Dosing regimes and combination therapies using archexin for the treatment of cancer

Abstract

Described herein are compositions, kits, and methods of treating or preventing cancer in a subject in need thereof. The methods can include administering a therapeutic effective amount of archexin, or pharmaceutically acceptable salts, prodrugs, or derivatives thereof to treat cancer without substantially inhibiting Akt-1.

Description

[0001] Attorney Docket No. 11650-002WO1 DOSING REGIMES AND COMBINATION THERAPIES USING ARCHEXIN FOR THE TREATMENT OF CANCER CROSS-REFERENCE TO RELATED APPLICATION This application claims priority to and the benefit of U.S. Provisional Application No.63 / 493,574, filed on March 31, 2023, the content of which is hereby incorporated in its entirety. REFERENCE TO SEQUENCE LISTING The Sequence Listing submitted March 21, 2024, as a text filed named “11650- 002PV1_2023_03_30_Sequence_Listing” created March 30, 2023, and having a file size of 2,629 bytes is hereby incorporated by reference pursuant to 37 C.F.R. § 1.52(e)(5). BACKGROUND AKT-1 (Archexin), a protein product of akt-1 proto-oncogene, plays a role in cancer progression by promoting cell proliferation and inhibiting apoptosis of cancer cells (see Revathidevi S, et al., Semin Cancer Biol.2019;59:80-91; and Uko NE, et al., Curr Top Med Chem.2020;20(10):883-900). Archexin is a fully phosphorothioated 20-mer antisense oligonucleotide, which can specifically bind to AKT-1 mRNA resulting in RNase H-based AKT-1 downregulation. Archexin inhibits AKT-1 mRNA translation and inhibits tumor growth. The current clinical treatment for advanced renal cancer patients involves a combination of 18 mg Lenvatinib and 5 mg Everolimus per day (see Lenvima (lenvatinib) [prescribing information], Woodcliff Lake, NJ:Eisai Inc.; 2020). However, due to the severe side effects of Lenvatinib, the dose is often reduced to 14 mg (see Pal SK, et al., Assessing the Safety and Efficacy of Two Starting Doses of Lenvatinib Plus Everolimus in Patients with Renal Cell Carcinoma: A Randomized Phase 2 Trial. Eur Urol. 2022 Sep;82(3): 283-292. Epub 2022 Feb 21, and Bergerot C., et al., Oncologist.2023; 28(1):59-71). Therefore, there is a need for treatments with enhanced therapeutic efficacy and reduced adverse reactions. The compositions and methods disclosed herein address these and other needs. Attorney Docket No. 11650-002WO1 SUMMARY Described herein are methods of treating cancer, preventing cancer, preventing cancer metastasis, and / or preventing cancer recurrence in a subject in need thereof including administering a therapeutic effective amount of Archexin, or a pharmaceutically acceptable salt thereof, to the subject to treat the cancer. In some embodiments, the therapeutically effective amount does not substantially inhibit Akt-1 expression in the subject. Described herein are also methods of stimulating an immune response in a subject, the method including administering to the subject an immunosImulatory amount of Archexin, or a pharmaceuIcally acceptable salt thereof. In some embodiments, the immunostimulatory amount does not substantially inhibit Akt-1 expression in the subject. In some embodiments, the method further includes administering everolimus, or a pharmaceutically acceptable salt, prodrug, or derivative thereof; lenvatinib, or a pharmaceutically acceptable salt, prodrug, or derivative thereof; or any combination thereof to the subject. In some embodiments, the method further includes administering everolimus, or a pharmaceutically acceptable salt, prodrug, or derivative thereof, and lenvatinib, or a pharmaceutically acceptable salt, prodrug, or derivative thereof, to the subject. Described herein are also kits and compositions including Archexin, or a pharmaceutically acceptable salt thereof; and Everolimus, or a pharmaceutically acceptable salt thereof, Lenvatinib, or a pharmaceutically acceptable salt thereof, or any combination thereof. BRIEF DESCRIPTION OF THE FIGURES Figure 1 shows the effects of test articles on mice body weight in Caki-1 model. Figure 2 shows the effects of test articles on mice body weight Change in Caki-1 model. Figure 3 shows the effects of test articles on tumor volume in Caki-1 model. Figure 4 shows the body weight changes after administering test articles to female Balb / c mice bearing Renca-luc tumor. Data points represent group mean body weight. Error bars represent standard error of the mean (SEM). Figure 5 shows the percentage of body weight change of the Renca-luc syngeneic. BW change was calculated based on animal weight on the first day of grouping. Data points represent percent group mean change in BW. Error bars represent standard error of the mean (SEM). Figure 6 shows the bioluminescence trace of female Balb / c mice bearing Renca-luc. Data points represent group mean bioluminescence. Error bars represent standard error of the mean (SEM). Attorney Docket No. 11650-002WO1 Figure 7 shows survival curve of RX-0201 combined with Lenvatinib and Everolimus in the treatment of murine renal cancer Renca-luc orthotopic model in the female Balb / c mice. Figure 8 shows a scheme of stage 1 of the 2-stage multi-center, open-label, randomized study to assess the safety, tolerability, and preliminary efficacy of HC-0201 in combination with Lenvatinib and Everolimus versus Lenvatinib plus Everolimus to treat subjects with advanced clear cell renal cell carcinoma. Figure 9 shows a scheme of stage 2of the 2-stage multi-center, open-label, randomized study to assess the safety, tolerability, and preliminary efficacy of HC-0201 in combination with Lenvatinib and Everolimus versus Lenvatinib plus Everolimus to treat subjects with advanced clear cell renal cell carcinoma. Figures 10A-10C show images of western blotting analysis of pPRAS40 expression in Caki-1 kidney tissues for Group 2 (Fig.10A), Group 3 (Fig.10B), and Group 4 (Fig.10C). Figures 11A-11C show images of western blotting analysis of Akt1 and pGSK-3β expression in Caki-1 kidney tissues for Group 2 (Fig.11A), Group 3 (Fig.11B), and Group 4 (Fig.11C). Figures 12A-12C show images of western blotting analysis of PTEN expression in Caki-1 kidney tissues for Group 2 (Fig.12A), Group 3 (Fig.12B), and Group 4 (Fig.12C). Figures 13A-13C show images of western blotting analysis of pAkt1 expression in Caki-1 kidney tissues for Group 2 (Fig.13A), Group 3 (Fig.13B), and Group 4 (Fig.13C). Figures 14A-14B show images of western blot analysis of Akt-1, pAkt-1, pPRAS40, pGSK-3β and PTEN expression in Caki-1 tumor tissues (Figure 14A) and Caki-1 kidney tissue (Figure 14B). Figure 15 shows images of western blot analysis of pAkt-1 expression in Caki-1 tumor tissues and kidney tissue. Figure 16 shows images of western blot analysis of pGSK-3β expression in Caki-1 tumor tissues and kidney tissue. Figure 17 shows images of western blot analysis of pAkt-1 and pGSK-3β expression in Caki-1 tumor tissues and kidney tissue. Figure 18 shows a graph of bioluminescence trace of female Balb / c mice bearing Renca-luc. Data points represent group mean bioluminescence. Error bars represent standard error of the mean (SEM). Figure 19 shows bioluminescence images. Figure 20 shows a scheme of treatment outline. Figure 21 shows a patient dose chart. Figures 22A-22D show plasma concentration of RX-0201 at different doses and over time. (22A) Attorney Docket No. 11650-002WO1 individual plasma RX-0201 concentrations on day 1 during cycle 1, at dose of 6, 12, 24, 48, and 96 mg / m2 / day. (22B) individual plasma RX-0201 concentrations on day 15 during cycle 1, at dose of 6, 12, 24, 48, and 96 mg / m2 / day. (22C) mean plasma RX-0201 concentrations on day 1 at dose of 192, 250, and 315 mg / m2 / day. (22D) mean plasma RX-0201 concentrations on day 15 at dose of 192, 250, and 315 mg / m2 / day. Figures 23A-23F show Immunohistochemistry images of tumor biopsy for (23A) breast carcinoma control, (23B) breast carcinoma, (23C) colon carcinoma, (23D) basal cell carcinoma, (23E) liver carcinoma, (23F) pancreas adenocarcinoma. Figures 24A and 24B. show graphs of plasma concentrations (24A) mean RX-0201 at day 1 (125 mg / m2 / day, 200 mg / m2 / day, 250 mg / m2 / day. (24B) mean RX-0201 at day 15 (125 mg / m2 / day, 200 mg / m2 / day, 250 mg / m2 / day. Figures 25A-25C show images of disease progression at different doses and cycles (25A) shows right adrenal lesion after 4 cycles of treatment at 125 mg / m2 / day. (25B) shows hypervascular mass just anterior to the nephrectomy bed at 200 mg / m2 / day after 2 cycles of treatment. (25C) lesions (RECIST v 1.1) after 2 cycles at 250 mg / m2 / day. (25D) single right hilar lesion after 2 cycles of treatment. Figure 26 shows a graph of progression free survival. DETAILED DESCRIPTION Before the present methods and systems are disclosed and described, it is to be understood that the methods and systems are not limited to specific synthetic methods, specific components, or to particular compositions. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting. As used in this specification and the following claims, the terms “comprise” (as well as forms, derivatives, or variations thereof, such as “comprising” and “comprises”) and “include” (as well as forms, derivatives, or variations thereof, such as “including” and “includes”) are inclusive (i.e., open-ended) and do not exclude additional elements or steps. For example, the terms "comprise" and / or "comprising," when used in this specification, specify the presence of stated features, integers, steps, operations, elements, and / or components, but do not preclude the presence or addition of one or more other features, integers, steps, operations, elements, components, and / or groups thereof. Other than where noted, all numbers expressing quantities of ingredients, reaction conditions, geometries, dimensions, and so forth used in the specification and claims are to be understood at the very least, and not as an Attorney Docket No. 11650-002WO1 attempt to limit the application of the doctrine of equivalents to the scope of the claims, to be construed in light of the number of significant digits and ordinary rounding approaches. Accordingly, these terms are intended to not only cover the recited element(s) or step(s), but may also include other elements or steps not expressly recited. Furthermore, as used herein, the use of the terms “a”, “an”, and “the” when used in conjunction with an element may mean “one,” but it is also consistent with the meaning of “one or more,” “at least one,” and “one or more than one.” Therefore, an element preceded by “a” or “an” does not, without more constraints, preclude the existence of additional identical elements. Ranges can be expressed herein as from “about” one particular value, and / or to “about” another particular value. By “about” is meant within 5% of the value, e.g., within 4, 3, 2, or 1% of the value. When such a range is expressed, another aspect includes from the one particular value and / or to the other particular value. Similarly, when values are expressed as approximations, by use of the antecedent “about,” it will be understood that the particular value forms another aspect. It will be further understood that the endpoints of each of the ranges are significant both in relation to the other endpoint, and independently of the other endpoint. It is also understood that there are a number of values disclosed herein, and that each value is also herein disclosed as “about” that particular value in addition to the value itself. For example, if the value “10” is disclosed, then “about 10” is also disclosed. A range may be construed to include the start and the end of the range. For example, a range of 10% to 20% (i.e., range of 10%-20%) can includes 10% and also includes 20%, and includes percentages in between 10% and 20%, unless explicitly stated otherwise herein. As used herein, the terms "may," "optionally," and "may optionally" are used interchangeably and are meant to include cases in which the condition occurs as well as cases in which the condition does not occur. Thus, for example, the statement that a formulation "may include an excipient" is meant to include cases in which the formulation includes an excipient as well as cases in which the formulation does not include an excipient. It is understood that when combinations, subsets, groups, etc. of elements are disclosed (e.g., combinations of components in a composition, or combinations of steps in a method), that while specific reference of each of the various individual and collective combinations and permutations of these elements may not be explicitly disclosed, each is specifically contemplated and described herein. As used here, the terms “beneficial agent” and “active agent” are used interchangeably herein to refer to a chemical compound or composition that has a beneficial biological effect. Beneficial biological effects include both therapeutic effects, i.e., treatment of a disorder or other undesirable Attorney Docket No. 11650-002WO1 physiological condition, and prophylactic effects, i.e., prevention of a disorder or other undesirable physiological condition. The terms also encompass pharmaceutically acceptable, pharmacologically active derivatives of beneficial agents specifically mentioned herein, including, but not limited to, salts, esters, amides, prodrugs, active metabolites, isomers, fragments, analogs, and the like. When the terms “beneficial agent” or “active agent” are used, then, or when a particular agent is specifically identified, it is to be understood that the term includes the agent per se as well as pharmaceutically acceptable, pharmacologically active salts, esters, amides, prodrugs, conjugates, active metabolites, isomers, fragments, analogs, etc. A "decrease" can refer to any change that results in a smaller amount of a symptom, disease, composition, condition, or activity. A substance is also understood to decrease the genetic output of a gene when the genetic output of the gene product with the substance is less relative to the output of the gene product without the substance. Also, for example, a decrease can be a change in the symptoms of a disorder such that the symptoms are less than previously observed. A decrease can be any individual, median, or average decrease in a condition, symptom, activity, composition in a statistically significant amount. Thus, the decrease can be a 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100% decrease so long as the decrease is statistically significant. "Inhibit," "inhibiting," and "inhibition" mean to decrease an activity, response, condition, disease, or other biological parameter. This can include but is not limited to the complete ablation of the activity, response, condition, or disease. This may also include, for example, a 10% reduction in the activity, response, condition, or disease as compared to the native or control level. Thus, the reduction can be a 10, 20, 30, 40, 50, 60, 70, 80, 90, 100%, or any amount of reduction in between as compared to native or control levels. “Inactivate”, “inactivating” and “inactivation” means to decrease or eliminate an activity, response, condition, disease, or other biological parameter due to a chemical (covalent bond formation) between the ligand and a its biological target. By “reduce” or other forms of the word, such as “reducing” or “reduction,” is meant lowering of an event or characteristic (e.g., tumor growth). It is understood that this is typically in relation to some standard or expected value, in other words it is relative, but that it is not always necessary for the standard or relative value to be referred to. For example, “reduces tumor growth” means reducing the rate of growth of a tumor relative to a standard or a control. As used herein, the terms “treating” or “treatment” of a subject includes the administration of a drug to a subject with the purpose of preventing, curing, healing, alleviating, relieving, altering, Attorney Docket No. 11650-002WO1 remedying, ameliorating, improving, stabilizing or affecting