0 0 0 0 6 100 100 AAVS 1 ¡PSC NGN2 3 0 0 2 1 0 33 100 AAVS 1 H9 MYO DI 12 2 0 3 0 7 58 75 AAVS 1 ¡PSC MYO DI 3 0 1 1 0 1 33 100 QPCQ 1 Π / RI Π7 / Ί / γ|Λ| (a) Incorrect targeting: No evidence of targeting (lack of bands in 5'- and 3'- integration PCR and presence of WT band in the place PCR) or evidence of targeting but incorrect size of 5'- or 3'- integration PCR. (b) Correct target integration with additional random integration of the plasmid (main structure PCR bands in 3'-). (c) integration into correct target (HET, heterozygotes; HOM, homozygotes). (d) percentage of clones with correct target integration (without additional off-target integration) (e) percentage of clones with correct target integration (with or without additional off-target integration) * All three numbers are from three different targeting experiments on hESCs. TABLE 2 List of primers used for genotyping PCR Site PCR Type Primer Binding Site Primer Sequence hROSA26 Site PCR Genome (51) GAGAAGAGGCTGTGCTTCGG Genome (31) ACAGTACAAGCCAGTAATGGAG 5'-INT PCR Genome (5') GAGAAGAGGCTGTGCTTCGG Splicing Acceptor AAGACCGCGAAGAG11IGICC 3'-INT PCR rtTA GAAACTCGCTCAAAAGCTGGG Genome (3') ACAGTACAAGCCAGTAATGGAG 3'-BB PCR rtTA GAAACTCGCTCAAAAGCTGGG Vector Main Structure (3') TGACCATGATTACGCCAAGC AAVS1 Site PCR Genome (51) C1G1 1 1LCCCTTCCCAGGCAGGTCC Genome (31) TGCAGGGGAACGGGGCTCAGTCTGA 5'-INT PCR Genome (5') CIGI 1 1CCCCTTCCCAGGCAGGTTC Puromycin TCGTCGCGGGTGGCGAGGCGCACCG 3'-INT PCR Inducible cassette Inducible cassette specific sequence Genome (3') TGCAGGGGAACGGGGCTCAGTCTGA 3'-BB PCR Inducible cassette Inducible cassette specific sequence Vector main structure (3') ATGCTTCCGGCTCGTATGTT orc in / R ίηζ / 3 / YΙΛΙ TABLE 3 List of primers for quantitative PCR Gene Orientation Primer sequence CNP Fw TCCTCATCATGAACAGAGGCTT Rev AAACTGCAGCTCAGGC11G1 DES Fw CCAACAAGAACAACGACGCC Rev ATCAGGGAATCGTTAGTGCCC DMD Fw TGGTGGGAAGAAGTAGAGGACT Rev TGCTCCGACCAGCACCGACCGACCTAGGACCTT Rev GTCCATGCCGAGAGTGATCC F0XG1 Fw TGCCAAGI 1 1 IACGACGGGA Rev GGGTTGGAAGAAGACCCCTG GRIA4 Fw GGCCAGGGAATTGACATGGA Rev AACCAACCI 1 1L1AGGTCCTGTG HMBS (PBGACCC) FwGACTGG RevGACTGG GGCTGTTGCTTGGAC11C1C MAG Fw CAGAAGACGTCCCCAACTCA Rev CCTCGGGAGGCTGAAATCATAA MAP2 Fw AGACTGCAGCTCTGCC11 IAG Rev AGGCTGTAAGTAAATCTTCCTCC MBP Fw TGGTGATGGAGATGTCAAGCAGGT Fw AGAGATAGAGAATCTCCACCGGA Rev TGATCAAGGCAACCAAGGGTC MYH1 Fw CACACTAGTTTCACAGCTCTCG Rev CAGGGCACTCTTGGCC1 1 IA MYH2 Fw GGAAGCTCTGGTGTCTCAGTT Rev CAGGGCGTTCTT GGC1 1 1 1 1 MACYCACHCA GCCIA GCCIA GCC CCCTGCTGGCATC1 ICIACC Gene Orientation MYH4 Primer Sequence Fw TCGCA111b1CAGCCAAGGG Rev TGAAACCCAGGATGTCCACAG MYH7 Fw GAGACTGTCGTGGGC1 1G1A Rev GCCCI 1C1CAATAGGCATC MYH8GCATCwTGAAGCAGATAGCAGCGCGA Rev CGTACGAAGTGAGGGTGTGT MY0D1 (endo) Fw GCCGC111CCTTAACCACAA Rev CTGAATGCCCACCCACTGTC MYOD1 Fw CGACGGCATGATGGACTACA Rev TAGTAGGCGCCTTCGTAGCA NANOG Fw AGCAGATGCAAGAACTCTCCAA Rev TGAGGCCTTCTGCGTCCAACAC NEUR0G2 (NGN2) Fw TGTTCGTCAAATCCGAGACCT Rev CGATCCGAGCAGCACTAATCAGTCGACC AAGACACCACCGAGCTGATT PLP Fw AACAGCTGAGTTCCAAATGACC Rev ACGGCAAAGTTGTAAGTGGC P0U3F2 (BRN2) Fw ACCCGCI 1 IAICGAAGGCAA Rev CCTCCATAACCTCCCCCAGA P0U5F1 (OCT4) Fw GTGGAGACCGAAG RevGACTGACTGACTGAGTTGAA RYR1 Fw CAATCGCCAGAACGGAGAGA Rev GTCG1G11CCCTGTCTGTGT SLC17A6 (VGLUT2) Fw GTAGACTGGCAACCACCTCC Rev CCATTCCAAAGCTTCCGTAGAC SYP Fw ACCTCGGGACTCAACACCTCGG Rev GAACCACACAGGGGGGGGACTCAACACCTCGY Fw CCCTGGGIGI 1IGCCCAGAT Rev ACCACGGGGTACGTTGTACT TUBB3 Fw CAACCAGATCGGGGCCAAGTT Rev CCGAGTCGCCCACGTAGTT orco in / A ίηζ / 3 / ΥΙΛΙ TABLE 4 Antibody List Antigen Species Isotype Clonality Company Cat. No. Dilution A2B5 mouse IgM monoclonal Millipore MAB312 1:300 ACTN2 (o-actinin) mouse IgG1 monoclonal Sigma A7811 1:200 BrdU mouse IgG1 monoclonal BD Bio 347580 1:100 CNP mouse IgG1 monoclonal Abcam ab6319 1:500 DES (desmin) rabbit IgG1 monoclonal Abcam ab32362 1:500 EOMES rabbit IgG2 polyclonal Abcam ab23345 1:200 MAG mouse IgG1 monoclonal Abcam ab89780 1:400 MAP2 mouse IgG1 monoclonal Sigma M4403 1:200 MBP Rat IgG2a monoclonal Millipore MAB386 1:200 MYOD1 rabbit IgG monoclonal Abcam abl33627 1:250 MYOG (myogenin) mouse IgG monoclonal DSHB F5D 1:100 MYOG (myogenin) rabbit IgG monoclonal Abcam abl24800 1:500 MYH (myosin heavy chains) mouse IgG2b monoclonal DSHB MF20 1:100 MYH-PE mouse IgG2b monoclonal BD Biosc. 