Recombinant AAV for the gene therapy of wilson disease

Abstract

The present invention provides a polynucleotide and recombinant AAV encoding a functional copper‐transporting ATPase. The present invention also provides a method of treating Wilson disease comprising administering the recombinant AAV to a subject in need thereof.

Description

RECOMBINANT AAV FOR THE GENE THERAPY OF WILSON DISEASETechnical FieldThe present invention is related to gene therapy. In particular, the present invention involves the recombinant adeno-associated virus (AAV) for the gene therapy of Wilson disease.BackgroundWilson disease (WD) is an autosomal-recessive disorder of copper metabolism caused by pathogenic variants in the atp7b gene which codes for a P‐type copper‐transporting ATPase, leading to copper accumulation in many organs such as the liver, central nervous system (CNS) , cornea, kidney, joints, cardiac muscle et al., where the physiological functions of the affected organs are impaired.WD may exhibit a variety of clinical symptoms, the most common being liver disease and neuropsychiatric disturbances. WD typically begins with a pre-symptomatic period, during which copper accumulation in the liver causes subclinical hepatitis and progresses to liver cirrhosis and development of neuropsychiatric symptoms in teenage years or early twenties.Currently, WD is generally treated by i) promoting the elimination of copper with a chelating agent, such as penicillamine, Sodium dimercaptopropionate, triethylene-hydroxyltetramethylamine and dimercaptosuccinic acid, or ii) blocking the absorption of copper by intestinal tract with, e.g., tetrathiomolybdate. However, these treatments they all have severe side effects leading to treatment discontinuation. For example, up to 31%of patients experience severe side effects with widely used D-penicillamine (Merle et al. Clinical presentation, diagnosis and long-term outcome of Wilson's disease: a cohort study, Gut., 2007, 56 (1) : 115–120) ; 10 to 30%of patients get paradoxical neurological worsening upon initiating chelators treatments (Ala et al., Wilson's disease, The Lancet, 2007, 369 (9559) : 397-408) ; up to 45%of patients do not show neurologic improvement (Weiss et al., Efficacy and safety of oral chelators in treatment of patients with Wilson disease, Clin Gastroenterol Hepatol, 2013, 11 (8) : 1028-35. e1-2) ; up to 24%of patients with neuro or liver disease progression despite treatment (Merle et al. above) ; and up to 13%of patients had to choose the liver transplant (Beinhardt et al., Long-term outcomes of patients with Wilson disease in a large Austrian cohort, Clin Gastroenterol Hepatol, 2014, 12 (4) : 683-9) . Patients need life-long low Cu diet and medication result in very poor quality of life.Gene therapy for WD is developing. For example, Ultragenyx has developed a gene therapy based on AAV9 for IV injection, and Vivet and Pfizer have developed a gene therapy based on AAV3b for IV injection, both of which are in clinical trial.There is a need of a new therapy for WD, such as a gene therapy that can provided persistent expression of functional ATP7b at a desired level.Summary of InventionIn order to meet the need, the inventors have developed a gene therapy for WD which offers a persistent and endogenous production of ATP7b following the transfer of a functional ATP7b gene to a patient.In a first aspect, the present invention provides a polynucleotide comprising a first segment comprising residues 169-3126 of SEQ ID NO: 2, 3, 4, 5 or 6.In some embodiments, the polynucleotide further comprises a second segment comprising residues 1-168 of SEQ ID NO: 2, 3, 4, 5 or 6. In some embodiments, the polynucleotide further comprises a third segment comprising residues 169-495 of SEQ ID NO: 8 or residues 169-393 of SEQ ID NO: 10, preferably between the first and second segment. In some embodiments, the polynucleotide further comprises a nucleotide sequence selected from the group consisting of SEQ ID NOs: 4, 8 or 10.In a second aspect, the present invention provides an expression construct comprising the polynucleotide of the present invention operably linked to a promoter, preferably comprising a nucleotide sequence of SEQ ID NO: 13 or 14.In some embodiments, the construct further comprises an enhancer, preferably comprising a nucleotide sequence of SEQ ID NO: 12. In some embodiments, the construct further comprises a polyA signal sequence, preferably comprising a nucleotide sequence of SEQ ID NO: 17 or 18. In some embodiments, the construct further comprises an intron, preferably comprising a nucleotide sequence of SEQ ID NO: 15 or 16.In a third aspect, the present invention provides a recombinant adeno-associated virus (rAAV) comprising a genome comprising the expression construct of the present invention.In some embodiments, the rAAV is hAAV6. In some embodiments, the genome comprises 5’ and 3’ ITRs, preferably comprising SEQ ID NOs: 19 and 20, respectively.In some embodiments, the rAAV is prepared by transforming a host cell with a system containing a transgene plasmid comprising the genome of the rAAV, a packaging plasmid encoding the REP and / or CAP proteins, and a helper plasmid. Therefore, the present invention further provides a vector comprising the expression construct of the invention.In a fourth aspect, the present invention provides a pharmaceutical composition comprising the rAAV of the present invention.In a fifth aspect, the present invention provides a host cell comprising the polynucleotide, the expression construct, the vector or the rAAV of the present invention.In a sixth aspect, the present invention provides a method of treating a disease associated with the deficiency of copper transport, comprising administering the rAAV or the pharmaceutical composition of the present invention to a subject in need thereof.The present invention also provides use of the polynucleotide, the expression construct, the vector, the rAAV, the pharmaceutical composition and / or the host cell of the present invention in the preparation of a medicament for treating a disease associated with the deficiency of copper transport in a subject in need thereof.In some embodiments, the disease is Wilson disease.Brief Description of the DrawingsFig. 1 shows the structures of the constructs for testing the codon optimization of mini-ATP7b.Fig. 2 shows the maps of the transgene plasmid (A) , helper plasmid (B) and packaging plasmid (C and D) .Fig. 3 shows the Western Blot for detecting the expression of mini-ATP7b by the rAAVs in HepG2 cell, alpha tubulin was used as reference. Lanes: NC, No treatment; G2, WT-AAV5; G3, Co1-AAV5; G4, Co2-AAV5; G5, Co3-AAV5; G6, Co4-AAV5; and G7, Co5-AAV5.Fig. 4 shows the Western Blot for detecting the expression of mini-ATP7b by the rAAVs in the liver of WT mice. Lanes: G1, No treatment; G2, WT-AAV5; G3, Co1-AAV5; G4, Co2-AAV5; G5, Co3-AAV5; G6, Co4-AAV5; and G7, Co5-AAV5. The first and second lanes (left to right direction) are protein ladder and positive control, respectively.Fig. 5 shows the Western Blot for detecting the expression of mini-ATP7b by the rAAV Co3-AAV5 in the liver of ATP7b knockout (KO) mice (Fig. 5A; PC, positive control) , and the viral genome in cell (Fig. 5B) .Fig. 6 shows the immunohistochemical staining of liver tissues from the ATP7b KO mice treated with different doses rAAV Co3-AAV5.Fig. 7 shows the H&E staining of liver from the ATP7b KO mice treated with different doses of rAAV Co3-AAV5.Fig. 8 shows the therapeutic efficacy of MBD5-6-AAV5 in 6-week-old male WD mice. Upon treatment with two different doses of MBD5-6-AAV5 (1E13 and 3E13vg / kg) , significant reductions in liver copper levels (left panel) and increase in ceruloplasmin activity (right panel) in serum were observed dose dependently.Fig. 9 shows the Western Blot for detecting the expression of mini-ATP7b by the rAAVs in HepG2 cell, alpha tubulin was used as reference. Lanes: 1, MBD3-5-6-AAV5; 2, MBD3T-5-6-AAV5; 3, MBD5-6-AAV5; 4, MBD3-5-6-AAV6; 5, MBD3T-5-6-AAV6; 6, MBD5-6-AAV6; 7, negative control, and C, positive control.Fig. 10 shows the Western Blot for detecting the expression of mini-ATP7b in the liver of ATP7b KO mice treated with the rAAVs MBD3-5-6-AAV5, MBD3T-5-6-AAV5, MBD5-6-AAV5, MBD3-5-6-AAV6, MBD3T-5-6-AAV6, and MBD5-6-AAV6.Fig. 11 shows the immunohistochemical staining of liver tissues from the ATP7b KO mice treated with the rAAVs MBD3-5-6-AAV5, MBD3T-5-6-AAV5, MBD5-6-AAV5, MBD3-5-6-AAV6, MBD3T-5-6-AAV6, and MBD5-6-AAV6.Fig. 12 shows the therapeutic efficacy of 6 different rAAVs in 6-week-old male WD mice. 4 weeks after the treatment with rAAVs MBD3-5-6-AAV5, MBD3T-5-6-AAV5, MBD5-6-AAV5, MBD3-5-6-AAV6, MBD3T-5-6-AAV6, and MBD5-6-AAV6 (5E12vg / kg) , significant reductions in liver copper levels (left panel) and increase in ceruloplasmin activity (right panel) in serum were observed in all groups. The potential reduction efficacies are comparable to positive control MBD5-6 in both AAV5 and AAV6 treated groups.Fig. 13 shows the Western Blot for detecting the expression of mini-ATP7b by the rAAVs in HepG2 cell. A, the image of Western Blot, and B, the quantification of the Western Blot. Lanes: 1, MBD3-5-6-1-AAV5; 2, MBD3T-5-6-1-AAV5; 3, MBD3T-5-6-2-AAV5; 4, MBD3-5-6-2-AAV5; 5, MBD3T-5-6-3-AAV5; 6, MBD3T-5-6-4-AAV5; 7, MBD3-5-6-3-AAV5; 8, MBD3T-5-6-5-AAV5; 9, MBD3-5-6-AAV5; 10, MBD3T-5-6-AAV5; 11, MBD5-6-AAV5; 12, negative control.Fig. 14 shows the structure of copper-responsive reporter (A) and the in vitro metal-responsive element luciferase reporter assay for copper transport activity (B) . Benchmark, MBD5-6-AAV6; #4, MBD3-5-6-2-AAV6; #6, MBD3T-5-6-4-AAV6; #7, MBD3-5-6-3-AAV6.Fig. 15 shows the distribution of the rAAVs in mouse liver (A) , the expression of mini-ATP7b by the rAAVs in mouse liver (B and C) , and the resulted Cu reduction in mouse liver (D) and recovery of ceruloplasmin activity (E) .Fig. 16 shows the IHC staining for mini-ATP7b in livers from mice treated with the rAAVs (A) and the quantification of the mini-ATP7b positive cells.Detailed Description1. DefinitionsUnless otherwise indicated, all terms used herein have the same meaning as they would to one skilled in the art, and the practice of the present invention will employ conventional techniques of microbiology and recombinant DNA technology, which are within the knowledge of those of skill in the art.As used herein, “ATP7b” belongs to class 1B of the highly conserved P-type ATPase superfamily responsible for the transport of copper and other heavy metals across cellular membranes.Adeno-associated virus (AAV) is a member of Parvoviridae family. It is a simple single-stranded DNA virus and requires a helper virus (such as adenovirus) for replication. The genome of a wildtype AAV contains approximately 4.7 kilobases (kb) , comprising the cap and rep genes between two inverted terminal repeat (ITR) sequences, approximately 145 nucleotides in length, with interrupted palindromic sequences that can fold into hairpin structures that function as primers during initiation of DNA replication. The cap gene encodes the viral capsid protein, and the rep gene is involved in the replication and integration of AAV. AAV can infect a variety of cells, and the viral DNA can be integrated into human chromosome 19 in the presence of the rep product.As used herein, the term “inverted terminal repeats” or “ITRs” as used herein refers to AAV viral cis elements named due to their symmetry. These elements are essential for efficient multiplication of an AAV genome. In the present invention, the term “ITR” refers to ITRs of known natural AAV serotypes, to chimeric ITRs formed by the fusion of ITR elements derived from different serotypes, and to functional variant thereof.The production of a recombinant AAV particle may involve three plasmids, a transgene plasmid comprising an expression construct for expressing an exogenous polynucleotide, a packaging plasmid encoding the REP and / or CAP proteins, and a helper plasmid.As used herein, the term “expression construct” refers to a single-stranded or double-stranded polynucleotide, which is isolated from a naturally occurring gene or modified to contain a nucleic acid segment that does not naturally occur. The expression construct may contain the control sequences required to express the coding sequence of the present invention.As used herein, the term “polynucleotide” usually refers to generally a nucleic acid molecule (e.g., 100 bases and up to 30 kilobases in length) and a sequence that is either complementary (antisense) or identical (sense) to the sequence of a messenger RNA (mRNA) or miRNA fragment