a disease or disorder, or a symptom of a disease or disorder. The terms “treating” and “treatment” can also refer to reduction in severity and / or frequency of symptoms, elimination of symptoms and / or underlying cause, prevention of the occurrence of symptoms and / or their underlying cause, and improvement or remediation of damage. By “prevent” or other forms of the word, such as “preventing” or “prevention,” is meant to stop a particular event or characteristic, to stabilize or delay the development or progression of a particular event or characteristic, or to minimize the chances that a particular event or characteristic will occur. Prevent does not require comparison to a control as it is typically more absolute than, for example, reduce. As used herein, something could be reduced but not prevented, but something that is reduced could also be prevented. Likewise, something could be prevented but not reduced, but something that is prevented could also be reduced. It is understood that where reduce or prevent are used, unless specifically indicated otherwise, the use of the other word is also expressly disclosed. For example, the terms “prevent” or “suppress” can refer to a treatment that forestalls or slows the onset of a disease or condition or reduced the severity of the disease or condition. Thus, if a treatment can treat a disease in a subject having symptoms of the disease, it can also prevent or suppress that disease in a subject who has yet to suffer some or all of the symptoms. As used herein, the term “preventing” a disorder or unwanted physiological event in a subject refers specifically to the prevention of the occurrence of symptoms and / or their underlying cause, wherein the subject may or may not exhibit heightened susceptibility to the disorder or event. By the term “effective amount” of a therapeutic agent is meant a nontoxic but sufficient amount of a beneficial agent to provide the desired effect. The amount of beneficial agent that is “effective” will vary from subject to subject, depending on the age and general condition of the subject, the particular beneficial agent or agents, and the like. Thus, it is not always possible to specify an exact “effective amount”. However, an appropriate “effective’ amount in any subject case may be determined by one of ordinary skill in the art using routine experimentation. Also, as used herein, and unless specifically stated otherwise, an “effective amount” of a beneficial can also refer to an amount covering both therapeutically effective amounts and prophylactically effective amounts. An “effective amount” of a drug necessary to achieve a therapeutic effect may vary according to factors such as the age, sex, and weight of the subject. Dosage regimens can be adjusted to provide the optimum therapeutic response. For example, several divided doses may be administered daily or the dose may be proportionally reduced as indicated by the exigencies of the therapeutic situation. Attorney Docket No. 11650-002WO1 As used herein, a “therapeutically effective amount” of a therapeutic agent refers to an amount that is effective to achieve a desired therapeutic result, and a “prophylactically effective amount” of a therapeutic agent refers to an amount that is effective to prevent an unwanted physiological condition. Therapeutically effective and prophylactically effective amounts of a given therapeutic agent will typically vary with respect to factors such as the type and severity of the disorder or disease being treated and the age, gender, and weight of the subject. The term “therapeutically effective amount” can also refer to an amount of a therapeutic agent, or a rate of delivery of a therapeutic agent (e.g., amount over time), effective to facilitate a desired therapeutic effect. The precise desired therapeutic effect will vary according to the condition to be treated, the tolerance of the subject, the drug and / or drug formulation to be administered (e.g., the potency of the therapeutic agent (drug), the concentration of drug in the formulation, and the like), and a variety of other factors that are appreciated by those of ordinary skill in the art. As used herein, the term “pharmaceutically acceptable” component can refer to a component that is not biologically or otherwise undesirable, i.e., the component may be incorporated into a pharmaceutical formulation of the invention and administered to a subject as described herein without causing any significant undesirable biological effects or interacting in a deleterious manner with any of the other components of the formulation in which it is contained. When the term “pharmaceutically acceptable” is used to refer to an excipient, it is generally implied that the component has met the required standards of toxicological and manufacturing testing or that it is included on the Inactive Ingredient Guide prepared by the U.S. Food and Drug Administration. "Pharmaceutically acceptable carrier" (sometimes referred to as a "carrier") means a carrier or excipient that is useful in preparing a pharmaceutical or therapeutic composition that is generally safe and non-toxic and includes a carrier that is acceptable for veterinary and / or human pharmaceutical or therapeutic use. The terms "carrier" or "pharmaceutically acceptable carrier" can include, but are not limited to, phosphate buffered saline solution, water, emulsions (such as an oil / water or water / oil emulsion) and / or various types of wetting agents. As used herein, the term "carrier" encompasses, but is not limited to, any excipient, diluent, filler, salt, buffer, stabilizer, solubilizer, lipid, stabilizer, or other material well known in the art for use in pharmaceutical formulations and as described further herein. Also, as used herein, the term “pharmacologically active” (or simply “active”), as in a “pharmacologically active” derivative or analog, can refer to a derivative or analog (e.g., a salt, ester, amide, conjugate, metabolite, isomer, fragment, etc.) having the same type of pharmacological activity as the parent compound and approximately equivalent in degree. Attorney Docket No. 11650-002WO1 A “control” is an alternative subject or sample used in an experiment for comparison purposes. A control can be "positive" or "negative." As used herein, by a “subject” is meant an individual. Thus, the “subject” can include domesticated animals (e.g., cats, dogs, etc.), livestock (e.g., cattle, horses, pigs, sheep, goats, etc.), laboratory animals (e.g., mouse, rabbit, rat, guinea pig, etc.), and birds. “Subject” can also include a mammal, such as a primate or a human. Thus, the subject can be a human or veterinary patient. The term “patient” refers to a subject under the treatment of a clinician, e.g., physician. Administration of the therapeutic agents can be carried out at dosages and for periods of time effective for treatment of a subject. In some embodiments, the subject is a human. The term “nucleic acid” as used herein means a polymer composed of nucleotides, e.g. deoxyribonucleotides or ribonucleotides. The terms “ribonucleic acid” and “RNA” as used herein mean a polymer composed of ribonucleotides. The terms “deoxyribonucleic acid” and “DNA” as used herein mean a polymer composed of deoxyribonucleotides. The term “oligonucleotide” denotes single- or double-stranded nucleotide multimers of from about 2 to up to about 100 nucleotides in length. Suitable oligonucleotides may be prepared by the phosphoramidite method described by Beaucage and Carruthers, Tetrahedron Lett., 22:1859-1862 (1981), or by the triester method according to Matteucci, et al., J. Am. Chem. Soc., 103:3185 (1981), both incorporated herein by reference, or by other chemical methods using either a commercial automated oligonucleotide synthesizer or VLSIPS™ technology. When oligonucleotides are referred to as “double-stranded,” it is understood by those of skill in the art that a pair of oligonucleotides exist in a hydrogen-bonded, helical array typically associated with, for example, DNA. In addition to the 100% complementary form of double-stranded oligonucleotides, the term “double-stranded,” as used herein is also meant to refer to those forms which include such structural features as bulges and loops, described more fully in such biochemistry texts as Stryer, Biochemistry, Third Ed., (1988), incorporated herein by reference for all purposes. The terms “identical” or percent “identity,” in the context of two or more nucleic acids or polypeptide sequences, refer to two or more sequences or subsequences that are the same or have a specified percentage of amino acid residues or nucleotides that are the same (i.e., about 60% identity, preferably 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%,94%, 95%, 96%, Attorney Docket No. 11650-002WO1 97%, 98%, 99% or higher identity over a specified region when compared and aligned for maximum correspondence over a comparison window or designated region) as measured using a BLAST or BLAST 2.0 sequence comparison algorithms with default parameters described below, or by manual alignment and visual inspection (see, e.g., NCBI web site or the like). Such sequences are then said to be “substantially identical.” This definition also refers to, or may be applied to, the compliment of a test sequence. The definition also includes sequences that have deletions and / or additions, as well as those that have substitutions. As described below, the preferred algorithms can account for gaps and the like. Preferably, identity exists over a region that is at least about 10 amino acids or 20 nucleotides in length, or more preferably over a region that is 10-50 amino acids or 20-50 nucleotides in length. As used herein, percent (%) amino acid sequence identity is defined as the percentage of amino acids in a candidate sequence that are identical to the amino acids in a reference sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity. Alignment for purposes of determining percent sequence identity can be achieved in various ways that are within the skill in the art, for instance, using publicly available computer software such as BLAST, BLAST-2, ALIGN, ALIGN-2 or Megalign (DNASTAR) software. Appropriate parameters for measuring alignment, including any algorithms needed to achieve maximal alignment over the full-length of the sequences being compared can be determined by known methods. For sequence comparisons, typically one sequence acts as a reference sequence, to which test sequences are compared. When using a sequence comparison algorithm, test and reference sequences are entered into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated. Preferably, default program parameters can be used, or alternative parameters can be designated. The sequence comparison algorithm then calculates the percent sequence identities for the test sequences relative to the reference sequence, based on the program parameters. One example of an algorithm that is suitable for determining percent sequence identity and sequence similarity are the BLAST and BLAST 2.0 algorithms, which are described in Altschul et al. (1977) Nuc. Acids Res.25:3389-3402, and Altschul et al. (1990) J. Mol. Biol.215:403-410, respectively. Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information (http: / / www.ncbi.nlm.nih.gov / ). This algorithm involves first identifying high scoring sequence pairs (HSPs) by identifying short words of length W in the query sequence, which either match or satisfy some positive-valued threshold score T when aligned with a word of the same length in a database sequence. T is referred to as the neighborhood word score threshold (Altschul et al. (1990) J. Attorney Docket No. 11650-002WO1 Mol. Biol.215:403-410). These initial neighborhood word hits act as seeds for initiating searches to find longer HSPs containing them. The word hits are extended in both directions along each sequence for as far as the cumulative alignment score can be increased. Cumulative scores are calculated using, for nucleotide sequences, the parameters M (reward score for a pair of matching residues; always >0) and N (penalty score for mismatching residues; always <0). For amino acid sequences, a scoring matrix is used to calculate the cumulative score. Extension of the word hits in each direction are halted when: the cumulative alignment score falls off by the quantity X from its maximum achieved value; the cumulative score goes to zero or below, due to the accumulation of one or more negative-scoring residue alignments; or the end of either sequence is reached. The BLAST algorithm parameters W, T, and X determine the sensitivity and speed of the alignment. The BLASTN program (for nucleotide sequences) uses as defaults a wordlength (W) of 11, an expectation (E) or 10, M=5, N=−4 and a comparison of both strands. For amino acid sequences, the BLASTP program uses as defaults a wordlength of 3, and expectation (E) of 10, and the BLOSUM62 scoring matrix (see Henikoff and Henikoff (1989) Proc. Natl. Acad. Sci. USA 89:10915) alignments (B) of 50, expectation (E) of 10, M=5, N=−4, and a comparison of both strands. The BLAST algorithm also performs a statistical analysis of the similarity between two sequences (see, e.g., Karlin and Altschul (1993) Proc. Natl. Acad. Sci. USA 90:5873-5787). One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P(N)), which provides an indication of the probability by which a match between two nucleotide or amino acid sequences would occur by chance. For example, a nucleic acid is considered similar to a reference sequence if the smallest sum probability in a comparison of the test nucleic acid to the reference nucleic acid is less than about 0.2, more preferably less than about 0.01. The term "nucleobase" refers to the part of a nucleotide that bears the Watson / Crick base- pairing functionality. The most common naturally-occurring nucleobases, adenine (A), guanine (G), uracil (U), cytosine (C), and thymine (T) bear the hydrogen-bonding functionality that binds one nucleic acid strand to another in a sequence specific manner. An antisense compound is a tool that can be used to introduce modifications into the nucleic acids found in living cells. The term “antisense” refers to the notion that nucleic acids “encode” proteins. That is, the sequence of nucleotides found in a given nucleic acid determines, among other things, what protein will be produced. A “sense” sequence for a full gene will yield a normal protein in the usual amount, in response to a given stimulus. A “sense” oligonucleotide will hybridize with a normal gene sequence, and will not affect the amount of, or properties of, the protein. A “nonsense” sequence will Attorney Docket No. 11650-002WO1 not yield a product, or may yield a non-functional product. For example, if a “nonsense” codon or oligomer is inserted into a gene, a truncated, non-functional protein may result. An “antisense” oligonucleotide will hybridize with a normal gene, but will yield a protein altered with respect to its structure, or amount. It has been found that antisense oligomers, that is antisense compounds that are relatively short, can be easily inserted into cells, where they alter gene function. Antisense compounds are commonly used as research reagents for the exploration of gene function because they are able to alter gene expression with exquisite specificity, and may be used to elucidate the function of particular genes. Antisense compounds can be used, for example, to distinguish between functions of various members of a biological pathway. Antisense oligonucleotides can be used to selectively block disease-causing genes, thereby inhibiting production of disease-associated proteins. Some antisense oligonucleotides have been safely and effectively administered to humans, and numerous clinical trials are presently underway. It is thus possible that oligonucleotides can be used to treat cells, tissues, and animals, especially humans. In the context of this invention, the term “oligonucleotide” refers to an oligomer or polymer of