LOAD-ADDICTED PRODUCTION STRAINS.
Patent Information
- Authority / Receiving Office
- MX · MX
- Patent Type
- Patents
- Current Assignee / Owner
- DANMARKS TEKNISKE UNIV
- Filing Date
- 2022-08-12
- Publication Date
- 2026-06-12
Abstract
Description
PRODUCTION STRAINS ADDICTED TO LOADS FIELD OF INVENTION The invention provides a microbial production cell for the synthesis of a product, further comprising a genetic charge addition circuit whose expression confers a selective growth and / or survival advantage to those cells that synthesize the product; while limiting the proliferation of non-productive escape cells. BACKGROUND OF THE INVENTION An increasing proportion of global chemical production relies on microorganisms that are genetically modified to function as cell factories and tailored for the biosynthesis of a given molecule. Production processes employing these cell factories typically begin with a starter culture of a small number of cells from a production organism, which then undergoes a growth and cell expansion phase in large fermentation tanks (up to 1,000,000 L in volume). In some configurations, the production of a given molecule occurs both during the growth phase and at a later stage (batch and fed-batch cultures); alternatively, production can be continuous.A chemostat heater allows a production organism to grow in a fermentation broth that is constantly diluted, thus removing the product and cells from the culture while replenishing it with fresh nutrient medium. At an industrial scale, such production processes can continue operating for 1–2 months before starting a new culture in a clean tank. The fermentation processes and equipment used in this industry are very similar, both for the production of a wide range of commercial small molecules and for therapeutic proteins, and consequently, these processes are subject to similar problems. In other applications, microbial cells can be engineered to produce a non-native molecule that confers a commercial advantage in the environment where the cell is cultured. Cell factories designed to allocate finite metabolic resources to the biosynthesis of a given molecule are subject to an unnatural loading, commonly reflected in slower growth. This loading exerts selective pressure on cells unable to synthesize the product molecule (non-producing or low-producing cells), a problem that arises particularly when the production run is for extended periods (e.g., in chemostats). Such non-producing cells within an industrial fermentation are highly undesirable, as they consume nutrients, oxygen, and space. Since low-producing and non-producing cells grow faster, they have a strong selective advantage over producing cells. In a growing cell culture, such improvements in fitness can lead to significant competition from producing cells over time.This deviation from the optimal production state is a possible reason to discard the fermentation broth and expend resources on cleaning, sterilization, and even nutrients to replenish the fermentation tank with new producing organisms. Such non-producing cells originate from genetic mutations that arise in the cells of an original producing organism that undergoes many growth divisions. QCRRnn / zznz / E / YiAi Since genetic mutations and non-genetic adaptations in the cells of a production organism cannot be prevented, leading to a decrease in product formation during a production run, methods are needed to eliminate or slow the growth of non-productive cells. Ideally, such elimination methods are effective enough to prevent the observed deviation from the production state and thus extend the lifespan of an industrial fermentation. The present invention addresses the problem of how to deprive non-producing members of a cell factory of a fitness advantage; such as to delay their proliferation among the productive members of a cell factory over time and thereby improve the productivity of the cell factory. BRIEF DESCRIPTION OF THE INVENTION A first aspect of the invention provides a genetically modified microbial production cell for synthesizing a product, wherein said cell further comprises: - an essential gene operationally linked to a charge-sensing promoter, wherein said promoter is heterologous with respect to said essential gene; wherein the synthesis of the product confers a charge and / or a suitability cost to said cell, and wherein the expression of said essential gene is upregulated when said charge-sensing promoter is induced by said charge and / or adequacy cost relative to a basal level of expression of said essential gene when said charge-sensing promoter is not induced. A second aspect of the invention provides a method for biosynthesizing products comprising the steps of: - to provide a microbial production cell of the invention, - introducing the cell into a culture medium comprising substrate for the production of said product, - to recover said product. A third aspect of the invention provides a use of an essential gene operatively linked to a charge-sensing promoter to enhance the product yield of a cultured population of microbial production cells arising from a single cell, wherein said promoter is heterologous with respect to said essential gene; wherein product production confers a charge in said cell; and wherein the expression of said essential gene is upregulated when said charge-sensing promoter is induced by said charge relative to a basal level of expression of said essential gene when said charge-sensing promoter is not induced. A fourth aspect of the invention provides for the use of a microbial production cell of the invention to produce a biosynthetic product. BRIEF DESCRIPTION OF THE FIGURES Figure 1: Graph showing the growth (measured as optical density: OD 630nm) over time of cells from the original strain BL21 (DE3) of E. cali (gray line) and cells from the original strain QCRRnn / zznz / E / YiAi transformed with a pEG34 hGH-GFP producing plasmid (black line; pEG34). The growth of four replicated cultures of each strain was measured under hGHGFP expression induction conditions; error bars represent the standard error of the mean (n = 4). Figure 2: Graph showing the growth (measured as optical density: OD 630nm) over time of cells from the original strain BL21(DE3) of E. co / / (black line) and cells from the strains s5 0#3, s7.0#8, and s9.0#8 of E. cali addicted to non-producing loads derived from the original strain (as indicated; where the essential genes folP-glmM are controlled by pyCcv, Pycjx, and pmutM, respectively). The measured growth rate is based on an average of four replicated cultures (n = 4). Figure 3: Graph showing the growth (measured as optical density: OD 630nm) over time of cells of the charge-addicted s9.0#8 strain harboring either the hGH-GFP producing plasmid pEG34 (black line) or the control plasmid pEGO (gray line). The growth of four replicated cultures of each strain was measured under hGH-GFP expression induction conditions; error bars represent the standard error of the mean (n = 4). Figure 4: Graph showing the growth (measured as optical density: OD 630nm) over time of cells from the original strain BL21(DE3) of E. coli (black line) and cells from three charge-addicted strains: s5.0#3, s7.0#8, and s9.0#8 that harbor and express the hGH-GFP production plasmid pEG34 (as indicated). The measured growth rate, measured under hGH-GFP expression induction conditions, is based on an average of four replicated cultures (n = 4). Figure 5: Histogram of GFP / OD values (Y-axis) measured during the first and sixth culture transfers (seed 1 and 6) of cultures of the hGH-GFP producing strains: s3.6 (p¡bPA), s6.6 (pgrpE), s7.6 (pycjx), and s10.6 (pybbN), which comprise the respective charge-sensing promoters and one of four variant RBS coding sequences that drive the expression of the essential gene, folPglmM. Cultures of the charge-addicted E. coli strain BEG34 and the original E. cali strain BL21(DE3), BEGO, are included as controls. Measurements were performed on cultures grown under hGH-GFP expression induction conditions. Error bars represent the standard error of the mean (n = 4). Figure 6: Histogram of GFP / OD values (Y-axis) measured after serial culture transfers (seed 1 to 12) of cultures of the hGH-GFP producing strains: s3.6#2 (p¡bPA), s6.6#6 (pgrPE), s7.6#8 (pycjx), and s10.6#7 (pybbN), comprising the respective charge-sensing promoters and one of four variant RBS coding sequences, which drive the expression of the essential gene, folP-glmM. Cultures of the non-charge-addicted E. coli strain BEG34 and the original E. coli strain BL21 (DE3) were included as controls. Measurements were performed on cultures grown under hGH-GFP expression induction conditions. Error bars represent the standard error of the mean (n = 3). Figure 7: Histogram of OD / min as a measure of the growth rate of the charge-addicted hGH-GFP producing strains s3.6#2, s6.6#6, s7.6#8, and sl0.6#7 compared to the charge-addicted hGH-GFP producing E. coli strain BEG34 and the original E. coli strain BL21-DE3 (BEGO). The growth rate of the respective strains is based on 7 replicated cultures measured in QCRAnn / zznz / E / YiAi hGH-GFP expression induction conditions in seed 0; error bars indicate the standard error of the mean (n = 7). Figure 8: Graphs showing GFP / OD values (Y-axis) measured after serial culture transfers (seed 1, 4 to 9) of hGH-GFP producing strains, minus the values measured for an empty plasmid-free control BEGO strain. The strains shown in: (A) s7.6#8 (Pycjx), (B) s13.6#2 (ptsxA), and (C) s13.6#2evo (ptsxA), each comprise the respective charge-sensing promoter driving expression of the essential gene, folP-glmM (gray line), and a non-charge-addicted hGH-GFP producing E. coli strain BEG34 (black line). Measurements were performed in cultures grown under hGH-GFP expression induction conditions. Error bars represent the standard error of the mean (n = 5). Figure 9: Graphs showing the GFP / OD values (Y-axis) measured after serial culture transfers (seed 1, 4 to 9) of hGH-GFP producing strains, minus the values measured for an empty plasmid-free control BEGO strain. The strains shown in (A) s15.6.7 (prmB) and (B) s16.6.6 (ρ™ε) each comprise the respective charge-sensing promoter that drives expression of the essential gene, folP-glmM (gray line), and a charge-addicted hGH-GFP producing E. coli strain BEG34 (black line). Measurements were performed in cultures grown under hGH-GFP expression induction conditions. Error bars represent the standard error of the mean (n = 5). Figure 10: Graph showing the relative production of hGH-GFP (Y-axis) measured after serial culture transfers (seeds 2 to 5 and 7) from cultures of an hGH-GFP-producing strain, s29.6#3, minus the values measured for a parallel empty plasmid control strain, BEGO. Strain s29.6#3 comprises the osmotic stress-sensing promoter pp0XB, which drives the expression of the essential gene folP-glmM (black squares), compared to the non-charge-addicted hGH-GFP-producing E. coli strain BEG34 (gray dots). Serial passage 7 was analyzed after 72 h. Measurements were performed on cultures grown under hGH-GFP expression induction conditions. Error bars represent the standard error of the mean (n = 5 for s29.6#3 and n = 8 for BEG34). Figure 11: Histogram showing the rate of S. aureus lysis per minute, normalized to the OD of the E. coli culture, as a measure of the rate of secreted lysostaphin production from cultures of s6.4#5 lysostaphin-producing strains comprising the pgrPE charge-sensing promoter and one of four variant RBS coding sequences driving expression of the essential gene, folP-glmM, compared to the non-charge-addicted lysostaphin-producing E. coli strain BENDUScam. The rate was measured in cultures grown under lysostaphin expression induction conditions after serial culture transfers (seed 1 and 7). Error bars represent the standard error of the mean (n = 3). Figure 12: Graph showing the mevalonic acid titer (g / L) synthesized by cultures of the charge-addicted mevalonic acid-producing strains s19.1 #1 (pCSpD) and s9.1.4 (pmutM), measured after serial culture transfers (seed 2, 5, and 6) compared to the non-charge-addicted mevalonic acid-producing E. coli strain BL21(DE3)pMevT. The detection promoters of QCRAnn / zznz / E / YiAi loading, pcsPDy pmutM, each combined with one of four variant RBS coding sequences that drive expression of the essential gene, folP-glmM. Measurements were performed in cultures grown under MevT expression induction conditions. Error bars represent the standard error of the mean (n = 3). Figure 13: Bar chart showing human serum albumin (hSA) production titers from cultures of the EGS31 strain of Pichia pastoris comprising a genomically integrated copy of a cDNA version of the ALB1 gene encoding hSA under the control of the AOX1 promoter and a PDI1 promoter operatively linked to the kanMX selection gene. Cultures were grown under either selection conditions (addiction activated by 750 pg / ml of G418) or non-selective conditions (addiction not activated). The hSA titer of the 'addiction not activated' culture is set at 100%, and the titer of the 'addiction activated' culture is shown as a percentage thereof. Figure 14A and B: Bar chart showing human serum albumin (hSA) production titers from load-addicted cultures of the EGS31 strain of Pichia pastoris, each comprising a genomically integrated copy of a cDNA version of the ALB1 gene encoding hSA under the control of the AOX1 promoter and a kan / WX selection gene operatively fused to a load-sensitive promoter FPR2, or RPL3, or RPL6A. Cultures were grown under either non-selective conditions (addiction not activated) or selective conditions (addiction activated with either 150 or 750 pg / mL of G418) for approximately 30 cell divisions ([A] Seed 1), or after approximately 10 additional cell divisions ([B] Seed 2). Average hSA titers are shown as a percentage of the titer in the 'EGS31' seed 1 culture. The error bars represent the standard error of the mean (n = 4). Abbreviations, terms and definitions: Burden refers to the general and / or product-specific metabolic toxicity, metabolic burden and / or metabolic depletion; experienced by a genetically modified microbial cell to synthesize a product during product production under production conditions, and which results in a suitability cost that can be quantified by measuring the percentage reduction in the cell's maximum exponential growth rate (along the growth curve) during product production under production conditions compared to an original microbial cell incapable of such production when grown under comparable production conditions. A load-sensing promoter refers to a promoter that is induced by a load, and when induced, this load-sensing promoter can upregulate the expression of a gene to which it is operatively linked in a microbial production cell when grown under production conditions, compared to a mutant derivative of that microbial production cell that synthesizes essentially nothing, or at least 50% less, of a product from the production cell. Such a mutant derivative includes a non-productive escape mutant isolated after long-term culture of a cell population derived from that production cell. Non-limiting examples of load-sensing promoters include promoters of the E. coii genes htpG, ibpA, QCRAnn / zznz / E / YiAi dpB, yccV, grpE, ycjX, IdhA, mutM, ybbN, prIC, groES, fxsA, htpX, rrnB, rrnE, cspD, katE, xthA, uspE, gadB, ahpC, katG, grxA, oxyS, poxB, trxC (see Table 2 for details) and their homologous versions in other gram-positive and gram-negative bacteria; and for S. cerevisiae, non-limiting examples of charge-sensing promoters include the promoter of the genes KAR2, PDI1, SAA1, FPR2, RPL3, RPL6A, RPL28, OGGI, RAD51, RAD54 (see Table 2 for details). Load-sensing promoters can also be hybrid, scrambled, or truncated versions of such natural promoters, provided that such promoters