564408 1:20 (Flow) NANOG goat IgG polyclonal R&D AF1997 1:200 NCAM mouse IgG monoclonal DSHB 5.1H11 1:100 orc in / R ιηζα / υιλι Antigen Species Isotype Clonality Company Cat. No. Dilution O4 mouse IgM monoclonal R&D MAB1326 1:1000 NKX2.5 rabbit IgG polyclonal Santa Cruz SC14033 1:200 OCT4 mouse IgG2b monoclonal Santa Cruz SC5279 1:200 PAX3 mouse IgG2a monoclonal DSHB Pax3 1:100 PAX6 mouse IgGl monoclonal DSHB PAX6 1:100 PAX7 mouse IgGl monoclonal DSHB PAX7 1:100 PLP rabbit IgG monoclonal Abcam Abl83493 1:2000 TNNT2 (troponin O) mouse IgG2a monoclonal DSHB CT3 1:100 TTN (titin) mouse IgM monoclonal DSHB 9D10 1:100 TetR (tet repressor) mouse IgGl monoclonal Clontech 631131 1:1000 (WB) TUBA4A (a4tubulin) mouse IgGl monoclonal Sigma T6199 1:10000 (WB) TUBB3 (βΙΠtubulin) mouse IgGl monoclonal Millipore MAB1637 1:1000 VGLUT1 goat IgG polyclonal Abcam abl04899 1:500 EXAMPLE 5 Inducible Gene Expression Reduction System TET-ON Development of an optimized inducible gene expression reduction platform in hPSCs. We generated hESC lines in which an EGFP transgene could be silenced in an inducible manner (Figure 14B). To achieve this, we targeted: (1) a CAG-tetR expression cassette at the ROSA26 site; and (2) a CAG-EGFP transgene plus an inducible EGFP shRNA cassette at the AAVS1 site (Figure 14A, 14B). The goal was to express higher levels of the tetR protein to more strongly repress shRNA expression in the absence of tetracycline. To accomplish this, we performed multiparameter RNA and codon optimization of bacterial tetR cDNA and used the resulting codon-optimized tetR (OPTtetR) to generate novel hESC lines with inducible EGFP gene expression reduction (Figure 14B). This modification allowed a tenfold increase in tetR expression when compared to the standard sequence (STDtetR; Figure 14D).Furthermore, homozygous expression of OPTtetR was sufficient to completely prevent shRNA leakage while fully preserving the induction of efficient gene expression reduction (Figure 14C). Notably, the inducible gene expression reduction was rapid, reversible, and dose-sensitive (Figures 14E, 14F). Finally, the inducible hESCs exhibited a normal karyotype (data not shown), demonstrating that the genome design required to create these lines does not compromise their genetic stability. Based on these encouraging results, we further validated this method in the context of endogenous genes by generating hESCs carrying inducible shRNAs against POU5F1 / OCT4 or B2M (data not shown). Notably, all analyzed sublines (6 per gene) showed robust inducible gene expression reduction without significant shRNA leakage. Tetracycline titration identified the optimal concentrations for partial or complete reduction of OCT4 gene expression. As expected, a strong decrease in OCT4 specifically resulted in loss of pluripotency and induction of neuroectoderm and definitive endoderm markers. Similar results were obtained with 20 additional hESC sublines for inducible OCT4 gene expression reduction, confirming the robustness and reproducibility of this method.Importantly, the generation of hESCs with strongly regulated gene expression reduction was so efficient that phenotypic analysis could be performed immediately after antibiotic selection in a mixed cell population, thus completely eliminating the need to select individual colonies for clonal isolation. Above all, these results establish that dual-targeting of GSHs with an optimized inducible gene expression reduction system is a powerful method. QPCQ 1 Π / R 107 / 3 / YILI to control gene expression in hPSCs. This