A test system for species identification of marine trematodes in Southeast Asia using Real-Time PCR
Patent Information
- Application Number
- RU2024140058
- Authority / Receiving Office
- RU · RU
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2024-12-27
- Publication Date
- 2026-06-29
Claims
A test system for the species identification of marine trematodes of Southeast Asia using Real-Time PCR, including a buffer for carrying out the polymerase chain reaction, a mixture for carrying it out, consisting of deoxynucleoside triphosphates, characterized in that it includes pairs of synthetic oligonucleotide primers, each of which is complementary and highly specific for working with individual species of marine trematodes of Southeast Asia: for Heterophyes heterophyes - forward primer: 5'-AGTGTGCTGCGTTGATTG-3', reverse primer: 5'-CCTCTGACTTCTGCGTGA-3'; for Stellantchasmus falcatus - forward primer: 5'-TGCAGTTGAGCAGTTCGT-3', reverse primer: 5'-AGGCTGACCTATCAGCTT-3'; for Metagonimus yokogawai - forward primer: 5'-ATGGTGTTGTTTGTTGGG-3', reverse primer: 5'-TCGAGAAGAGCCGATGTC-3'; as well as a pair of fluorescent probes: for Heterophyes heterophyes: (FAM)TGGCTCTGACTGCTCTGGTG(BHQ1) (HEX)CAGCTTGGGAGTTTCTGACC(BHQ1) for Stellantchasmus falcatus.