ribonucleic acid (RNA) or deoxyribonucleic acid (DNA) or mimetics thereof. This term includes oligonucleotides composed of naturally-occurring nucleobases, sugars and covalent internucleoside (backbone) linkages as well as oligonucleotides having non-naturally-occurring portions which function similarly. Such modified or substituted oligonucleotides are often preferred over native forms because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for a nucleic acid target and increased stability in the presence of nucleobases. The present invention employs oligomeric nucleotide compounds, particularly antisense oligonucleotides, which are targeted to a portion of a nucleic acid encoding Akt-1, and which modulate the expression of Akt-1. The oligonucleotide compounds are designed to specifically hybridize with one or more nucleic acids encoding Akt-1. To target an antisense compound to a particular gene means to identify the nucleic acid sequence of interest, and select one or more sites within the nucleic acid sequence to be modified. Once the target site has been identified, an oligonucleotide is chosen which is sufficiently complementary to the target site so that it will hybridize specifically to the site, i.e., hybridize sufficiently well and with sufficient specificity, to give the desired effect. As used herein, the phrase “nucleic acid encoding Akt-1” encompasses DNA encoding Akt-1, RNA (including pre-mRNA) transcribed from such DNA, and also cDNA derived from such RNA. The specific hybridization of an antisense oligomeric compound with its target nucleic acid interferes with Attorney Docket No. 11650-002WO1 the normal function of the nucleic acid. The functions of DNA to be interfered with include replication and transcription. The functions of RNA to be interfered with include all vital functions such as, for example, translocation of the RNA to the site of protein translation, translation of protein from the RNA, splicing of the RNA to yield one or more mRNA species, and catalytic activity which may be engaged in or facilitated by the RNA. The overall effect of such interference with target nucleic acid function is modulation of the expression, or production of, a protein. In the context of the present invention, “modulation” means either an increase (stimulation) or a decrease (inhibition) in the expression of a gene. In the context of this invention, “to hybridize” means to hydrogen bond, which may be via Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleoside or nucleotide bases. For example, adenine and thymine are complementary nucleobases which pair through the formation of hydrogen bonds. “Complementary,” as used herein, refers to the capacity for precise pairing between two nucleotides. For example, if a nucleotide at a certain position of an oligonucleotide is capable of hydrogen bonding with a nucleotide at the same position of a DNA or RNA molecule, then the oligonucleotide and the DNA or RNA are considered to be complementary to each other at that position. The oligonucleotide and the DNA or RNA are complementary to each other when a sufficient number of corresponding positions in each molecule are occupied by nucleotides which can hydrogen bond with each other. Thus, “specifically hybridizable” and “complementary” are terms which are used to indicate a sufficient degree of complementarity or precise pairing such that stable and specific binding occurs between the oligonucleotide and the DNA or RNA target. It is understood in the art that the sequence of an antisense compound need not be 100% complementary to that of its target nucleic acid to be specifically hybridizable. An antisense compound is specifically hybridizable when binding of the compound to the target DNA or RNA molecule interferes with the normal function of the target DNA or RNA to cause a loss of utility, and there is a sufficient degree of complementarity to avoid non-specific binding of the antisense compound to non-target sequences under conditions in which specific binding is desired, i.e., under physiological conditions in the case of in vivo assays or therapeutic treatment, and in the case of in vitro assays, under conditions in which the assays are performed. While antisense oligonucleotides are a preferred form of antisense compound, the present invention comprehends other oligomeric antisense compounds, including but not limited to oligonucleotide mimetics such as are described below. The antisense compounds in accordance with this invention preferably comprise from about 10 to about 30 nucleobases. Particularly preferred are Attorney Docket No. 11650-002WO1 antisense oligonucleotides comprising about 20 nucleobases (i.e. about 20 linked nucleosides). As is known in the art, a nucleoside is a base-sugar combination. The base portion of the nucleoside is normally a heterocyclic base. The two most common classes of such heterocyclic bases are the purines and the pyrimidines. Nucleotides are nucleosides that further include a phosphate group covalently linked to the sugar portion of the nucleoside. For those nucleosides that include a pentofuranosyl sugar, the phosphate group can be linked to either the 2′, 3′ or 5′ hydroxyl moiety of the sugar. In forming oligonucleotides, the phosphate groups covalently link adjacent nucleosides to one another to form a linear polymeric compound. In turn the respective ends of this linear polymeric structure can be further joined to form a circular structure, however, open linear structures are generally preferred. Within the oligonucleotide structure, the phosphate groups are commonly referred to as forming the internucleoside backbone of the oligonucleotide. The normal linkage or backbone of RNA and DNA is a 3′ to 5′ phosphodiester linkage. Specific examples of preferred antisense compounds useful in this invention include oligonucleotides containing modified backbones or non-natural internucleoside linkages. As defined in this specification, oligonucleotides having modified backbones include those that retain a phosphorus atom in the backbone and those that do not have a phosphorus atom in the backbone. For the purposes of this specification, and as sometimes referenced in the art, modified oligonucleotides that do not have a phosphorus atom in their internucleoside backbone can also be considered to be oligonucleosides. Preferred modified oligonucleotide backbones include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates including 3′-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3′-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, and boranophosphates having normal 3′–5′ linkages, 2′–5′ linked analogs of these, and those having inverted polarity wherein the adjacent pairs of nucleoside units are linked 3′–5′ to 5′–3′ or 2′–5′ to 5′–2′. Various salts, mixed salts and free acid forms are also included. Preferred modified oligonucleotide backbones that do not include a phosphorus atom therein have backbones that are formed by short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatomic or heterocyclic internucleoside linkages. These include those having morpholino linkages (formed in part from the sugar portion of a nucleoside); siloxane backbones; sulfide, sulfoxide and sulfone backbones; formacetyl and thioformacetyl backbones; methylene formacetyl and thioformacetyl backbones; alkene Attorney Docket No. 11650-002WO1 containing backbones; sulfamate backbones; methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide backbones; and others having mixed N, O, S and CH2 component parts. In other preferred oligonucleotide mimetics, both the sugar and the internucleoside linkage, i.e., the backbone, of the nucleotide units are replaced with novel groups. The base units are maintained for hybridization with an appropriate nucleic acid target compound. One such oligomeric compound, an oligonucleotide mimetic that has been shown to have excellent hybridization properties, is referred to as a peptide nucleic acid (PNA). In PNA compounds, the sugar-backbone of an oligonucleotide is replaced with an amide containing backbone, in particular an aminoethylglycine backbone. The nucleobases are retained and are bound directly or indirectly to aza nitrogen atoms of the amide portion of the backbone. Most preferred embodiments of the invention are oligonucleotides with phosphorothioate backbones and oligonucleosides with heteroatom backbones, and in particular —CH2—NH—O—CH2—, —CH2—N(CH3)—O—CH2— [known as a methylene (methylimino) or MMI backbone], —CH2—O— N(CH3)—CH2—, —CH2—N(CH3)—N(CH3)—CH2— and —O—N(CH3)—CH2—CH2— [wherein the native phosphodiester backbone is represented as —O—P—O—CH2—]. Also preferred are oligonucleotides having morpholino backbone structures. Modified oligonucleotides may also contain one or more substituted sugar moieties. Preferred oligonucleotides comprise one of the following at the 2′ position: OH; F; O—, S—, or N-alkyl; O—, S—, or N-alkenyl; O—, S— or N-alkynyl; or O-alkyl-O-alkyl, wherein the alkyl, alkenyl and alkynyl may be substituted or unsubstituted C1to C10alkyl or C2to C10alkenyl and alkynyl. Particularly preferred are O[(CH2)nO]mCH3, O(CH2)nOCH3, O(CH2)nNH2, O(CH2)nCH3, O(CH2)nONH2, and O(CH2)nON[(CH2)nCH3)]2, where n and m are from 1 to about 10. Other preferred oligonucleotides comprise one of the following at the 2′ position: C1 to C10 lower alkyl, substituted lower alkyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH3, OCN, Cl, Br, CN, CF3, OCF3, SOCH3, SO2CH3, ONO2, NO2, N3, NH2, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving the pharmacokinetic properties of an oligonucleotide, or a group for improving the pharmacodynamic properties of an oligonucleotide, and other substituents having similar properties. A preferred modification includes 2′-methoxyethoxy (2′- O—CH2CH2OCH3, also known as 2′-O-(2-methoxyethyl) or 2′-MOE) (Martin et al., Helv. Chim. Acta, 1995, 78, 486–504) i.e., an alkoxyalkoxy group. A further preferred modification includes 2′- Attorney Docket No. 11650-002WO1 dimethylaminooxyethoxy, i.e., a O(CH2)2ON(CH3)2group, also known as 2′-DMAOE, as described in examples hereinbelow. Other preferred modifications include 2′-methoxy (2′-O—CH3), 2′-aminopropoxy (2′- OCH2CH2CH2NH2) and 2′-fluoro (2′-F). Similar modifications may also be made at other positions on the oligonucleotide, particularly the 3′ position of the sugar on the 3′ terminal nucleotide or in 2′-5′ linked oligonucleotides and the 5′ position of 5′ terminal nucleotide. Oligonucleotides may also have sugar mimetics such as cyclobutyl moieties in place of the pentofuranosyl sugar. Oligonucleotides may also include nucleobase (often referred to in the art simply as “base”) modifications or substitutions. As used herein, “unmodified” or “natural” nucleobases include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U). Modified nucleobases include other synthetic and natural nucleobases such as 5-methylcytosine (5-Me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2- thiocytosine, 5-halouracil and cytosine, 5-propynyl uracil and cytosine, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo particularly 5-bromo, 5-trifluoromethyl and other 5- substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8- azaadenine, 7-deazaguanine and 7-deazaadenine and 3-deazaguanine and 3-deazaadenine. Certain nucleobases are particularly useful for increasing the binding affinity of the oligomeric compounds of the invention. These include 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and O-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil and 5-propynylcytosine.5- methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6–1.2° C. and are presently preferred base substitutions, even more particularly when combined with 2′-O- methoxyethyl sugar modifications. Another modification of the oligonucleotides of the invention involves chemically linking to the oligonucleotide one or more moieties or conjugates which enhance the activity, cellular distribution or cellular uptake of the oligonucleotide. Such moieties include but are not limited to lipid moieties such as a cholesterol moiety, cholic acid, a thioether, e.g., hexyl-S-tritylthiol, a thiocholesterol, an aliphatic chain, e.g., dodecandiol or undecyl residues, a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethyl- ammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate, a polyamine or a polyethylene glycol chain, or adamantane acetic acid, a palmityl moiety, or an octadecylamine or hexylamino-carbonyl- oxycholesterol moiety. Attorney Docket No. 11650-002WO1 It is not necessary for all positions in a given compound to be uniformly modified, and in fact more than one of the aforementioned modifications may be incorporated in a single compound or even at a single nucleoside within an oligonucleotide. The present invention also includes antisense compounds which are chimeric compounds. “Chimeric” antisense compounds or “chimeras,” in the context of this invention, are antisense compounds, particularly oligonucleotides, which contain two or more chemically distinct regions, each made up of at least one monomer unit, i.e., a nucleotide in the case of an oligonucleotide compound. These oligonucleotides typically contain at least one region wherein the oligonucleotide is modified so as to confer upon the oligonucleotide increased resistance to nuclease degradation, increased cellular uptake, and / or increased binding affinity for the target nucleic acid. An additional region of the oligonucleotide may serve as a substrate for enzymes capable of cleaving RNA:DNA or RNA:RNA hybrids. By way of example, RNase H is a cellular endonuclease which cleaves the RNA strand of an RNA:DNA duplex. Activation of RNase H, therefore, results in cleavage of the RNA target, thereby greatly enhancing the efficiency of oligonucleotide inhibition of gene expression. Consequently, comparable results can often be obtained with shorter oligonucleotides when chimeric oligonucleotides are used, compared to phosphorothioate deoxyoligonucleotides hybridizing to the same target region. Cleavage of the RNA target can be routinely detected by gel electrophoresis and, if necessary, associated nucleic acid hybridization techniques known in the art. Chimeric antisense compounds of the invention may be formed as composite structures of two or more oligonucleotides, modified oligonucleotides, oligonucleosides and / or oligonucleotide mimetics as described above. Such compounds have also been referred to in the art as hybrids or gapmers. The antisense compounds used in accordance with this invention may be conveniently and routinely made through the well-known technique of solid phase synthesis. Equipment for such synthesis is sold by several vendors including, for example, Applied Biosystems (Foster City, Calif.). Any other means for such synthesis known in the art may additionally or alternatively be employed. It is well known to use similar techniques to prepare oligonucleotides such as the phosphorothioates and alkylated derivatives. The antisense compounds of the invention are synthesized in vitro and do not include antisense compositions of biological origin, or genetic vector constructs designed to direct the in vivo synthesis of antisense molecules. The compounds of the invention may also be admixed, encapsulated, conjugated or otherwise associated with other molecules, molecule structures or mixtures of compounds, as for example, liposomes, receptor targeted molecules, oral, rectal, topical or other formulations, for assisting in uptake, distribution and / or absorption. Attorney Docket No. 11650-002WO1 The antisense compounds of the invention encompass any pharmaceutically acceptable salts, esters, or salts of such esters, or any other compound which, upon administration to an animal including a human, is capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. Accordingly, for example, the disclosure is also drawn to prodrugs and pharmaceutically acceptable salts of the compounds of the invention, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents. The