or molecule. The term can also refer to DNA or RNA molecules that are either transcribed or non-transcribed.The term “exogenous polynucleotide” as used herein refers to a nucleotide sequence that does not originate from the host in which it is placed. It may be identical to the host’s DNA or heterologous. An example is a sequence of interest inserted into a vector. Such exogenous DNA sequences may be derived from a variety of sources including DNA, cDNA, synthetic DNA, and RNA. Exogenous polynucleotides also encompass DNA sequences that encode antisense oligonucleotides.As used herein, the term “expression” includes any step involved in the production of a polypeptide, including but not limited to transcription, post-transcriptional modification, translation, post-translational modification, and secretion.A “control sequence” includes all elements necessary or beneficial for the expression of the polynucleotide encoding the polypeptide of the present invention. Each control sequence may be natural or foreign to the nucleotide sequence encoding the polypeptide, or natural or foreign to each other. Such control sequences include, but are not limited to, leader sequence, polyadenylation sequence, propeptide sequence, promoter, enhancer, signal peptide sequence, and transcription terminator. At a minimum, control sequences include a promoter and signals for the termination of transcription and translation.For example, the control sequence may be a suitable promoter sequence, a nucleotide sequence recognized by the host cell to express the polynucleotide encoding the polypeptide of the present invention. The promoter sequence contains a transcription control sequence that mediates the expression of the polypeptide. The promoter may be any nucleotide sequence that exhibits transcriptional activity in the selected host cell, for example, lac operon of E. coli. The promoters also include mutant, modified and hybrid promoters, and can be obtained from genes encoding extracellular or intracellular polypeptides, which are homologous or heterologous to the host cell.In some cases, an intron can be included in the construct to improve the expression of the coding sequence. A “modified” intron comprises a modification such as substitution, insertion or deletion of one or more nucleotides in an internal region of an initial intron.As used herein, the term “operably linked” herein refers to a configuration in which a control sequence is placed at an appropriate position relative to the coding sequence of the polynucleotide sequence, whereby the control sequence directs the expression of the polypeptide coding sequence.The polynucleotide encoding the ATP7b protein can be subjected to various manipulations to improve the expression of the polypeptide. Before the insertion thereof into a vector, manipulation of the polynucleotide according to the expression vector or the host, such as codon optimization, is desirable or necessary.The term “recombinant” as used herein refers to nucleic acids, vectors, polypeptides, or proteins that have been generated using DNA recombination (cloning) methods and are distinguishable from native or wild-type nucleic acids, vectors, polypeptides, or proteins.The terms “polypeptide” and “protein” are used interchangeably herein and refer to a polymer of amino acids and includes full-length proteins and fragments thereof.As used herein, the term “host cell” refers to, for example microorganisms, yeast cells, insect cells, and mammalian cells, that can be, or have been, used as recipients of rAAV vectors. The term includes the progeny of the original cell which has been transduced. Thus, a “host cell” as used herein generally refers to a cell which has been transduced with an exogenous DNA sequence. It is understood that the progeny of a single parental cell may not necessarily be completely identical in morphology or in genomic or total DNA complement to the original parent, due to natural, accidental, or deliberate mutation.The term “pharmaceutically acceptable” as used herein refers to molecular entities and compositions that are physiologically tolerable and do not typically produce toxicity or an allergic or similar untoward reaction, such as gastric upset, dizziness and the like, when administered to a human.The term “subject” as used herein includes, but is not limited to, humans, nonhuman primates such as chimpanzees and other apes and monkey species; farm animals such as cattle, sheep, pigs, goats and horses; domestic mammals such as dogs and cats; laboratory animals including rodents such as mice, rats and guinea pigs, and the like. The term does not denote a particular age or sex. Thus, adult and newborn subjects, as well as fetuses, whether male or female, are intended to be covered.2. mini-ATP7b polypeptideGene therapy aims to correct defective genes that underlie the development of diseases, and to introduce exogenous gene into the cell of interest in a subject to express the product of the exogenous gene that is useful for treating a certain disease, such as Wilson disease. A common approach for this purpose involves the delivery of a functional gene such as atp7b to the nucleus. This gene may then be inserted into the genome of the cell of interest or may remain episomal. Delivery of a functional gene to a subject’s target cells can be carried out via numerous methods, including the use of viral vectors. Among the many viral vectors available (e. g, retrovirus, lentivirus, adenovirus, and the like) , AAV is gaining popularity as a versatile vector in gene therapy.Vectors derived from AAV are particularly attractive for delivering genetic material because (i) they are able to infect (transduce) a wide variety of non-dividing and dividing cell types including muscle fibers and neurons; (ii) they are devoid of the virus structural genes, thereby eliminating the natural host cell responses to virus infection, e.g., interferon-mediated responses; (iii) wild-type viruses have never been associated with any pathology in humans; (iv) in contrast to wild type AAVs, which are capable of integrating into the host cell genome, replication-deficient AAV vectors generally persist as episomes, thus limiting the risk of insertional mutagenesis or activation of oncogenes; and (v) in contrast to other vector systems, AAV vectors do not trigger a significant immune response (see ii) , thus granting long-term expression of the therapeutic transgenes (provided their gene products are not rejected) . AAV vectors can also be produced at high titer and it has been reported that intra-arterial, intra-venous, or intra-peritoneal injections allow gene transfer to significant muscle regions in rodents through a single injection. However, due to the small size of AAV genome, the length of the gene delivered by rAAV is limited.ATP7B is encoded by a large gene, e.g., human gene has 150 kb of genomic DNA, resulting in a ～4.4 kb-long cDNA. Therefore, it is generally not possible to deliver the polynucleotide encoding full length ATP7b with rAAV.The 165kD protein contains 1, 465 amino acids organized into, from the N terminus to the C terminus, the phosphatase domain (PD) , the phosphorylation domain and eight transmembrane ion channels that span the phospholipid bilayer of the plasma membrane. The copper (Cu) -binding domain is composed of six copper-binding sites (referred to as Sites 1, 2, 3, 4, 5 and 6, respectively, which are numbered from N to C terminal) , which play a central role in accepting Cu from the copper transport protein ATOX1 through protein–protein interactions.It was found that ATP7b can also function upon the removal of one or several copper-binding sits, with Sites 5 and 6 remained, which may result in a smaller size enabling the delivery with rAAV. Such a modified ATP7b comprises the distal N terminus, the modified Cu-binding domain, the transmembrane ion channels, the phosphorylation domain and PD, and is referred to as “mini-ATP7b” , which can be named in more details with the copper binding sites comprised therein.For example, it was reported that upon a mini-ATP7b derived from human ATP7the removal of Sites 1 to 4 can affect the copper transport. Such a mini-ATP7b comprises a Cu-binding domain comprising Sites 5 and 6 only (SEQ ID NO: 7) , and is referred to as MBD5-6 herein.The inventors believe that the introduction of additional Cu-binding site may improve the function of mini-ATP7b.Therefore, the present invention provides a mini-ATP7b polypeptide comprising an additional Cu-binding site inserted at the N-terminal of the Cu-binding domain.The mini-ATP7b can be derived from any animal species, including but not limited to, human, nonhuman primates such as chimpanzees and other apes and monkey species; farm animals such as cattle, sheep, pigs, goats and horses; domestic mammals such as dogs and cats; laboratory animals including rodents such as mice, rats and guinea pigs, and the like.In some embodiments, the mini-ATP7b is derived from human ATP7b. In some embodiments, the mini-ATP7b of the present invention comprises an additional Cu-binding site inserted between residues 56 and 57, of SEQ ID NO: 7. In some embodiments, the additional Cu-binding site is Site 3 of ATP7b (which is referred to as MBD3-5-6) , e.g., having an amino acid sequence comprising residues 57-165 of SEQ ID NO: 9. In some embodiments, the additional Cu-binding site is a truncated Site 3 of ATP7b (which is referred to as MBD3T-5-6) , e.g., having an amino acid sequence comprising residues 57-131 of SEQ ID NO: 11.In some embodiments, the mini-ATP7b comprises an amino acid sequence of SEQ ID NO: 9 or 10, or an amino acid sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 9 or 11, and has at least 10%, 20%, 30%, 40%, 50%, 60%70%, 80%, 90%, 100%or more Cu-transporting ability of the polypeptide of SEQ ID NO: 9 or 11.3. The polynucleotide or construct for expressing mini-ATP7bThe present invention thus intends to provide a polynucleotide, an expression construct, or a vector comprising the polynucleotide or the expression construct, for expressing mini-ATP7b in a subject.In some embodiments, the polynucleotide encoding mini-ATP7b is codon-optimized to improve the expression.In some embodiments, the polynucleotide comprises a first segment comprising residues 169-3126 of SEQ ID NO: 2, 3, 4, 5 or 6. In some embodiments, the polynucleotide further comprises a second segment comprising residues 1-168 of SEQ ID NO: 2, 3, 4, 5 or 6.In some embodiments, the polynucleotide comprises a nucleotide sequence of SEQ ID NO: 2, 3, 4, 5 or 6, or a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 2, 3, 4, 5 or 6.In some embodiments, the polynucleotide comprises SEQ ID NO: 2 or a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 2. In some embodiments, the polynucleotide comprises a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 2, and encodes a functional mini-ATP7b polypeptide, such as a mini-ATP7b polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%70%, 80%, 90%, 100%or more Cu-transporting ability of the polypeptide of SEQ ID NO: 7. In some embodiments, the polynucleotide comprises a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 2, and encodes the polypeptide of SEQ ID NO: 7.In some embodiments, the polynucleotide comprises SEQ ID NO: 3 or a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 3. In some embodiments, the polynucleotide comprises a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 3, and encodes a functional mini-ATP7b polypeptide, such as a mini-ATP7b polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%70%, 80%, 90%, 100%or more Cu-transporting ability of the polypeptide of SEQ ID NO: 7. In some embodiments, the polynucleotide comprises a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 3, and encodes the polypeptide of SEQ ID NO: 7.In some embodiments, the polynucleotide comprises SEQ ID NO: 4 or a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 4. In some embodiments, the polynucleotide comprises a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 4, and encodes a functional mini-ATP7b polypeptide, such as a mini-ATP7b polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%70%, 80%, 90%, 100%or more Cu-transporting ability of the polypeptide of SEQ ID NO: 7. In some embodiments, the polynucleotide comprises a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 4, and encodes the polypeptide of SEQ ID NO: 7.In some embodiments, the polynucleotide comprises SEQ ID NO: 5 or a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 5. In some embodiments, the polynucleotide comprises a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 