still maintain the load response. Charge-addicted microbial cell refers to a microbial cell engineered to comprise a genetic circuit comprising said 'charge-sensing promoter' operatively linked to an essential cell gene. A charge-addicted microbial production cell refers to a microbial cell genetically engineered to synthesize a desired product. This cell is further genetically modified to include a genetic circuit comprising a charge-sensing promoter operatively linked to an essential gene of the cell. The desired product may be a protein encoded by a nucleic acid molecule in the engineered microbial cell, or a product of a heterologous pathway encoded by one or more nucleic acid molecules to be expressed by the cell. The desired products of the invention include—but are not limited to—products that, when synthesized by the genetically modified microbial production cell, transmit a suitability cost (burden) to the production cell. Non-limiting examples include organic acids, terpenoids, isoprenoids, polyketides, alcohols, sugars, vitamins, aldehydes, carboxylic acids, fatty acids, amino acids, peptides, enzymes, therapeutic proteins and precursors thereof, such as human growth hormone, insulin, glucagon-like peptide-1, monoclonal and polyclonal antibodies, and single-fragment antibodies. An essential gene (or essential gene operon) refers to genes in a microbial production cell that, if downregulated, lead to a reduction in the growth rate of the microbial production cell under production conditions. Ideally, an essential gene is essential for growth regardless of the nutrient composition of these production conditions, so sufficient expression of such essential genes to support cell growth would not depend on the presence or absence of specific inhibitors or nutrients provided under the production conditions. Non-limiting examples of essential genes during standard laboratory conditions include folP-glmM, glmM, murl, asd, thyA, rpoD, nusG, rpsU, accD, degS, fldA, ftsN, hflB, lolA, mraY, mreD, murA, murB, murF, nadD, rplV and rpsG, and for Bacillus licheniformis or Bacillus subtilis: glmM, ylaN, infA and dapA, and for S.cerevisiae, non-limiting examples include URA3, FOL1, MED7, RRP40, NOP8, PGI1, and NEP1. For example, suitable genes encode enzymes responsible for synthesizing cell wall constituents. Furthermore, an essential gene used in the context of this invention preferably does not encode a desired product to be expressed by the production strain; nor does it encode a protein that facilitates the synthesis of a desired product or intermediate thereof in a heterologous pathway to be expressed by the production strain. A conditionally essential gene is one that allows the cargo-addition system in the microbial production cell to be "activated" by culturing the cells under the essentiality condition, such as added antibiotic or removed nutrient. The basal expression level of an essential gene is the transcription level of an 'essential gene' (as defined above) that is operatively linked to a 'charge-sensing promoter' in a charge-addicted microbial production cell, when the 'charge-sensing promoter' is not induced. The charge-sensing promoter to which the essential gene is operatively linked is heterologous with respect to that essential gene, in that the promoter is not the native promoter of that essential gene (although the promoter may be present in the same genome), and is therefore not operatively linked to that essential gene in nature.This basal level of expression (i.e., non-induced) of an essential gene is a level sufficient to support the growth of a cell under production conditions (or during an exponential growth phase) at a level equal to or less than 10, 20, 50, 90, or 95% of the growth rate of a corresponding cell where said essential gene is operationally linked to its native promoter. Cost of adaptation: This is quantified by comparing the maximum exponential growth rate of a non-charge-addicted microbial production cell (i.e., lacking a charge-sensing promoter operatively linked to the essential gene), but comprising and expressing one or more genes encoding the product or a metabolic pathway for product biosynthesis, relative to the maximum exponential growth rate of an original microbial cell either devoid of or unable to express genes encoding the product or a metabolic pathway for product biosynthesis, from which the derived microbial production cell was grown, when grown under comparable production conditions. Production conditions refer to the specific culture conditions that will be used during production and may relate to the medium and / or other culture conditions (e.g., temperature, pH, agitation, aeration, etc.) for the production of a desired product by the microbial production cell. Ribosomal binding site (RBS), translation initiation region or translational strength element refers to the genetic region of the 5' untranslated region that controls the translation strength of a particular messenger RNA. DETAILED DESCRIPTION OF THE INVENTION I. A charge-addicted microbial production cell A first aspect of the present invention provides a genetically modified microbial production cell for synthesizing a product, wherein said cell further comprises: a. an essential gene operationally linked to a charge-sensing promoter, wherein said promoter is heterologous with respect to said essential gene; wherein the production of the ocRAnn / zznz / E / YiAi product confers a charge and / or adequacy cost to said cell, and wherein the expression of said essential gene is upregulated when said charge-sensing promoter is induced by said charge and / or adequacy cost relative to a basal level of expression of said essential gene when said charge-sensing promoter is not induced. According to one embodiment, the microbial production cell of the invention comprises: b. one or more genes encoding the product or encoding a metabolic pathway for the synthesis of the product, wherein optionally said one or more genes are operationally linked to a constitutive or inducible promoter. According to one embodiment, said load and / or adaptation cost on said microbial production cell of the invention is quantified by comparing the maximum exponential growth rate of the microbial production cell comprising one or more genes encoding the product or encoding a metabolic pathway for the synthesis of the product, but lacking a load-sensing promoter operatively linked to the essential gene, in relation to the maximum exponential growth rate of an original microbial cell that lacks or is unable to express one or more genes encoding the product or encoding a metabolic pathway for the synthesis of the product, and from which said microbial production cell was derived, wherein the respective cells are grown under essentially identical production conditions.The burden and / or cost of adapting to said microbial production cell preferably corresponds to a percentage reduction in the selected maximum quantified exponential growth rate of > 5%, > 10%, > 15%, > 20%, > 25%, > 35% and > 45%. The microbial production cell addicted to loads according to the invention can be any prokaryotic or eukaryotic microorganism such as a bacterium, yeast, and filamentous fungus. In one embodiment, the microbial production cell of the invention is a prokaryote. A non-exhaustive list of suitable bacteria is provided below: a species belonging to the genus selected from among Escherichia, Lactobacillus, Lactococcus, Corynebacterium, Bacillus, Acetobacter, Acinetobacter, Pseudomonas, Propionibacterium, Bacteroides, and Bifidobacterium. In another embodiment, the microbial production cell of the invention is a eukaryote, such as a yeast or fungus. In certain embodiments, the eukaryote may be a member of the genera Saccharomyces, Komagataella, or Aspergillus. The following is a non-exhaustive list of suitable yeasts: a yeast belonging to the genus Saccharomyces, for example, S. cerevisiae, S. kluyveri, S. bayanos, S. exiguos, S. sevazzi, S. ovarum; a yeast belonging to the genus Kloyveromyces, for example, K. lactis, K. marxianos var. marxianos, K. thermotolerans; a yeast belonging to the genus Candida, for example, C. otilis, C. tropicalis, C. albicans, C. hypolytica, C. versatilis; a yeast belonging to the genus Pichia, for example, P. stipidis, P. pastoris, P. sorbitophila; or other genera of yeast, for example, Cryptococcus, Debaromyces, Hansenola, Yarrowia, Zygosaccharomyces, or Schizosaccharomyces. QCRAnn / zznz / E / YiAi The following is a non-exhaustive list of suitable filamentous fungi: a filamentous fungus belonging to the genera Penicillium, Rhizopus, Fusarium, Fusidium, Gibberella, Mucor, Mortierella, Trichoderma, Thermomyces, Streptomyces, and Aspergillus. More specifically, the filamentous fungus may be selected from Fusarium oxysporum, A. niger, A. awamori, A. oryzae, and A. nidulans. The products synthesized by the microbial production cell of the invention are those that incur a burden on the cell, and the cost of adaptation is reflected in a reduction in the growth rate. Such products include amino acids, organic acids, terpenoids, isoprenoids, polyketides, alcohols, sugars, vitamins, aldehydes, carboxylic acids, fatty acids, peptides, enzymes, therapeutic proteins, and precursors thereof, such as human growth hormone, insulin, glucagon-like peptide-1, monoclonal and polyclonal antibodies, and single-fragment antibodies. In one embodiment, the product is not a native product of the microbial production cell of the invention and, therefore, is not produced by a stem cell from which the microbial production cell was derived.In one embodiment, one or more genes encoding the product or encoding a metabolic pathway for the synthesis of the product are heterologous with respect to the microbial production cell of the invention; wherein said one or more genes may be transgenes. II. Characteristics of the microbial production cell of the invention II.i Adaptation cost - production load The heterologous expression of a desired product or pathways leading to a desired product in a microbial cell imposes a burden on the cell. This burden can also result from the overproduction of a native product, for example, in cells of selected microbial strains after mutagenesis. The burden can be described as a cost of fitness that results in slower cell growth (Example 1; Figure 1). This may be due to general and / or product-specific metabolic toxicities, increased use and / or depletion of potentially finite cellular resources and metabolites experienced by a microbial cell during the biosynthesis of a product of the invention under production conditions.Particularly during industrial-scale fermentation, a combination of adaptation cost and slower growth exerts selective pressure on the cell population in the heater, which over time leads to a decrease in product yield due to an accumulation of non-productive cells resulting from genetic mutations or non-genetic variation (example 2, BEG34 in figure 6). In the present invention, the presence and expression of one or more genes that encode a product or that encode a metabolic pathway for the biosynthesis of a product in a microbial production cell confers a suitability cost (burden). The cost of adapting to produce a product in a microbial production cell is quantified by comparing the growth rate of a non-charge-addicted microbial production cell (i.e., one that lacks the charge-sensing promoter operatively linked to the essential gene), but which comprises and expresses one or more genes that encode the product or that encode a pathway QCRAnn / zznz / E / YiAi metabolic pathway for product biosynthesis, relative to the growth rate of an original microbial cell devoid of genes encoding the product or metabolic pathway for product biosynthesis, from which the derived microbial production cell was derived. The burden and / or cost of adapting to such a microbial production cell preferably corresponds to a percentage reduction in the selected quantified growth rate of 5%, 10%, 15%, 20%, 25%, 35% and 45%, most preferably at least 5%. Preferably, the quantification of relative growth rates is carried out in the respective microbial cells by measuring their maximum exponential growth rate when cultured under essentially identical conditions; these conditions are chosen to closely mimic those in which a final large-scale fermentation takes place. II. Essential Gene A microbial production cell of the invention comprises an essential gene encoding a protein whose expression is required for cell growth and / or survival. Preferably, the essential gene and its expression do not indirectly cause a decrease in the production of the desired product by the production cell. Furthermore, the essential genes used in the context of this invention do not encode or lead to the synthesis of a desired product or intermediate of a heterologous pathway for expression in the microbial production cell. The essential gene is preferably a non-conditional essential gene, so that the expression of the gene is essential for cell growth and / or survival regardless of the composition of the growth medium or the conditions in which the cell is cultured. In one embodiment of the invention, when the production cell is a prokaryote, such as E. coli, the non-conditional essential gene is selected from folP-glmM, glmM, mur!, asd, thyA, usA, rpoD, nusG, rpsU. accD, degS, fldA, ftsN. hfíB, lolA, mraY, mreD, murA, murB, murF, nadD, rplVy rpsG. In a further embodiment of the invention, when the production cell is a prokaryote, such as a strain of Bacillus, the non-conditional essential gene is selected from glmM, ylaN, infA, and dapA. In one embodiment of the invention, the essential gene is a conditionally essential gene that leads to the synthesis of a product required for auxotrophic growth, or a protein product required for resistance to growth inhibitors, such as an antibiotic, specific toxin, protoxin, or the like. In one embodiment of the invention, when the production cell is a eukaryote, the essential gene, when not conditional, is selected from FOL1, MED7, RRP40, NOP8, PGI1, NEP1; and when conditional, it is selected from URA3, LEU2, TRP1, HIS3. When the essential gene is conditionally essential, then the composition of the growth medium / growth conditions of the production cell must be adjusted, such as using a growth medium that lacks specific nutrients or is supplemented with growth inhibitors. QCRAnn / zznz / E / YiAi Table 1. Non-exhaustive list of essential genes of E. coli, S. cerevisiae and Bacillus Gene*** Product(s) encoded by genes Ecocyc / Biocyc accession ID** E. coli folP-glmM (SEQ ID NO.: 1) Operon of genes encoding dihydropteroate synthase and phosphoglucosamine mutase EG50011 glmM (SEQ ID NO.: 3) phosphoglucosamine mutase EG11553 murl (SEQ ID NO.: 5) glutamate acemase EG11204 asd (SEQ ID NO.: 7) aspartate-semialdehyde dehydrogenase EG10088 thyA (SEQ ID NO.: 9) thymidylate synthase EG11002 rpoD (SEQ ID NO.: 11) RNA polymerase, sigma70 EG10896 nusG (SEQ ID NO.: 13) NusG transcription termination factor EG10667 rpsU (SEQ ID NO.: 15) 30S S21 ribosomal subunit protein EG10920 accD (SEQ ID NO.: 17) acetyl-CoA carboxyltransferase β subunit EG10217 degS (SEQ ID NO.: 19) serine endoprotease EG11652 fldA (SEQ ID NO.: 21) flavodoxin 1 EG10318 ftsN (SEQ ID NO.: 23) cell division protein FtsN EG11529 hflB (SEQ ID NO.: 25) ATP-dependent zinc metalloprotease FtsH EG11506 lolA (SEQ ID NO.: 27) outer membrane lipoprotein carrier protein G6465 mraY (SEQ ID NO.: 29) phospho-N-acetylmuramoyl-pentapeptide transferase EG11506 mraY NO.: 31) cell shape-determining protein MreD EG10610. QCRAnn / zznz / E / YiAi murA (SEQ ID NO.: 33) UDP-N-acetylglucosamine 1-carboxyvinyltransferase EG11358 murB (SEQ ID NO.: 35) UDP-N-acetylenelpyruvoylglucosamine reductase EG11205 murF (SEQ ID NO.: 37) D-alanyl-D-alanine-addition enzyme EG10622 nadD (SEQ ID NO.: 