term “prodrug” indicates a therapeutic agent that is prepared in an inactive form that is converted to an active form (i.e., drug) within the body or cells thereof by the action of endogenous enzymes or other chemicals and / or conditions. In particular, prodrug versions of the oligonucleotides of the invention are prepared as SATE [(S-acetyl-2-thioethyl) phosphate] derivatives. The term “pharmaceutically acceptable salts” refers to physiologically and pharmaceutically acceptable salts of the compounds of the invention: i.e., salts that retain the desired biological activity of the parent compound and do not impart undesired toxicological effects thereto. For oligonucleotides, preferred examples of pharmaceutically acceptable salts include but are not limited to (a) salts formed with cations such as sodium, potassium, ammonium, magnesium, calcium, polyamines such as spermine and spermidine, etc.; (b) acid addition salts formed with inorganic acids, for example hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, nitric acid and the like; (c) salts formed with organic acids such as, for example, acetic acid, oxalic acid, tartaric acid, succinic acid, maleic acid, fumaric acid, gluconic acid, citric acid, malic acid, ascorbic acid, benzoic acid, tannic acid, palmitic acid, alginic acid, polyglutamic acid, naphthalenesulfonic acid, methanesulfonic acid, p-toluenesulfonic acid, naphthalenedisulfonic acid, polygalacturonic acid, and the like; and (d) salts formed from elemental anions such as chlorine, bromine, and iodine. Compositions Described herein are compositions including Archexin, or a pharmaceutically acceptable salt thereof; and Everolimus, or a pharmaceutically acceptable salt thereof, Lenvatinib, or a pharmaceutically acceptable salt thereof, or any combination thereof. RX-0201 or pharmaceutically acceptable salts thereof A compound, RX-0201, 5′ gctgcatgatctccttggcg 3′, SEQ. ID. NO.1, targeted to a nucleic acid molecule encoding Akt-1. RX-0201, is targeted to a site in the coding region of the Akt-1 gene having the following sequence: 5′ cgccaaggagatcatgcagc 3′ at site 1,478 of Akt-1 gene (Genebank # BC000479) (Seq. Id. No.2). The sequence for the backbone of RX-0201 is complementary to this site. Archexin (RX-0201) is described in U.S. Patent No.7,122,527, which is hereby incorporated by reference in its entirety. Attorney Docket No. 11650-002WO1 In some embodiments, the compound is an antisense oligonucleotide. In some embodiments, the antisense oligonucleotide has at least one modified internucleoside linkage that is a phosphorothioate linkage. Everolimus The compound Everolimus is defined by the following structure. , or Lenvatinib , or pharmaceutically acceptable salts, prodrugs, or derivatives thereof. Methods of Using Described herein are methods of treating cancer, preventing cancer, preventing cancer metastasis, and / or preventing cancer recurrence in a subject in need thereof including administering a therapeutic effective amount of Archexin, or a pharmaceutically acceptable salt thereof, to the subject Attorney Docket No. 11650-002WO1 to treat the cancer. In some embodiments, the therapeutically effective amount does not substantially inhibit Akt-1 expression in the subject. Described herein are methods of treating cancer, preventing cancer, preventing cancer metastasis, and / or preventing cancer recurrence in a subject in need thereof including administering a therapeutic effective amount of Archexin, or a pharmaceutically acceptable salt thereof, to the subject to treat the cancer. In some embodiments, the therapeutically effective amount does not substantially inhibit Akt-1 expression in the subject. Described herein are methods of preventing cancer in a subject in need thereof including administering a therapeutic effective amount of Archexin, or a pharmaceutically acceptable salt thereof, to the subject to treat the cancer. In some embodiments, the therapeutically effective amount does not substantially inhibit Akt-1 expression in the subject. Described herein are also methods of stimulating an immune response in a subject, the method including administering to the subject an immunosImulatory amount of Archexin, or a pharmaceuIcally acceptable salt thereof. In some embodiments, the immunostimulatory amount does not substantially inhibit Akt-1 expression in the subject. In some embodiments, the Archexin, or a pharmaceutically acceptable salt thereof, is co-administered with an active agent or therapy, such as radiotherapy, a chemotherapeutic agent, an immunomodulating agent, an antigen, or any combination thereof. In some embodiments, the Archexin has a nucleic acid sequence of SEQ. ID. NO.1. In some embodiments, the cancer is an Akt-1 expressing cancer. The expression of AKT-1 is altered in many human malignant carcinomas including, for example, gastric cancers, renal cancer, breast cancer, prostate cancer, ovarian cancer, and pancreatic cancer. See, for example, Yu, Y., et al. PLoS One 2015, 10 (10) No. e0140479. In some embodiments, the cancer can be an Akt-1 expressing cancer, including but not limited to, renal carcinoma, gastric cancer, breast cancer, prostate cancer, ovarian cancer, and pancreatic cancer. In some embodiments, the methods described herein are used to treat cancer, for example, melanoma, lung cancer (including lung adenocarcinoma, basal cell carcinoma, squamous cell carcinoma, large cell carcinoma, bronchioloalveolar carcinoma, bronchogenic carcinoma, non-small-cell carcinoma, small cell carcinoma, mesothelioma); breast cancer (including ductal carcinoma, lobular carcinoma, inflammatory breast cancer, clear cell carcinoma, mucinous carcinoma, serosal cavities breast carcinoma); colorectal cancer (colon cancer, rectal cancer, colorectal adenocarcinoma); anal cancer; pancreatic cancer (including pancreatic adenocarcinoma, islet cell carcinoma, neuroendocrine tumors); prostate cancer; prostate adenocarcinoma; ovarian carcinoma (ovarian epithelial carcinoma or surface Attorney Docket No. 11650-002WO1 epithelial-stromal tumor including serous tumor, endometrioid tumor and mucinous cystadenocarcinoma, sex-cord-stromal tumor); lymphoma; liver and bile duct carcinoma (including hepatocellular carcinoma, cholangiocarcinoma, hemangioma); esophageal carcinoma (including esophageal adenocarcinoma and squamous cell carcinoma); oral and oropharyngeal squamous cell carcinoma; salivary gland adenoid cystic carcinoma; bladder cancer; bladder carcinoma; carcinoma of the uterus (including endometrial adenocarcinoma, ocular, uterine papillary serous carcinoma, uterine clear-cell carcinoma, uterine sarcomas, leiomyosarcomas, mixed mullerian tumors); glioma, glioblastoma, medulloblastoma, and other tumors of the brain; kidney cancers (including renal cell carcinoma, clear cell carcinoma, Wilm's tumor); cancer of the head and neck (including squamous cell carcinomas); cancer of the stomach (gastric cancers, stomach adenocarcinoma, gastrointestinal stromal tumor); testicular cancer; germ cell tumor; neuroendocrine tumor; cervical cancer; carcinoids of the gastrointestinal tract, breast, and other organs; signet ring cell carcinoma; mesenchymal tumors including sarcomas, fibrosarcomas, haemangioma, angiomatosis, haemangiopericytoma, pseudoangiomatous stromal hyperplasia, myofibroblastoma, fibromatosis, inflammatory myofibroblastic tumor, lipoma, angiolipoma, granular cell tumor, neurofibroma, schwannoma, angiosarcoma, liposarcoma, rhabdomyosarcoma, osteosarcoma, leiomyoma, leiomysarcoma, skin, including melanoma, cervical, retinoblastoma, head and neck cancer, pancreatic, brain, thyroid, testicular, renal, bladder, soft tissue, adenal gland, urethra, cancers of the penis, myxosarcoma, chondrosarcoma, osteosarcoma, chordoma, malignant fibrous histiocytoma, lymphangiosarcoma, mesothelioma, squamous cell carcinoma; epidermoid carcinoma, malignant skin adnexal tumors, adenocarcinoma, hepatoma, hepatocellular carcinoma, renal cell carcinoma, hypernephroma, cholangiocarcinoma, transitional cell carcinoma, choriocarcinoma, seminoma, embryonal cell carcinoma, glioma anaplastic; glioblastoma multiforme,, neuroblastoma, medulloblastoma, malignant meningioma, malignant schwannoma, neurofibrosarcoma, parathyroid carcinoma, medullary carcinoma of thyroid, bronchial carcinoid, pheochromocytoma, Islet cell carcinoma, malignant carcinoid, malignant paraganglioma, melanoma, Merkel cell neoplasm, cystosarcoma phylloide, salivary cancers, thymic carcinomas, and cancers of the vagina among others. In some embodiments, the compositions and methods described herein are useful in treating cancer, preventing cancer, preventing cancer metastasis, and / or preventing cancer recurrence. In some cases, the cancer is a circulating cancer cell (circulating tumor cell). In some cases, the cancer is a metastatic cancer cell. In some embodiments, the cancer is kidney cancer such as renal cell carcinoma. Attorney Docket No. 11650-002WO1 In some embodiments, the therapeutically effective amount of the Archexin can be administered over a period of at least 4 weeks, such as over a period of at least 5 weeks, at least 6 weeks, at least 7 weeks, at least 8 weeks, at least 9 weeks, at least 10 weeks, at least 11 weeks, at least 12 weeks, at least 13 weeks, at least 14 weeks, at least 15 weeks, at least 16 weeks, at least 17 weeks, at least 18 weeks, at least 19 weeks, or at least 20 weeks. In some embodiments, the therapeutically effective amount of the Archexin can be administered over a period of 20 weeks or less, such as over a period of 5 weeks or less, 6 weeks or less, 7 weeks or less, 8 weeks or less, 9 weeks or less, 10 weeks or less, 11 weeks or less, 12 weeks or less, 13 weeks or less, 14 weeks or less, 15 weeks or less, 16 weeks or less, 17 weeks or less, 18 weeks or less, 19 weeks or less. The therapeutically effective amount of the Archexin can be administered over a period ranging from any of the minimum values described above to any of the maximum values described above. For example, in some embodiments, the therapeutically effective amount of the Archexin can be administered over a period of from 4 weeks to 8 weeks, from 4 weeks to 12 weeks, from 4 weeks to 16 weeks, or from 4 weeks to 20 weeks. In some embodiments, the Archexin, or a pharmaceutically acceptable salt thereof, can be administered twice weekly. In some embodiments, the Archexin, or a pharmaceutically acceptable salt thereof, can be administered in a total dose of less than 1960 mg / m2, such as a total dose of less than 1800 mg / m2, less than 1850 mg / m2, less than 1700 mg / m2, less than 1750 mg / m2, less than 1650 mg / m2, less than 1600 mg / m2, less than 1550 mg / m2, less than 1500 mg / m2, less than 1450 mg / m2, less than 1400 mg / m2, less than 1350 mg / m2, less than 1300 mg / m2, or less than 1250 mg / m2. In some embodiments, the Archexin, or a pharmaceutically acceptable salt thereof, can be administered in a total dose of at least 1900 mg / m2, such as a total dose of at least 1800 mg / m2, at least 1850 mg / m2, at least 1700 mg / m2, at least 1750 mg / m2, at least 1650 mg / m2, at least 1600 mg / m2, at least 1550 mg / m2, at least 1500 mg / m2, at least 1450 mg / m2, at least 1400 mg / m2, at least 1350 mg / m2, at least 1300 mg / m2, or at least 1250 mg / m2. In some embodiments, the total dose is from 1000 mg / m2to 1900 mg / m2, such as from 1200 mg / m2to 1800 mg / m2, from 1200 mg / m2to 1300 mg / m2, 1200 mg / m2to 1400 mg / m2, 1200 mg / m2to 1500 mg / m2, 1200 mg / m2to 1600 mg / m2, 1200 mg / m2to 1700 mg / m2, from 1000 mg / m2to 1900 mg / m2, from 1000 mg / m2to 1800 mg / m2, from 1000 mg / m2to 1300 mg / m2, 1000 mg / m2to 1400 mg / m2, 1000 mg / m2to 1500 mg / m2, 1000 mg / m2to 1600 mg / m2, 1000 mg / m2to 1700 mg / m2, from Attorney Docket No. 11650-002WO1 1300 mg / m2to 1900 mg / m2, from 1300 mg / m2to 1800 mg / m2, 1300 mg / m2to 1400 mg / m2, 1300 mg / m2to 1500 mg / m2, 1300 mg / m2to 1600 mg / m2, 1300 mg / m2to 1700 mg / m2, from 1400 mg / m2to 1900 mg / m2, from 1400 mg / m2to 1800 mg / m2, 1400 mg / m2to 1500 mg / m2, 1400 mg / m2to 1600 mg / m2, 1400 mg / m2to 1700 mg / m2, from 1500 mg / m2to 1900 mg / m2, from 1500 mg / m2to 1800 mg / m2, 1500 mg / m2to 1600 mg / m2, 1500 mg / m2to 1700 mg / m2, from 1600 mg / m2to 1900 mg / m2, from 1600 mg / m2to 1800 mg / m2, 1600 mg / m2to 1700 mg / m2, from 1700 mg / m2to 1900 mg / m2, from 1700 mg / m2to 1800 mg / m2, from 1800 mg / m2to 1900 mg / m2. In some embodiments, the total dose is administered over a period of at least 4 weeks, such as over a period of at least 5 weeks, at least 6 weeks, at least 7 weeks, at least 8 weeks, at least 9 weeks, at least 10 weeks, at least 11 weeks, at least 12 weeks, at least 13 weeks, at least 14 weeks, at least 15 weeks, at least 16 weeks, at least 17 weeks, at least 18 weeks, at least 19 weeks, or at least 20 weeks. In some embodiments, the total dose is administered over a period of 20 weeks or less, such as over a period of 5 weeks or less, 6 weeks or less, 7 weeks or less, 8 weeks or less, 9 weeks or less, 10 weeks or less, 11 weeks or less, 12 weeks or less, 13 weeks or less, 14 weeks or less, 15 weeks or less, 16 weeks or less, 17 weeks or less, 18 weeks or less, 19 weeks or less. The total dose is administered over a period ranging from any of the minimum values described above to any of the maximum values described above. For example, in some embodiments, the total dose is administered over at least 4 weeks, such as over a period of from 4 weeks to 8 weeks, from 4 weeks to 12 weeks, from 4 weeks to 16 weeks, or from 4 weeks to 20 weeks. In some embodiments, the Archexin, or a pharmaceutically acceptable salt thereof, is administered at a weekly dose of at least 300 mg / m2(e.g., at least 300 mg / m2, at least 350 mg / m2, at least 400 mg / m2, at least 450 mg / m2). In some embodiments, the Archexin, or a pharmaceutically acceptable salt thereof, is administered at a weekly dose of 500 mg / m2or less (e.g., 450 mg / m2or less, 400 mg / m2or less, 350 mg / m2or less). The Archexin, or a pharmaceutically acceptable salt thereof, is administered at a weekly dose ranging from any of the minimum values described above to any of the maximum values described above. For example, in some embodiments, the Archexin, or a pharmaceutically acceptable salt thereof, is administered at a weekly dose of from 300 mg / m2to 500 mg / m2, (e.g., from 350 mg / m2to 500 mg / m2, from 400 mg / m2to 500 mg / m2, from 450 mg / m2to 500 mg / m2, from 300 mg / m2to 450 mg / m2, from 300 mg / m2to 400 mg / m2, from 300 mg / m2to 350 mg / m2, from 400 mg / m2to 450 mg / m2, or from 450 mg / m2to 500 mg / m2). Attorney Docket No. 11650-002WO1 In some embodiments, the Archexin, or a pharmaceutically acceptable salt thereof, is administered parenterally, such as via intravenous infusion. In some embodiments, the Archexin, or a pharmaceutically acceptable salt thereof, is administered at a dose of at least 150 mg / m2per intravenous infusion (e.g., at least 200 mg / m2, at least 250 mg / m2, or at least 300 mg / m2). In some embodiments, the Archexin, or a pharmaceutically acceptable salt thereof, is administered at a dose of 350 mg / m2or less per intravenous infusion (e.g., 300 mg / m2or less, 250 mg / m2or less, or 200 mg / m2or less). The Archexin, or a pharmaceutically acceptable salt thereof, is administered at a dose per intravenous infusion ranging from any of the minimum values described above to any of the maximum values described above. For example, in some embodiments, the Archexin, or a pharmaceutically acceptable salt thereof, is administered at a dose of from 150 mg / m2to 350 mg / m2per intravenous infusion (e.g., from 150 mg / m2to 300 mg / m2, from 150 mg / m2to 250 mg / m2, from 150 mg / m2to 200 mg / m2, from 200 mg / m2to 300 mg / m2, from 200 mg / m2to 350 mg / m2, from 250 mg / m2to 300 mg / m2, from 250 mg / m2to 350 mg / m2, or from 300 mg / m2to 350 mg / m2). In some embodiments, the Archexin, or pharmaceutically acceptable salts thereof, is