5, and encodes a functional mini-ATP7b polypeptide, such as a mini-ATP7b polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%70%, 80%, 90%, 100%or more Cu-transporting ability of the polypeptide of SEQ ID NO: 7. In some embodiments, the polynucleotide comprises a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 5, and encodes the polypeptide of SEQ ID NO: 7.In some embodiments, the polynucleotide comprises SEQ ID NO: 6 or a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 6. In some embodiments, the polynucleotide comprises a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 6, and encodes a functional mini-ATP7b polypeptide, such as a mini-ATP7b polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%70%, 80%, 90%, 100%or more Cu-transporting ability of the polypeptide of SEQ ID NO: 7. In some embodiments, the polynucleotide comprises a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 6, and encodes the polypeptide of SEQ ID NO: 7.Surprisingly, the inventors found that the polynucleotide comprising SEQ ID NO: 2, 4 or 6 achieves a higher expression of mini-ATP7b than SEQ ID NO: 1 in cells and mice.The inventors believe that the introduction of additional Cu-binding site may improve the function of mini-ATP7b. Therefore, in some embodiments, the polynucleotide further comprises a third segment comprising residues 169-495 of SEQ ID NO: 8 or residues 169-393 of SEQ ID NO: 10, preferably between the first and second segments.In some embodiments, the polynucleotide comprises SEQ ID NO: 8 or a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 8. In some embodiments, the polynucleotide comprises a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 8, and encodes a functional mini-ATP7b polypeptide, such as a mini-ATP7b polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%70%, 80%, 90%, 100%or more Cu-transporting ability of the polypeptide of SEQ ID NO: 9. In some embodiments, the polynucleotide comprises a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 8, and encodes the polypeptide of SEQ ID NO: 9.In some embodiments, the polynucleotide comprises SEQ ID NO: 10 or a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 10. In some embodiments, the polynucleotide comprises a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 10, and encodes a functional mini-ATP7b polypeptide, such as a mini-ATP7b polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%70%, 80%, 90%, 100%or more Cu-transporting ability of the polypeptide of SEQ ID NO: 11. In some embodiments, the polynucleotide comprises a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 10, and encodes the polypeptide of SEQ ID NO: 11.In some embodiments, the polynucleotide comprises, from 5’ to 3’, residues 1-168 of SEQ ID NO: 2, residues 169-495 of SEQ ID NO: 8, and residues 169-3126 of SEQ ID NO: 2. In some embodiments, the polynucleotide comprises, from 5’ to 3’, residues 1-168 of SEQ ID NO: 2, residues 169-495 of SEQ ID NO: 8, and residues 169-3126 of SEQ ID NO: 2.In some embodiments, the polynucleotide comprises, from 5’ to 3’, residues 1-168 of SEQ ID NO: 6, residues 169-495 of SEQ ID NO: 8, and residues 169-3126 of SEQ ID NO: 6. In some embodiments, the polynucleotide comprises, from 5’ to 3’, residues 1-168 of SEQ ID NO: 6, residues 169-495 of SEQ ID NO: 8, and residues 169-3126 of SEQ ID NO: 6.The present invention also provides an expression construct for expressing mini-ATP7b, which comprises a polynucleotide encoding mini-ATP7b operably linked to a promoter. In some embodiments, the mini-ATP7b is derived from human ATP7b. In some embodiments, the mini-ATP7b comprises the amino acid sequence of SEQ ID NO: 7, 9 or 11.In some embodiments, the polynucleotide comprises a first segment comprising residues 169-3126 of SEQ ID NO: 2, 3, 4, 5 or 6. In some embodiments, the polynucleotide further comprises a second segment comprising residues 1-168 of SEQ ID NO: 2, 3, 4, 5 or 6.In some embodiments, the polynucleotide comprises a nucleotide sequence of SEQ ID NO: 2, 3, 4, 5 or 6, or a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 2, 3, 4, 5 or 6.In some embodiments, the polynucleotide comprises SEQ ID NO: 2 or a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 2. In some embodiments, the polynucleotide comprises a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 2, and encodes a functional mini-ATP7b polypeptide, such as a mini-ATP7b polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%70%, 80%, 90%, 100%or more Cu-transporting ability of the polypeptide of SEQ ID NO: 7. In some embodiments, the polynucleotide comprises a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 2, and encodes the polypeptide of SEQ ID NO: 7.In some embodiments, the polynucleotide comprises SEQ ID NO: 3 or a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 3. In some embodiments, the polynucleotide comprises a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 3, and encodes a functional mini-ATP7b polypeptide, such as a mini-ATP7b polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%70%, 80%, 90%, 100%or more Cu-transporting ability of the polypeptide of SEQ ID NO: 7. In some embodiments, the polynucleotide comprises a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 3, and encodes the polypeptide of SEQ ID NO: 7.In some embodiments, the polynucleotide comprises SEQ ID NO: 4 or a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 4. In some embodiments, the polynucleotide comprises a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 4, and encodes a functional mini-ATP7b polypeptide, such as a mini-ATP7b polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%70%, 80%, 90%, 100%or more Cu-transporting ability of the polypeptide of SEQ ID NO: 7. In some embodiments, the polynucleotide comprises a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 4, and encodes the polypeptide of SEQ ID NO: 7.In some embodiments, the polynucleotide comprises SEQ ID NO: 5 or a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 5. In some embodiments, the polynucleotide comprises a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 5, and encodes a functional mini-ATP7b polypeptide, such as a mini-ATP7b polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%70%, 80%, 90%, 100%or more Cu-transporting ability of the polypeptide of SEQ ID NO: 7. In some embodiments, the polynucleotide comprises a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 5, and encodes the polypeptide of SEQ ID NO: 7.In some embodiments, the polynucleotide comprises SEQ ID NO: 6 or a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 6. In some embodiments, the polynucleotide comprises a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 6, and encodes a functional mini-ATP7b polypeptide, such as a mini-ATP7b polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%70%, 80%, 90%, 100%or more Cu-transporting ability of the polypeptide of SEQ ID NO: 7. In some embodiments, the polynucleotide comprises a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 6, and encodes the polypeptide of SEQ ID NO: 7.Surprisingly, the inventors found that the polynucleotide comprising SEQ ID NO: 2, 4 or 6 achieves a higher expression of mini-ATP7b than SEQ ID NO: 1 in cells and mice.In some embodiments, the polynucleotide further comprises a third segment comprising residues 169-495 of SEQ ID NO: 8 or residues 169-393 of SEQ ID NO: 10, preferably between the first and second segments.In some embodiments, the polynucleotide comprises SEQ ID NO: 8 or a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 8. In some embodiments, the polynucleotide comprises a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 8, and encodes a functional mini-ATP7b polypeptide, such as a mini-ATP7b polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%70%, 80%, 90%, 100%or more Cu-transporting ability of the polypeptide of SEQ ID NO: 9. In some embodiments, the polynucleotide comprises a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 8, and encodes the polypeptide of SEQ ID NO: 9.In some embodiments, the polynucleotide comprises SEQ ID NO: 10 or a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 10. In some embodiments, the polynucleotide comprises a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 10, and encodes a functional mini-ATP7b polypeptide, such as a mini-ATP7b polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%70%, 80%, 90%, 100%or more Cu-transporting ability of the polypeptide of SEQ ID NO: 11. In some embodiments, the polynucleotide comprises a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 10, and encodes the polypeptide of SEQ ID NO: 11.In some embodiments, the polynucleotide comprises, from 5’ to 3’, residues 1-168 of SEQ ID NO: 2, residues 169-495 of SEQ ID NO: 8, and residues 169-3126 of SEQ ID NO: 2. In some embodiments, the polynucleotide comprises, from 5’ to 3’, residues 1-168 of SEQ ID NO: 2, residues 169-495 of SEQ ID NO: 8, and residues 169-3126 of SEQ ID NO: 2.In some embodiments, the polynucleotide comprises, from 5’ to 3’, residues 1-168 of SEQ ID NO: 6, residues 169-495 of SEQ ID NO: 8, and residues 169-3126 of SEQ ID NO: 6. In some embodiments, the polynucleotide comprises, from 5’ to 3’, residues 1-168 of SEQ ID NO: 6, residues 169-495 of SEQ ID NO: 8, and residues 169-3126 of SEQ ID NO: 6.The construct will generally be transferred to mammalian cells (such as human cells) for expression. Such constructs often include promoter-enhancers for high-level expression, for example the SV40 promoter-enhancer, the human cytomegalovirus (CMV) promoter and the long terminal repeat of Rous sarcoma virus (RSV) . These promoter-enhancers are active in many cell types. Tissue and cell-type promoters and enhancer regions also can be used for expression. Exemplary promoter / enhancer regions include, but are not limited to, those from genes such as elastase I, insulin, immunoglobulin, mouse mammary tumor virus, albumin, alpha fetoprotein, alpha 1 antitrypsin, beta globin, myelin basic protein, myosin light chain 2, and gonadotropic releasing hormone gene.In some embodiments, the promoter is a constitutive promoter. In some embodiments, the promoter comprises SEQ ID NO: 13 or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 13. In some embodiments, the promoter comprises SEQ ID NO: 14 or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 14.In some embodiments, the expression construct further comprises an enhancer. In some embodiments, the enhancer is upstream of the promoter. In some embodiments, the enhancer comprises SEQ ID NO: 12, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 12.It is also desirable to include an intron (e.g., an intron derived from a eukaryotic organism or an artificial intron) in the construct to increase the expression in eukaryotic cells. In some embodiments, the expression construct further comprises an intron. In some embodiments, the intron is upstream of the nucleotide sequence encoding mini-ATP7b. In some embodiments, the intron is downstream of the promoter. In some embodiments, the intron comprises a nucleotide sequence of SEQ ID NO: 15 or 16.The expression construct further comprises a polyadenylation signal sequence for the processing of the transcript. In some embodiments, the construct comprises a polyadenylation signal sequence downstream of the nucleotide sequence encoding mini-ATP7b. In some embodiments, the polyadenylation signal sequence comprises SEQ ID NO: 17 or 18, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 17 or 18.In some embodiments, the expression construct comprises, in the order of 5’ to 3’, an enhancer, a promoter, an intron, a polynucleotide of interest encoding mini-ATP7b (such as MBD5-6 of SEQ ID NO: 7) , and a polyadenylation signal sequence.In some embodiments, the expression construct comprises, in the order of 5’ to 3’,SEQ ID NO: 12 or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 12,SEQ ID NO: 13 or 14, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 13 or 14,SEQ ID NO: 15 or 16, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 15 or 16,SEQ ID NO: 2 or a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 2, preferably encoding a functional mini-ATP7b polypeptide, such as a mini-ATP7b polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%70%, 80%, 90%, 100%or more Cu-transporting ability of the polypeptide of SEQ ID NO: 7, and more preferably encoding SEQ ID NO: 7; andSEQ ID NO: 17 or 18, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 17 or 18.In some embodiments, the expression construct comprises, in the order of 5’ to 3’,SEQ ID NO: 12 