39) nicotinate-mononucleotide adenylyltransferase G6350 rplV (SEQ ID NO.: 41) 50S ribosomal subunit protein L22 EG10882 rpsG (SEQ ID NO.: 43) 30S ribosomal subunit protein S7 EG10906 S. cerevisiae IDdeSGD* FOL1 (SEQ ID NO.: 45) dihydroneopterin aldolase SGD:S000005200 MED7 (SEQ ID NO.: 47) MED7 mediator complex subunit SGD:S000005495 RRP40 (SEQ ID NO.: 49) RRP40 exosome non-catalytic core subunit SGD:S000005502 NOP8 (SEQ ID NO.: 51) Nucleolar protein required for 60S ribosomal subunit biogenesis SGD:S000005504 PGI1 (SEQ ID NO.: 53) glucose-6-phosphate isomerase SGD:S000000400 NEP1 (SEQ ID NO.: 55) 18S rRNA pseudouridine methyltransferase SGD:S000004176 URA3 (SEQ ID NO.: 57) orotidine-5'-phosphate decarboxylase SGD:S000000747 LEU2 (SEQ ID NO.: 59) 3-isopropylmalate dehydrogenase SGD:S000000523 TRP1 (SEQ ID NO.: 61) phosphoribosylanthranilate isomerase SGD:S000002414 HIS3 (SEQ ID NO.: 63) imidazoleglycerol-phosphate dehydratase SGD:S000005728 Bacillus Lotus brand of Bl_**** glmM (SEQ ID NO.: 147) phosphoglucosamine mutase BL02703 ylaN Protein that controls cell shape BL02974. QCRAnn / zznz / E / YiAi (SEQ ID NO.: 149) infA (SEQ ID NO.: 151) translation initiation factor BL01028 dapA (SEQ ID NO.: 153) dihydrodipicolinate synthase BL01208 ** BL: accessed via https: / / www.genoma.jp / kegg-bln / show_organism?org=bl! QCRAnn / zznz / E / YiAi **' An essential gene according to the invention is one that encodes a protein having at least 70%, 80%, 90%, 95% or even 100% amino acid homology with the protein encoded by the respective essential gene listed in the Table. ** BioCyc / EcoCyc Database Collection is a large online collection of Pathway / Genome Databases accessed via https: / / biocvc.org / * SGD is the Saccharomyces Genome Database - accessed via https: / / yeastaenome.org / The essentiality of a gene can be determined by creating cells in which the respective gene is inactivated, where an unconditional gene inactivation will result in a loss of cell viability or a failure in growth, regardless of the growth conditions; whereas a conditional gene inactivation will result in a failure in growth or loss of cell viability depending on the composition of the culture medium / conditions. A suitable essential gene can be identified by performing a test assay that replaces the native promoter of the essential gene being analyzed with an inducible promoter, such as the larabinose-inducible pbad (in E. cali), xylose-inducible pxyl (in Bacillus subtilis or Bacillus licheniformis), galactose-inducible pgal (in S. cerevisiae or Pichia pastoris), or plac (in E. coU or Lactobacillus). In such an essential gene assay, an integration DNA construct comprising the inducible promoter is chromosomally integrated into a host microbial cell using standard methods.In the case of prokaryotic organisms, the integration DNA preferably contains a catalog of RBS (e.g., Table 3) to direct the translation of the essential gene at different rates to account for the different basal expression levels of different promoters and the different basal expression levels required for essential genes to support growth at the corresponding wild-type-specific growth rate. After targeted integration of the integration DNA, the integrating cells were seeded in plates supplemented with permissive conditions (temperature or inducer concentration: >0.9% L-arabinose, >0.8% xylose, >1% IPTG, >2% galactose).The cells are subsequently analyzed to determine their synthetic addition to the inducing condition in standard growth curve assays, and suitable essential genes can be identified as those for which inducer-dependent growth rates can be identified. Inducer-dependent growth can be observed as a reduced growth rate of >5 percent in the absence of inducing conditions. Suitable essential genes are characterized by conferring less than <5% reduction in the exponential-phase-specific growth rate under optimal inducer conditions in the production-relevant culture medium. Methods for identifying an essential gene are detailed in “Gene Essentiality Method and Protocols” (January 2015) [DOI 10.1007 / 978-1-4939-2398-4], which allows experts to determine whether a gene is essential for microbial cell growth under specific growth conditions. These methods include mapping and identifying essential genes in Campylobacter jejuni, Streptococcus sanguinis, Porphyromonas gingivalis, Escherichia coli, Leptospirosis, Mycobacterium tuberculosis, Pseudomonas aeruginosa, and Candida albicans, primarily through the selection of transposon-labeled libraries. Furthermore, a variety of computational tools described therein allow experts to directly predict and identify genes encoding essential proteins in a microbial genome. This is facilitated by the widespread availability of whole-genome microbial sequences and the structural characteristics of many known essential genes.Consequently, the expert has access to both essential gene databases and several freely available online tools and algorithms to successfully and reproducibly identify a large number of essential genes in the microbial cell genome without undue burden. It is also worth noting that 82% of the essential genes in Saccharomyces cerevisiae encode essential proteins that are similar to a protein in another organism [Giaever G et al., 2002]; demonstrating that most essential genes, whether known or identified in one microorganism (e.g., yeast), will have a counterpart in other microorganisms—and could therefore be identified in a microorganism of choice by a simple BLAST search. II.iii Load detection promoter The microbial production cell of the invention comprises a load-sensing promoter operatively linked to the essential gene encoding a protein required for cell growth and / or survival, as described above. A load-sensing promoter is one that is induced in a microbial production cell that is subject to a load and / or suitability cost due to its production or overproduction of a product. Typically, the induction of the load-sensing promoter will occur when the production of a product by a microbial cell results in a reduction in the cell's growth rate, which, in turn, is attributable to the suitability cost of production. Importantly, the load-sensing promoter, according to the invention, is induced by the "load state" in the production cell resulting from the production of a product, and not by the product per se.Since the use of the charge-sensing promoter and essential gene to enhance the productivity of a microbial production cell is largely independent of the product for which it is designed, the charge-addiction conferred by the invention supports a wide range of microbial production cell applications. Since the essential gene is operatively linked to the charge-sensing promoter, its transcription and expression levels only increase above a basal level when the charge-sensing promoter is induced. A suitable charge-sensing promoter is one that, when not induced, allows a basal level of expression of the operatively linked essential gene that significantly limits or prevents cell growth and / or survival. Therefore, cells that Cells containing the charge-sensing promoter in the non-induced state will grow significantly more slowly than cells where the essential gene is operatively linked to its native promoter (Example 1, Figure 2). Conversely, microbial production cells containing the charge-sensing promoter linked to an essential gene exhibit a significantly increased growth rate when the cells synthesize the desired product compared to cells that do not produce the product (Example 1, Figure 3).Furthermore, the microbial production cells of the invention, despite the inherent burden of producing a product, can surprisingly achieve an initial growth rate that is indistinguishable from the growth rate of the original microbial cells, devoid of genes encoding the product or the metabolic pathway for product biosynthesis, from which the microbial production cell was derived (Example 1, Figure 4). Therefore, under production conditions, a microbial production cell of the invention will have a selective advantage over an escape variant of the production cell that ceases to synthesize the product and thus reduces the escape rate. In one modality, the charge-sensing promoter can be a native promoter, or a modified native promoter, with respect to the microbial production cell, while being heterologous with respect to the essential gene. In one modality, the promoter contains native TF / sigma binding sites. Suitable charge-sensing promoters are those in the o32 region of E. coli, as they are generally upregulated in response to protein overexpression and intracellular aggregation. Table 2 includes a non-exhaustive list of E. coli σ32 promoters, while additional suitable promoters were identified by Nonaka et al., 2006. In one embodiment, the load-sensing promoter is a factor-regulated promoter. In a preferred embodiment, the load-sensing promoter is activated via the o32 region and can be selected from the promoters of the E. coli genes htpG, ibpA, dpB, yccV, grpE, ycjX, IdhA, mutM, ybbN, prIC, groES, fxsA, and htpX. For Bacillus, such suitable load-sensing promoters can be selected, for example, from HrcA-regulated promoters, including the groES promoter. In one modality, the charge-sensing promoter is the promoter of the mutM gene. mutM encodes a functionally conserved DNA glycosylase responsible for initiating the repair of one of the most common oxidative stress-induced DNA damages, namely, oxidation of guanine to 7,8-dihydro-8-oxoguanine (8-oxoG) (Jain et al, 2007). Load-sensing promoters also include promoters related to a cell's carbon nutrient status and growth phase. Accordingly, in one modality, the load-sensing promoter is the toxin gene promoter, cspD, which is activated by reduced growth rates and carbon deprivation (Uppal et al., 2014; Yamanaka and Inouye, 1997) and is therefore predicted to be differentially upregulated in cells subjected to load or adequacy cost due to metabolite production. In one modality, the load-sensing promoter is a ribosomal RNA promoter, specifically a promoter of the rrnB and rmE genes, which respond to nutritional supply and are induced. QCRAnn / zznz / E / YiAi is promoted by the Fis protein and is inhibited by the alarmone ppGpp. The rrn promoter activity is induced in cells with high protein production, as seen in their early exponential growth phase (Nonaka et al, 2006). In one modality, the load-sensing promoter responds to oxidative stress associated with metabolic load and heterologous microbial production (Dragosits & Mattanovich, 2013). Promoters of the oxidative stress response include those regulated by OxyR, which activates several genes associated with cell enhancement and protection in response to oxidative damage; and promoters of genes belonging to rpoS (σε) that are upregulated during protein overexpression, primarily during the stationary growth phase. QCRAnn / zznz / E / YiAi Table 2. Non-exhaustive list of charge-sensing promoters No.* Promoter Protein encoded by the E. coli or S. cerevisiae gene regulated by the promoter Ecocyc / Biocyc accession ID** 2 p(ñtpG) (SEQ ID NO.: 65) Heat shock protein G (HtpG), a member of the Hsp90 family, is a molecular chaperone that assists in the refolding of protein aggregates in the cell. Transcription of htpG is activated via the σ32 region. (Yeast homolog: Hsp90). EG10461- MONOMER 3 p{ibpA} (SEQ ID NO.: 66) The small heat shock proteins LbpA and LbpB are chaperone proteins associated with heterologous protein expression and inclusion body formation that assist in the refolding of aggregated proteins. The transcription of ibpA is activated via the σ32 region. EG11534 4 ρ(φB) (SEQ ID NO.: 67) CIpB is a caseinolytic protease that catalyzes protein disaggregation. The transcription of dpB is activated via the σ32 and / or σ70 region. (Yeast homolog: Hsp104).EG10157 5 P(yccV) (SEQ ID NO.: 68) YccV, also known as HspQ, participates in the degradation of denatured protein during heat shock. Transcription of yccV is activated via the σ32 region. G6500 6 P(grpE) (SEQ ID NO.: 69) GrpE is a nucleotide exchange factor in the DnaK-Dnaj-GrpE chaperone system. The grpE promoter is activated via the σ32 region. EG10416 7 p(ycyX) (SEQ ID NO.: 70) ycyX is activated via the o32 region. G6659 8 p(ldhA') D-lactate dehydrogenase and the IdhA promoter are G592. (SEQ ID NO.: 71) activated via the σ32 region. 9 p(mutM) (SEQ ID NO.: 72) DNA-formamidopyrimidine glycosylase is a component of the base excision repair pathway that repairs certain types of DNA lesions. The mutM promoter is activated via the o32 region, but is inhibited by the binding of DksAppGpp under amino acid starvation. EG10329 10 p(ybbN) (SEQ ID NO.: 73) YbbN, also known as CnoX, is a chaperedoxin. The yybN promoter is activated via the o32 region. G6268 11 p(prlC) (SEQ ID NO.: 74) PrIC, also known as oligopeptidase A, belongs to the o32 region. EG11441 12 p(groES) (SEQ ID NO.: 75) GroES is a chaperonin, and belongs to the o32 and o70 region. EG10600 13 p(fxsA) (SEQ ID NO.: 76) FxsA is a polytopic membrane protein that belongs to the σ32 region. G7832 14 P(htpX) (SEQ ID NO.: 77) HtpX is a zinc-dependent endoprotease and heat shock protein that belongs to the o32 region. EG10462 15 p(rrnB) (SEQ ID NO.: 78) 16S rRNA gene, whose promoter responds to nutritional supply, and is induced in cells with high protein production. EG30085 16 p(rmEj) (SEQ ID NO.: 79) 16S rRNA gene, whose promoter responds to nutritional supply, and is induced in cells with high protein production. EG30088 19 P(cspD) (SEQ ID NO.: 80) CspD is a toxin. The cspD promoter responds inversely to growth rate. cspD transcription is activated by cyclic AMP-CRP, HNS, and ppGpp. EG11111 21 p(katE) (SEQ ID NO.: 81) The monofunctional catalase (HPlI) responsible for the breakdown of toxic hydrogen peroxide into water and oxygen in the cell. katE transcription is os-dependent and is activated by Fur-Fe2+ and ppGpp. EG10509 22 p(xtñA) (SEQ ID Multifunctional endonuclease. Exodeoxyribonuclease III, which, for example, removes DNA damaged by EG11073 peroxide. QCRAnn / zznz / E / YiAi NO.: 82) hydrogen. xthA belongs to region o32. 