administered over a period of at least 30 minutes, (e.g., at least 1 hour, at least 1.5 hours, at least 2 hours, at least 2.5 hours, at least 3 hours, at least 3.5 hours, at least 4 hours, at least 4.5 hours, at least 5 hours, or at least 5.5 hours). In some embodiments, the Archexin, or pharmaceutically acceptable salts thereof, is administered over a period of 6 hours or less, (e.g., 5.5 hours or less, 5 hours or less, 4.5 hours or less, 4 hours or less, 3.5 hours or less, 3 hours or less, 2.5 hours or less, 2 hours or less, 1.5 hours or less, 1 hour or less, or 45 minutes or less). The Archexin, or pharmaceutically acceptable salts thereof, is administered over a period ranging from any of the minimum values described above to any of the maximum values described above. For example, in some embodiments, the Archexin, or pharmaceutically acceptable salts thereof, is administered over a period of from 30 minutes to 6 hours, such as from 1 hour to 4 hours, from 1 hour to 3 hours, 1 hour to 5 hours, 1 hour to 2 hours, from 2 hours to 4 hours, from 2 hours to 3 hours, 2 hours to 5 hours, 3 hours to 6 hours, from 3 hours to 4 hours, from 2 hours to 6 hours, 3 hours to 5 hours, from 4 hours to 5 hours, from 4 hours to 6 hours, 5 hours to 6 hours. In some embodiments, the method further includes administering everolimus, or a pharmaceutically acceptable salt, prodrug, or derivative thereof; lenvatinib, or a pharmaceutically acceptable salt, prodrug, or derivative thereof; or any combination thereof to the subject. In some embodiments, the method further includes administering everolimus, or a pharmaceutically acceptable Attorney Docket No. 11650-002WO1 salt, prodrug, or derivative thereof, and lenvatinib, or a pharmaceutically acceptable salt, prodrug, or derivative thereof, to the subject. In some embodiments, the everolimus, or a pharmaceutically acceptable salt, prodrug, or derivatives thereof, is administered orally to the subject at a dose of from 0.5 mg to 5 mg per day, such as 1 mg per day, 1.5 mg per day, 2 mg per day, 2.5 mg per day, 3 mg per day, 3.5 mg per day, 4 mg per day, or 5 mg per day. In some embodiments, the everolimus, or a pharmaceutically acceptable salt, prodrug, or derivatives thereof, is administered daily for a period of at least 4 weeks, such as over a period of at least 5 weeks, at least 6 weeks, at least 7 weeks, at least 8 weeks, at least 9 weeks, at least 10 weeks, at least 11 weeks, at least 12 weeks, at least 13 weeks, at least 14 weeks, at least 15 weeks, at least 16 weeks, at least 17 weeks, at least 18 weeks, at least 19 weeks, or at least 20 weeks. In some embodiments, the everolimus, or a pharmaceutically acceptable salt, prodrug, or derivatives thereof, is administered daily for a period of 20 weeks or less, such as over a period of 5 weeks or less, 6 weeks or less, 7 weeks or less, 8 weeks or less, 9 weeks or less, 10 weeks or less, 11 weeks or less, 12 weeks or less, 13 weeks or less, 14 weeks or less, 15 weeks or less, 16 weeks or less, 17 weeks or less, 18 weeks or less, 19 weeks or less. The everolimus, or a pharmaceutically acceptable salt, prodrug, or derivatives thereof, is administered daily for a period ranging from any of the minimum values described above to any of the maximum values described above. For example, in some embodiments, the everolimus, or a pharmaceutically acceptable salt, prodrug, or derivatives thereof, is administered daily for a period of from 4 weeks to 8 weeks, from 4 weeks to 12 weeks, from 4 weeks to 16 weeks, or from 4 weeks to 20 weeks. In some embodiments, the lenvatinib, or a pharmaceutically acceptable salt, prodrug, or derivative thereof, is administered to the subject orally at a dose of from 8 mg to 24 mg per day, such as 8 mg per day, 10 mg per day, 12 mg per day, 14 mg per day, 16 mg per day, or 18 mg per day. In some embodiments, the lenvatinib, or a pharmaceutically acceptable salt, prodrug, or derivatives thereof, is administered daily for a period of at least 4 weeks, such as over a period of at least 5 weeks, at least 6 weeks, at least 7 weeks, at least 8 weeks, at least 9 weeks, at least 10 weeks, at least 11 weeks, at least 12 weeks, at least 13 weeks, at least 14 weeks, at least 15 weeks, at least 16 weeks, at least 17 weeks, at least 18 weeks, at least 19 weeks, or at least 20 weeks. In some embodiments, the lenvatinib, or a pharmaceutically acceptable salt, prodrug, or derivatives thereof, is administered daily for a period of 20 weeks or less, such as over a period of 5 Attorney Docket No. 11650-002WO1 weeks or less, 6 weeks or less, 7 weeks or less, 8 weeks or less, 9 weeks or less, 10 weeks or less, 11 weeks or less, 12 weeks or less, 13 weeks or less, 14 weeks or less, 15 weeks or less, 16 weeks or less, 17 weeks or less, 18 weeks or less, 19 weeks or less. The lenvatinib, or a pharmaceutically acceptable salt, prodrug, or derivatives thereof, is administered daily for a period ranging from any of the minimum values described above to any of the maximum values described above. For example, in some embodiments, the lenvatinib, or a pharmaceutically acceptable salt, prodrug, or derivatives thereof, is administered daily for a period of from 4 weeks to 8 weeks, from 4 weeks to 12 weeks, from 4 weeks to 16 weeks, or from 4 weeks to 20 weeks. Active Agents As used herein, a “active agent” refers to therapeutic agents, diagnostic agents, or prophylactic agents. As discussed herein, the therapeutic agents can be released from the disclosed compounds, compositions, and systems in a biologically active form. It is further understood, that as used herein, the terms “therapeutic agents” refers to one or more therapeutic agents, active ingredients, or substances that can be used to treat a medical condition. Therapeutic agent includes any synthetic or naturally occurring biologically active compound or composition of matter which, when administered to an organism (human or nonhuman animal), induces a desired pharmacologic, immunogenic, and / or physiologic effect by local and / or systemic action. The term therefore encompasses those compounds or chemicals traditionally regarded as drugs, vaccines, and biopharmaceuticals including molecules such as proteins, peptides, hormones, nucleic acids, gene constructs and the like. Examples of therapeutic agents are described in well-known literature references such as the Merck Index (14th edition), the Physicians' Desk Reference (64th edition), and The Pharmacological Basis of Therapeutics (12th edition), and they include, without limitation, medicaments; vitamins and minerals such as essential amino acids, calcium, iron, potassium, zinc, vitamin B12, and the like; substances used for the treatment, prevention, diagnosis, cure or mitigation of a disease or illness; substances that affect the structure or function of the body, or pro-drugs, which become biologically active or more active after they have been placed in a physiological environment. For example, the term “therapeutic agent” includes compounds or compositions for use in all of the major therapeutic areas including, but not limited to, adjuvants; an antimicrobial agents (including antibiotics, antiviral agents, antiparasitic, and anti-fungal agents), anti-inflammatory agents (including steroids and non-steroidal anti-inflammatory agents), anti-coagulant agents, ophthalmic agents, gastrointestinal drugs, antiplatelet agents, and antiseptic agents, steroidal agent, anti-neoplastic agent, Attorney Docket No. 11650-002WO1 anti-cancer agent, antigen, antibody, birth control agent, progestational agent, anti-cholinergic, nutritional agent, analgesics and analgesic combinations such as acetaminophen, acetylsalicylic acid, and the like; anesthetics such as lidocaine, xylocaine, and the like, anorexics such as dexadrine, phendimetrazine tartrate, and the like; anti-epileptics, local and general anesthetics, hypnotics, sedatives, antipsychotic agents, neuroleptic agents, antidepressants such as isocarboxazid, amoxapine, and the like; anxiolytics, antagonists, neuron blocking agents, anticholinergic and cholinomimetic agents, antimuscarinic and muscarinic agents, antiparkinsonian agents, anti-Alzheimer's agents, antiadrenergics, antiarrhythmics, antihypertensive agents, hormones such as insulin, progestins, estrogens, corticoids, glucocorticoids, androgens, and the like; nutrients, antiarthritics such as methylprednisolone, ibuprofen, and the like; antiasthmatics such as terbutaline sulfate, theophylline, ephedrine, and the like; anticonvulsants such as phenyloin sodium, diazepam, and the like; antiallergenics, antihistamines such as diphenhydramine HCl, chlorpheniramine maleate, and the like; antinauseants, antineoplastics, antipruritics, antipyretics; antispasmodics such as belladonna alkaloids, dicyclomine hydrochloride, and the like; cardiovascular agents such as prazosin HCl, nitroglycerin, propranolol HCl, hydralazine HCl, pancrelipase, succinic acid dehydrogenase, and the like; vasoactive agent, cardiovascular preparations (including calcium channel blockers, beta-blockers, beta-agonists and antiarrythmics), antihypertensives, diuretics such as furosemide, spironolactone, and the like; vasodilators; central nervous system stimulants; cough and cold preparations; decongestants; diagnostics; bone growth stimulants and bone resorption inhibitors; muscle relaxants; psychostimulants; sedatives; tranquilizers such as thorazine, diazepam, chlorpromazine HCl, reserpine, chlordiazepoxide HCl, and the like; antiulcer drugs such as rantidine HCl, cimetidine HCl, and the like; anti-asthmatic agents, anti-diarrheals, anti-obesity agents, anti-thrombotic agents, anti-tussive agents, anti-uricemic agents, anti-anginal agents, appetite suppressants, expectorants, hyperglycemic agents, hypoglycemic agents, thyroid and anti-thyroid agents, tissue growth agents, uterine relaxants, immunomodulator, including, for example, cytokines, interleukins, interferon, colony stimulating factor, tumor necrosis factor, and the like; immunosuppressants such as rapamycin, tacrolimus, and the like; immunological agent; antigens, factors, growth factors, amino acids, peptides and proteins and fragments thereof (whether naturally occurring, chemically synthesized or recombinantly produced) such as LHRH, somatostatin, calcitonin, growth hormone, glucagon-like peptides, growth releasing factor, angiotensin, FSH, EGF, bone morphogenic protein (BMP), erythopoeitin (EPO), interferon, interleukin, collagen, fibrinogen, insulin, Factor VIII, Factor IX, Enbrel®, Rituxam®, Herceptin®, alpha-glucosidase, Cerazyme / Ceredose®, vasopressin, ACTH, human serum albumin, gamma globulin, structural proteins, Attorney Docket No. 11650-002WO1 blood product proteins, complex proteins, antigens or antigenic polypeptides, enzymes, antibodies, monoclonal antibodies, and the like; and nucleic acid molecules (polymeric forms of two or more nucleotides, polynucleotides, either ribonucleotides (RNA) or deoxyribonucleotides (DNA) including both double- and single-stranded molecules, gene constructs, expression vectors, antisense molecules and the like), small molecules (e.g., doxorubicin) and other biologically active macromolecules such as, for example, proteins and enzymes. The agent may be a biologically active agent used in medical, including veterinary, applications and in agriculture, such as with plants, as well as other areas. In certain embodiments of the present disclosure, the agent to be delivered may be a mixture of active agents. Representative examples of antibiotics include amikacin, amoxicillin, ampicillin, atovaquone, azithromycin, aztreonam, bacitracin, carbenicillin, cefadroxil, cefazolin, cefdinir, cefditoren, cefepime, cefiderocol, cefoperazone, cefotetan, cefoxitin, cefotaxime, cefpodoxime, cefprozil, ceftaroline, ceftazidime, ceftibuten, ceftizoxime, ceftriaxone, chloramphenicol, colistimethate, cefuroxime, cephalexin, cephradine, cilastatin, cinoxacin, ciprofloxacin, clarithromycin, clindamycin, dalbavancin, dalfopristin, daptomycin, demeclocycline, dicloxacillin, doripenem, doxycycline, eravacycline, ertapenem, erythromycin, fidaxomicin, fosfomycin, gatifloxacin, gemifloxacin, gentamicin, imipenem, lefamulin, lincomycin, linezolid, lomefloxacin, loracarbef, meropenem, metronidazole, minocycline, moxifloxacin, nafcillin, nalidixic acid, neomycin, norfloxacin, ofloxacin, omadacycline, oritavancin, oxacillin, oxytetracycline, paromomycin, penicillin, pentamidine, piperacillin, plazomicin, quinupristin, rifaximin, sarecycline, secnidazole, sparfloxacin, spectinomycin, sulfamethoxazole, sulfisoxazole, tedizolid, telavancin, telithromycin, ticarcillin, tigecycline, tobramycin, trimethoprim, trovafloxacin, and vancomycin. Representative examples of antiviral agents include, but are not limited to, abacavir, acyclovir, adefovir, amantadine, amprenavir, atazanavir, balavir, baloxavir marboxil, boceprevir, cidofovir, cobicistat, daclatasvir, darunavir, delavirdine, didanosine, docasanol, dolutegravir, doravirine, ecoliever, edoxudine, efavirenz, elvitegravir, emtricitabine, enfuvirtide, entecavir, etravirine, famciclovir, fomivirsen, fosamprenavir, forscarnet, fosnonet, famciclovir, favipravir, fomivirsen, foscavir, ganciclovir, ibacitabine, idoxuridine, indinavir, inosine, inosine pranobex, interferon type I, interferon type II, interferon type III, lamivudine, letermovir, letermovir, lopinavir, loviride, maraviroc, methisazone, moroxydine, nelfinavir, nevirapine, nitazoxanide, oseltamivir, peginterferon alfa-2a, peginterferon alfa- 2b, penciclovir, peramivir, pleconaril, podophyllotoxin, pyramidine, raltegravir, remdesevir, ribavirin, rilpivirine, rimantadine, rintatolimod, molnupiravir, ritonavir, saquinavir, simeprevir, sofosbuvir, stavudine, tarabivirin, telaprevir, telbivudine, tenofovir alafenamide, tenofovir disoproxil, tenofovir, Attorney Docket No. 11650-002WO1 tipranavir, trifluridine, trizivir, tromantadine, umifenovir, valaciclovir, valganciclovir, vidarabine, zalcitabine, zanamivir, and zidovudine. Representative examples of anticoagulant agents include, but are not limited to, heparin, warfarin, rivaroxaban, dabigatran, apixaban, edoxaban, enoxaparin, and fondaparinux. Representative examples of antiplatelet agents include, but are not limited to, clopidogrel, ticagrelor, prasugrel, dipyridamole, dipyridamole / aspirin, ticlopidine, and eptifibatide. Representative examples of antifungal agents include, but are not limited to, voriconazole, itraconazole, posaconazole, fluconazole, ketoconazole, clotrimazole, isavuconazonium, miconazole, caspofungin, anidulafungin, micafungin, griseofulvin, terbinafine, flucytosine, terbinafine, nystatin, and amphotericin b. Representative examples of steroidal anti-inflammatory agents include, but are not limited to, hydrocortisone, dexamethasone, prednisolone, prednisone, triamcinolone, methylprednisolone, budesonide, betamethasone, cortisone, and deflazacort. Representative examples of non-steroidal anti- inflammatory drugs include ibuprofen, naproxen, ketoprofen, tolmetin, etodolac, fenoprofen, flurbiprofen, diclofenac, piroxicam, indomethacin, sulindax, meloxicam, nabumetone, oxaprozin, mefenamic acid, and diflunisal. Other examples of active agents include chloroquine, hydrochloroquine, Pyridoxal phosphate, Vitamin D, and Vitamin C. Representative examples of anticytokine or immunomodulatory agents, but are not limited to, tocilizumab, sarilumab, bevacizumab, fingolimod, imiquimod, and eculizumab. Representative examples of contraceptives include, but are not limited to, progestins, estrogens, or any combination thereof. For example, suitable progestins include, but are not limited to, natural and synthetic compounds having progestational activity, such as, for example, progesterone, chlormadinone acetate, norethindrone, cyproterone acetate, norethindrone acetate, desogestrel, levonorgestrel, drospirenone, trimegestone, norgestrel, norgestimate, norelgestromin, etonogestrel, gestodene, and other natural and / or synthetic gestagens. For example suitable