or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 12,SEQ ID NO: 13 or 14, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 13 or 14,SEQ ID NO: 15 or 16, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 15 or 16,SEQ ID NO: 3 or a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 3, preferably encoding a functional mini-ATP7b polypeptide, such as a mini-ATP7b polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%70%, 80%, 90%, 100%or more Cu-transporting ability of the polypeptide of SEQ ID NO: 7, and more preferably encoding SEQ ID NO: 7; andSEQ ID NO: 17 or 18, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 17 or 18.In some embodiments, the expression construct comprises, in the order of 5’ to 3’, SEQ ID NO: 12 or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 12,SEQ ID NO: 13 or 14, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 13 or 14,SEQ ID NO: 15 or 16, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 15 or 16,SEQ ID NO: 4 or a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 4, preferably encoding a functional mini-ATP7b polypeptide, such as a mini-ATP7b polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%70%, 80%, 90%, 100%or more Cu-transporting ability of the polypeptide of SEQ ID NO: 7, and more preferably encoding SEQ ID NO: 7; andSEQ ID NO: 17 or 18, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 17 or 18.In some embodiments, the expression construct comprises, in the order of 5’ to 3’, SEQ ID NO: 12 or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 12,SEQ ID NO: 13 or 14, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 13 or 14,SEQ ID NO: 15 or 16, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 15 or 16,SEQ ID NO: 5 or a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 5, preferably encoding a functional mini-ATP7b polypeptide, such as a mini-ATP7b polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%70%, 80%, 90%, 100%or more Cu-transporting ability of the polypeptide of SEQ ID NO: 7, and more preferably encoding SEQ ID NO: 7; andSEQ ID NO: 17 or 18, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 17 or 18.In some embodiments, the expression construct comprises, in the order of 5’ to 3’, SEQ ID NO: 12 or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 12,SEQ ID NO: 13 or 14, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 13 or 14,SEQ ID NO: 15 or 16, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 15 or 16,SEQ ID NO: 6 or a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 6, preferably encoding a functional mini-ATP7b polypeptide, such as a mini-ATP7b polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%70%, 80%, 90%, 100%or more Cu-transporting ability of the polypeptide of SEQ ID NO: 7, and more preferably encoding SEQ ID NO: 7; andSEQ ID NO: 17 or 18, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 17 or 18.The incorporation of the additional Cu-binding site will result in a larger size, such that the construct may not be suitable for the delivery by rAAV. The inventors surprisingly found that upon optimization of the control sequences, it is possible to achieve a desired expression of a larger mini-ATP7b (such as MBD3-5-6 and MBD3T-5-6) without one of the elements such as enhancer or intron.In some embodiments, the expression construct comprises, in the order of 5’ to 3’, a promoter, an intron, a polynucleotide of interest encoding mini-ATP7b (such as MBD3-5-6 and MBD3T-5-6 of SEQ ID NO: 9 and 11, respectively) , and a polyadenylation signal sequence. In some embodiments, the expression construct does not comprise an enhancer.In some embodiments, the expression construct comprises, in the order of 5’ to 3’, SEQ ID NO: 14, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 14,SEQ ID NO: 15, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 15,SEQ ID NO: 8 or a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 8, preferably encoding a functional mini-ATP7b polypeptide, such as a mini-ATP7b polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%70%, 80%, 90%, 100%or more Cu-transporting ability of the polypeptide of SEQ ID NO: 9, and more preferably encoding SEQ ID NO: 9; andSEQ ID NO: 17, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 17.In some embodiments, the expression construct comprises, in the order of 5’ to 3’, SEQ ID NO: 14, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 14,SEQ ID NO: 15, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 15,SEQ ID NO: 8 or a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 8, preferably encoding a functional mini-ATP7b polypeptide, such as a mini-ATP7b polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%70%, 80%, 90%, 100%or more Cu-transporting ability of the polypeptide of SEQ ID NO: 9, and more preferably encoding SEQ ID NO: 9; andSEQ ID NO: 18, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 18.In some embodiments, the expression construct comprises, in the order of 5’ to 3’, SEQ ID NO: 14, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 14,SEQ ID NO: 15, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 15,SEQ ID NO: 10 or a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 10, preferably encoding a functional mini-ATP7b polypeptide, such as a mini-ATP7b polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%70%, 80%, 90%, 100%or more Cu-transporting ability of the polypeptide of SEQ ID NO: 11, and more preferably encoding SEQ ID NO: 11; andSEQ ID NO: 17, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 17.In some embodiments, the expression construct comprises, in the order of 5’ to 3’, SEQ ID NO: 14, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 14,SEQ ID NO: 15, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 15,SEQ ID NO: 10 or a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 10, preferably encoding a functional mini-ATP7b polypeptide, such as a mini-ATP7b polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%70%, 80%, 90%, 100%or more Cu-transporting ability of the polypeptide of SEQ ID NO: 11, and more preferably encoding SEQ ID NO: 11; andSEQ ID NO: 18, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 18.In some embodiments, the expression construct comprises, in the order of 5’ to 3’, an enhancer a promoter, a polynucleotide of interest encoding mini-ATP7b (such as MBD3-5-6 and MBD3T-5-6 of SEQ ID NO: 9 and 11, respectively) , and a polyadenylation signal sequence. In some embodiments, the expression construct does not comprise an intron.In some embodiments, the expression construct comprises, in the order of 5’ to 3’, SEQ ID NO: 12 or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 12,SEQ ID NO: 13 or 14, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 13 or 14,SEQ ID NO: 8 or a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 8, preferably encoding a functional mini-ATP7b polypeptide, such as a mini-ATP7b polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%70%, 80%, 90%, 100%or more Cu-transporting ability of the polypeptide of SEQ ID NO: 9, and more preferably encoding SEQ ID NO: 9; andSEQ ID NO: 17 or 18, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 17 or 18.In some embodiments, the expression construct comprises, in the order of 5’ to 3’, SEQ ID NO: 12 or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 12,SEQ ID NO: 13 or 14, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 13 or 14,SEQ ID NO: 10 or a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 10, preferably encoding a functional mini-ATP7b polypeptide, such as a mini-ATP7b polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%70%, 80%, 90%, 100%or more Cu-transporting ability of the polypeptide of SEQ ID NO: 11, and more preferably encoding SEQ ID NO: 11; andSEQ ID NO: 17 or 18, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 17 or 18.In some embodiments, the expression construct comprises, in the order of 5’ to 3’, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 2, and SEQ ID NO: 17. In some embodiments, the expression construct comprises, in the order of 5’ to 3’, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 3, and SEQ ID NO: 17. In some embodiments, the expression construct comprises, in the order of 5’ to 3’, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 4, and SEQ ID NO: 17. In some embodiments, the expression construct comprises, in the order of 5’ to 3’, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 5, and SEQ ID NO: 17. In some embodiments, the expression construct comprises, in the order of 5’ to 3’, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 6, and SEQ ID NO: 17.In some embodiments, the expression construct comprises, in the order of 5’ to 3’, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 2, and SEQ ID NO: 17. In some embodiments, the expression construct comprises, in the order of 5’ to 3’, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 3, and SEQ ID NO: 17. In some embodiments, the expression construct comprises, in the order of 5’ to 3’, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 4, and SEQ ID NO: 17. In some embodiments, the expression construct comprises, in the order of 5’ to 3’, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 5, and SEQ ID NO: 17. In some embodiments, the expression construct comprises, in the order of 5’ to 3’, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 6, and SEQ ID NO: 17.In some embodiments, the expression construct comprises, in the order of 5’ to 3’, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 2, and SEQ ID NO: 18. In some embodiments, the expression construct comprises, in the order of 5’ to 3’, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 3, and SEQ ID NO: 18. In some embodiments, the expression construct comprises, in the order of 5’ to 3’, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 4, and SEQ ID NO: 18. In some embodiments, the expression construct comprises, in the order of 5’ to 3’, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 5, and SEQ ID NO: 18. In some embodiments, the expression construct comprises, in the order of 5’ to 3’, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 6, and SEQ ID NO: 18.In some embodiments, the expression construct comprises, in the order of 5’ to 3’, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 2, and SEQ ID NO: 18. In some embodiments, the expression construct comprises, in the order of 5’ to 3’, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 3, and SEQ ID NO: 18. In some embodiments, the expression construct comprises, in the order of 5’ to 3’, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 4, and SEQ ID NO: 18. In some embodiments, the expression construct comprises, in the order of 5’ to 3’, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 5, and SEQ ID NO: 18. In some embodiments, the expression construct comprises, in the order of 5’ to 3’, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 6, and SEQ ID NO: 18.In some embodiments, the expression construct comprises, in the order of 5’ to 3’, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 8, and SEQ ID NO: 17. In some embodiments, the expression construct comprises, in the order of 5’ to 3’, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 8, and SEQ ID NO: 18.In some embodiments, the expression construct comprises, in the order of 5’ to 3’, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 10, and SEQ ID NO: 17. In some embodiments, the expression construct comprises, in the order of 5’ to 3’, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 10, and SEQ ID NO: 18.In some embodiments, the expression construct comprises, in the order of 5’ to 3’, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 8, and SEQ ID NO: 17. In some embodiments, the expression construct comprises, in the order of 5’ to 3’, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 8, and SEQ ID NO: 18.In some embodiments, the expression construct comprises, in the order of 5’ to 3’, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 10, and SEQ ID NO: 17. In some embodiments, the expression construct comprises, in the order of 5’ to 3’, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 10, and SEQ ID NO: 18.4. Recombinant AAV, pharmaceutical composition and host cellThe present invention further provides a recombinant AAV (rAAV) comprising a genome comprising the expression construct of the invention. In some embodiments, the expression construct flanked by 5’ and 3’ inverted terminal repeats (ITRs) of AAV.In some embodiments, the rAAV of the invention can be selected from human serotype 1 AAV (hAAV1) , hAAV2, hAAV3, hAAV4, hAAV5, hAAV6, hAAV7, hAAV8, hAAV9, hAAV10, and hAAV11. In some embodiments, the rAAV is hAAV5. In some embodiments, the rAAV is hAAV6.In some embodiment, the genome of the rAAV comprises an expression construct flanked by 5’ and 3’ ITRs of AAV.In some embodiment, the expression construct comprises a polynucleotide encoding mini-ATP7b operably linked to a promoter. In some embodiments, the mini-ATP7b is derived from human ATP7b. In some embodiments, the mini-ATP7b comprises the amino acid sequence of SEQ ID NO: 7, 9 or 11.In some embodiments, the polynucleotide comprises a first segment comprising residues 169-3126 of SEQ ID NO: 2, 3, 4, 5 or 6. In some embodiments, the polynucleotide further comprises a second segment comprising residues 1-168 of SEQ ID NO: 2, 3, 4, 5 or 6.In some embodiments, the polynucleotide comprises a nucleotide sequence of SEQ ID NO: 2, 3, 4, 5 or 6, or a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 2, 3, 4, 5 or 6.In some embodiments, the polynucleotide comprises SEQ ID NO: 2 or a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 2. In some embodiments, the polynucleotide comprises a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 2, and encodes a functional mini-ATP7b polypeptide, such as a mini-ATP7b polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%70%, 80%, 90%, 100%or more Cu-transporting ability of the polypeptide of SEQ ID NO: 7. In some embodiments, the polynucleotide comprises a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 2, and encodes the polypeptide of SEQ ID NO: 7.In some embodiments, the polynucleotide comprises SEQ ID NO: 3 or a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 3. In some embodiments, the polynucleotide comprises a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 3, and encodes a functional mini-ATP7b polypeptide, such as a mini-ATP7b polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%70%, 80%, 90%, 100%or more Cu-transporting ability of the polypeptide of SEQ ID NO: 7. In some embodiments, the polynucleotide comprises a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 3, and encodes the polypeptide of SEQ ID NO: 7.In some embodiments, the polynucleotide comprises SEQ ID NO: 4 or a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 4. In some embodiments, the polynucleotide comprises a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 4, and encodes a functional mini-ATP7b polypeptide, such as a mini-ATP7b polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%70%, 80%, 90%, 100%or more Cu-transporting ability of the polypeptide of SEQ ID NO: 7. In some embodiments, the polynucleotide comprises a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 4, and encodes the polypeptide of SEQ ID NO: 7.In some embodiments, the polynucleotide comprises SEQ ID NO: 5 or a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 5. In some embodiments, the polynucleotide comprises a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 5, and encodes a functional mini-ATP7b polypeptide, such as a mini-ATP7b polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%70%, 80%, 90%, 100%or more Cu-transporting ability of the polypeptide of SEQ ID NO: 7. In some embodiments, the polynucleotide comprises a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 5, and encodes the polypeptide of SEQ ID NO: 7.In some embodiments, the polynucleotide comprises SEQ ID NO: 6 or a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 6. In some embodiments, the polynucleotide comprises a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 6, and encodes a functional mini-ATP7b polypeptide, such as a mini-ATP7b polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%70%, 80%, 90%, 100%or more Cu-transporting ability of the polypeptide of SEQ ID NO: 7. In some embodiments, the polynucleotide comprises a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 6, and encodes the polypeptide of SEQ ID NO: 7.Surprisingly, the inventors found that the polynucleotide comprising SEQ ID NO: 2, 4 or 6 achieves a higher expression of mini-ATP7b than SEQ ID NO: 1 in cells and mice.In some embodiments, the polynucleotide further comprises a third segment comprising residues 169-495 of SEQ ID NO: 8 or residues 169-393 of SEQ ID NO: 10, preferably between the first and second segments.In some embodiments, the polynucleotide comprises SEQ ID NO: 8 or a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 8. In some embodiments, the polynucleotide comprises a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 8, and encodes a functional mini-ATP7b polypeptide, such as a mini-ATP7b polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%70%, 80%, 90%, 100%or more Cu-transporting ability of the polypeptide of SEQ ID NO: 9. In some embodiments, the polynucleotide comprises a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 8, and encodes the polypeptide of SEQ ID NO: 9.In some embodiments, the polynucleotide comprises SEQ ID NO: 10 or a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 10. In some embodiments, the polynucleotide comprises a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 10, and encodes a functional mini-ATP7b polypeptide, such as a mini-ATP7b polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%70%, 80%, 90%, 100%or more Cu-transporting ability of the polypeptide of SEQ ID NO: 11. In some embodiments, the polynucleotide comprises a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 10, and encodes the polypeptide of SEQ ID NO: 11.In some embodiments, the polynucleotide comprises, from 5’ to 3’, residues 1-168 of SEQ ID NO: 2, residues 169-495 of SEQ ID NO: 8, and residues 169-3126 of SEQ ID NO: 2. In some embodiments, the polynucleotide comprises, from 5’ to 3’, residues 1-168 of SEQ ID NO: 2, residues 169-495 of SEQ ID NO: 8, and residues 169-3126 of SEQ ID NO: 2.In some embodiments, the polynucleotide comprises, from 5’ to 3’, residues 1-168 of SEQ ID NO: 6, residues 169-495 of SEQ ID NO: 8, and residues 169-3126 of SEQ ID NO: 6. In some embodiments, the polynucleotide comprises, from 5’ to 3’, residues 1-168 of SEQ ID NO: 6, residues 169-495 of SEQ ID NO: 8, and residues 169-3126 of SEQ ID NO: 6.The construct will generally be transferred to mammalian cells (such as human cells) for expression. Such constructs often include promoter-enhancers for high-level expression, for example the SV40 promoter-enhancer, the human cytomegalovirus (CMV) promoter and the long terminal repeat of Rous sarcoma virus (RSV) . These promoter-enhancers are active in many cell types. Tissue and cell-type promoters and enhancer regions also can be used for expression. Exemplary promoter / enhancer regions include, but are not limited to, those from genes such as elastase I, insulin, immunoglobulin, mouse mammary tumor virus, albumin, alpha fetoprotein, alpha 1 antitrypsin, beta globin, myelin basic protein, myosin light chain 2, and gonadotropic releasing hormone gene.In some embodiments, the promoter is a constitutive promoter. In some embodiments, the promoter comprises SEQ ID NO: 13 or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 13. In some embodiments, the promoter comprises SEQ ID NO: 14 or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 14.In some embodiments, the expression construct further comprises an enhancer. In some embodiments, the enhancer is upstream of the promoter. In some embodiments, the enhancer comprises SEQ ID NO: 12, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 12.It is also desirable to include an intron (e.g., an intron derived from a eukaryotic organism or an artificial intron) in the construct to increase the expression in eukaryotic cells. In some embodiments, the expression construct further comprises an intron. In some embodiments, the intron is upstream of the nucleotide sequence encoding mini-ATP7b. In some embodiments, the intron is downstream of the promoter. In some embodiments, the intron comprises a nucleotide sequence of SEQ ID NO: 15 or 16.The expression construct further comprises a polyadenylation signal sequence for the processing of the transcript. In some embodiments, the construct comprises a polyadenylation signal sequence downstream of the nucleotide sequence encoding mini-ATP7b. In some embodiments, the polyadenylation signal sequence comprises SEQ ID NO: 17 or 18, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 17 or 18.In some embodiments, the expression construct comprises, in the order of 5’ to 3’, an enhancer, a promoter, an intron, a polynucleotide of interest encoding mini-ATP7b (such as MBD5-6 of SEQ ID NO: 7) , and a polyadenylation signal sequence.In some embodiments, the expression construct comprises, in the order of 5’ to 3’,SEQ ID NO: 12 or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 12,SEQ ID NO: 13 or 14, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 13 or 14,SEQ ID NO: 15 or 16, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 15 or 16,SEQ ID NO: 2 or a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 2, preferably encoding a functional mini-ATP7b polypeptide, such as a mini-ATP7b polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%70%, 80%, 90%, 100%or more Cu-transporting ability of the polypeptide of SEQ ID NO: 7, and more preferably encoding SEQ ID NO: 7; andSEQ ID NO: 17 or 18, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 17 or 18.In some embodiments, the expression construct comprises, in the order of 5’ to 3’,SEQ ID NO: 12 or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 12,SEQ ID NO: 13 or 14, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 13 or 14,SEQ ID NO: 15 or 16, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 15 or 16,SEQ ID NO: 3 or a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 3, preferably encoding a functional mini-ATP7b polypeptide, such as a mini-ATP7b polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%70%, 80%, 90%, 100%or more Cu-transporting ability of the polypeptide of SEQ ID NO: 7, and more preferably encoding SEQ ID NO: 7; andSEQ ID NO: 17 or 18, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 17 or 18.In some embodiments, the expression construct comprises, in the order of 5’ to 3’,SEQ ID NO: 12 or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 12,SEQ ID NO: 13 or 14, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 13 or 14,SEQ ID NO: 15 or 16, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 15 or 16,SEQ ID NO: 4 or a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 4, preferably encoding a functional mini-ATP7b polypeptide, such as a mini-ATP7b polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%70%, 80%, 90%, 100%or more Cu-transporting ability of the polypeptide of SEQ ID NO: 7, and more preferably encoding SEQ ID NO: 7; andSEQ ID NO: 17 or 18, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 17 or 18.In some embodiments, the expression construct comprises, in the order of 5’ to 3’,SEQ ID NO: 12 or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 12,SEQ ID NO: 13 or 14, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 13 or 14,SEQ ID NO: 15 or 16, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 15 or 16,SEQ ID NO: 5 or a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 5, preferably encoding a functional mini-ATP7b polypeptide, such as a mini-ATP7b polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%70%, 80%, 90%, 100%or more Cu-transporting ability of the polypeptide of SEQ ID NO: 7, and more preferably encoding SEQ ID NO: 7; andSEQ ID NO: 17 or 18, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 17 or 18.In some embodiments, the expression construct comprises, in the order of 5’ to 3’,SEQ ID NO: 12 or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 12,SEQ ID NO: 13 or 14, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 13 or 14,SEQ ID NO: 15 or 16, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 15 or 16,SEQ ID NO: 6 or a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 6, preferably encoding a functional mini-ATP7b polypeptide, such as a mini-ATP7b polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%70%, 80%, 90%, 100%or more Cu-transporting ability of the polypeptide of SEQ ID NO: 7, and more preferably encoding SEQ ID NO: 7; andSEQ ID NO: 17 or 18, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 17 or 18.The incorporation of the additional Cu-binding site will result in a larger size, such that the construct may not be suitable for the delivery by rAAV. The inventors surprisingly found that upon optimization of the control sequences, it is possible to achieve a desired expression of a