approach is hereafter called OPTiKD, for OPTimized inducible gene expression reduction (Figure 14A). EXAMPLE 6 The ability to reduce gene expression in a variety of differentiated cells could represent a significant advance over previous systems for reducing the gene expression of inducible genes. To thoroughly test this possibility, we analyzed the efficacy of the OPTiKD platform for reducing the gene expression of an EGFP transgene in hPSCs differentiated in all three germ layers, as well as in a panel of thirteen fully differentiated cell types (Figure 15A). For both methods, qPCR analyses demonstrated a strong and inducible reduction in the gene expression of EGFP transcripts in all lineages tested (Figure 17). Microscopic observations confirmed the robust decrease in EGFP protein expression, and flow cytometry showed a decrease in EGFP fluorescence of more than 70% for most lineages (data not shown). EXAMPLE 7 Development of an optimized inducible CRISPR / Cas9 platform in hPSCs. We turned our attention to developing an inducible gene-switching approach. Current inducible CRISPR / Cas9 methods rely on the conditional overexpression of Cas9 in the presence of a constitutively expressed gRNA. In this case, control of Cas9 overexpression is achieved by a TET-ON method in which, after doxycycline treatment, a tetracidin-controlled reverse transactivator (rtTA) activates a Pol II-dependent tetracidin-sensitive element (TRE) promoter (a fusion between multiple TET operons and a minimal CMV promoter). While this TET-ON platform has been successfully applied to certain human cell types, we observed that this inducible system is silenced during hPSC differentiation into multiple lineages (including cardiomyocytes, hepatocytes, and smooth muscle cells), even after targeting the AAVS1 GHS (data not shown).We explored the possibility of developing an alternative and improving the method by combining a constitutively expressed CAG promoter-driven Cas9 with an inducible gRNA cassette based on the one developed for inducible shRNA expression (Figure 18A, 18B). We therefore generated hESCs lines in which a fluorescent reporter gene could be genetically inducibly switched off (Figure 18C). QPCQ 1 Π / Α I Π7 / 3 / ΥΙΛΙ For this purpose, we targeted ROSA26-EGFPd2 reporter hESCs with both an inducible EGFPgRNA and a constitutive Cas9 at the AAVS1 site, each transgene being integrated into one of the two alleles. This dual-targeting approach was rapid (<2 weeks) and efficient (>90% of lines containing both transgenes). Notably, when individual clonal sublines were cultured in the presence of tetracycline, we observed decreased EGFPd2 expression in all target lines, and EGFPd2 homozygous cells showed a nearly homogeneous loss of at least one copy of the reporter gene as early as five days after tetracycline induction (as demonstrated by a 50% reduction in EGFPd2 fluorescence). Prolonged tetracycline treatment led to a progressive complete loss of EGFPd2 fluorescence in up to 75% of EGFPd2 homozygous cells (data not shown).Interestingly, co-expression of any two or three copies of the same EGFPd2 gRNA cassette from the same AAVS1 site was sufficient to significantly increase the rate and efficiency of inducible EGFPd2 gene knockdown in all tested subline cells. For example, simultaneous induction of three copies of the same gRNA resulted in a remarkable gene knockdown efficiency of 95% after tetracycline treatment. Importantly, hESCs of inducible EGFPd2 gene knockdown showed no significant decrease in the proportion of EGFPd2-positive cells or in their fluorescence after prolonged culture in the absence of tetracycline, even when many gRNA copies were used. This demonstrated that inducible gRNA expression was tightly controlled. Finally, further gRNA tests against EGFPd2 revealed that the rate and efficiency of inducible gene knockdown were strongly gRNA-dependent.In fact, an