estrogens include, but are not limited to, natural and synthetic compounds having estrogenic activity, such as, for example, estradiol (17β-estradiol), 17α-estradiol, estriol, estrone, and their esters, such as the acetate, sulfate, valerate or benzoate esters of these compounds, including, for example, estradiol 17β-cypionate, estradiol 17- propionate, estradiol 3-benzoate, and piperazine estrone sulfate; ethinyl estradiol; conjugated estrogens (natural and synthetic); mestranol; agonistic anti-estrogens; and selective estrogen receptor modulators. Other examples of contraceptives include gonodotropin releasing Attorney Docket No. 11650-002WO1 hormone (GnRh) or anologs thereof such as deslorelin, avorelin, leuprolide, triptorelin, nafarelin, goserelin, buserelin, and fertirelin. The term “steroid” refers to compounds belonging to or related to the following illustrative families of compounds: corticosteroids, mineralicosteroids, and sex steroids (including, for example, potentially androgenic or estrogenic or anti-androgenic and anti- estrogenic molecules). Included among these are, for example, prednisone, prednisolone, methyl-prednisolone, triamcinolone, fluocinolone, aldosterone, spironolactone, danazol (otherwise known as OPTINA), and others. In some embodiments, the therapeutic agent may comprise a steroid. Exemplary cancer drugs or anti-cancer agents can include, but are not limited to, antimetabolite anti- cancer agents and antimitotic anti-cancer agents, and combinations thereof. Various antimetabolite and antimitotic anti-cancer agents, including single such agents or combinations of such agents, may be employed in the methods and compositions described herein. Antimetabolic anti-cancer agents typically structurally resemble natural metabolites, which are involved in normal metabolic processes of cancer cells such as the synthesis of nucleic acids and proteins. The antimetabolites, however, differ enough from the natural metabolites such that they interfere with the metabolic processes of cancer cells. In the cell, antimetabolites are mistaken for the metabolites they resemble, and are processed by the cell in a manner analogous to the normal compounds. The presence of the “decoy” metabolites prevents the cells from carrying out vital functions and the cells are unable to grow and survive. For example, antimetabolites may exert cytotoxic activity by substituting these fraudulent nucleotides into cellular DNA, thereby disrupting cellular division, or by inhibition of critical cellular enzymes, which prevents replication of DNA. In one aspect, therefore, the antimetabolite anti-cancer agent is a nucleotide or a nucleotide analog. In certain aspects, for example, the antimetabolite agent may comprise purine (e.g., guanine or adenosine) or analogs thereof, or pyrimidine (cytidine or thymidine) or analogs thereof, with or without an attached sugar moiety. Suitable antimetabolite anti-cancer agents for use in the present disclosure may be generally classified according to the metabolic process they affect, and can include, but are not limited to, analogues and derivatives of folic acid, pyrimidines, purines, and cytidine. Thus, in one aspect, the antimetabolite agent(s) is selected from the group consisting of cytidine analogs, folic acid analogs, purine analogs, pyrimidine analogs, and combinations thereof. Attorney Docket No. 11650-002WO1 In one particular aspect, for example, the antimetabolite agent is a cytidine analog. According to this aspect, for example, the cytidine analog may be selected from the group consisting of cytarabine (cytosine arabinodside), azacitidine (5-azacytidine), and salts, analogs, and derivatives thereof. In another particular aspect, for example, the antimetabolite agent is a folic acid analog. Folic acid analogs or antifolates generally function by inhibiting dihydrofolate reductase (DHFR), an enzyme involved in the formation of nucleotides; when this enzyme is blocked, nucleotides are not formed, disrupting DNA replication and cell division. According to certain aspects, for example, the folic acid analog may be selected from the group consisting of denopterin, methotrexate (amethopterin), pemetrexed, pteropterin, raltitrexed, trimetrexate, and salts, analogs, and derivatives thereof. In another particular aspect, for example, the antimetabolite agent is a purine analog. Purine- based antimetabolite agents function by inhibiting DNA synthesis, for example, by interfering with the production of purine containing nucleotides, adenine and guanine which halts DNA synthesis and thereby cell division. Purine analogs can also be incorporated into the DNA molecule itself during DNA synthesis, which can interfere with cell division. According to certain aspects, for example, the purine analog may be selected from the group consisting of acyclovir, allopurinol, 2-aminoadenosine, arabinosyl adenine (ara-A), azacitidine, azathiprine, 8-aza-adenosine, 8-fluoro-adenosine, 8-methoxy- adenosine, 8-oxo-adenosine, cladribine, deoxycoformycin, fludarabine, gancylovir, 8-aza-guanosine, 8- fluoro-guanosine, 8- methoxy-guanosine, 8-oxo-guanosine, guanosine diphosphate, guanosine diphosphate-beta- L-2-aminofucose, guanosine diphosphate-D-arabinose, guanosine diphosphate-2- fluorofucose, guanosine diphosphate fucose, mercaptopurine (6-MP), pentostatin, thiamiprine, thioguanine (6-TG), and salts, analogs, and derivatives thereof. In yet another particular aspect, for example, the antimetabolite agent is a pyrimidine analog. Similar to the purine analogs discussed above, pyrimidine-based antimetabolite agents block the synthesis of pyrimidine-containing nucleotides (cytosine and thymine in DNA; cytosine and uracil in RNA). By acting as “decoys,” the pyrimidine-based compounds can prevent the production of nucleotides, and / or can be incorporated into a growing DNA chain and lead to its termination. According to certain aspects, for example, the pyrimidine analog may be selected from the group consisting of ancitabine, azacitidine, 6-azauridine, bromouracil (e.g., 5-bromouracil), capecitabine, carmofur, chlorouracil (e.g.5-chlorouracil), cytarabine (cytosine arabinoside), cytosine, dideoxyuridine, 3′-azido-3′- deoxythymidine, 3′- dideoxycytidin-2′-ene, 3′-deoxy-3′-deoxythymidin-2′-ene, dihydrouracil, doxifluridine, enocitabine, floxuridine, 5-fluorocytosine, 2-fluorodeoxycytidine, 3-fluoro-3′- deoxythymidine, fluorouracil (e.g., 5-fluorouracil (also known as 5-FU), gemcitabine, 5-methylcytosine, Attorney Docket No. 11650-002WO1 5- propynylcytosine, 5-propynylthymine, 5-propynyluracil, thymine, uracil, uridine, and salts, analogs, and derivatives thereof. In one aspect, the pyrimidine analog is other than 5- fluorouracil. In another aspect, the pyrimidine analog is gemcitabine or a salt thereof. In certain aspects, the antimetabolite agent is selected from the group consisting of 5- fluorouracil, capecitabine, 6-mercaptopurine, methotrexate, gemcitabine, cytarabine, fludarabine, pemetrexed, and salts, analogs, derivatives, and combinations thereof. In other aspects, the antimetabolite agent is selected from the group consisting of capecitabine, 6- mercaptopurine, methotrexate, gemcitabine, cytarabine, fludarabine, pemetrexed, and salts, analogs, derivatives, and combinations thereof. In one particular aspect, the antimetabolite agent is other than 5-fluorouracil. In a particularly preferred aspect, the antimetabolite agent is gemcitabine or a salt or thereof (e.g., gemcitabine HCl (Gemzar®)). Other antimetabolite anti-cancer agents may be selected from, but are not limited to, the group consisting of acanthifolic acid, aminothiadiazole, brequinar sodium, Ciba-Geigy CGP-30694, cyclopentyl cytosine, cytarabine phosphate stearate, cytarabine conjugates, Lilly DATHF, Merrel Dow DDFC, dezaguanine, dideoxycytidine, dideoxyguanosine, didox, Yoshitomi DMDC, Wellcome EHNA, Merck & Co. EX-015, fazarabine, fludarabine phosphate, N-(2′-furanidyl)-5-fluorouracil, Daiichi Seiyaku FO-152, 5- FU-fibrinogen, isopropyl pyrrolizine, Lilly LY-188011; Lilly LY-264618, methobenzaprim, Wellcome MZPES, norspermidine, NCI NSC-127716, NCI NSC-264880, NCI NSC-39661, NCI NSC-612567, Warner- Lambert PALA, pentostatin, piritrexim, plicamycin, Asahi Chemical PL-AC, Takeda TAC-788, tiazofurin, Erbamont TIF, tyrosine kinase inhibitors, Taiho UFT and uricytin, among others. In one aspect, the antimitotic agent is a microtubule inhibitor or a microtubule stabilizer. In general, microtubule stabilizers, such as taxanes and epothilones, bind to the interior surface of the beta-microtubule chain and enhance microtubule assembly by promoting the nucleation and elongation phases of the polymerization reaction and by reducing the critical tubulin subunit concentration required for microtubules to assemble. Unlike mictrotubule inhibitors, such as the vinca alkaloids, which prevent microtubule assembly, the microtubule stabilizers, such as taxanes, decrease the lag time and dramatically shift the dynamic equilibrium between tubulin dimers and microtubule polymers towards polymerization. In one aspect, therefore, the microtubule stabilizer is a taxane or an epothilone. In another aspect, the microtubule inhibitor is a vinca alkaloid. In some embodiments, the therapeutic agent may comprise a taxane or derivative or analog thereof. The taxane may be a naturally derived compound or a related form, or may be a chemically synthesized compound or a derivative thereof, with antineoplastic properties. The taxanes are a family Attorney Docket No. 11650-002WO1 of terpenes, including, but not limited to paclitaxel (Taxol®) and docetaxel (Taxotere®), which are derived primarily from the Pacific yew tree, Taxus brevifolia, and which have activity against certain tumors, particularly breast and ovarian tumors. In one aspect, the taxane is docetaxel or paclitaxel. Paclitaxel is a preferred taxane and is considered an antimitotic agent that promotes the assembly of microtubules from tubulin dimers and stabilizes microtubules by preventing depolymerization. This stability results in the inhibition of the normal dynamic reorganization of the microtubule network that is essential for vital interphase and mitotic cellular functions. Also included are a variety of known taxane derivatives, including both hydrophilic derivatives, and hydrophobic derivatives. Taxane derivatives include, but are not limited to, galactose and mannose derivatives described in International Patent Application No. WO 99 / 18113; piperazino and other derivatives described in WO 99 / 14209; taxane derivatives described in WO 99 / 09021, WO 98 / 22451, and U.S. Pat. No.5,869,680; 6-thio derivatives described in WO 98 / 28288; sulfenamide derivatives described in U.S. Pat. No.5,821,263; deoxygenated paclitaxel compounds such as those described in U.S. Pat. No.5,440,056; and taxol derivatives described in U.S. Pat. No.5,415,869. As noted above, it further includes prodrugs of paclitaxel including, but not limited to, those described in WO 98 / 58927; WO 98 / 13059; and U.S. Pat. No.5,824,701. The taxane may also be a taxane conjugate such as, for example, paclitaxel-PEG, paclitaxel-dextran, paclitaxel-xylose, docetaxel-PEG, docetaxel- dextran, docetaxel- xylose, and the like. Other derivatives are mentioned in “Synthesis and Anticancer Activity of Taxol Derivatives,” D. G. I. Kingston et al., Studies in Organic Chemistry, vol.26, entitled “New Trends in Natural Products Chemistry” (1986), Atta-ur-Rabman, P. W. le Quesne, Eds. (Elsevier, Amsterdam 1986), among other references. Each of these references is hereby incorporated by reference herein in its entirety. Various taxanes may be readily prepared utilizing techniques known to those skilled in the art (see also WO 94 / 07882, WO 94 / 07881, WO 94 / 07880, WO 94 / 07876, WO 93 / 23555, WO 93 / 10076; U.S. Pat. Nos.5,294,637; 5,283,253; 5,279,949; 5,274,137; 5,202,448; 5,200,534; 5,229,529; and EP 590,267) (each of which is hereby incorporated by reference herein in its entirety), or obtained from a variety of commercial sources, including for example, Sigma-Aldrich Co., St. Louis, Mo. Alternatively, the antimitotic agent can be a microtubule inhibitor; in one preferred aspect, the microtubule inhibitor is a vinca alkaloid. In general, the vinca alkaloids are mitotic spindle poisons. The vinca alkaloid agents act during mitosis when chromosomes are split and begin to migrate along the tubules of the mitosis spindle towards one of its poles, prior to cell separation. Under the action of these spindle poisons, the spindle becomes disorganized by the dispersion of chromosomes during mitosis, Attorney Docket No. 11650-002WO1 affecting cellular reproduction. According to certain aspects, for example, the vinca alkaloid is selected from the group consisting of vinblastine, vincristine, vindesine, vinorelbine, and salts, analogs, and derivatives thereof. The antimitotic agent can also be an epothilone. In general, members of the epothilone class of compounds stabilize microtubule function according to mechanisms similar to those of the taxanes. Epothilones can also cause cell cycle arrest at the G2-M transition phase, leading to cytotoxicity and eventually apoptosis. Suitable epithiolones include epothilone A, epothilone B, epothilone C, epothilone D, epothilone E, and epothilone F, and salts, analogs, and derivatives thereof. One particular epothilone analog is an epothilone B analog, ixabepilone (Ixempra™). In certain aspects, the antimitotic anti-cancer agent is selected from the group consisting of taxanes, epothilones, vinca alkaloids, and salts and combinations thereof. Thus, for example, in one aspect the antimitotic agent is a taxane. More preferably in this aspect the antimitotic agent is paclitaxel or docetaxel, still more preferably paclitaxel. In another aspect, the antimitotic agent is an epothilone (e.g., an epothilone B analog). In another aspect, the antimitotic agent is a vinca alkaloid. Examples of cancer drugs that may be used in the present disclosure include, but are not limited to: thalidomide; platinum coordination complexes such as cisplatin (cis-DDP), oxaliplatin and carboplatin; anthracenediones such as mitoxantrone; substituted ureas such as hydroxyurea; methylhydrazine derivatives such as procarbazine (N- methylhydrazine, MIH); adrenocortical suppressants such as mitotane (o,p′-DDD) and aminoglutethimide; RXR agonists such as bexarotene; and tyrosine kinase inhibitors such as sunitimib and imatinib. Examples of additional cancer drugs include alkylating agents, antimetabolites, natural products, hormones and antagonists, and miscellaneous agents. Alternate names are indicated in parentheses. Examples of alkylating agents include nitrogen mustards such as mechlorethamine, cyclophosphainide, ifosfamide, melphalan sarcolysin) and chlorambucil; ethylenimines and methylmelamines such as hexamethylmelamine and thiotepa; alkyl sulfonates such as busulfan; nitrosoureas such as carmustine (BCNU), semustine (methyl-CCNU), lomustine (CCNU) and streptozocin (streptozotocin); DNA synthesis antagonists such as estramustine phosphate; and triazines such as dacarbazine (DTIC, dimethyl-triazenoimidazolecarboxamide) and temozolomide. Examples of antimetabolites include folic acid analogs such as methotrexate (amethopterin); pyrimidine analogs such as fluorouracin (5-fluorouracil, 5-FU, SFU), floxuridine (fluorodeoxyuridine, FUdR), cytarabine (cytosine arabinoside) and gemcitabine; purine analogs such as mercaptopurine (6-mercaptopurine, 6-MP), thioguanine (6-thioguanine, TG) and pentostatin (2′- deoxycoformycin, deoxycoformycin), cladribine and fludarabine; and topoisomerase inhibitors such as Attorney Docket No. 11650-002WO1 amsacrine. Examples of natural products include vinca alkaloids such as vinblastine (VLB) and vincristine; taxanes such as paclitaxel, protein bound paclitaxel (Abraxane) and docetaxel (Taxotere); epipodophyllotoxins such as etoposide and teniposide; camptothecins such as topotecan and irinotecan; antibiotics such as dactinomycin (actinomycin D), daunorubicin (daunomycin, rubidomycin), doxorubicin, histrelin, bleomycin, mitomycin (mitomycin C), idarubicin, epirubicin; enzymes such as L- asparaginase; and biological response modifiers such as interferon alpha and interlelukin 2. Examples of hormones and antagonists include luteinising releasing hormone agonists such as buserelin; adrenocorticosteroids such as prednisone and related preparations; progestins such as hydroxyprogesterone caproate, rnedroxyprogesterone acetate and megestrol acetate; estrogens such as diethylstilbestrol and ethinyl estradiol and related preparations; estrogen antagonists such as tamoxifen and anastrozole; androgens such as testosterone propionate and fluoxymesterone and related preparations; androgen antagonists such as flutamide and bicalutamide; and gonadotropin-releasing hormone analogs such as leuprolide. Alternate names and trade-names of these and additional examples of cancer drugs, and their methods of use including dosing and administration regimens, will be known to a person versed in the art. In some aspects, the anti-cancer agent may comprise a chemotherapeutic agent. Suitable chemotherapeutic agents include, but are not limited to, alkylating agents, antibiotic agents, antimetabolic agents, hormonal agents, plant-derived agents and their synthetic derivatives, anti- angiogenic agents, differentiation inducing agents, cell growth arrest inducing agents, apoptosis inducing agents, cytotoxic agents, agents affecting cell bioenergetics i.e., affecting cellular ATP levels and molecules / activities regulating these levels, biologic agents, e.g., monoclonal antibodies, kinase inhibitors and inhibitors of growth factors and their receptors, gene therapy agents, cell therapy, e.g., stem cells, or any combination thereof. According to these aspects, the chemotherapeutic agent is selected from the group consisting of cyclophosphamide, chlorambucil, melphalan, mechlorethamine, ifosfamide, busulfan, lomustine, streptozocin, temozolomide, dacarbazine, cisplatin, carboplatin, oxaliplatin, procarbazine, uramustine, methotrexate, pemetrexed, fludarabine, cytarabine, fluorouracil, floxuridine, gemcitabine, capecitabine, vinblastine, vincristine, vinorelbine, etoposide, paclitaxel, docetaxel, doxorubicin, daunorubicin, epirubicin, idarubicin, mitoxantrone, bleomycin, mitomycin, hydroxyurea, topotecan, irinotecan, amsacrine, teniposide, erlotinib hydrochloride and combinations thereof. Each possibility represents a separate aspect of the invention. Attorney Docket No. 11650-002WO1 According to certain aspects, the therapeutic agent may comprise a biologic drug, particularly an antibody. According to some aspects, the antibody is selected from the group consisting of cetuximab, anti-CD24 antibody, panitumumab and bevacizumab. Growth factors useful as therapeutic agents include, but are not limited to, transforming growth factor-α (“TGF-α”), transforming growth factors (“TGF-β”), platelet-derived growth factors (“PDGF”), fibroblast growth factors (“FGF”), including FGF acidic isoforms 1 and 2, FGF basic form 2 and FGF 4, 8, 9 and 10, nerve growth factors (“NGF”) including NGF 2.5s, NGF 7.0s and beta NGF and neurotrophins, brain derived neurotrophic factor, cartilage derived factor, bone growth factors (BGF), basic fibroblast growth factor, insulin-like growth factor (IGF), vascular endothelial growth factor (VEGF), granulocyte colony stimulating factor (G-CSF), insulin like growth factor (IGF) I and II, hepatocyte growth factor, glial neurotrophic growth factor (GDNF), stem cell factor (SCF), keratinocyte growth factor (KGF), transforming growth factors (TGF), including TGFs alpha, beta, beta1, beta2, beta3, skeletal growth factor, bone matrix derived growth factors, and bone derived growth factors and mixtures thereof. Cytokines useful as therapeutic agents include, but are not limited to, cardiotrophin, stromal cell derived factor, macrophage derived chemokine (MDC), melanoma growth stimulatory activity (MGSA), macrophage inflammatory proteins 1 alpha (MIP-1alpha), 2, 3 alpha, 3 beta, 4 and 5, IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11, IL-12, IL-13, TNF-α, and TNF-β. Immunoglobulins useful in the present disclosure include, but are not limited to, IgG, IgA, IgM, IgD, IgE, and mixtures thereof. Some preferred growth factors include VEGF (vascular endothelial growth factor), NGFs (nerve growth factors), PDGF-AA, PDGF-BB, PDGF-AB, FGFb, FGFa, and BGF. Other molecules useful as therapeutic agents include but are not limited to growth hormones, leptin, leukemia inhibitory factor (LIF), tumor necrosis factor alpha and beta, endostatin, thrombospondin, osteogenic protein-1, bone morphogenetic proteins 2 and 7, osteonectin, somatomedin-like peptide, osteocalcin, , interferon alpha, interferon alpha A, interferon beta, interferon gamma, interferon 1 alpha, and interleukins 2, 3, 4, 56, 7, 8, 9, 10, 11, 12,13, 15, 16, 17 and 18. Diagnostic agents include gases; metals; commercially available imaging agents used in positron emissions tomography (PET), computer assisted tomography (CAT), single photon emission computerized tomography, x-ray, fluoroscopy, and magnetic resonance imaging (MRI); and contrast agents. Examples of suitable materials for use as contrast agents in MRI include gadolinium chelates, as well as iron, magnesium, manganese, copper, and chromium. Examples of materials useful for CAT and x-ray imaging include iodine-based materials. Attorney Docket No. 11650-002WO1 Therapeutic and prophylactic agents include, but are not limited to, antibiotics, nutritional supplements, and vaccines. Vaccines may comprise isolated proteins or peptides, inactivated organisms and viruses, dead organisms and viruses, genetically altered organisms or viruses, cell extracts, and RNA encoding at least one antigenic polypeptide or an immunogenic fragment thereof (e.g., an immunogenic fragment capable of inducing an immune response to the antigenic polypeptide). Therapeutic and prophylactic agents may be combined with interleukins, interferon, cytokines, and adjuvants such as cholera toxin, alum, Freund's adjuvant, etc. Prophylactic agents can include infection agents such as antigens of such bacterial organisms as Streptococccus pneumoniae, Haemophilus influenzae, Staphylococcus aureus, Streptococcus pyrogenes, Corynebacterium diphtheriae, Listeria monocytogenes, Bacillus anthracis, Clostridium tetani, Clostridium botulinum, Clostridium perfringens, Neisseria meningitidis, Neisseria gonorrhoeae, Streptococcus mutans, Pseudomonas aeruginosa, Salmonella typhi, Haemophilus parainfluenzae, Bordetella pertussis, Francisella tularensis, Yersinia pestis, Vibrio cholerae, Legionella pneumophila, Mycobacterium tuberculosis, Mycobacterium leprae, Treponema pallidum, Leptospirosis interrogans, Borrelia burgdorferi, Camphylobacter jejuni, and the like; antigens of such viruses as human Metapneumovirus (hMPV), human parainfluenza viruses (hPIV) types 1, 2, and 3 (hPIV1, hPIV2 and hPIV3, respectively), respiratory syncytial virus (RSV), measles virus (MeV), coronaviruses (e.g., MERS-CoV, SARS-CoV, SARS-CoV2, HCoV-OC43, HCoV-229E, HCoV-NL63, HCoV-NL, HCoV-NH, HCoV-HKU1), poxviruses (e.g., smallpox, monkeypox), influenza A and B, HIV, varicella-zoster, herpes simplex 1 and 2, cytomegalovirus, Epstein-Barr virus, rotavirus, rhinovirus, adenovirus, papillomavirus, poliovirus, mumps, rabies, rubella, coxsackieviruses, equine encephalitis, Japanese encephalitis, yellow fever, Rift Valley fever, hepatitis A, B, C, D, and E virus, and the like; antigens of fungal, protozoan, and parasitic organisms such as Cryptococcus neoformans, Histoplasma capsulatum, Candida albicans, Candida tropicalis, Nocardia asteroides, Rickettsia ricketsii, Rickettsia typhi, Mycoplasma pneumoniae, Chlamydial psittaci, Chlamydial trachomatis, Plasmodium falciparum, Trypanosoma brucei, Entamoeba histolytica, Toxoplasma gondii, Trichomonas vaginalis, Schistosoma mansoni, and the like. These antigens may be in the form of whole killed organisms, peptides, proteins, glycoproteins, carbohydrates, or combinations thereof. In some embodiments, the Archexin or a pharmaceutically acceptable salt thereof can further include an excipient. The term "pharmaceutically acceptable carrier" (sometimes referred to as a "carrier") means a carrier or excipient that is useful in preparing a pharmaceutical or therapeutic composition that is generally safe and non-toxic and includes a carrier that is acceptable for veterinary and / or human Attorney Docket No. 11650-002WO1 pharmaceutical or therapeutic use. The terms "carrier" or "pharmaceutically acceptable carrier" can include, but are not limited to, phosphate buffered saline solution, water, emulsions (such as an oil / water or water / oil emulsion) and / or various types of wetting agents. As used herein, the term "carrier" encompasses, but is not limited to, any excipient, diluent, filler, salt, buffer, stabilizer, solubilizer, lipid, stabilizer, or other material well known in the art for use in pharmaceutical formulations and as described further herein. “Excipients” include any and all solvents, diluents or other liquid vehicles, dispersion or suspension aids, surface active agents, isotonic agents, thickening or emulsifying agents, preservatives, solid binders, lubricants and the like, as suited to the particular dosage form desired. General considerations in formulation and / or manufacture can be found, for example, in Remington's Pharmaceutical Sciences, Sixteenth Edition, E. W. Martin (Mack Publishing Co., Easton, Pa., 1980), and Remington: The Science and Practice of Pharmacy, 21st Edition (Lippincott Williams & Wilkins, 2005). Exemplary excipients include, but are not limited to, any non-toxic, inert solid, semisolid or liquid filler, diluent, encapsulating material or formulation auxiliary of any type. Some examples of materials which can serve as excipients include, but are not limited to, sugars such as lactose, glucose, and sucrose; starches such as corn starch and potato starch; cellulose and its derivatives such as sodium carboxymethyl cellulose, ethyl cellulose, and cellulose acetate; powdered tragacanth; malt; gelatin; talc; excipients such as cocoa butter and suppository waxes; oils such as peanut oil, cottonseed oil; safflower oil; sesame oil; olive oil; corn oil and soybean oil; glycols such as propylene glycol; esters such as ethyl oleate and ethyl laurate; agar; detergents such as Tween 80; buffering agents such as magnesium hydroxide and aluminum hydroxide; alginic acid; pyrogen-free water; isotonic saline; Ringer's solution; ethyl alcohol; and phosphate buffer solutions, as well as other non-toxic compatible lubricants such as sodium lauryl sulfate and magnesium stearate, as well as coloring agents, releasing agents, coating agents, sweetening, flavoring and perfuming agents, preservatives and antioxidants can also be present in the composition, according to the judgment of the formulator. As would be appreciated by one of skill in this art, the excipients may be chosen based on what the composition is useful for. For example, with a pharmaceutical composition, the choice of the excipient will depend on the route of administration, the agent being delivered, time course of delivery of the agent, etc., and can be administered to humans and / or to animals, orally, rectally, parenterally, intracisternally, intravaginally, intranasally, intraperitoneally, topically (as by powders, creams, ointments, or drops), buccally, or as an oral or nasal spray. In some embodiments, the active compounds disclosed herein are administered topically. Attorney Docket No. 11650-002WO1 Exemplary diluents include calcium carbonate, sodium carbonate, calcium phosphate, dicalcium phosphate, calcium sulfate, calcium hydrogen phosphate, sodium phosphate lactose, sucrose, cellulose, microcrystalline cellulose, kaolin, mannitol, sorbitol, inositol, sodium chloride, dry starch, cornstarch, powdered sugar, etc., and combinations thereof. Exemplary granulating and / or dispersing agents include potato starch, corn starch, tapioca starch, sodium starch glycolate, clays, alginic acid, guar gum, citrus pulp, agar, bentonite, cellulose and wood products, natural sponge, cation-exchange resins, calcium carbonate, silicates, sodium carbonate, cross-linked poly(vinyl-pyrrolidone) (crospovidone), sodium carboxymethyl starch (sodium starch glycolate), carboxymethyl cellulose, cross- linked sodium carboxymethyl cellulose (croscarmellose), methylcellulose, pregelatinized starch (starch 1500), microcrystalline starch, water insoluble starch, calcium carboxymethyl cellulose, magnesium aluminum silicate (Veegum), sodium lauryl sulfate, quaternary ammonium compounds, etc., and combinations thereof. Exemplary surface active agents and / or emulsifiers include natural emulsifiers (e.g. acacia, agar, alginic acid, sodium alginate, tragacanth, chondrux, cholesterol, xanthan, pectin, gelatin, egg yolk, casein, wool fat, cholesterol, wax, and lecithin), colloidal clays (e.g. bentonite [aluminum silicate] and Veegum [magnesium aluminum silicate]), long chain amino acid derivatives, high molecular weight alcohols (e.g. stearyl alcohol, cetyl alcohol, oleyl alcohol, triacetin monostearate, ethylene glycol distearate, glyceryl monostearate, and propylene glycol monostearate, polyvinyl alcohol), carbomers (e.g. carboxy polymethylene, polyacrylic acid, acrylic acid polymer, and carboxy vinyl polymer), carrageenan, cellulosic derivatives (e.g. carboxymethylcellulose sodium, powdered cellulose, hydroxymethyl cellulose, hydroxypropyl cellulose, hydroxypropyl methylcellulose, methylcellulose), sorbitan fatty acid esters (e.g. polyoxyethylene sorbitan monolaurate [Tween 20], polyoxyethylene sorbitan [Tween 60], polyoxyethylene sorbitan monooleate [Tween 80], sorbitan monopalmitate [Span 40], sorbitan monostearate [Span 60], sorbitan tristearate [Span 65], glyceryl monooleate, sorbitan monooleate [Span 80]), polyoxyethylene esters (e.g. polyoxyethylene monostearate [Myrj 45], polyoxyethylene hydrogenated castor oil, polyethoxylated castor oil, polyoxymethylene stearate, and Solutol), sucrose fatty acid esters, polyethylene glycol fatty acid esters (e.g. Cremophor), polyoxyethylene ethers, (e.g. polyoxyethylene lauryl ether [Brij 30]), poly(vinyl-pyrrolidone), diethylene glycol monolaurate, triethanolamine oleate, sodium oleate, potassium oleate, ethyl oleate, oleic acid, ethyl laurate, sodium lauryl sulfate, Pluronic F 68, Poloxamer 188, cetrimonium bromide, cetylpyridinium chloride, benzalkonium chloride, docusate sodium, etc. and / or combinations thereof. Exemplary binding agents include starch (e.g. cornstarch and starch paste), gelatin, sugars (e.g. sucrose, Attorney Docket No. 11650-002WO1 glucose, dextrose, dextrin, molasses, lactose, lactitol, mannitol, etc.), natural and synthetic gums (e.g. acacia, sodium alginate, extract of Irish moss, panwar gum, ghatti gum, mucilage of isapol husks, carboxymethylcellulose, methylcellulose, ethylcellulose, hydroxyethylcellulose, hydroxypropyl cellulose, hydroxypropyl methylcellulose, microcrystalline cellulose, cellulose acetate, poly(vinyl-pyrrolidone), magnesium aluminum silicate (Veegum), and larch arabogalactan), alginates, polyethylene oxide, polyethylene glycol, inorganic calcium salts, silicic acid, polymethacrylates, waxes, water, alcohol, etc., and / or combinations thereof. Exemplary preservatives include antioxidants, chelating agents, antimicrobial preservatives, antifungal preservatives, alcohol preservatives, acidic preservatives, and other preservatives. Exemplary antioxidants include alpha tocopherol, ascorbic acid, ascorbyl palmitate, butylated hydroxyanisole, butylated hydroxytoluene, monothioglycerol, potassium metabisulfite, propionic acid, propyl gallate, sodium ascorbate, sodium bisulfite, sodium metabisulfite, and sodium sulfite. Exemplary chelating agents include ethylenediaminetetraacetic acid (EDTA) and salts and hydrates thereof (e.g., sodium edetate, disodium edetate, trisodium edetate, calcium disodium