larger mini-ATP7b (such as MBD3-5-6 and MBD3T-5-6) without one of the elements such as enhancer or intron.In some embodiments, the expression construct comprises, in the order of 5’ to 3’, a promoter, an intron, a polynucleotide of interest encoding mini-ATP7b (such as MBD3-5-6 and MBD3T-5-6 of SEQ ID NO: 9 and 11, respectively) , and a polyadenylation signal sequence. In some embodiments, the expression construct does not comprise an enhancer.In some embodiments, the expression construct comprises, in the order of 5’ to 3’,SEQ ID NO: 14, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 14,SEQ ID NO: 15, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 15,SEQ ID NO: 8 or a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 8, preferably encoding a functional mini-ATP7b polypeptide, such as a mini-ATP7b polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%70%, 80%, 90%, 100%or more Cu-transporting ability of the polypeptide of SEQ ID NO: 9, and more preferably encoding SEQ ID NO: 9; andSEQ ID NO: 17, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 17.In some embodiments, the expression construct comprises, in the order of 5’ to 3’,SEQ ID NO: 14, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 14,SEQ ID NO: 15, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 15,SEQ ID NO: 8 or a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 8, preferably encoding a functional mini-ATP7b polypeptide, such as a mini-ATP7b polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%70%, 80%, 90%, 100%or more Cu-transporting ability of the polypeptide of SEQ ID NO: 9, and more preferably encoding SEQ ID NO: 9; andSEQ ID NO: 18, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 18.In some embodiments, the expression construct comprises, in the order of 5’ to 3’,SEQ ID NO: 14, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 14,SEQ ID NO: 15, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 15,SEQ ID NO: 10 or a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 10, preferably encoding a functional mini-ATP7b polypeptide, such as a mini-ATP7b polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%70%, 80%, 90%, 100%or more Cu-transporting ability of the polypeptide of SEQ ID NO: 11, and more preferably encoding SEQ ID NO: 11; andSEQ ID NO: 17, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 17.In some embodiments, the expression construct comprises, in the order of 5’ to 3’,SEQ ID NO: 14, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 14,SEQ ID NO: 15, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 15,SEQ ID NO: 10 or a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 10, preferably encoding a functional mini-ATP7b polypeptide, such as a mini-ATP7b polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%70%, 80%, 90%, 100%or more Cu-transporting ability of the polypeptide of SEQ ID NO: 11, and more preferably encoding SEQ ID NO: 11; andSEQ ID NO: 18, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 18.In some embodiments, the expression construct comprises, in the order of 5’ to 3’, an enhancer a promoter, a polynucleotide of interest encoding mini-ATP7b (such as MBD3-5-6 and MBD3T-5-6 of SEQ ID NO: 9 and 11, respectively) , and a polyadenylation signal sequence. In some embodiments, the expression construct does not comprise an intron.In some embodiments, the expression construct comprises, in the order of 5’ to 3’,SEQ ID NO: 12 or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 12,SEQ ID NO: 13 or 14, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 13 or 14,SEQ ID NO: 8 or a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 8, preferably encoding a functional mini-ATP7b polypeptide, such as a mini-ATP7b polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%70%, 80%, 90%, 100%or more Cu-transporting ability of the polypeptide of SEQ ID NO: 9, and more preferably encoding SEQ ID NO: 9; andSEQ ID NO: 17 or 18, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 17 or 18.In some embodiments, the expression construct comprises, in the order of 5’ to 3’,SEQ ID NO: 12 or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 12,SEQ ID NO: 13 or 14, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 13 or 14,SEQ ID NO: 10 or a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 10, preferably encoding a functional mini-ATP7b polypeptide, such as a mini-ATP7b polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%70%, 80%, 90%, 100%or more Cu-transporting ability of the polypeptide of SEQ ID NO: 11, and more preferably encoding SEQ ID NO: 11; andSEQ ID NO: 17 or 18, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 17 or 18.In some embodiments, the expression construct comprises, in the order of 5’ to 3’, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 2, and SEQ ID NO: 17. In some embodiments, the expression construct comprises, in the order of 5’ to 3’, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 3, and SEQ ID NO: 17. In some embodiments, the expression construct comprises, in the order of 5’ to 3’, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 4, and SEQ ID NO: 17. In some embodiments, the expression construct comprises, in the order of 5’ to 3’, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 5, and SEQ ID NO: 17. In some embodiments, the expression construct comprises, in the order of 5’ to 3’, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 6, and SEQ ID NO: 17.In some embodiments, the expression construct comprises, in the order of 5’ to 3’, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 2, and SEQ ID NO: 17. In some embodiments, the expression construct comprises, in the order of 5’ to 3’, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 3, and SEQ ID NO: 17. In some embodiments, the expression construct comprises, in the order of 5’ to 3’, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 4, and SEQ ID NO: 17. In some embodiments, the expression construct comprises, in the order of 5’ to 3’, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 5, and SEQ ID NO: 17. In some embodiments, the expression construct comprises, in the order of 5’ to 3’, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 6, and SEQ ID NO: 17.In some embodiments, the expression construct comprises, in the order of 5’ to 3’, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 2, and SEQ ID NO: 18. In some embodiments, the expression construct comprises, in the order of 5’ to 3’, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 3, and SEQ ID NO: 18. In some embodiments, the expression construct comprises, in the order of 5’ to 3’, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 4, and SEQ ID NO: 18. In some embodiments, the expression construct comprises, in the order of 5’ to 3’, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 5, and SEQ ID NO: 18. In some embodiments, the expression construct comprises, in the order of 5’ to 3’, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 6, and SEQ ID NO: 18.In some embodiments, the expression construct comprises, in the order of 5’ to 3’, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 2, and SEQ ID NO: 18. In some embodiments, the expression construct comprises, in the order of 5’ to 3’, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 3, and SEQ ID NO: 18. In some embodiments, the expression construct comprises, in the order of 5’ to 3’, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 4, and SEQ ID NO: 18. In some embodiments, the expression construct comprises, in the order of 5’ to 3’, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 5, and SEQ ID NO: 18. In some embodiments, the expression construct comprises, in the order of 5’ to 3’, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 6, and SEQ ID NO: 18.In some embodiments, the expression construct comprises, in the order of 5’ to 3’, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 8, and SEQ ID NO: 17. In some embodiments, the expression construct comprises, in the order of 5’ to 3’, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 8, and SEQ ID NO: 18.In some embodiments, the expression construct comprises, in the order of 5’ to 3’, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 10, and SEQ ID NO: 17. In some embodiments, the expression construct comprises, in the order of 5’ to 3’, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 10, and SEQ ID NO: 18.In some embodiments, the expression construct comprises, in the order of 5’ to 3’, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 8, and SEQ ID NO: 17. In some embodiments, the expression construct comprises, in the order of 5’ to 3’, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 8, and SEQ ID NO: 18.In some embodiments, the expression construct comprises, in the order of 5’ to 3’, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 10, and SEQ ID NO: 17. In some embodiments, the expression construct comprises, in the order of 5’ to 3’, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 10, and SEQ ID NO: 18.The present invention also provides a method for preparing the rAAV. In some embodiments, the rAAV is prepared by a system containing a transgene plasmid comprising the genome of the rAAV, a packaging plasmid encoding the REP and / or CAP proteins, and a helper plasmid, e.g., a host cell such as a mammalian cell comprising the transgene plasmid comprising the genome of the rAAV, the packaging plasmid encoding the REP and / or CAP proteins, and the helper plasmid. Therefore, the present invention also provides a vector such as a plasmid comprising the genome of the rAAV of the invention.In some embodiments, the rAAV can be packaged as described in Crosson SM et al.

[0012] .The present invention further provides a vector comprising the genome of the rAAV, wherein the genome of rAAV comprises the expression construct of the invention flanked by 5’ and 3’ ITRs. In some embodiments, the vector is a transgene plasmid for the packaging of rAAV. In some embodiments, the 5’ ITR comprises SEQ ID NO: 19. In some embodiments, the 3’ ITR comprises SEQ ID NO: 20.In some embodiments, the genome of the rAAV comprises, in the order of 5’ to 3’, SEQ ID NO: 19, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 2, SEQ ID NO: 17 and SEQ ID NO: 20. In some embodiments, the genome of the rAAV comprises, in the order of 5’ to 3’, SEQ ID NO: 19, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 3, SEQ ID NO: 17 and SEQ ID NO: 20. In some embodiments, the genome of the rAAV comprises, in the order of 5’ to 3’, SEQ ID NO: 19, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 4, SEQ ID NO: 17 and SEQ ID NO: 20. In some embodiments, the genome of the rAAV comprises, in the order of 5’ to 3’, SEQ ID NO: 19, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 5, SEQ ID NO: 17 and SEQ ID NO: 20. In some embodiments, the genome of the rAAV comprises, in the order of 5’ to 3’, SEQ ID NO: 19, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 6, SEQ ID NO: 17 and SEQ ID NO: 20.In some embodiments, the genome of the rAAV comprises, in the order of 5’ to 3’, SEQ ID NO: 19, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 2, SEQ ID NO: 17 and SEQ ID NO: 20. In some embodiments, the genome of the rAAV comprises, in the order of 5’ to 3’, SEQ ID NO: 19, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 3, SEQ ID NO: 17 and SEQ ID NO: 20. In some embodiments, the genome of the rAAV comprises, in the order of 5’ to 3’, SEQ ID NO: 19, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 4, SEQ ID NO: 17 and SEQ ID NO: 20. In some embodiments, the genome of the rAAV comprises, in the order of 5’ to 3’, SEQ ID NO: 19, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 5, SEQ ID NO: 17 and SEQ ID NO: 20. In some embodiments, the genome of the rAAV comprises, in the order of 5’ to 3’, SEQ ID NO: 19, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 6, SEQ ID NO: 17 and SEQ ID NO: 20.In some embodiments, the genome of the rAAV comprises, in the order of 5’ to 3’, SEQ ID NO: 19, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 2, SEQ ID NO: 18 and SEQ ID NO: 20. In some embodiments, the genome of the rAAV comprises, in the order of 5’ to 3’, SEQ ID NO: 19, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 3, SEQ ID NO: 18 and SEQ ID NO: 20. In some embodiments, the genome of the rAAV comprises, in the order of 5’ to 3’, SEQ ID NO: 19, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 4, SEQ ID NO: 18 and SEQ ID NO: 20. In some embodiments, the genome of the rAAV comprises, in the order of 5’ to 3’, SEQ ID NO: 19, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 