optimal sequence allowed up to 90% gene deactivation after only 2 days of induction. Notably, the most efficient gRNA also resulted in uncontrolled gene deactivation of EGFPd2, but this limitation was avoided by simply adding a second TET operon to the inducible H1 promoter to ensure even tighter transcriptional control. Collectively, these results show that the gene expression reduction system could be readily repurposed to support inducible gRNA expression and allow tightly controlled CRISPR / Cas9 activity over a broad gRNA potency range. To the best of our knowledge, this is the first conditional CRISPR / Cas9 approach based on inducible gRNA expression.
Claims
1. CLAIMS 1. A method for controlling the transcription of a genetic sequence in a cell comprising a) the targeted insertion of a gene encoding a transcriptional regulatory protein into a first genetic secure anchoring site; and b) the targeted insertion of an inducible cassette into a second genetic secure anchoring site, wherein said inducible cassette comprises said genetic sequence operatively linked to an inducible promoter, and said promoter is regulated by the transcriptional regulatory protein; wherein said first and second genetic secure anchoring sites are different.
2. The method according to claim 1, further characterized in that the genetic sequence is a transgene.
3. The method according to claim 1, further characterized in that the genetic sequence encodes a non-coding RNA.
4. The method according to any of claims 1 to 3, further characterized in that the activity of said transcriptional regulatory protein is controlled by an exogenously supplied substance.
5. The method according to any of claims 1 to 4, further characterized in that said transcriptional regulatory protein is constitutively expressed.
6. The method according to any of the preceding claims, further characterized in that said transcriptional regulatory protein is selected from any of: tetracycline-sensitive transcriptional activator protein (rtTa), tetracycline repressor (TetR), synthetic VgEcR receptor, or the Gene Switch hybrid transcriptional regulatory protein, and derivatives thereof.
7. The method in accordance with any of the preceding claims, further characterized in that said transcriptional regulatory protein is rtTA or any derivative thereof.
8. The method according to claim 5, further characterized in that the activity of tTA is controlled by tetracycline or a derivative thereof, optionally doxycycline.
9. The method according to claim 7 or claim 8, further characterized in that the inducible promoter includes a Tet Sensitive Element (TRE).
10. The method according to any of the preceding claims, QPCQ 1 Π / AI Π7 / 3 / YILI 66 further characterized in that said first and second genomic secure anchoring sites are selected from any two of the hROSA26 site, the AAVS1 site, the CLYBL gene, the CCR5 gene or the HPRT gene.
11. The method according to any of the preceding claims, further characterized in that the insertion of said gene encoding a transcriptional regulatory protein into a first genetic secure anchoring site occurs on both chromosomes of the cell and / or the insertion of said inducible cassette into a second genetic secure anchoring site occurs on both chromosomes of the cell.
12. The method according to any of the preceding claims, further characterized in that the additional genetic material is inserted into the first / second genomic secure anchoring sites, optionally one or more of the following: a) suicide gene; b) select marker; c) reporter gene; and / or d) gene for a non-coding RNA.
13. The method in accordance with any of the preceding claims, further characterized in that said method is performed ex vivo.
14. The method according to any of the preceding claims, further characterized in that said cell is selected from a pluripotent stem cell, a somatic stem cell, or a mature cell.