23 P(uspE) (SEQ ID NO.: 83) Universal stress protein E; which is induced in the stationary phase as a result of various stress conditions such as oxidative stress. Transcription of uspE is activated by GadX and ppGpp. EG11246 24 p(gac®) (SEQ ID NO.: 84) Glutamate decarboxylase B helps the cell maintain a near-neutral intracellular pH after exposure to acidic conditions by converting glutamate to gamma-aminobutyrate, accepting a proton in the reaction. gadB is part of region o70 and os, and is activated by AdiY, GadE, GadX, Pasp56-RcsB and ppGpp. EG11490 25 P(ahpC) (SEQ ID NO.: 85) Alkyl hydroperoxide reductase C plays a role in protecting cells from oxidative stress by catalyzing the reduction of endogenously synthesized hydroperoxide. ahpC is part of o70 and transcription is activated by OxyR. EG11384 26 p(AatG) (SEQ ID NO.86) Bifunctional hydroperoxidase I (HPI) acts as both a catalase and a peroxidase. EG10511 27 P(grxA) (SEQ ID NO.: 87) Glutaredoxin is primarily responsible for catalyzing disulfide reduction. Transcription initiation of grxA is activated by OxyR. EG10417 28 p(oxyS) (SEQ ID NO.: 88) oxyS is a small RNA gene activated by oxidative stress via OxyR. EG31116 29 ρ(ροχβ) (SEQ ID NO.: 89) Pyruvate oxidase is upregulated by oxidative and osmotic stress via OxyR, but also by Ora, MarA, fnr, ppGpp, and os. EG10754 30 p(trxC) (SEQ ID NO.: 90) Thioredoxin induced during oxidative stress via OxyR. EG11887 p(KAR2) (SEQ ID NO.: 91) HAC-upregulated promoter comprising an unfolded protein response element, which responds positively to high production. p(PD11) (SEQ ID NO.: 92) HAC-upregulated promoter comprising an unfolded protein response element, which responds positively to high production. p(SAA1) (SEQ ID HAC-upregulated promoter comprising an unfolded protein response element, which. QCRAnn / zznz / E / YiAi NO.: 93) responds positively to high production. píFPR2) (SEQ ID NO.: 94) HAC-upregulated promoter comprising an unfolded protein response element. p(RPL3) (SEQ ID NO.: 95) RNA polymerase I upregulated promoter, which responds positively to high production. p(RPL6A) (SEQ ID NO.: 96) RNA polymerase I upregulated promoter, which responds positively to high production. p(RPL28) (SEQ ID NO.: 97) RNA polymerase I upregulated promoter, which responds positively to high production. p(OGG / ) (SEQ ID NO.: 98) DNA damage response, resulting from heterologous expression that broadly induces transcription of the DNA repair system. p(RAD51) (SEQ ID NO.: 99) DNA damage response, resulting from heterologous expression that widely induces transcription of the DNA repair system. p(RAD54) (SEQ ID NO.: 100) DNA damage response, resulting from heterologous expression that widely induces transcription of the DNA repair system. No. corresponds to the numbers assigned to the different strains analyzed in the Examples section QCRAnn / zznz / E / YiAi of the present application. ** BioCyc / EcoCyc Database Collection is a large online collection of Pathway / Genome Databases accessed through https: / / biocyc.org / The basal expression level and specific response curve following induction / activation of different charge-sensing promoters (e.g., in Table 2) vary, which can be exploited by selecting a charge-sensing promoter that has the best match (in terms of strength) with a specific microbial production cell and its product. Suitable load-sensing promoters that are induced by load and / or suitability cost in a microbial production cell during production can be selected from public databases known to the skillful user, e.g., https: / / ecocvc.org for E. coir promoters, https: / / bsubcvc.org for Bacillus subtilis promoters (which also works for Bacillus licheniformis promoters), and their respective prokaryotic homologs; https: / / www.yeastqenome.org for Saccharomyces cerevisiae promoters and their fungal homologs. Suitable charge-sensing promoters can also be validated in a test assay in which a candidate charge-sensing promoter is operationally linked to a gene encoding a fluorescent protein (e.g., green fluorescent protein) and integrated into a genetically modified microbial production cell designed to synthesize a product, and into a corresponding non-producing cell (control), which is isolated after a serial dilution culture experiment in production medium for 50 to 150 cell generations. The charge-sensing promoters induce detectable fluorescent protein expression in the producing cells compared to the non-producing cell (control) by at least 5%, 7.5%, 10%, 15%, 25%, 60%, 150%, and 300%. II.iv Coincidence of a charge-sensing promoter with a microbial production cell Microbial production cells, in response to the burden or cost of producing a product, exhibit a transcriptional state characterized by the expression of certain genes whose expression is not induced in a corresponding non-productive mother cell or in a non-productive escape cell derived from a microbial production cell during production fermentation. The physiological nature of the burden or cost of production will depend on the product synthesized by a given microbial production cell and will be reflected in the types of genes whose expression is induced. The identity of the promoters of induced genes in a cell producing a given product can be determined using well-established techniques (e.g., transcriptomics, see Example 7).Since many of the induced gene promoters will be related to or correspond with those listed in Table 2, these provide a starting point for finding a matching charge-sensing promoter for a given microbial production cell. The choice of promoters can be broadened by identifying 5 to 15 gene promoters that are specifically upregulated in the production strain of interest. As illustrated in the examples herein, the method used to match a charge-sensing promoter operationally linked to an essential gene with a microbial production cell in a product-specific manner is experimentally rapid and can be performed in simple laboratory settings. I lv Translation control elements The regulation of the growth of a microbial production cell of the invention by means of the expression of the essential gene requires that the response threshold and the load-sensing promoter curve and the level of expression of the essential gene be balanced; such that the expression of the essential gene at the basal level supports limited or no growth, whereas in highly productive cells the induced load-sensing promoter drives sufficient expression of the essential gene to support a significantly higher growth rate, preferably a growth rate similar to that of productive cells lacking the load-sensing promoter of the invention or < 5% less, when measured in the exponential growth phase. A suitable approach to balancing the response to the detection promoter's load The QCRAnn / zznz / E / YiAi loading at the essential gene expression level modifies the translation strength of the essential gene. In bacteria, translation strength is defined by the Shine-Dalgarno sequence / ribosome binding site (RBS) directly upstream of the start codon, whereas in eukaryotic cells, translation initiation regions / Kozak elements can be used to modify translation strength. RBSs in E. cali that confer a wide range of translation strengths are provided in Table 3, while additional examples can be found in the literature (e.g., Bonde et al., 2016).An expert in the technique can balance the translational strength of the regulated essential gene by constructing four ribosomal binding site variants for each charge-sensing promoter (Rugbjerg et al., 2018, PNAS) and analyzing which variant allows a selected essential gene to effectively regulate a cell's growth rate. Examples of RBS for use in Bacillus licheniformis or Bacillus subtilis are provided in Table 3.1. QCRAnn / zznz / E / YiAi Table 3. List of suitable RBS in E. cotí that generally cover a wide range of expression as defined in the assay by the expression of red fluorescent protein (Bonde et al, 2016). RBS Log (Expression Level) ACTTGA 2.80244 ACTTGC 2.73094 ACTTGG 3.14847 ACTTGT 2.77523 Table 3.1. List of suitable RBS in B. subtilis or B. licheniformis that generally cover a wide range of expression. RBS ACGAGA ACGAGC ACGAGT ACGAGA II.vi Load detection promoters designed and translation control element A native charge-sensing promoter of choice is generally encompassed by the -1 to -300 bp region (upstream) of the native regulated ORF in prokaryotic organisms and the 1 to -500 bp region in eukaryotic organisms. Core promoters to be included and the sequence boundaries of their regulatory sites, e.g., transcription factor binding sites, are common knowledge, as for σ32 (Nonaka et al., 2006). The translation control element / RBS can be added downstream of the promoter to avoid altering the regulatory properties of the selected promoter sequence. II. vi i Improved production levels A striking advantage of the microbial production cell of the invention, besides having an increased initial growth rate compared to non-productive cells, is that the cells retain significantly improved productivity during large-scale fermentation (simulated in Example 2; Figure 6), over many cell divisions, compared to microbial production cells lacking engineered load addition. The striking advantages conferred by load addition in a microbial production cell of the invention are obtained regardless of the type of product synthesized—as illustrated by the range of products synthesized by microbial production cells in Examples 2–5. According to one embodiment, the microbial production cell of the invention is characterized by improved product yield after at least 20, 25, 30, 35, 40, 45, 50, 55, 60, 70, 100, 150, 250, or 400 generations of cell division from a single cell, compared to a non-charge-addicted production cell undergoing the same number of cell division generations. Product yield is measured as moles or grams of product produced per unit of substrate. In one modality, production levels increase by at least 10, 25, 50, or 80% after at least 50 generations of cell division from a single cell, compared to a non-charge-addicted production cell after the same generations of cell division. Universal practice in microbial cell factory engineering aims to minimize the burden known to arise from the maintenance and expression of heterologous pathways. The present invention provides a counterintuitive solution for improving cell factory yields by making microbial cell growth and survival dependent on the cell producing its product while subjected to a constant burden or fitness cost. While not wishing to limit the theory, it is speculated that the selection pressure exerted on a microbial production cell of the invention and its descendants, where only productive cells in a given burden state can grow / survive, may serve to progressively select burdened cell subpopulations during long-term culture from an initial population of isogenic cells. III. Methods for preparing and identifying cells from a charge-addicted microbial production strain In a preferred method for carrying out the invention, a charge-addicted microbial production strain is prepared and identified by the following steps. To obtain the best working relationship between the charge-sensing promoter and the essential gene, it may be relevant to prepare and analyze different candidate charge-sensing promoters with different RBSs to regulate a selected essential gene. QCRAnn / zznz / E / YiAi III. i Identification of candidate load-sensing promoters in a specific production strain The candidate load-sensing promoters listed in Table 2. Alternatively, unique positive differentiation gene transcripts detected in a specific production strain of interest can be identified; their respective promoters provide a source of candidate charge-sensing promoters. Preferably, such differentiation gene transcripts are identified by comparing the transcription profile of a microbial production strain (during production) with one or more isolated genetic or non-genetic escape mutant variants derived from the corresponding production strain, where such escape mutant variant is characterized by at most 50% lower production rate. Positive differentiation gene transcripts can be identified using transcriptomics; for example, by RNA sequencing of the transcribed RNA extracted from productive microbial production cells compared to the non-producing / low-producing escape mutant variant.The identified promoters can be analyzed in combination with a given essential gene in a microbial production cell. Example 7 illustrates a method for identifying one or more charge-sensing promoters; where these promoters are then operationally linked to an essential gene in a selected microbial production cell for testing. III. ii Introduction of the Charge-Sensing Promoter into Growth Regulation Processes One or more promoters selected from the list of general candidate charge-sensing promoters (Table 2) or from identified specific charge-sensing promoters (see l1i) are analyzed by operationally linking them to an essential gene in the microbial production cell. Different translation strengths of the essential gene can be analyzed simultaneously by providing alternative RBS sequences for the cognate essential gene; different essential genes can also be analyzed (as described in section ll1i). The essential gene can be native or heterologous with respect to the microbial production cell. When the essential gene is a native gene, its native cognate promoter can be disrupted (i.e., become non-functional), for example, by mutation or deletion events, and the charge-sensing promoter (which is heterologous to the essential gene) is then operatively linked to the native essential gene by targeted introduction. In another modality, the native essential gene promoter is replaced with the charge-sensing promoter by targeted introduction. Suitable methods for the targeted introduction of a genetic sequence into microorganisms include recombination in bacteria, for example, Lambda Red recombination in E. coli, while homologous recombination can be used in yeasts and filamentous fungi. Both concepts can optionally be used in combination with CRISPR to increase the efficiency of gene replacement. III. Selection for balanced load detection and growth regulation Microbial production cell clones comprising a detection promoter QCRAnn / zznz / E / YiAi cargo-inserted genes operatively linked to an essential gene are then screened to identify clones in which the cargo-sensing promoter regulates an essential gene in a way that controls growth. For example, the growth of several such clones (e.g., clones 8-96) is compared with cells from a corresponding non-charge-addicted microbial production strain, under conditions where product production is controlled (e.g., using microbial production strains where the production gene is inducible). When cell growth is measured under conditions where product production by both strains is low / absent; a suitable charge-addicted production clone is one that exhibits a significantly lower growth rate, and preferably at least 5%, than the non-charge-addicted production strain (Example 1, Figure 2). 111.iv Validation of undisturbed central metabolism and production Changes in the transcriptional regulation or expression of essential genes can lead to an unintended indirect disruption of production genes and central carbon or nitrogen metabolism, compromising product formation and, in turn, reducing the load on a load-addicted microbial production cell. To exclude such clones, cell growth is measured under conditions where both strains synthesize the product; a suitable load-addicted production clone is one that exhibits a growth rate equal to or less than that of the non-load-addicted production strain (as seen in Example 2, Figure 7). III. Selection for growth rate stability Clones that meet the above criteria are analyzed to determine the stability of their growth rate under conditions that simulate production by culturing them for at least 20 generations of cell division, for example, by serial steps and measuring growth rates, or by sampling from various steps in a scaled-up production process. Microbial production cells addicted to appropriate loads maintain lower growth rates than the non-load-addicted production strain over time (e.g., Example 2, Figure 7). IV. Method for producing a desired product using cells from a charge-addicted microbial production strain A second aspect of the present invention relates to a method for producing a desired product comprising the steps of: a. providing a genetically modified microbial production cell for synthesizing a product, wherein said cell further comprises an essential gene operatively linked to a charge-sensing promoter, and wherein said promoter is heterologous with respect to said essential gene, b. introduce the genetically modified microbial cell into a culture medium that QCRAnn / zznz / E / YiAi comprises substrate for the production of said product, c. recovering said product synthesized by said culture, wherein the synthesis of the product confers a burden and / or a suitability cost to said cell, and wherein the expression of said essential gene is upregulated with respect to the basal level of expression of said essential gene when said burden-sensing promoter is induced by said burden and / or suitability cost; and wherein the lack of said product synthesis in said burden-addicted production strain or progeny cell thereof reduces the growth rate of said cell. IV. Use of cells from a charge-addicted microbial production strain to produce a desired product A third aspect of the present invention relates to the use of a microbial production cell addicted to the load of the invention to produce a desired product, wherein the lack of synthesis of the product in said production strain addicted to the load or progeny cell thereof reduces the growth rate of said strain. EXAMPLES Example 1: Design of E. coli strains addicted to loads that produce recombinant human growth hormone 1.1 Maintenance and expression of heterologous production genes by a cell factory constitutes an unnatural burden on its cells The growth rate of E. coli BL21 (DE3) stem cells was compared with an engineered derivative transformed with the pEG34 plasmid, comprising a gene encoding recombinant human growth hormone (hGH) fused with green fluorescent protein (GFP). 