5, SEQ ID NO: 18 and SEQ ID NO: 20. In some embodiments, the genome of the rAAV comprises, in the order of 5’ to 3’, SEQ ID NO: 19, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 6, SEQ ID NO: 18 and SEQ ID NO: 20.In some embodiments, the genome of the rAAV comprises, in the order of 5’ to 3’, SEQ ID NO: 19, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 2, SEQ ID NO: 18 and SEQ ID NO: 20. In some embodiments, the genome of the rAAV comprises, in the order of 5’ to 3’, SEQ ID NO: 19, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 3, SEQ ID NO: 18 and SEQ ID NO: 20. In some embodiments, the genome of the rAAV comprises, in the order of 5’ to 3’, SEQ ID NO: 19, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 4, SEQ ID NO: 18 and SEQ ID NO: 20. In some embodiments, the genome of the rAAV comprises, in the order of 5’ to 3’, SEQ ID NO: 19, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 5, SEQ ID NO: 18 and SEQ ID NO: 20. In some embodiments, the genome of the rAAV comprises, in the order of 5’ to 3’, SEQ ID NO: 19, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 6, SEQ ID NO: 18 and SEQ ID NO: 20.In some embodiments, the genome of the rAAV comprises, in the order of 5’ to 3’, SEQ ID NO: 19, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 8, SEQ ID NO: 17 and SEQ ID NO: 20. In some embodiments, the genome of the rAAV comprises, in the order of 5’ to 3’, SEQ ID NO: 19, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 8, SEQ ID NO: 18 and SEQ ID NO: 20.In some embodiments, the genome of the rAAV comprises, in the order of 5’ to 3’, SEQ ID NO: 19, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 10, SEQ ID NO: 17 and SEQ ID NO: 20. In some embodiments, the genome of the rAAV comprises, in the order of 5’ to 3’, SEQ ID NO: 19, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 10, SEQ ID NO: 18 and SEQ ID NO: 20.In some embodiments, the genome of the rAAV comprises, in the order of 5’ to 3’, SEQ ID NO: 19, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 8, SEQ ID NO: 17 and SEQ ID NO: 20. In some embodiments, the genome of the rAAV comprises, in the order of 5’ to 3’, SEQ ID NO: 19, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 8, SEQ ID NO: 18 and SEQ ID NO: 20.In some embodiments, the genome of the rAAV comprises, in the order of 5’ to 3’, SEQ ID NO: 19, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 10, SEQ ID NO: 17 and SEQ ID NO: 20. In some embodiments, the genome of the rAAV comprises, in the order of 5’ to 3’, SEQ ID NO: 19, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 10, SEQ ID NO: 18 and SEQ ID NO: 20.The present invention also provides a pharmaceutical composition comprising the rAAV. Pharmaceutical compositions containing the AAV of the invention can be formulated in any conventional manner by mixing a selected amount of the rAAV with one or more pharmaceutically acceptable carriers or excipients.Selection of the carrier or excipient is within the skill of the administering professional and can depend upon a number of parameters. These include, for example, the mode of administration (i.e., systemic, oral, local, topical or any other mode) and the disease to be treated. Pharmaceutical carriers or vehicles suitable for administration of the rAAV provided herein include any such carriers known to those skilled in the art to be suitable for the particular mode of administration.In some embodiments, the pharmaceutical composition is formulated for parenteral administration, e.g., intravenous, intramuscular, or subcutaneous injection. In some embodiments, the pharmaceutical composition is formulated for local administration.The inventors found that the pharmaceutical composition of the present invention can achieve a desired safety, e.g., when being administered by intravenous injection.The present invention further provides a host cell comprising the polynucleotide, the expression construct, and / or the vector of the present invention. In some embodiment, the host cell is a mammalian cell, such as a human cell. In some embodiment, the host cell is 293-VPC cell.5. Treatment of diseasesThe present invention provides a method of treating a disease associated with the deficiency of ATP7b, comprising administering the rAAV or the pharmaceutical composition of the present invention to a subject in need thereof. In some embodiments, the disease is Wilson disease. In some embodiments, the rAAV or the pharmaceutical composition is administered by intravenous injection.The present invention further provides use of the polynucleotide, the expression construct, the rAAV, the pharmaceutical composition, the vector or the host cell of the present invention in the preparation of a medicament for treating a disease associated with the deficiency of ATP7b in a subject in need thereof. In some embodiments, the disease is Wilson disease. In some embodiments, the medicament is administered by intravenous injection.Provided is the rAAV and / or the pharmaceutical composition of the present invention, for use in the treatment of a disease associated with the deficiency of ATP7b in a subject in need thereof. In some embodiments, the disease is Wilson disease. In some embodiments, the rAAV and / or the pharmaceutical composition is administered by intravenous injection.In some embodiments, the treatment increases the Cu transport in the subject. In some embodiments, the treatment increases the Cu transport in liver and / or central neural system. In some embodiments, the treatment reduces the death of neurons.In some embodiments, the subject is a human.In some embodiments, the treatment cures, improves, alleviates, blocks or partially blocks the symptoms of Wilson disease.ExamplesThe following Examples are provided for illustration only, rather than for any limitation to the present application.Example 1. Preparation of rAAVs6 constructs comprising the genomes of rAAVs comprising a codon-optimized coding sequence for mini-ATP7bwere prepared by Gibson Assembling the ApoE enhancer (SEQ ID NO: 12) , the hAAT promoter (SEQ ID NO: 13) , a chimeric intron (SEQ ID NO: 15) , coding sequence (one of the codon-optimized sequences of SEQ ID NOs: 2-6, or non-optimized sequence of SEQ ID NO: 1) , rabbit globin polyA signal sequence (SEQ ID NO: 17) and ITRs (SEQ ID NOs: 19 and 20) in the backbone of pGCB108 plasmid. The structure of the constructs is shown in Fig. 1. The transgene plasmids were referred to as WT, Co1, Co2, Co3, Co4, and Co5 (comprising SEQ ID NO: 1, 2, 3, 4, 5, and 6, respectively) and the map of the transgene plasmid is shown in Fig. 2A.rAAV vectors were prepared with a method similar to that described in Crosson SM et al. 2018. Briefly, 3E6 cells / ml 293VPC cells (Thermo, Catalog A35347) in serum free virus production medium OPM-293 CD05 (Shanghai OPM Biosciences Co. Ltd. Catalog: 81075-001) were triple transfected, using polyethylenimine, with the helper plasmid, the packaging plasmid encoding rep / cap, and the transgene plasmid below:- helper plasmid ( “pHelper” containing the Ad E2A, E4, and VA RNA helper genes as described in Crosson Sm et al., the map thereof is shown in Fig. 2B) ;- packaging plasmid, the map thereof is shown in Fig. 2C, in which “AAV5 Cap” is the nucleotide sequence encoding the Cap polypeptide of AAV5 (SEQ ID NO: 21) , and “AAV2 Rep” is the nucleotide sequence encoding the Rep polypeptide of AAV2 (SEQ ID NO: 22) ;- transgene plasmid, those constructed above.Following 72 h incubation at 37℃, cells were harvested, and viral particles were purified through an iodixanol gradient (see Crosson SM et al. ) .The resulted rAAVs were named with the transgene plasmid and serotype (i.e., WT-AAV5, Co1-AAV5, Co2-AAV5, Co3-AAV5, Co4-AAV5, and Co5-AAV5) , and were tested for titers by ddPCR, which were all at the level of 1013 viral genomes (vg)  / mL. In particular, the ddPCR was carried out with Bio-Rad’s QXDx AutoDG ddPCR System and QXDx Universal Kit for AutoDG ddPCR System according to the manufacturer’s instructions. The primers and probe for the ddPCR are as follows:Example 2. Expression of mini-ATP7b by the rAAVsThis Example was carried out to verify the expression of ATP7b contained in the rAAVs as prepared in Example 1, and the results showed an increased expression of the mini-ATP7b in the rAAVs comprising the codon-optimized coding sequence for mini-ATP7b of the present invention.The rAAVs as prepared in Example 1 were infected into HepG2 cells with the MOI of 5E4 for 48 hours at 37℃.The infected cells were counted, and then, lysed by M-PERTM Mammalian Protein Extraction Reagent (Thermo Fisher, Catalog number: 78501) . Equal amounts of lysates (10μg) were loaded on a SDS-PAGE Gel, and run at 200V for 22min. The proteins were transferred onto a PVDF membrane using2 Gel Transfer Device (Thermo Fisher Scientific) and2 Transfer Stack (PVDF, regular size) according to the manufacturer’s instructions. After one hour incubation with a blocking buffer (8%milk in 1XTBST) , and rinse for 3 times (1min / rinse) , the membranes were probed with primary antibodies Rabbit ATP7B Polyclonal Antibody (1: 1000, Invitrogen, Catalog #PA5-122222) , 4℃, overnight in the same buffer, followed by rinse for 3 times (1min / rinse) , and then, the incubation with800CW Donkey anti-Rabbit IgG (H + L) , (Licor, P / N: 926-32213) for 2h, RT. α-Tubulin served as housekeeping control for quantitation of the ATP7b relative expression. Immunoreaction was visualized using LicorDLx Imaging System. Image acquisition, organization, and analysis were performed on scanned images using the EmpiriaSoftware paired with Odyssey DLx Imager. The image of the Western Blot was shown in Fig. 3.The viral genomes in the samples were measured as described in Example 1, and the relative expressions of mini-ATP7b to viral genomes per cell (VG / cell, which was calculated using housekeeping gene as per cell normalization) were shown in Table 1.Table 1. Relative expression of ATP7b to VG / cellAs shown in Fig. 3 and Table 1, the codon optimization indeed worked and rAAVs comprising the coding sequence of SEQ ID NO: 2, 4 or 6 (rAAVs Co1-AAV5, Co3-AAV5 and Co5-AAV5) showed higher relative expressions than non-optimized coding sequence, about 2 to 2.5 folds higher than the rAAV comprising SEQ ID NO: 1 (WT-AAV5) .Example 3. In vivo expression of mini-ATP7b by the rAAVs in WT miceThis Example was carried out to evaluate the in vivo expression of mini-ATP7b by the rAAVs as prepared in Example 1.The rAAVs in DPBS were injected to C57BL / 6 rice (6-to 8-week-old) with a single IV dose of 1E13 vg / kg, while the mice injected with DPBS were employed as control (200μL / mouse, n=6, 3 males + 3 females) . The livers of the mice were collected at day 28 post-injection for the evaluation of mini-ATP7b protein levels.The liver tissue was lysed with T-PERTM Tissue Protein Extraction Reagent (Thermo, Catalog number: 78510) , 100μl T-per with proteinase inhibitor (PierceTM Protease Inhibitor Mini Tablets, EDTA-free, Catalog number: A32955) was added to the frozen tissue, then follow the instructions of Catalog number: 78510.50μg of tissue lysates were loaded for the SDS-PAGE and subsequent Western Blot analysis as described in Example 2. The results were shown in Fig. 4 and Table 2.Table 2. Quantification of Western BlotThe viral genomes (VG) in the tissue lysates were measured as described in Example 1, and the relative expression of mini-ATP7b to VG was shown in Table 3.Table 3. Relative expression of mini-ATP7b to VGIt can be seen that rAAVs comprising the coding sequence of SEQ ID NO: 2, 4 or 6 (rAAVs Co1-AAV5, Co3-AAV5 and Co5-AAV5) showed higher relative expressions than non-optimized coding sequence (the rAAV WT-AAV5) , and Co3-AAV5 achieved higher expression both in vitro and in vivo.Example 4. In vivo expression of mini-ATP7b by the rAAVs in a WD modelThis Example was carried out to investigate the expression level of mini-ATP7b by rAAVs in the ATP7b knockout (KO) mice (WD model, Atp7b- / -) .The Atp7b- / -mouse model used in this study was developed by Buiakova et al. 10 129S6 / SvEv Atp7b- / -males were crossed with C57BL / 6J WT females, followed by embryo transfer into recipient female mice. Atp7b+ / -heterozygous mice (maintained on a mixed 129S6 / SvEv x C57BL / 6J genetic background) were bred in Shanghai Model Organisms Center, Inc. and used to generate Atp7b- / -and Atp7b+ / + mice. The Atp7b- / -mice were generated by breeding, genotyping according to protocols approved by the ethics committees, the veterinary authorities of shanghai public health department.The male ATP7b KO mice (7-week old) were injected