15. The method according to claim 1 or claim 2, further characterized in that said method is for programming pluripotent stem cells into defined mature cells.
16. The method according to claim 1 or claim 2, further characterized in that said cell is a pluripotent stem cell and said genetic sequence is a transgene for one or more master regulators, optionally a transcription factor.
17. The method according to claim 16, further characterized in that the transcription of said genetic sequence results in the direct programming of the cell into a defined type of mature cell.
18. The method according to claim 17, further characterized in that said mature cell type is selected from any of the following cell types: nerve cells, myocytes, osteocytes, chondrocytes, epithelial cells, secretory cells, and / or blood cells.
19. The method according to any of claims 14 to 18, further characterized in that said pluripotent stem cell is selected from an induced pluripotent stem cell (PSC) or an embryonic stem cell (ESC).
20. The method in accordance with any of claims 1 to 19, QPCQ ! Π / RI Π7 / 3 / YILI further characterized in that said cell is human.
21. The method according to claim 1, further characterized in that said method is for the insertion of a genetic sequence for the purposes of gene therapy, optionally wherein the genetic sequence encodes a protein including a wild-type protein, a modified protein, an antigen, an enzyme, a selectable marker, or a non-coding RNA molecule.
22. A cell produced by the method of claim 1.
23. A cell with a modified genome comprising an inserted gene encoding a transcriptional regulatory protein at a first gene secure anchoring site; and an inserted inducible cassette comprising a gene sequence operatively linked to an inducible promoter at a second gene secure anchoring site, wherein said inducible promoter is regulated by the transcriptional regulatory protein and said first and second sites are different.
24. The use of a cell as claimed in claim 22 or claim 23 in therapy.
25. The use of a cell as claimed in claim 22 or 23 for in vitro diagnostics.
26. The use of a cell as claimed in claim 22 or 23 for tissue engineering, optionally cultured meat.
27. A method for producing myocytes from pluripotent stem cells, characterized in that it comprises the steps of: a) the targeted insertion of a gene encoding a transcriptional regulatory protein into a first gene-secure anchoring site; and b) the targeted insertion of the MYOD1 gene operatively linked to an inducible promoter into a second gene-secure anchoring site, wherein said inducible promoter is regulated by the transcriptional regulatory protein; wherein said first and second gene-secure anchoring sites are different, and culturing said cells in the presence of retinoic acid.
28. A method for producing oligodendrocytes from pluripotent stem cells, characterized in that it comprises the steps of: a) the targeted insertion of a gene encoding a transcriptional regulatory protein into a first gene-secure anchoring site; and b) the targeted insertion of the SOX-10 gene operatively linked to an inducible promoter into a second gene-secure anchoring site, wherein said inducible promoter is regulated by the transcriptional regulatory protein; wherein said first and second gene-secure anchoring sites are different, and culturing said cells in the presence of retinoic acid.
29. A method for reducing the transcription and / or translation of an endogenous gene in a cell, characterized in that it comprises the following steps: a) the targeted insertion of a gene encoding a transcriptional regulatory protein into a first genetic secure anchoring site; and b) the targeted insertion of an inducible cassette into a second genetic secure anchoring site, wherein said inducible cassette comprises DNA encoding a non-coding RNA sequence operatively linked to an inducible promoter and said promoter is regulated by the transcriptional regulatory protein and wherein said non-coding RNA sequence suppresses the transcription or translation of an endogenous gene; wherein said first and second genetic secure anchoring sites are different.
30. A method for the gene deactivation of an endogenous gene in a cell, characterized in that it comprises the following steps: a) the targeted insertion of a gene encoding a transcriptional regulatory protein and a gene encoding Cas9 into a first gene-secure anchoring site; and b) the targeted insertion of an inducible cassette into a second gene-secure anchoring site, wherein said inducible cassette comprises a guide RNA operatively linked to an inducible promoter and said promoter is regulated by the transcriptional regulatory protein and wherein said gRNA sequence targets the endogenous gene; wherein said first and second gene-secure anchoring sites are different.
31. The method according to any of claims 1 to 21 or 27 to 29, further characterized in that an additional inducible cassette or transgene is inserted into an additional GSH, which is different from the first and second GSH.
32. An optimized tetR sequence comprising a sequence with 80%, 85%, 90%, 95% or 99% homology to SEQ ID No.
6.
33. A method for producing myocytes from pluripotent stem cells expressing MYOD1, comprising culturing said cells in the presence of retinoic acid.