1.1.1 Materials and Methods Cells from the E. coli host strain BL21 (DE3) (E. coli Genetic Stock Center in the QCRAnn / zznz / E / YiAi Yale University) were made electrocompetent and transformed by standard electroporation methods (1800 V, 25 pF, 200 Ohms, 1 mm wide cuvette) with the pEG34 plasmid, and placed on LB agar plates containing chloramphenicol. Table 4. Plasmids Plasmid Genotype Proteins expressed pEG34 [SEQ ID NO.: 101] hGH-GFP fusion camR* gene [SEQ ID NO.: 103] hGH fused to GFP [SEQ ID NO.: 102] chloramphenicol resistance protein [SEQ ID NO.: 104] pEGO [SEQ ID NO.: 105] camR* gene [SEQ ID NO.: 103] chloramphenicol resistance protein [SEQ ID NO.: 104] pENDU5CAM Iss Lysostaphin gene [SEQ ID NO.: 107] [SEQ ID NO.: 106] camR* gene [SEQ ID NO.: 103] chloramphenicol resistance protein [SEQ ID NO.: 104] pMevT [SEQ ID NO.: 108] mevT operon camR* gene [SEQ ID NO.: 103] Acetoacetyl-CoA synthase [SEQ ID NO.: 109] Hydroxymethylglutaryl-CoA synthase [SEQ ID NO.: 110] Hydroxymethylglutaryl-CoA reductase [SEQ ID NO.: 111] chloramphenicol resistance protein [SEQ ID NO.: 104] pSIM5-tet [Koskiniemi et al 2011] QCRAnn / zznz / E / YiAi * The camR gene [SEQ ID No: 103] encoding the chloramphenicol resistance protein [SEQ ID No: 104] is in pEG34 [SEQ ID No: 101] located at nucleotide positions 3768-4427 on the supplementary strand; it is in pEGO [SEQ ID No: 105] located at nucleotide positions 2339-2995 on the supplementary strand; it is in pENDU5CAM [SEQ ID No: 106] located at nucleotide positions 1617-2276 on the supplementary strand; and it is in pMevT [SEQ ID No: 108] located at nucleotide positions 6585-7244 on the supplementary strand. Single-colony transformant precultures were grown in 96-well microtiter plates in 200 pL of 2xYT medium (16 g / L tryptone, 5 g / L NaCl, 10 g / L yeast extract) containing 500 μM IPTG and 30 mg / L chloramphenicol. The plates were incubated at 37°C with rapid horizontal shaking in an ELx808 plate reader (Biotek), with OD630 readings taken every ten minutes. OD630 values were subtracted in the background using the OD630 value from the first reading. 1.1.2 Results E. coli cells comprising the hGH-GFP expression plasmid, pEG34, grow more slowly than the original E. coli host cells from which they are derived (Figure 1); illustrating the burden or load placed on the cells as a result of the allocation of cellular resources for the maintenance and expression of a synthetic construct. 1.2 Design of a charge-addicted cell factory The original host E. coli load-addiction strains were genetically engineered to incorporate a genetic circuit designed to confer a selective fitness advantage to productive cells in a cell factory. Specifically, a load-sensing promoter (pmutM, Pyccv, or Pycjx) was replaced in place of the native promoter of the essential gene folP-glmM operon on chromosome E. coli BL21 (DE3). The genetic circuit also included a RBS between the promoter and the essential gene, where four different RBSs were analyzed (Table 3) to modulate the expression level of the essential gene. The growth rate of the strains comprising the genetic circuit was compared with the original host strain E. coli BL21 (DE3). 1.2.1 Materials and Methods Charge detection promoters: The promoters, pmutM, pyccv, or pyc!x, were generated by PCR by amplifying a 0.3 kb region immediately upstream of the respective gene (see Table 3) using the primers specified in Table 5 and genomic DNA derived from E. coli BL21 (DE3) cells used as a template. PCR mix: 10 µL of MQ water, 2 µL of forward primer (10 µM), 2 µL of reverse primer (10 µM), 10 µL of DNA template, 15 µL of Phusion U MasterMix (Thermo Scientific). PCR reaction protocol: 95°C for 180 seconds (1x); 95°C for 20 seconds, 68-58°C (touch-up) for 30 seconds, 72°C for 60 seconds (35x); 72°C for 300 seconds (1 x); leave at 15°C. QCRAnn / zznz / E / YiAi Table 5. Primers E. coli Gene Promoter Primer Name Primer Sequence (5'-3')* SEQ ID No.: yccV yccV forward TTCATATGUGGTTATAAAGACATCAACATGC 112 yccV reverse ATCCCCATTACGTGAGGATGGCTAAGGTCAGCCAGCCAGTTAGTCAGTTACATGC CAAGTAGTCACCTCCCGGGAAATCT 113 ycjx ycjX direct ATTCATATGUTTGGCTGATACTGTAATTCTTC 114 ycjX reverse ATCCCCATTACGTGAGGATGGCTAAGGTCCAG TGAAGTACCCTGGGGCAAAGAGTTTCATAccttN CAAGTTGCTGCTGCTGCTGCT15 mu mutM direct ATTCATATGUGGCGAAAAGTACTAAGTACTTA 116 mutM reverse ATCCCCATTACGTGAGGATGGCTAAGGTCCAG TGAAGTACCCTGGGCAAAGAGTTTCATaccttN CAAGTAGCATCTCCAGGAATGAACA 117 P492 TGCAACTTCTTCA19 GGC18 AAGAACCAGGCGCTTCTAA 119 P525 ATTGATGACCTGATGGCAC 120 P526 GATCCAGACTTCGAAGCG 121 * Additional RBS coding sequences are in bold; where N is either A, G, T or C. The RBS is encoded on the opposite strand of the oligosequence shown. USER cloning was used to generate integration sequences comprising the amplified promoter region fused with a 1.5 kb linear DNA fragment containing a kanR gene for selecting correct recombination products and a 221 bp targeting sequence identical to 221 bp directly upstream of the folP gene. The amplified promoter region and the kanR-folP fragment were fused by mixing them in equimolar amounts and adding 1 µL 10x T4 ligation buffer (Thermo Scientific) and 0.75 µL of USER enzyme (New England Biolabs), in a total reaction volume of 10 µL. The USER reaction was carried out at 37°C for 30 minutes. The reaction was then placed at room temperature for 15 minutes, followed by the addition of 0.75 μI of DNA ligase T4 (Thermo Scientific) and incubated at room temperature for 30 minutes.An example of such an integration sequence comprising the promoter, KanR resistance gene, and folP targeting sequence can be found in sequence listing SEQ ID NO. 140 (s9_pmutM_folP). The ligated product was then amplified using the 'reverse' primers (according to the specific promoter in Table 5) and P493 (Table 5) at approximately 250 ng / µL using the PCR reaction protocol: 98°C for 180 seconds (1x); 85°C for 20 seconds, 72–68°C (touch-up) for 30 seconds, 72°C for 60 seconds (35x); 72°C for 5 min (1x); leave at 15°C. The excess primer provided a 50 bp folP-identical targeting sequence to direct recombination to the folP locus. Chromosomal integration of charge addition promoters: The promoters were integrated upstream of the folP gene into the genome of E. coli BL21 (DE3) cells as follows: 100 µL of 2xYT medium containing tetracycline were inoculated with 600 µL of overnight BL21 (DE3) cells pretransformed with pSIM5-tet (Koskiniemi et al., 2011). The cells were cultured at 30°C, and upon reaching OD600=0.20, the culture was transferred to a 42°C shake bath for 15 minutes to allow expression of the recombinant enzymes located in pSIM5-tet. The culture was then transferred to two chilled 50 µL centrifuge tubes; centrifuged at 4000 g for 10 minutes; the supernatant was discarded; and the remaining cell sediments were washed with 20 ml of ice-cooled 10% glycerol.The partially resuspended cells were then centrifuged at 4000 g for 6 min; the supernatant was discarded; and the cell pellets were washed with 20 mL of ice-cooled 10% glycerol. The partially resuspended cells were centrifuged at 4000 g for 6 min; each cell pellet was carefully resuspended in 495 µL of ice-cooled 10% glycerol and pooled. Ninety µL of resuspended cells were added to electroporation cuvettes, each containing 1 µL (>250 ng) of one of the charge-sensing promoter integration sequences. The cells were electroporated under the following conditions: 1800 V, 25 pF, 200 Ω, 1 mm wide cuvette. 900 ml of 2xYT medium was added to the cuvette immediately after electroporation and the cells were allowed to recover for 1.5 hours at 37°C in 1.5 ml Eppendorf tubes.Electroporated cells were incubated at room temperature overnight to allow time for recombination; they were then placed on LB agar plates containing 50 mg / L kanamycin and cultured at 37°C overnight to ensure pSIM5-tet curing. Correct targeting to the essential gene locus was validated using primers P525 and P526. Individual kanR colonies of average or smaller size than the colony population were generally collected. Integration of the charge-addiction promoter into the colony genome The selected QCRAnn / zznz / E / YiAi colonies from kanR were validated by colony PCR using Taq DNA polymerase and primers targeting the folP promoter region. In addition, the identity of the RBS in the selected colonies was determined by Sanger sequencing. Subsequently, the growth rate of the strains comprising the genetic circuit was compared with the original host strain BL21 (DE3) of E. coli by culturing in 200 μI of 2xYT supplemented with IPTG 500 μM at 37°C with horizontal shaking. 1.2.2 Results The growth rate of the selected load-addicted E. coli strains was slower, to varying degrees, compared to the original E. coli host from which they were derived (Figure 2 shows the growth of load-addicted strains s5.0#3, s7.0#8, and s9.0#8, where the essential genes folP-glmM are controlled by the load-sensing promoters pyCcv, pyc!x, and pmutM, respectively). Since cell growth depends on the expression level of the essential genes folP-glmM, it can be concluded that the level of essential gene expression driven by the respective load-sensing promoter in a non-productive, load-addicted strain is insufficient to support growth at the level of an original wild-type strain. The observed reduction in growth rate in these charge-addicted strains provides a measure of the penalty that can be exerted on a non-producing cell that spontaneously evolves during the culture of a factory cell population comprising the charge-addiction genetic circuit. The degree of penalty is determined by the choice of charge-sensing promoter combined with the strength of the chosen RBS. The greater the penalty, the wider the window for negative selection of any low- or no-producing variants (e.g., resulting from a mutation in the production genes) that arise spontaneously during culture. 1.3 Production increases the growth rate of a charge-addicted cell factory E. coli strains addicted to charges, which conferred a growth penalty due to lack of production (Figure 2), were used as host strains to demonstrate the selective fitness advantage for productive charge-addicted cells. 1.3.1 Materials and methods The slowest-growing clones of the charge-addicted E. coli strains (s9.0#8, s5.0#3, and s7.0#8) were made electrocompetent and transformed by standard electroporation methods (1800 V, 25 pF, 200 ohms, 1-mm-wide cuvette) with either pEG34 or pEGO, respectively (Table 4), and plated onto LB agar plates containing chloramphenicol and kanamycin. Single-colony transformants were cultured overnight in 2xYT medium containing chloramphenicol and then used to inoculate 96-well microtiter plates containing 200 µL of 2xYT medium (IPTG 500 µM, chloramphenicol) and cultured at 37°C with rapid horizontal shaking. QCRAnn / zznz / E / YiAi used an ELx808 (Biotek) license plate reader with OD630 readings every ten minutes. The OD630 values were subtracted in the background using the OD630 value from the first reading. Each of the E. coli strains was transformed with the pEG34 or pEGO plasmid (Table 4), and their growth rate properties were measured when the cells were induced to synthesize the recombinant protein, hGH fused with GFP. 1.3.2 Results The charge-addicted strain, E. coli strain s9.0#8, which contains the pmutM charge-sensing promoter that controls the expression of the essential genes folP-glmM, exhibited the slowest growth of the strains tested compared to the original E. coli strain BL21 (DE3) (Figure 2). This reduction in exponential growth rate was reversed in E. coli strain s9.0#8 cells transformed with the pEG34 plasmid and induced to express the recombinant protein hGH-GFP, in contrast to E. coli strain s9.0#8 cells transformed with the empty plasmid BEGO (Figure 3). This demonstrates that the pmutM charge-sensing promoter in E. coli strain s9.0#8 is induced by the biological charge, or load on the cells, caused by the synthesis of the recombinant protein hGH-GFP. This, in turn, leads to an upregulated expression of the folP-glmM genes and enhanced exponential growth. The synthesis of hGH-GFP in each of the charge-addicted strains, strains s5.0#3, s7.0#8 and s9.0#8 of E. coli harboring the pEG34 plasmid, not only led to a reversal of the reduction in exponential growth rate; but, in addition, the growth rate of these strains was indistinguishable from the growth of the original strain BL21 (DE3) of E. coli (Figure 4). In summary, this example illustrates that the genetic circuit of charge addiction can be used to confer a selective fitness advantage to those cells in a cell factory whose protein or metabolite synthesis is high enough to constitute a biological charge, or cargo; and that this biological charge, or cargo, is detectable by a charge-sensing promoter operatively linked to an essential gene in the cells. Conversely, non-productive variant cells (e.g., resulting from mutations in the production gene), which arise spontaneously during culture in the charge-addicted cell factory, will be subject to negative selection pressure, as their growth will be slowed to a rate supported by the basal expression of the essential gene.A reduced growth rate is, in itself, sufficient to slow the increase in the frequency of such variant cells in the cell factory and thus delay the decline in the productivity of the cell factory over time. Example 2: Load-addicted E. coli strains that produce human growth hormone show improved long-term production stability It is shown that charge-sensing promoters are promoters that can detect and be activated by a charge-induced state in a cell resulting from the cellular synthesis of a recombinant protein, hGH-GFP. Once activated, the charge-sensing promoters are shown to QCRAnn / zznz / E / YiAi loads raise the expression of an essential gene, folP-glmM, to a level sufficient to confer a selective growth advantage to a cell compared to a non-productive cell. To maximize the dynamic range of essential gene expression in response to its affinity load-sensing promoter, the load-sensing promoter is randomly combined with variant RBS coding sequences (Table 3) that confer different translation strengths. Promoters that have charge-sensing properties suitable for use in a genetic charge-addition circuit have been shown to include heat shock promoters, DNA damage promoters, oxidative stress response promoters, and rRNA promoters, as illustrated in the following genetically modified production strains grown under simulated large-scale production conditions. First, a series of clones harboring random variant RBS coding sequences for each of the charge-sensing promoters were selected, and their hGH-GFP synthesis was followed for many cell divisions to demonstrate their relative ability to elevate / preserve recombinant hGH-GFP synthesis over time. 2.1 Materials and Methods Charge detection promoters: The promoters, pyCcv, pyCjx, p¡bPA, pgrPE, pidhA and pybbN, and their respective integration sequences were generated by PCR and USER cloning as described in Example 1.2.1, using the primers specified in Table 6; while the ligated products were amplified using the 'reverse' primers (according to the specific promoter in Table 