with rAAV Co3-AAV5 at a single IV dose of 1E13 or 3E13 vg / kg in 200 μL DPBS (n=10) , mice injected with 200 μL DPBS were used as control (n=5) .Blood was collected on the day of injection and 28 days after the injection. The liver tissue was collected 28 days after the injection from the injected mice to assess mini-ATP7b protein levels by Western Blot similar to that described in Example 2 with miniATP7b overexpressed cell lysate as positive control and GAPDH as reference.As shown in Fig. 5, the ATP7b KO mice injected with rAAV Co3-AAV5 showed a dose-dependent ATP7b expression in liver.The liver samples were also IHC stained for ATP7b, and H&E stained for detecting the inflammation. The liver samples were also tested for copper accumulation. The copper content in the sample was determined by inductively coupled plasma (Agilent ICP-OES 730) . Samples were prepared according to the manufacturer’s instructions. Briefly, pieces of tissue (such as liver) were weighed and digested in HNO3 and H2O2 at 180 ℃. The digested samples were diluted with deionized water and measured directly with ICP.Immunohistochemistry (IHC) was performed using the IHC Automatic Staining System (Leica Bond RX) with a standard protocol for paraffin section. The slides were dewaxed and followed by antigen retrieval with ER2 (AR9640, Leica) at 100℃ for 20 min. The slides were rinsed and blocked with peroxide at room temperature for 5 min, followed by washing slides with Wash buffer (Leica) for 30 sec, which was repeated for 4 times. The diluted primary antibody (anti-ATP7b, ab124973, abcam) was added onto each slide which was then incubated at room temperature for 40 mins. The slides were washed with Wash Buffer (Leica) and then incubated with Polymer (Leica) at room temperature for 8mins. The slides were washed and incubated with DAB solution at room temperature for 10 mins. The slides were counterstained with Hematoxylin for 10 min after rinsing with water. Finally, the mounted slides were scanned with a Slide Scanner (Aperio GT450 DX, Leica) .H&E staining was performed using Leica Automatic Staining System ST5010 with the standard protocol. The slides were mounted using Leica Cover Slip System (Leica CV5030) . Images were acquired by a Slide Scanner (Aperio GT450 DX, Leica) .Sera were separated from the blood samples, and seral ceruloplasmin was detected. In brief, seral proteins were precipitated by adding 100μl saturated ammonium sulfate solution (～4.1M) to 100μl serum, and the supernatant was removed after a centrifugation at 10,000 rpm for 5 min at room temperature. The pellets were resuspended in 160μl 0.1 M sodium acetate buffer (pH5.0) and transferred to a non-binding clear 96-well plate. 20 μl of the suspension was mixed with 80 μl of dimethoxybenzidine dihydrochloride (o-dianisidine; TCI) solution with a final concentration of o-dianisidine at 2.5 mg / ml. The mixture was incubated at 30 ℃ for 90 min for reaction, which was then stopped by adding 50μl of 9 M sulfuric acid. Absorbance at 540 nm was measured within 20 minutes from the endpoint.As shown in Fig. 6, AAV5 transduced the Hepatocytes in ATP7b KO mice and human ATP7b protein was widely expressed in hepatocytes in dose dependent manner.As shown in Fig. 7, no inflammation was observed at both doses.As shown in Fig. 8, miniATP7b expression in liver alleviated hepatic copper accumulation, restored the serum ceruloplasmin activity.Example 5. Design and Test of New ATP7b VariantsThis Example was carried out to test new ATP7b variant in vitro and in vivo.The transgene plasmids were constructed as described in Example 1 with the coding sequence altered to SEQ ID NO: 8 or 10 (referred to as MBD3-5-6, and MBD3T-5-6) . The rAAVs were prepared as described in Example 1 with the transgene plasmids above. Further, the transgene plasmids Co3 (also referred to as MBD5-6 hereinafter) , MBD3-5-6, and MBD3T-5-6 were also used to prepare rAAVs with a similar method in which the packaging plasmid encoding AAV6 capsid (SEQ ID NO: 23, see Fig. 2D) . The resulted rAAVs were shown in Table 4.Table 4The HepG2 cells were infected with the rAAVs listed in Table 4 to test the expression of ATP7b as described in Example 2.As shown in Fig. 9, the rAAVs of AAV6 showed a higher expression of ATP7b than the rAAVs of AAV5, and the rAAVs comprising SEQ ID NO: 8 or 10 showed a lower expression of ATP7b than those comprising SEQ ID NO: 4.The rAAVs were also injected into male ATP7b KO mice at a dose 3E13 vg / kg in 200 μL DPBS (n=10) , mice injected with 200 μL DPBS were used as control (n=5) . The expression of ATP7b and copper accumulation in liver was detected as described in Example 4. The results were shown in Figs. 10-12 and Table 5.Table 5As shown in Fig. 10, the expression of ATP7b by the rAAVs in ATP7b KO mice was similar to the expression in HepG2 cells, i.e., the rAAVs of AAV6 showed a higher expression of ATP7b than the rAAVs of AAV5, and the rAAVs comprising SEQ ID NO: 8 or 10 showed a lower expression of ATP7b than those comprising SEQ ID NO: 4.As shown in Table 5, the higher expression by rAAVs of AAV6 was associated with higher level of virus in liver tissue.As shown in Fig. 11, all treated groups showed good transduction efficacy, as reflected on the great ATP7b expression in hepatocytes, while AAV6 showed better transduction efficacy compare with AAV5.As shown in Fig. 12, the over-expression of human truncated ATP7b (mini-ATP7b) in the liver of WD model alleviated hepatic copper accumulation, and restored the serum ceruloplasmin activity.Example 6. Optimization of the Genome of rAAVThis Example was carried out to identify the elements for reducing the size of rAAV genome encoding ATP7b MBD3-5-6 and providing an improved expression of ATP7b.6.1. Construction of modified transgene plasmidsThe modified transgene plasmids were constructed by replacing elements, such as promoter, intron and polyA signal, in plasmid Co3 by Gibson Assembling. The elements in Plasmid 11 and the modified transgene plasmids were shown in Table 6.Table 6. The modified transgene plasmids6.2. Preparation of rAAVsrAAVs were prepared with a method similar to that described in Example 1 with the modified transgene plasmids in Table 6, and the resulted rAAVs were named with the plasmid and serotype, i.e., MBD3-5-6-1-AAV5, MBD3T-5-6-1-AAV5, MBD3T-5-6-2-AAV5, MBD3-5-6-2-AAV5, MBD3T-5-6-3-AAV5, MBD3T-5-6-4-AAV5, MBD3-5-6-3-AAV5, MBD3T-5-6-5-AAV5, MBD3-5-6-1-AAV6, MBD3T-5-6-1-AAV6, MBD3T-5-6-2-AAV6, MBD3-5-6-2-AAV6, MBD3T-5-6-3-AAV6, MBD3T-5-6-4-AAV6, MBD3-5-6-3-AAV6, and MBD3T-5-6-5-AAV6.6.3. Expression of ATP7b in cellsHepG2 cells were infected with the rAAVs prepared in Example 6.2 as well as MBD5-6-AAV5, MBD3-5-6-AAV5, and MBD3T-5-6-AAV5, and the expression of ATP7b was detected as described in Example 2.As shown in Fig. 13, the rAAVs MBD3-5-6-2-AAV5, MBD3T-5-6-3-AAV5, and MBD3-5-6-3-AAV5 showed a higher expression of ATP7b, indicating that the promoter of SEQ ID NO: 14 and / or the polyA signal sequence of SEQ ID NO: 18 contribute to the increased expression, even with the intron removed.6.4. In vitro metal-responsive element luciferase reporter assay for copper transport activityThe copper transport activity was used to determine whether the truncated three ATP7b transgene alters the functionality of the protein. The four rAAVs, MBD3-5-6-2-AAV6, MBD3T-5-6-4-AAV6, MBD3-5-6-3-AAV6 and MBD5-6-AAV6 (the control) were added to human HepG2 cells at an MOI of 3E6 which were co-transfected with a reporter plasmid expressing luciferase under the control of a metal-inducible promoter (pGL4.40 [luc2P / MRE / Hygro] , Promega, E4131) and a normalization plasmid Renilla luciferase (pGL4.75 [hRluc / CMV] , Promega, E6931) .As shown in Fig. 14, all of rAAVs MBD3-5-6-2-AAV6, MBD3T-5-6-4-AAV6, MBD3-5-6-3-AAV6 and MBD5-6-AAV6 showed no elevation of luciferase signal in response to copper, in contrast with cells without AAV infection cells. These results indicate that all the four versions of mini-ATP7b were acting as copper transporters with the similar capacity to eliminate the excess copper.6.5. In vivo expression of mini-ATP7b by the rAAVsrAAVs were also prepared with transgene plasmids MBD3-5-6-2, MBD3T-5-6-4 and MBD3-5-6-3, respectively, and the packaging plasmid encoding AAV6 capsid as described in Example 1 (MBD3-5-6-2-AAV6, MBD3T-5-6-4-AAV6 and MBD3-5-6-3-AAV6) .The rAAVs (MBD5-6-AAV5 (G2) , MBD3-5-6-2-AAV5 (G3) , MBD3T-5-6-4-AAV5 (G4) , MBD3-5-6-3-AAV5 (G5) , MBD5-6-AAV6 (G6) , MBD3-5-6-2-AAV6 (G7) , MBD3T-5-6-4-AAV6 (G8) and MBD3-5-6-3-AAV6 (G9) ) were IV injected (single dose) into male ATP7b KO mice (6-week old) at a dose of 5E12 vg / kg in 200 μL DPBS (n=7) , ATP7b KO mice injected with 200 μL DPBS (G1) and WT mice were used as control (n=5, respectively ) .On Day 28 post injection, the plasma, and liver were collected and tested as described in Example 4.In addition, the mRNA transcribed from the transgene was detected by qPCR. In brief, the RNA was isolated with RNeasy Mini Kit (QIAGEN 74106) , QIAzol Lysis Reagent (QIAGEN 79306) and Buffer RWT (QIAGEN 1067933) according to the manufacturer’s instructions, and were reverse-transcribed with HiScript III All-in-one RT SuperMix Perfect for qPCR (Vazyme R333-01) . The qPCR was carried out with TaqManTM Gene Expression Master Mix (Thermo4369016) , Ultra PureTM Distilled Water (Invitrogen 10977-015) , and the following primers and probe. GAPDH was used as housekeeping reference.ApoE-F AGCAGCAAACAGCAAACAC (SEQ ID NO: 24)ApoE-R CCTCTCCACCGAAATTCCAA (SEQ ID NO: 25)ApoE-Probe 5′-6-FAM-ATGCCACCT / ZEN / CCAACATCCACTCG-Iowa Black FQ-3′ (SEQ ID NO: 26)M_GAPDH-F CCACTCACGGCAAATTCAAC (SEQ ID NO: 27)M_GAPDH-R ACCAGTAGACTCCACGACATA (SEQ ID NO: 28)M_GAPDH-P 5’ -VIC-TTGTCATCAACGGGAAGCCCATCA -MGB-3’ (SEQ ID NO: 29)As shown in Fig. 15, the average AAV distribution (vg / cell) in liver was similar between AAV5 and AAV6. Certainly, the benchmark (MBD5-6) had a slightly higher vg / cell, ATP7b mRNA, and ATP7b protein. AAV6 had a higher ATP7b mRNA, and ATP7b protein than AAV5, indicating that AAV6 is more potent in terms of copper reduction and increasing ceruloplasmin activity than AAV5. The hepatic copper levels of G6-G9 were comparable, and were lower than that of G1-G5 (see Table 7 below) .Table 7. Quantification of hepatic copper (μg / g)As shown in Fig. 16, the percentage of positive cell (as counted with Mutiplex IHC module of Halo program) in tissues from mice injected with AAV6 was higher than AAV5, and the percentage of positive cell in tissues from G9 is comparable with G6.

Claims

1.A polynucleotide comprising a first segment comprising residues 169-3126 of SEQ ID NO: 2, 3, 4, 5 or 6.2.The polynucleotide of claim 1, further comprising a second segment comprising residues 1-168 of SEQ ID NO: 2, 3, 4, 5 or 6.3.The polynucleotide of claim 1 or 2, further comprising a third segment comprising residues 169-495 of SEQ ID NO: 8 or residues 169-393 of SEQ ID NO: 10, preferably between the first and second segment.4.The polynucleotide of any of claims 1-3, comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 4, 8 or 10.5.An expression construct comprising the polynucleotide of any of claims 1-4 operably linked to a promoter, preferably comprising a nucleotide sequence of SEQ ID NO: 13 or 14.6.The expression construct of claim 5, further comprising an enhancer, preferably comprising a nucleotide sequence of SEQ ID NO: 12.7.The expression construct of claim 5 or 6, further comprising a polyAsignal sequence, preferably comprising a nucleotide sequence of SEQ ID NO: 17 or 18.8.The expression construct of any of claims 5-7, further comprising an intron, preferably comprising a nucleotide sequence of SEQ ID NO: 15 or 16.9.A vector comprising the polynucleotide of any of claims 1-4 or the expression construct of any of claims 5-8.10.A recombinant adeno-associated virus (rAAV) comprising a genome comprising an expression construct of any of claims 5-8.11.The rAAV of claim 10, wherein the rAAV is hAAV6.12.The rAAV of claim 10 or 11, wherein the genome comprises 5’ and 3’ ITRs, preferably comprising SEQ ID NOs: 19 and 20, respectively.13.A host cell comprising the polynucleotide of claim any of claims 1-4, the expression construct of any of claims 5-8, the vector of claim 9 or the rAAV of any of claims 10-12.14.A pharmaceutical composition comprising the rAAV of any of claims 10-12.15.A method of treating a disease associated with the deficiency of copper transport comprising administering the rAAV of any of claims 7-9 or the pharmaceutical composition of claim 14.16.The method of claim 15, wherein the disease is Wilson disease.

Images