6) and P493 (Table 5). QCRAnn / zznz / E / YiAi Table 6. Primers E. coli Gene Promoter Primer Name Primer Sequence (5'-3')* SEQ ID No.: ibpA ibpA direct ATCCCCATTACGTGAGGATGGCTAAGGGTCCAGT GAAGTACCCTGGGGCAAAGAGTTTCATACTTNCA CTACCATCATTGACTGAG12bp ibpA reverse ATTCATATGTTTGGCCTGATGAGTTATAGCG 123 grpE grpE direct ATTCATATGUTCTCCGCGAGCGTGCCAGI III 124 grpE reverse ATCCCCATTACGTGAGGATGGCTAAGGTCCAGT IdhA IdhA direct ATTCATATGUGGGAACCCACAGCCCGAGCGTC 126 IdhA inverse ATCCCCATTACGTGAGGATGGCTAAGGTCCAGT GAAGTACCCTGGGCAAAGAGTTTCATaccttNCA AGTAAGACTTTCCAGTGATGT 127 ybbN ybbN direct ATTCATATGUCCCATTCGTACTCGCTTCACCGAT CCCCATTACGTGAGGATGGCTAAGGTCCAGTGA 128 AGTACCCTGGGCAAAGAGTTTCATaccttNCAAG TGG AGTCG CTCTCTGTTGTCG ybbN inverse ATCCCCATTACGTGAGGATGGCTAAGGTCCAGT GAAGTACCCTGGGCAAAGAGTTTCATAccttNCA AGTGGAGTCGCTCTCTGTTGTCG 129 fxs fxsA directo ATTCATATGUTAAACACACAGAATATATGTGG 130 fxsA inverse ATCCCCATTACGTGAGGATGGCTAAGGTCCAGT GAAGTACCCTGGGCAAAGAGTTTCATaccttNCA AGTAGGTTTCTCCTGTAATAGCA 131 rrnB rrnB directo ATTCAGTCGATCGATCGGGGGG131 rrnB reverse ATCCCCATTACGTGAGGATGGCTAAGGTCCAGT GAAGTACCCTGGGCAAAGAGTTTCATaccttNCA AGTAAAAGTTTGACGCTCAAAGA 133 rrnE rrnE direct ATTCATATGUAATGCCTCCGTTGAGACGACA AC 134 rrnE inverso ATCCCCATTACGTGAGGATGGCTAAGGTCCAGT GAAGTACCCTGGGCAAAGAGTTTCATAccttNCA AGTAAAAGTTTGATGCTCAAAGA 135 poxB poxB direct ATTCATATGUTAGGTTGTCGCTGCCTGCCGTG 136 poxB reverse ATCCCATTAGGGTTGGTTGA GAAGTACCCTGGGCAAAGAGTTTCATaccttNCA AGTGGTTCTCCATCTCCTGAATG 137 Additional RBS coding sequences are in bold; EN where N is either A, G, T or QCRAnn / zznz / E / YiAi C. The RBS is encoded on the opposite strand of the oligosequence shown. Chromosomal integration of charge addition promoters: Each of the promoters was integrated upstream of the folP gene in the genome of the E. coli BEG34 strain (corresponding to E. coli BL21 (DE3) harboring the pEG34 plasmid), as follows. E. coli BEG34 strain cells, pretransformed with the recombinant plasmid pSIM5-tet, were prepared and transformed by electroporation with each of the promoter integration sequences, as described in Example 1.2.1. Following the described pSIM5-tet recombination and curing steps, eight colonies were selected from each plate, corresponding to eight clones with the same promoter integration but having a random variant RBS DE sequence (see Table 6). Next, each clone was transferred to a cavity of a 96-cavity plate containing 200 pl of 2xYT supplemented with chloramphenicol for maintenance of the pEG34 plasmid.2 μI of each cultured clone were used to validate promoter integration by colony PCR as described in Example 1.2.1; before freezing the 96-well plate. Short-term hGH-GFP production selection assay: The frozen 96-cavity plate was thawed, and a needle replicator was used to transfer cells to a new cavity plate containing 200 μL of 2xYT supplemented with chloramphenicol. This plate was sealed with a Breathe-Easy sealing membrane (Sigma-Aldrich) and placed in a SynergyHI plate reader (Biotek) overnight at 37°C and linear shaking at 754 rpm for 20 hours; the OD (600 nm) and GFP fluorescence (ex / em 485 nm / 528 nm) of each cavity were measured every 10 minutes for a period of 20 hours. The plate was then placed in a normal benchtop plate shaker at room temperature for 4 hours, followed by the transfer of 2 μL of culture from each cavity to a new 96-cavity plate containing 200 μL of 2xYT supplemented with chloramphenicol and 0.5 mM IPTG.The new 96-cavity plate was also sealed with a Breathe-Easy sealing membrane (Sigma-Aldrich) and placed in a SyngergyFII plate reader overnight at 37°C with linear shaking at 754 rpm for 20 hours. The OD and GFP fluorescence of each cavity were measured at 600 nm and ex / em 485 nm / 528 nm every 10 minutes for 20 hours. The following day, 2 µL of culture were transferred to a new 96-cavity plate containing 200 µL of 2xYT supplemented with chloramphenicol and 0.5 mM IPTG, and this process was repeated daily for a total of 6 days. Long-term hGH-GFP production assay (Figure 6): A single selected colony from each load-addicted hGH-GFP producing strain was used to inoculate a 15 mL Greiner culture tube containing 4 mL of 2xYT supplemented with chloramphenicol and 0.5 mM IPTG. Cultures were grown for 23 hours at 37°C on a 250 rpm shaking table. Then, 2 µL of each culture at a 2000x dilution (corresponding to approximately 11 generations of cell division) were seeded into a fresh Greiner culture tube under identical conditions, and these steps were repeated for a total of 12 seeds. After each step, 200 µl samples were taken from the culture to determine hGH-GFP synthesis by measuring OD600 and GFP fluorescence (ex / em 485nm / 528nm) in a SynergyHI plate reader (Biotek). Long-term hGH-GFP production assay (Figure 8): A single selected colony from each load-addicted hGH-GFP producing strain was used to inoculate a 24-well deep plate containing 1.8 mL of 2xYT supplemented with chloramphenicol and 0.5 mM IPTG. Cultures were grown for 23 hours at 30°C on a 200 rpm shaking table. Then, 2 µL of each culture at a 1000x dilution (corresponding to approximately 10 generations of cell division) were seeded onto a new deep-well plate under identical conditions, and these steps were repeated for a total of 9 seeds. After each step, 200 µl samples were taken from the culture to determine hGH-GFP synthesis by measuring OD600 and GFP fluorescence (ex / em 485nm / 528nm) in a SynergyHI plate reader (Biotek). Growth rate measurements of the selected strains: The selected high hGH-producing strains, s3.6#2, s6.6#6, s7.6#8, and s10.6#7, were plated on LB agar plates containing chloramphenicol and kanamycin. The BEG 34 and BEG0 strains were plated on LB agar plates containing chloramphenicol. Seven colonies from each plate were used to inoculate a 96-well plate containing 200 µL of 2xYT supplemented with chloramphenicol; these were sealed with Breathe-Easy sealing membranes (Sigma-Aldrich). Growth was measured overnight on a SynergyHI plate reader (Biotek) at 37°C with linear shaking at 754 rpm. Two-µL samples from each well were transferred to QCRAnn / zznz / E / YiAi cavities in a new 96-cavity plate containing 200 μI of 2xYT supplemented with chloramphenicol and 0.5 mM IPTG. The 96-cavity plate was sealed with a breathable film and incubated for 20 hours at 37°C and linear shaking of 754 rpm and growth (OD600nm) was measured every 10 minutes using a Synergy H1 plate reader. QCRAnn / zznz / E / YiAi Catalog of strains: BEG34 = BL21(DE3) from E. coligue carrying pEG34; BEG0 = BL21(DE3) of E. coli carries the empty plasmid pEGO sX.Z#Y = BL21(DE3) of E. coli carrying pEG34, which has the folP wt promoter exchanged for the X charge addition promoter, where X refers to the promoter IDs in Table 2. The number Y after # indicates the selected clone from the group of four RBS variants introduced by the degenerate primer (Table 7). Z refers to the hGH-GFP (0 or 6), mevalonic acid (1), and lysostaphin (4) production genes, respectively. Table 7. Identity of the RBS N nucleotide of the respective E. coli strains Strain identifier RBS N identity Strain identifier RBS N identity Strain identifier RBS N identity s5.0#3 C s16.6#6 A s19.6#2 A s7.0#8 A s18.6#8 T S21.6#8 C s9.0#8 NGS S9.1 #1 c s23.6#4 T s6.4#5 C s15.1#1 A s24.6#2 T s3.6#2 A s19.1#1 T s25.6#1 c s6.6#6 C s14.1#5 T s29.6#3 T s7.6#8 T s15.1#5 A s22.6#8 T s10.6#7 A s19.1#7 A s26.6#3 A s13.6#2 C s15.6#1 A s29.6#4 T s15.6#7 A s16.6#7 T s30.6#6 T 2.2 Results 2.2.1 Short-term hGH-GFP productivity selection: The productivity of four hGH-GFP producing strains comprising load-sensing promoters selected from a group of heat shock promoters (p¡bPA, pgrE, pycjx, and pybbN) and having one of the four RBS coding sequence variants was analyzed under simulated large-scale production conditions, as described below. The strains were serially back-diluted by 100x daily for 6 consecutive days, corresponding to almost 6 generations per seed. By day 6 (seed 6), several strains showed elevated hGH-GFP synthesis compared to the non-load-addicted production strain BEG34, both during seed 1 and seed 6. The strains that had high short-term hGH-GFP productivity relative to strain BEG34 are s3.6#2 (p¡bPA), s6.6#6 (pgrpE), s7.6#8 (pycjx), and s10.6#7 (pybbN) - see Figure 5. 2.2.2 Improved long-term hGH-GFP productivity·, the hGH-GFP productivity of load-addicted strains s3.6#2, s6.6#6, s7.6#8, s10.6#7 and non-load-addicted BEG34 strains and non-producing strain BEGO were monitored under simulated large-scale fermentation by serial transfer. After seed 2, the load-addicted strains s3.6#2, s6.6#6, s7.6#8, s10.6#7 and the non-load-addicted control strain BEG34 performed equally well in terms of hGH-GFP synthesis (Figure 6). However, after almost 20 additional generations (seed 4), the hGHGFP productivity of the control strain, BEG34, had declined considerably; and by seed 6, the strain essentially ceased production. Surprisingly, the load-addicted strain s7.6#8 (with pyCjx controlling folP-glmM) still retained a productivity of around 50% of the seed 2 level. Furthermore, the load-addicted strains s3.6#2 (with p¡bPA controlling folP-glmM), s10.6#7 (with pybbN controlling folP-glmM) and s6.6#6 (with pgrpE controlling folP-glmM) also showed significantly better long-term productivity compared to the non-load-addicted BEG34 strain. 2.2.3 Growth rate of load-addicted strains. The growth rates of load-addicted strains producing hGH-GFP s3.6#2, s6.6#6, s7.6#8 and s10.6#7 are not greater than the non-load-addicted hGH-GFP-producing strain BEG34; and, therefore, their improved hGH-GFP production levels over time are not simply derived from a reduced initial production level and, therefore, an inherently lower load (Figure 7). 2.2.4 Dependence of the genetic circuit of charge addiction on the selected essential gene. A charge-addicted hGH-GFP producing strain (s13.6#2 (fxsA)) comprising the heat shock promoter ptxsA controlling the essential gene folP-glmM was compared with a mutant derivative comprising a folP scaffold change abolishing folP expression, strain s13.6#2evo (fxsA), whose growth was solely dependent on glmM expression. Although loss of folP expression led to a lower growth rate (data not shown) in complex 2xYT medium, the essential glmM gene alone has been shown to be sufficient to confer improved long-term hGH-GFP production stability in the load-addicted strain s13.6#2evo(fxsA) to levels comparable to strain s7.6#8 (pycjX), compared to the non-load-addicted hGH-GFP-producing strain BEG34 (Figure 8). 2.2.5 Use of ribosomal RNA promoters in the charge addiction genetic circuit: In addition to heat shock promoters, ribosomal RNA promoters such as prmB and prmE have been shown to detect a charge addiction state in a cell and, in response, to control essential gene expression, thereby improving long-term productivity in an hGH-GFP producing strain. As shown in Figure 9, the long-term stability of hGH-GFP production in strains s15.6.7 (prmB) and s16.6.6 (prrbE) was significantly improved compared to a non-charge-addicted hGH-GFP producing strain BEG34 under simulated large-scale production corresponding to approximately 110 cell division generations. 2.2.6 Use of oxidative stress sensing promoters in the charge addition genetic circuit: Oxidative stress sensing promoters such as pPoxB have been shown to be capable QCRAnn / zznz / E / YiAi was developed to detect a charge addiction state in a cell and, in response, control the expression of essential genes to improve long-term productivity in an hGH-GFP producing strain. As shown in Figure 10, both the production levels and long-term stability of hGH-GFP production in the s29.6#3 (Ppoxb) strain were significantly increased compared to a non-charge-addicted hGH-GFP producing strain BEG34 under simulated large-scale production of seven serial steps corresponding to approximately 90 generations and extended culture for the final seed. As shown in Figure 10, production using the ppOxB-based charge addiction genetic circuit surprisingly resulted in high production over time, indicative of the enrichment of non-genetically high-yielding variants. In summary, this example illustrates that charge addiction improves long-term stability and production in E. coli strains engineered to synthesize GFP-fused human growth hormone by coupling the transcription of essential folP-glmM genes to any one of E. coli heat shock, oxidative stress and DNA damage-sensitive promoters, as well as an rRNA promoter. Example 3: Load-addicted E. coli strains that produce lysostaphin show improved long-term production stability Lysostaphine is a 27 kDa endopeptidase that cleaves cross-linked pentaglycine bridges in the peptidoglycan of the Staphylococcus aureus cell wall, resulting in cell lysis. This antibacterial agent can be recombinantly synthesized in E. coli. It is shown that a charge-addiction genetic circuit comprising a promoter with charge-sensing properties improves the production stability of such E. coli strains engineered to synthesize lysostaphine, as illustrated by the following charge-addicted E. coli strains producing lysostaphine under simulated large-scale production conditions. It is further shown that the productivity of charge-addiction production strains is optimized by selecting a strain in which the charge-sensing promoter is combined with an RBS sequence (Table 6) that confers optimized translation strength of the essential cognate gene. These advantages are exemplified by the charge-addicted strain s6.4#5 (pgrPE), described below, which is shown to be more resistant to production loss due to loading or suitability cost resulting from lysostaphin expression. 3.1 Materials and Methods Charge detection promoters: A promoter integration sequence comprising the pgrpE promoter was generated as described in Example 1.2.1, by amplifying the pgrpE promoter by PCR, using the pgrpE-specific primers specified in Table 6. Chromosomal integration of charge-addition promoters: The grpE promoter was integrated upstream of the folP-glmM gene in the genome of the BENDU5cam strain of E. coli (corresponding to BL21 (DE3) of E. coli harboring a lysostaphin-producing pENDUScam plasmid), as follows. Cells of the BENDU5cam strain of E. coli, pretransformed with the recombinant pSIM5-tet plasmid, were prepared, and QCRAnn / zznz / E / YiAi were transformed by electroporation with the pgrpE promoter integration sequence, as described in Example 1.2.1. Following the described pSIM5-tet recombination and curing steps, five colonies were selected, corresponding to clones with the same promoter integration but with a random variant RBS sequence (see Table 6). Each clone was then transferred to a 15 µL Greiner culture tube containing 4 µL of 2xYT supplemented with chloramphenicol for plasmid maintenance, pENDU5cam, and cultured. Two µL of each cultured clone were used to validate promoter integration as described in Example 1.2.1 before freezing. Selection of lysostaphin production. The E. coli strain s6.4#5(pgrPE) with the highest lysostaphin productivity was identified using a selection assay in which the other three possible combinations of RBS and pgrPE were grown in chloramphenicol-supplemented 2xYT in a 96-well format in six serial 1000x dilution steps (corresponding to 60 generations) compared to the non-charge-addicted production strain BENDU5cam. The strains were grown in 3 mL of 2xYT medium containing 30 mg / L chloramphenicol in 15 mL culture tubes at 37°C for 21 hours. 150 µL of the cultures were mixed with 50 µL of 50% glycerol and stored in a 96-well plate at -80°C.In addition, 30 μL of the cultures were transferred to 3 μL of fresh 2xYT medium supplemented with chloramphenicol and cultured for a further 21 hours under identical conditions; and this was repeated for a total of 5 transfers where frozen stock solutions were made from the cultures overnight with each transfer. Lysostaphin expression and selection assay: The 96-well plate containing all the frozen stock solutions from the 5 transfers was thawed on ice. 20 µL from each cavity were transferred to a 96-well plate containing 180 µL of 2xYT supplemented with chloramphenicol and cultured at 37°C in a plate reader until most cavities reached an OD630 = 0.35. Then, 10 µL of 2xYT supplemented with 30 mg / L chloramphenicol and 20 mM IPTG were added to each cavity to a final IPTG concentration of 1 mM, sufficient to induce lysostaphin gene expression. The induced cultures were grown at 37°C for 4 hours, and then the plate was centrifuged at 4000 RPM for 10 minutes. 100 µL of supernatant were transferred to a new 96-well plate containing 100 µL of overnight S. aureus culture. Lysis of S.S. aureus in each cavity was monitored at OD630 on a plate reader at 37°C for 2 hours every 10 minutes. The lysis rate of S. aureus was quantified by dividing the change in S. aureus OD by the 60-minute time period in which the change occurred. The equation can be seen below: ODt- ODt Speeds=--------ti — t0 The specific lysostaphin synthesis rate was determined by normalizing the measured rate to the final OD630 measurement of the respective production E. coli culture. 3.2 Results QCRAnn / zznz / E / YiAi Load-addicted lysostaphine-producing strains possessing a pgrpE promoter and one of the four RBS coding sequence variants controlling essential gene expression, folP-glmM, were cultured under simulated large-scale production conditions achieved through serial steps. As shown in Figure 11, the s6.4#5 (pgrPE) strain maintained significantly higher levels of lysostaphine production compared to the sharp reduction in production observed in the non-load-addicted lysostaphine-producing strain BENDU5cam. Since the initial lysostaphine production rates for the s6.4#5 (pgrPE) and BENDU5cam strains in seed 0 were the same, the smaller decrease in production rates for s6.4#5 (pgrPE) is not due to an inherently lower initial load of lysostaphine production. In summary: It was shown that charge addiction improves long-term stability and production in E. cali engineered to synthesize secreted lysostaphin by coupling the transcription of essential genes folP-glmM to the pgrPE heat shock promoter of E. cali. Example 4: Load-addicted E. coli strains that produce mevalonic acid show improved long-term production stability E. coli BL21(DE3) cells were engineered to synthesize mevalonic acid by introducing a pMevT plasmid expressing a heterologous three-step enzymatic pathway (Martin et al., 2003) that converts glucose to mevalonic acid via the acetyl-CoA group. A charge-addition genetic circuit comprising a promoter with charge-sensing properties that controls the transcription of an essential gene is shown to improve the production stability of such mevalonic acid-producing E. coli strains under simulated large-scale production conditions. The productivity of charge-addition production strains is further optimized by selecting a strain in which the charge-sensing promoter is combined with an RBS coding sequence (Table 5) that confers optimized translation strength of the related essential gene.Specifically, mevalonic acid-producing strains comprising the charge-addiction promoter pCspD (an oxidative stress and glucose depletion sensing promoter) or pmutM (DNA damage / heat shock sensing promoter) that control folP-glmM transcription are shown to be more resistant to loss of production than the non-charge-addicted strain due to their addiction to transcriptional signals resulting from mevalonic acid production. 4.1 Materials and Methods Load detection promoters: Promoter integration sequences were generated QCRAnn / zznz / E / YiAi comprising the pmutM and pCsPD promoters as described in Example 1.2.1, amplifying the pmutM and PcsPd promoters by PCR, using pmutM- and pCsPD-specific primers specified in Table 8. Table 8. Primers E. coli Gene Promoter Primer Name Primer Sequence (5'-3')* SEQ ID No.: mutM mutM direct ATTCATATGUGGCGAAAAGTACTAAGTACTTA 116 mutM reverse ATCCCCATTACGTGAGGATGGCTAAGGTCCAGTGAA GTACCCTGGGCAAAGAGTTTCATaccttNCAAGTAGC ATCTCCAGGAATGAACA 117 cspD cspD direct ATTCATATGUCGGTTATCGGCAGAACGCCCTG 138 cspD reverse ATCCCCATTACGTGAGGATGGCTAAGGTCCAGTGAA GTACCCTGGGCAAAGAGTTTCATAccttNCAAGTGCT TCGACATCCTTCGCAAA 139 * Additional RBS coding sequences are in bold; where N is either A, G, T or C. The RBS is encoded on the opposite strand of the oligosequence shown. QCRAnn / zznz / E / YiAi Chromosomal integration of charge-addition promoters: pmutM and pcspD were individually integrated upstream of the folP-glmM gene into the genome of E. coli BL21 (DE3)pMevT cells harboring a lysostaphin-producing pMevT plasmid, as follows. E. coli BL21 (DE3)pMevT cells, pretransformed with the recombinant plasmid pSIM5-tet, were prepared and transformed by electroporation with each of the promoter integration sequences, as described in Example 1.2.1. Following the described pSIM5-tet recombination and curing steps, 5 colonies were selected, corresponding to clones with the same promoter integration but with a random variant RBS sequence (see Table 8). Next, each clone was transferred to a cavity of a 96-cavity plate containing 200 μI of 2xYT supplemented with chloramphenicol for plasmid maintenance, pMevT, and cultured.2 μ of each cultured clone were used to validate promoter integration as described in Example 1.2.1; before freezing the 96-cavity plate. Selection of mevalonic acid production: The E. coli strains s19.1.1 (pcsPD) and s9.1.4 (pmutM) with the highest mevalonic acid productivity were identified by a selection assay in which strains comprising the other four possible RBS and promoter combinations were grown in 96-well plates for six serial 1000x dilution steps (corresponding to 60 generations) in parallel with the load-non-addicted E. coli strain BL21 (DE3)pMevT, as follows. The strains were grown in 200 µL of 2xYT medium containing 30 mg / L chloramphenicol and 0.5 mM IPTG in a microtiter plate sealed with a breathable seal at 37°C for 21 hours with horizontal shaking. 150 µL of the cultures were mixed with 50 µL of 50% glycerol and stored in a 96-well plate at -80°C. In addition, 2 µL of a 10x diluted culture were transferred to 200 µL of fresh 2xYT medium supplemented with chloramphenicol and IPTG 0.5 mM and grew for another 21 hours under identical conditions. In total, 5 identical transfers were performed as described above, and frozen stock solutions were made from the cultures overnight with each transfer. Mevalonic acid synthesis and detection assay: The 96-well plate containing frozen stock solutions from the second, fifth, and sixth transfers was thawed on ice and used to inoculate 10 mL of 2xYT with 0.5 mM IPTG and 30 mg / L chloramphenicol and cultured at 37°C with horizontal shaking (250 rpm) for 54 hours. 300 µL aliquots of each culture were treated with 23 µL of 20% sulfuric acid; vigorously shaken and then centrifuged at 13,000 x g for 1 minute. Supernatant (medium) samples were injected into an Ultimate 3000 high-performance liquid chromatography system with a 5 mM sulfuric acid mobile phase (0.6 mL / min) on an Aminex HPX-87H ion-exclusion column (300 mm x 7.8 mm, Bio-Rad Laboratories) at 50°C. A refractive index detector was used for detection. A standard curve for mevalonic acid was generated using mevalonolactone (Sigma-Aldrich) dissolved in 2xYT supernatant medium from an E. strain.non-producing coli incubated under the same conditions. 4.2 Results Charge-addicted mevalonic acid-producing strains possessing either the PcspD or pmutM promoters and one of the four RBS coding sequence variants controlling essential gene expression, folP-glmM, were cultured under simulated large-scale production conditions achieved through serial steps. As shown in Figure 12, the two selected charge-addicted strains, s19.1.1 (PcsPd) and s9.1.4 (pmutM), retained significantly higher levels of mevalonic acid production compared to the sharp reduction in production observed in the non-charge-addicted mevalonic acid-producing strain BL21 (DE3)pMevT. Since the initial rates of mevalonic acid production for each charge-addicted strain were the same as for the control strain BL21 (DE3)pMevT in seed 0; the smaller decrease in production rates for strains s19.1.1 (pcsPD) and s9.1.4 (pmutM) is not due to an inherently lower initial load of mevalonic acid production. In summary: Charge addiction has been shown to improve long-term stability and production in E. coli engineered to synthesize mevalonic acid by coupling the transcription of essential genes folP-glmM to the oxidative stress-promoting E. coli glucose starvation sensing promoter pcsPD, and the DNA damage / heat shock sensing promoters pmutM. Example 5: Evaluation of promoters as charge sensors to make yeast cells charge addicted to the production of engineered recombinant proteins Promoters capable of sensing the biological load, or charge, in a cell caused by the recombinant expression of a protein or biosynthetic pathway, and subsequently inducing the expression of an essential gene, can be used to create a genetic charge-addition circuit adapted for use in yeast. A method for evaluating candidate promoters in yeast cells genetically modified to synthesize recombinant human serum albumin (hSA) or insulin precursor (IP), optionally translationally fused to green fluorescent protein (GFP), is illustrated. To make growth responsive to the activity of a candidate charge-sensing promoter, the native promoter of an essential gene in the yeast Saccharomyces cerevisiae was genetically replaced with a candidate promoter using homologous recombination of linear DNA constructs transformed in yeast cells using a standard selectable marker. For example, candidate promoters can be selected from upregulated promoters of ribosomal RNA genes, such as those transcribed by RNA polymerase I (Laferté et al., 2006). QCRAnn / zznz / E / YiAi DNA damage detection promoters (e.g., pOGG1) and unfolded protein response promoters upregulated by the transcription factor HAC1 (Kimata et al., 2006). To ensure that the load-sensing promoter, once activated, confers a selective growth advantage to the cell compared to a non-sensing promoter, it may be necessary to fine-tune the expression level of the essential gene. A range of translation strengths can be engineered by varying the translation initiation region introduced with the load-sensing promoter. Clones with potentially different combinations of candidate charge-sensing promoters were selected and evaluated to maintain protein production for 30-100 cell division generations. 5.1 Materials and methods Growth medium. The YPD medium comprises 1% yeast extract, 2% peptone, and 2% glucose. The SC medium comprises 6.7 g / l of yeast nitrogenous base without amino acids and with ammonium sulfate, but lacks uracil. Chromosomal integration and validation of promoter constructs. The constructs for chromosomal integration will contain 300–600 bp upstream of the natively regulated gene. Chromosomal integration of the promoter construct is performed by transformation and homologous recombination using standard electroporation procedures for S. cerevisiae. Correct chromosomal integration of the promoter was validated by colony PCR. Long-term culture and production. A single colony of each strain was transferred to 24-well deep plates and cultured in 1.8 ml of YPD medium under conditions that induced recombinant protein production, at 250 rpm and 30°C. After 48 hours of culture, the cells were transferred to a new deep-well plate under identical conditions by 1000x backdilution. Samples were analyzed for production using recombinant protein-specific assays (e.g., GFP detection), and cell density was monitored by OD600. Measurements of the growth rate of selected strains: The growth rates of individual strains were compared to non-load-addicted production strains. The 96-cell plate was sealed with a breathable film, and growth was measured using a Synergy H1 plate reader for 20 hours at 37°C and linear shaking at 754 rpm. The OD600 was measured every 10 minutes. 5.2 Results 5.2.1 Overregulated HAC1 Promoters Upregulated HAC1 promoters comprising an unfolded protein response (UPR) element, e.g., KAR2 (SEQ ID NO.: 91), PDI1 (SEQ ID NO.: 92), SSA1 (SEQ ID NO.: 93), or FPR2 (SEQ ID NO.: 94), have been shown to be useful for regulating growth when introduced opposite a native growth-regulating gene (e.g., the conditionally essential gene URA3 encoding orotidine 5'-phosphate decarboxylase essential for pyrimidine biosynthesis) in a recombinant protein-producing Saccharomyces strain that QCRAnn / zznz / E / YiAi produces the precursor of human insulin or human serum albumin, optionally coupled to GFP. Production stability is monitored under simulated long-term production through serial steps corresponding to 60–80 generations of cell division. In Saccharomyces strains comprising the HAC1 upregulated promoter that controls the transcription of the growth regulator gene (URA3), production is expected to be more stable than the corresponding original recombinant protein-producing Saccharomyces strain. 5.3.2 RNA polymerase I overregulated promoters RNA polymerase I transcribes ribosomal RNA genes in yeast. RNA polymerase I overregulated promoters, such as those of the genes RPL3 (SEQ ID NO.: 95), RPL6A (SEQ ID NO.: 96), and RPL28 (SEQ ID NO.: 97), are useful for regulating the growth of essential yeast genes. These overregulated promoters are introduced upstream of the native growth regulator gene (e.g., the conditionally essential gene URA3) in a recombinant protein overproduction strain that produces a precursor of human insulin or human serum albumin, potentially coupled to GFP. Production stability is followed by experimentally simulated long-term production through serial steps corresponding to 60–80 generations of cell division.In Saccharomyces strains comprising an upregulated RNA polymerase I promoter that controls transcription of the conditionally essential gene, URA3, production will be more stable than the corresponding original recombinant protein-producing Saccharomyces strain. 5.3.3 DNA damage-sensitive promoters The response to DNA damage in yeast, resulting from heterologous expression, extensively induces transcription of the DNA repair system, which includes OGG1 (SEQ ID NO.: 98), RAD51 (SEQ ID NO.: 99), and PAD54 (SEQ ID NO.: 100). The promoters of the genes encoding OGG1, RAD51, or RAD54, when operationally linked to an essential gene, are useful for regulating the growth of a yeast cell of the invention. Such promoters are introduced upstream of the native essential gene (e.g., the growth-regulating gene encoding URA3) in cells of a yeast protein-producing strain that produces a precursor of human insulin or human serum albumin, optionally fused with GFP. Production stability is followed by insufficiently simulated long-term production through serial steps corresponding to 60–80 generations of cell division. In strains with an essential gene upregulated with pradsi and / or prads4, production will be more stable. In summary: Charge addition improves long-term stability and production in budding yeast cells engineered to synthesize human serum albumin or insulin precursors by coupling the transcription of essential genes to selected charge-sensing promoters from promoters activated during recombinant protein production loading or associated with ribosomal RNA promoters (Table 2). QCRAnn / zznz / E / YiAi Example 6: Examples of load-addicted yeast strains that produce human serum albumin showing improved long-term production stability Charge addition systems for use in yeast strains include promoters derived from genes encoding: 1) PDI1 protein isomerase, which encodes a chaperone involved in the unfolded protein response of yeasts such as S. cerevisiae and P. pastoris, and whose abundance is frequently upregulated in response to recombinant protein overexpression; 2) ribosomal subunits encoded by the RPL6A and RPL3 genes; and 3) FPR2, which encodes a peptidyl-prolyl cis-trans isomerase known to be activated by DNA replication stress. Charge addition systems based on these promoters were introduced into a Pichia pastoris strain engineered to express and secrete human serum albumin to determine their effect on the long-term stability of human serum albumin (hSA) production. 6.1 Materials and methods: The EGS31 strain of Pichia pastoris (Komagataella phaffii) is a derivative of the CBS7435 strain (NRRL-Y11430 or ATCC 76273), engineered to secrete hSA by means of a genomically integrated cDNA version of the ALB1 gene encoding hSA under the control of the AOX1 promoter. Strain construction: Charge-addicted versions of the EGS31 strain were generated by genetically integrating a construct comprising a conditionally selectable resistance gene G418 kanMX operatively linked to one of the charge-sensitive promoters: pPDI1, pFPR2, pRPL3, and pRPL6A. These charge-addiction constructs were integrated into the KU70 genomic locus of the P. pastoris strain by transforming EGS31 cells with linear integration DNA (N1-N3 sequences, respectively) flanked by homology arms >750 bp. Transformation was performed using a standard electroporation procedure in exponentially cultured cells pretreated with lithium acetate and dithiothreitol (Wu & Letchworth, 2004). QCRAnn / zznz / E / YiAi Table: Recombinant genes and charge addiction constructs introduced into P. pastoris Gene / Construct Name SEQ ID NO: Nucleotide Number of Construct SEQ ID NO: Protein Encoded by Construct pAOX1-ALB SEQ ID NO: 155 hSA protein SEQ ID NO: 156 KU70(up)-pPDI1 -KanMX- terminator-KU70(dw) SEQ ID NO: 157 kanMX protein SEQ ID NO: 158 KU70(up)-pFPR2-KanMX terminator-KU70(dw) SEQ ID NO: 159 kanMX protein SEQ ID NO: 160 KU70(up)-pRPL3-KanMX terminator-KU70(dw) SEQ ID NO: 161 kanMX protein SEQ ID NO: 162 KU70(up)-pRPL6A-kanMX terminator-KU70(dw) SEQ ID NO: 163 kanMX protein SEQ ID NO: 164 Growth Media: Liquid media BMGY and BMMY (1 I) were prepared as follows: 10 g of yeast extract and 20 g of peptone were added to 700 ml of H2O; mixed with a magnetic stirrer and then autoclaved. After cooling to room temperature, the following were added to the solution: 100 ml of 1 M potassium phosphate buffer (pH 6.0); 100 ml of 13.4% (w / v) amino acid-free yeast nitrogenous base with ammonium sulfate; 2 ml of 0.02% (w / v) biotin; and in the case of BMGY, 100 ml of 10% (v / v) glycerol was added; and in the case of BMMY, 100 ml of 5% (v / v) methanol was added. Culture: EGS31 and load-addicted EGS31 strains were plated on YPD agar plates (1% yeast extract, 2% peptone, 2% D-glucose) and incubated overnight at 30°C. Individual colonies were collected and precultured in 2 mL of BMGY, where load-addicted strain cultures were supplemented with 50 µg / mL of G418 and cultured at 30°C with horizontal shaking at 300 rpm overnight. Expression cultures were seeded using 1 µL of preculture into 500 µL of BMGY containing different concentrations (0 µg / mL, 750 µg / mL) of G418 in a 96-cell deep-well plate with an aeration lid to generate seed 1. The cultures were incubated at 30°C for 72 hours (horizontal shaking at 300 rpm). To generate the next seed, four times over, the growth cultures were serially transferred (500x dilution) to 500 µL of fresh BMMY medium containing different concentrations (0 pg / ml, 750 µg / ml) of G418 in a 96-cavity deep-well plate with aeration lids. At each serial step, stock solutions of glycerol (20% glycerol) from the grown cultures were stored at -80°C. To quantify secreted hSA production, quantification cultures were regrown from glycerol stock solutions in 500 μI of BMMY medium containing different concentrations (0 μg / ml and 750 pg / ml) of G418 in a 96-cavity deep cavity plate with an aeration lid for 72 hours. The cultures were centrifuged at 3000 g for 15 minutes and the concentration was quantified in 50 μI of supernatants using a specific hSA ELISA kit (Abcam catalog no.: ab179887: Human Albumin SimpleStep ELISA® Kit) following the manufacturer's instructions. 6.2 Results Strains with a genomically integrated charge-addiction promoter, PDI1, operatively linked to the selectable kanMX gene showed increased secreted hSA production when the strain's charge-addiction system was activated by the addition of G418 (Figure 13). Furthermore, enhanced hSA production was observed with increased selection (750 mg / ml of G418) for each of the other charge-addiction promoters tested after approximately 30 cell divisions (Figure 14A - Seed 1). When cultured for an additional 10 cell divisions (Figure 14B - Seed 2), the strains showed improved hSA production levels when charge-addiction was activated (150–750 pg / ml of G418) compared to the non-activated control. QCRAnn / zznz / E / YiAi addicted to loads and strains without addiction to activated loads (0 pg / ml of G418). In conclusion, it is believed that yeast cell cultures comprising the load-addition systems exemplified by the invention, under conditions that activate their respective load-addition systems, enrich high-yielding yeast variants within the cultured population. While an increase in hSA production can be detected after a relatively short culture period (30 cell divisions), the enrichment of high-yielding yeast variants was maintained and further enhanced during longer culture periods, when traditional cultures commonly exhibit a significant decline in productivity. Example 7: Identifying suitable load detection promoter candidates The different engineered genes and production pathways elicit different transcriptional responses indicative of the production process. To identify suitable promoter candidates for use as charge sensors, the following experiment was conducted. Methods. Typical genetic escapee cells were isolated from long-term culture with the genetically modified microbial production cells of interest in the intended fermentation medium. Suitable genetic escapee cells are characterized by having at least a 5% higher exponential phase growth rate and at least a 30% lower production rate or product yield than the original genetically modified production cell. Production cells and corresponding escapee cells were cultured under the intended fermentation conditions, under reduced conditions, or in a shaker flask mimicking the intended fermentation conditions. At time points corresponding to the highest production rate in the production cells, samples were taken for RNA sequencing. Total RNA was purified using the Purelink RNA Mini Kit (Thermo Fischer) and prepared using the TruSeq Stranded mRNA Kit (Illumina) according to the kit manufacturer's instructions. The reads were mapped and analyzed against the strain's reference genome and then analyzed to determine differential expression between the production cells and their corresponding escapee cells. Results: Suitable candidate promoters were identified as those that drive the expression of genes that showed differential expression > 3 times higher in the production organism relative to at least one isolated genetic escape strain. References Bonde, Μ. T., Pedersen, M., Klausen, M.S., Jensen, S.I., Wulff, T., Harrison, S., et al. (2016). Predictable tuning of protein expression in bacteria. Nat. Methods 13. doi: 10.1038 / nmeth.3727. Koskiniemi, S., Prántinq, M., Gullberg, E., Násvatl, J., & Andersson, DI (2011). Activation of cryptic aminoglycoside resistance in Salmonella enterica. Molecular Microbiology, Vol. 80, pp. 14641478. https: / / doi.Org / 10.1111 / j. 1365-2958.2011,07657.x Giaever G et al., Nature. 2002 Jul 25;418(6896) :387-91. DOI: 10.1038 / nature00935 Jain, R., Kumar, P. & Varshney, U. A distinct role of formamidopyrimidine DNA glycosylase (MutM) in down ocRRnn / zznz / E / YiAi regulation of accumulation of G, C mutations and protection against oxidative stress in mycobacteria. DNA Repair (Arst). 6, 1774-1785 (2007). Kimata, Y., Ishiwata-Kimata, Y., Yamada, S., and Kohno, K. (2006). Yeast unfolded protein response pathway regulates expression of genes for anti-oxidative stress and for cell surface proteins. Genes to Cells 11,59-69. do¡:10.1111 / j. 1365-2443.2005.00921 .x. Laferté, A., Favry, E., Sentenac, A., Riva, M., Caries, C., and Chédin, S. (2006). The transcriptional activity of RNA polymerase I is a key determinant for the level of all ribosome components. Genes Dev. 20, 2030-2040. doi:10.1101 / gad.386106. Maeda, M., Shimada, T., and Ishihama, A. (2015). Strength and Regulation of Seven rRNA Promoters in Escherichia coli. PLoS One 10, 1-19. doi: 10.1371 / journal.pone.0144697. Nonaka, G., Blankschien, M., Hermán, C., Gross, C. a, and Rhodius, V. a (2006). Regulon and promoter analysis of the E. col! heat-shock factor, sigma32, reveáis a multifaceted cellular response to heat stress. Genes Dev. 20, 1776-89. doi: 10.1101 / gad. 1428206. Pitera, D. J., Paddon, C. J., Newman, J. D., and Keasling, J. D. (2007). Balancing a heterologous mevalonate pathway for improved isoprenoid production in Escherichia coli. Metab. Eng. 9, 193-207. do¡:10.1016 / j.ymben.2006.11.002. Rugbjerg, P., Sarup-Lytzen, K., Nagy, M., and Sommer, M. 0. A. (2018). Synthetic addiction extends the productive life timeof engineered Escherichia colipopulations. Proc. Nati. Acad. Sci. 115, 23472352. doi: 10.1073 / pnas.1718622115. Wu, S. and Letchworth, G.J. (2004) High efficiency transformation by electroporation of Pichia pastoris pretreated with lithium acétate and dithiothreitol. Biotechniques 36, 152-154. Yoon, S. H., Han, M. J., Lee, S. Y., Jeong, K. J., and Yoo, J. S. (2003). Combined transcriptome and proteome analysis of Escherichia coli during high cell density culture. Biotechnol. Bioeng. 81,753-767. doi: 10.1002 / bít.10626. Uppal, S., Shetty, D. M., & Jawali, N. (2014). Cyclic AMP receptor protein regulates cspd, a bacterial toxin gene, in Escherichia coli. Journal of Bacteriology, 196(8), 1569-1577. https: / / doi.Org / 10.1128 / JB.01476-13. Yamanaka, K., & Inouye, M. (1997). Growth-phase-dependent expression of cspD, encoding a member of the CspA family in Escherichia coli. Journal of Bacteriology, 179(16), 5126-5130. https: / / doi.org / 10.1128 / jb.179.16.5126-5130.1997.
Claims
1. A genetically modified microbial production cell for synthesizing a product, characterized in that said microbial cell further comprises: a. an essential gene operatively linked to a charge-sensing promoter, wherein said promoter is heterologous with respect to said essential gene; wherein synthesis of the product confers a charge in said cell, and wherein the expression of said essential gene is upregulated when said charge-sensing promoter is induced by said charge relative to a basal level of expression of said essential gene when said charge-sensing promoter is not induced.
2. The microbial production cell according to claim 1, characterized in that said cell comprises b. one or more genes encoding the product or encoding a metabolic pathway for the synthesis of the product, wherein said one or more genes are operatively linked to a promoter.
3. The microbial production cell according to claim 1 or 2, characterized in that said burden conferred by the synthesis of said product, when said essential gene in the cell is operatively linked to its native promoter, has a suitability cost measured as a percentage reduction in the exponential phase growth rate of the selected microbial production cell of > 5%, > 10%, > 15%, > 20%, > 25%, > 35% and > 45% relative to a corresponding non-producing microbial cell.
4. The microbial production cell according to any one of claims 1-3, characterized in that the cell is: i. a bacterium belonging to a genus selected from among Escherichia, Lactobacillus, Lactococcus, Corynebacterium, Bacillus, Acetobacter, Acinetobacter, Pseudomonas, Propionibacterium, Bacteroides, and Bifidobacterium; or ii. a yeast belonging to a genus selected from among Saccharomyces, Kluyveromyces, Candida, Pichia, Komagataella, Cryptococcus, Debaromyces, Hansenula, Yarrowia, Zygosaccharomyces, and Schizosaccharomyces; or iii. a filamentous fungus selected from among Penicillium, Rhizopus, Fusarium, Fusidium, Gibberella, Mucor, Mortierella, Trichoderma, Thermomyces, Streptomyces, and Aspergillus.
5. The microbial production cell according to any of claims 1-4, characterized in that the essential gene is a non-conditional essential gene.
6. The microbial production cell according to any of claims 1-5, characterized in that the cell is a bacterium and the essential gene is an E. coli gene or operon selected from folP-glmM, glmM, murl, asd, thyA, usA, rpoD, nusG, rpsU, accD, degS, fldA, ftsN, hflB, lolA, mraY, mreD, murA, murB, murF, nadD, rpIVy, rpsGo, or a homolog thereof.
7. The microbial production cell according to any of claims 1-6, characterized in that the essential gene is operatively linked to a synthetic RBS QCRRnn / zznz / E / YiAi whose sequence is selected to modify the translation strength of the essential gene independently of the induction of said charge-sensing promoter.
8. The microbial production cell according to any of claims 1-7, characterized in that the charge-sensing promoter is selected from: i. a factor-regulated promoter, such as a σ32, σBo os factor-regulated promoter, ii. a ribosomal RNA promoter, iii. an HAC1 overregulated promoter comprising a UPR element, and iv. a DNA damage-sensing promoter.
9. The microbial production cell according to any of claims 1-8, characterized in that the cell is characterized by an increased product yield after at least 25, 30, 35, 40, 45, 50, 60, 70, 80, 90 or 100 generations of cell division from a single cell, compared to an original microbial production cell lacking said essential gene operatively linked to a charge-sensing promoter.
10. The microbial production cell according to any of claims 1-9, characterized in that the cell is characterized by an increased product yield of at least 10, 25, 50 or 80% after at least 50 generations of cell division from a single cell, compared to an original microbial production cell lacking said essential gene operatively linked to a charge-sensing promoter.
11. A method for biosynthesizing products, characterized in that it comprises the steps of: i. providing a microbial production cell according to any of claims 1-10, ii. introducing the cell into a culture medium comprising substrate for the production of said product, iii. recovering said product.
12. A method for biosynthesizing products according to claim 11, characterized in that the product is selected from among: amino acid, organic acid, terpenoid, isoprenoid, polyketide, alcohol, sugar, vitamin, aldehyde, carboxylic acid, fatty acid, peptide, enzyme, therapeutic protein and precursor thereof, human growth hormone, insulin, glucagon-like peptide-1, monoclonal and polyclonal antibody, and single-fragment antibody.
13. Use of an essential gene operationally linked to a charge-sensing promoter to enhance the product yield of a cultured population of microbial production cells arising from a single cell, wherein said promoter is heterologous with respect to said essential gene, wherein product production confers a charge in said cell, and wherein the expression of said essential gene is upregulated when said charge-sensing promoter is induced by said charge relative to a basal level of expression of said essential gene when said charge-sensing promoter is not induced. QCRAnn / zznz / E / YiAi 14. Use of a microbial production cell according to any of claims 1-9, to produce a biosynthetic product.
15. Use of a microbial production cell according to claim 14, wherein the product is selected from: an amino acid, organic acid, terpenoid, isoprenoid, polyketide, alcohol, sugar, vitamin, aldehyde, carboxylic acid, fatty acid, peptide, enzyme, therapeutic protein and precursor thereof, human growth hormone, insulin, glucagon-like peptide-1, monoclonal and polyclonal antibody, and single fragment antibody.