edetate, dipotassium edetate, and the like), citric acid and salts and hydrates thereof (e.g., citric acid monohydrate), fumaric acid and salts and hydrates thereof, malic acid and salts and hydrates thereof, phosphoric acid and salts and hydrates thereof, and tartaric acid and salts and hydrates thereof. Exemplary antimicrobial preservatives include benzalkonium chloride, benzethonium chloride, benzyl alcohol, bronopol, cetrimide, cetylpyridinium chloride, chlorhexidine, chlorobutanol, chlorocresol, chloroxylenol, cresol, ethyl alcohol, glycerin, hexetidine, imidurea, phenol, phenoxyethanol, phenylethyl alcohol, phenylmercuric nitrate, propylene glycol, and thimerosal. Exemplary antifungal preservatives include butyl paraben, methyl paraben, ethyl paraben, propyl paraben, benzoic acid, hydroxybenzoic acid, potassium benzoate, potassium sorbate, sodium benzoate, sodium propionate, and sorbic acid. Exemplary alcohol preservatives include ethanol, polyethylene glycol, phenol, phenolic compounds, bisphenol, chlorobutanol, hydroxybenzoate, and phenylethyl alcohol. Exemplary acidic preservatives include vitamin A, vitamin C, vitamin E, beta- carotene, citric acid, acetic acid, dehydroacetic acid, ascorbic acid, sorbic acid, and phytic acid. Other preservatives include tocopherol, tocopherol acetate, deteroxime mesylate, cetrimide, butylated hydroxyanisol (BHA), butylated hydroxytoluene (BHT), ethylenediamine, sodium lauryl sulfate (SLS), sodium lauryl ether sulfate (SLES), sodium bisulfite, sodium metabisulfite, potassium sulfite, potassium metabisulfite, Glydant Plus, Phenonip, methylparaben, Germall 115, Germaben II, Neolone, Kathon, and Euxyl. In Attorney Docket No. 11650-002WO1 certain embodiments, the preservative is an anti-oxidant. In other embodiments, the preservative is a chelating agent. Exemplary buffering agents include citrate buffer solutions, acetate buffer solutions, phosphate buffer solutions, ammonium chloride, calcium carbonate, calcium chloride, calcium citrate, calcium glubionate, calcium gluceptate, calcium gluconate, D-gluconic acid, calcium glycerophosphate, calcium lactate, propanoic acid, calcium levulinate, pentanoic acid, dibasic calcium phosphate, phosphoric acid, tribasic calcium phosphate, calcium hydroxide phosphate, potassium acetate, potassium chloride, potassium gluconate, potassium mixtures, dibasic potassium phosphate, monobasic potassium phosphate, potassium phosphate mixtures, sodium acetate, sodium bicarbonate, sodium chloride, sodium citrate, sodium lactate, dibasic sodium phosphate, monobasic sodium phosphate, sodium phosphate mixtures, tromethamine, magnesium hydroxide, aluminum hydroxide, alginic acid, pyrogen- free water, isotonic saline, Ringer's solution, ethyl alcohol, etc., and combinations thereof. Exemplary lubricating agents include magnesium stearate, calcium stearate, stearic acid, silica, talc, malt, glyceryl behanate, hydrogenated vegetable oils, polyethylene glycol, sodium benzoate, sodium acetate, sodium chloride, leucine, magnesium lauryl sulfate, sodium lauryl sulfate, etc., and combinations thereof. Exemplary natural oils include almond, apricot kernel, avocado, babassu, bergamot, black current seed, borage, cade, chamomile, canola, caraway, carnauba, castor, cinnamon, cocoa butter, coconut, cod liver, coffee, corn, cotton seed, emu, eucalyptus, evening primrose, fish, flaxseed, geraniol, gourd, grape seed, hazel nut, hyssop, isopropyl myristate, jojoba, kukui nut, lavandin, lavender, lemon, litsea cubeba, macademia nut, mallow, mango seed, meadowfoam seed, mink, nutmeg, olive, orange, orange roughy, palm, palm kernel, peach kernel, peanut, poppy seed, pumpkin seed, rapeseed, rice bran, rosemary, safflower, sandalwood, sasquana, savoury, sea buckthorn, sesame, shea butter, silicone, soybean, sunflower, tea tree, thistle, tsubaki, vetiver, walnut, and wheat germ oils. Exemplary synthetic oils include, but are not limited to, butyl stearate, caprylic triglyceride, capric triglyceride, cyclomethicone, diethyl sebacate, dimethicone 360, isopropyl myristate, mineral oil, octyldodecanol, oleyl alcohol, silicone oil, and combinations thereof. Additionally, the composition may further comprise a polymer. Exemplary polymers contemplated herein include, but are not limited to, cellulosic polymers and copolymers, for example, cellulose ethers such as methylcellulose (MC), hydroxyethylcellulose (HEC), hydroxypropyl cellulose (HPC), hydroxypropyl methyl cellulose (HPMC), methylhydroxyethylcellulose (MHEC), methylhydroxypropylcellulose (MHPC), carboxymethyl cellulose (CMC) and its various salts, including, Attorney Docket No. 11650-002WO1 e.g., the sodium salt, hydroxyethylcarboxymethylcellulose (HECMC) and its various salts, carboxymethylhydroxyethylcellulose (CMHEC) and its various salts, other polysaccharides and polysaccharide derivatives such as starch, dextran, dextran derivatives, chitosan, and alginic acid and its various salts, carageenan, various gums, including xanthan gum, guar gum, gum arabic, gum karaya, gum ghatti, konjac and gum tragacanth, glycosaminoglycans and proteoglycans such as hyaluronic acid and its salts, proteins such as gelatin, collagen, albumin, and fibrin, other polymers, for example, polyhydroxyacids such as polylactide, polyglycolide, polyl(lactide-co-glycolide) and poly(.epsilon.- caprolactone-co-glycolide)-, carboxyvinyl polymers and their salts (e.g., carbomer), polyvinylpyrrolidone (PVP), polyacrylic acid and its salts, polyacrylamide, polyacrylic acid / acrylamide copolymer, polyalkylene oxides such as polyethylene oxide, polypropylene oxide, poly(ethylene oxide- propylene oxide), and a Pluronic polymer, polyoxy ethylene (polyethylene glycol), polyanhydrides, polyvinylalchol, polyethyleneamine and polypyrridine, polyethylene glycol (PEG) polymers, such as PEGylated lipids (e.g., PEG-stearate, l,2-Distearoyl-sn-glycero-3-Phosphoethanolamine-N-[Methoxy(Polyethylene glycol)-1000], 1,2-Distearoyl-sn-glycero-3-Phosphoethanolamine-N-[Methoxy(Polyethylene glycol)-2000], and 1,2- Distearoyl-sn-glycero-3-Phosphoethanolamine-N-[Methoxy(Polyethylene glycol)-5000]), copolymers and salts thereof. Additionally, the composition may further comprise an emulsifying agent. Exemplary emulsifying agents include, but are not limited to, a polyethylene glycol (PEG), a polypropylene glycol, a polyvinyl alcohol, a poly-N-vinyl pyrrolidone and copolymers thereof, poloxamer nonionic surfactants, neutral water-soluble polysaccharides (e.g., dextran, Ficoll, celluloses), non-cationic poly(meth)acrylates, non- cationic polyacrylates, such as poly (meth) acrylic acid, and esters amide and hydroxy alkyl amides thereof, natural emulsifiers (e.g. acacia, agar, alginic acid, sodium alginate, tragacanth, chondrux, cholesterol, xanthan, pectin, gelatin, egg yolk, casein, wool fat, cholesterol, wax, and lecithin), colloidal clays (e.g. bentonite [aluminum silicate] and Veegum [magnesium aluminum silicate]), long chain amino acid derivatives, high molecular weight alcohols (e.g. stearyl alcohol, cetyl alcohol, oleyl alcohol, triacetin monostearate, ethylene glycol distearate, glyceryl monostearate, and propylene glycol monostearate, polyvinyl alcohol), carbomers (e.g. carboxy polymethylene, polyacrylic acid, acrylic acid polymer, and carboxy vinyl polymer), carrageenan, cellulosic derivatives (e.g. carboxymethylcellulose sodium, powdered cellulose, hydroxymethyl cellulose, hydroxypropyl cellulose, hydroxypropyl methylcellulose, methylcellulose), sorbitan fatty acid esters (e.g. polyoxyethylene sorbitan monolaurate [Tween 20], polyoxyethylene sorbitan [Tween 60], polyoxyethylene sorbitan monooleate [Tween 80], sorbitan monopalmitate [Span 40], sorbitan monostearate [Span 60], sorbitan tristearate [Span 65], Attorney Docket No. 11650-002WO1 glyceryl monooleate, sorbitan monooleate [Span 80]), polyoxyethylene esters (e.g. polyoxyethylene monostearate [Myrj 45], polyoxyethylene hydrogenated castor oil, polyethoxylated castor oil, polyoxymethylene stearate, and Solutol), sucrose fatty acid esters, polyethylene glycol fatty acid esters (e.g. Cremophor), polyoxyethylene ethers, (e.g. polyoxyethylene lauryl ether [Brij 30]), poly(vinyl- pyrrolidone), diethylene glycol monolaurate, triethanolamine oleate, sodium oleate, potassium oleate, ethyl oleate, oleic acid, ethyl laurate, sodium lauryl sulfate, Pluronic F 68, Poloxamer 188, cetrimonium bromide, cetylpyridinium chloride, benzalkonium chloride, docusate sodium, etc. and / or combinations thereof. In certain embodiments, the emulsifying agent is cholesterol. Liquid compositions include emulsions, microemulsions, solutions, suspensions, syrups, and elixirs. In addition to the active compound, the liquid composition may contain inert diluents commonly used in the art such as, for example, water or other solvents, solubilizing agents and emulsifiers such as ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butylene glycol, dimethylformamide, oils (in particular, cottonseed, groundnut, corn, germ, olive, castor, and sesame oils), glycerol, tetrahydrofurfuryl alcohol, polyethylene glycols and fatty acid esters of sorbitan, and mixtures thereof. Besides inert diluents, the oral compositions can also include adjuvants such as wetting agents, emulsifying and suspending agents, sweetening, flavoring, and perfuming agents. Injectable compositions, for example, injectable aqueous or oleaginous suspensions may be formulated according to the known art using suitable dispersing or wetting agents and suspending agents. The sterile injectable preparation may also be an injectable solution, suspension, or emulsion in a nontoxic parenterally acceptable diluent or solvent, for example, as a solution in 1,3-butanediol. Among the acceptable vehicles and solvents for pharmaceutical or cosmetic compositions that may be employed are water, Ringer's solution, U.S.P. and isotonic sodium chloride solution. In addition, sterile, fixed oils are conventionally employed as a solvent or suspending medium. Any bland fixed oil can be employed including synthetic mono- or diglycerides. In addition, fatty acids such as oleic acid are used in the preparation of injectables. In certain embodiments, the particles are suspended in a carrier fluid comprising 1% (w / v) sodium carboxymethyl cellulose and 0.1% (v / v) Tween 80. The injectable composition can be sterilized, for example, by filtration through a bacteria-retaining filter, or by incorporating sterilizing agents in the form of sterile solid compositions which can be dissolved or dispersed in sterile water or other sterile injectable medium prior to use. The compounds can be incorporated microparticles, nanoparticles (e.g., lipid nanoparticles), or combinations thereof that provide controlled release of the compounds and / or additional active agents. Attorney Docket No. 11650-002WO1 For example, the compounds can be incorporated into polymeric microparticles, which provide controlled release of the drug(s). Release of the drug(s) is controlled by diffusion of the drug(s) out of the microparticles and / or degradation of the polymeric particles by hydrolysis and / or enzymatic degradation. Suitable polymers include ethylcellulose and other natural or synthetic cellulose derivatives. Polymers, which are slowly soluble and form a gel in an aqueous environment, such as hydroxypropyl methylcellulose or polyethylene oxide, may also be suitable as materials for drug containing microparticles. Other polymers include, but are not limited to, polyanhydrides, poly(ester anhydrides), polyhydroxy acids, such as polylactide (PLA), polyglycolide (PGA), poly(lactide-co-glycolide) (PLGA), poly-3-hydroxybutyrate (PHB) and copolymers thereof, poly-4-hydroxybutyrate (P4HB) and copolymers thereof, polycaprolactone and copolymers thereof, and combinations thereof. Proteins, which are water insoluble, such as zein, can also be used as materials for the formation of drug containing microparticles. Additionally, proteins, polysaccharides and combinations thereof, which are water-soluble, can be formulated with drug into microparticles and subsequently cross-linked to form an insoluble network. For example, cyclodextrins can be complexed with individual drug molecules and subsequently cross-linked. Encapsulation or incorporation of drug into carrier materials to produce drug-containing microparticles can be achieved through known pharmaceutical formulation techniques. In the case of formulation in fats, waxes or wax-like materials, the carrier material is typically heated above its melting temperature and the drug is added to form a mixture comprising drug particles suspended in the carrier material, drug dissolved in the carrier material, or a mixture thereof. Microparticles can be subsequently formulated through several methods including, but not limited to, the processes of congealing, extrusion, spray chilling or aqueous dispersion. In a preferred process, wax is heated above its melting temperature, drug is added, and the molten wax-drug mixture is congealed under constant stirring as the mixture cools. Alternatively, the molten wax-drug mixture can be extruded and spheronized to form pellets or beads. These processes are known in the art. For some carrier materials it may be desirable to use a solvent evaporation technique to produce drug-containing microparticles. In this case drug and carrier material are co-dissolved in a mutual solvent and microparticles can subsequently be produced by several techniques including, but not limited to, forming an emulsion in water or other appropriate media, spray drying or by evaporating off the solvent from the bulk solution and milling the resulting material. Attorney Docket No. 11650-002WO1 Kits Described herein are kits including Archexin, or a pharmaceutically acceptable salt thereof; and Everolimus, or a pharmaceutically acceptable salt thereof, Lenvatinib, or a pharmaceutically acceptable salt thereof, or any combination thereof. EXAMPLES The following examples are for the purpose of illustration of the invention only and are not intended to limit the scope of the present invention in any manner whatsoever. Example 1: Evaluation of an AKT-1 antisense oligonucleotide in combination with Lenvatinib and Everolimus in Renca-luciferase syngeneic orthotopic murine tumor model The current clinical treatment for advanced renal cancer patients involves a combination of 18 mg Lenvatinib and 5 mg Everolimus per day (see Lenvima (lenvatinib) [prescribing information], Woodcliff Lake, NJ:Eisai Inc.; 2020). However, due to the severe side effects of Lenvatinib, the dose is often reduced to 14 mg (see Pal SK, et al., Assessing the Safety and Efficacy of Two Starting Doses of Lenvatinib Plus Everolimus in Patients with Renal Cell Carcinoma: A Randomized Phase 2 Trial. Eur Urol. 2022 Sep;82(3):283-292. Epub 2022 Feb 21, and Bergerot C., et al., Oncologist.2023; 28(1):59-71). Archexin, a fully phosphorothioated 20-mer antisense oligonucleotide, inhibits AKT-1 mRNA translation and inhibits tumor growth. In order to enhance therapeutic efficacy and reduce adverse reactions, a combination of Archexin with reduced doses of Lenvatinib and Everolimus was investigated. In this study, first Lenvatinib and Everolimus monotherapies were evaluated for antitumor efficacy in an orthotopic Renca-luciferase syngeneic model. Briefly, 45 mice were randomly divided into 9 groups (5 in each group), vehicle control, Lenvatinib (5, 10, 20, and 30 mg / kg) and Everolimus (0.2, 0.5, 1, 2, and 4 mg / kg) via daily oral administration for 20 days. Next, the anti-tumor effect of the two- and three-drug combination was investigated. Briefly, 35 mice were randomly divided into 7 groups (5 in each group), including vehicle control, Lenvatinib / Everolimus combinations (5+0.2, 10+0.2 and 10+0.5 mg / kg) and Archexin / Lenvatinib / Everolimus combinations (60+5+0.2, 60+10+0.2 and 60+10+0.5 mg / kg) via tail vein injection (vehicle / Archexin, Q3D*6 times) or oral administration (Lenvatinib and Everolimus, QD*18 days). Body weight was monitored daily, and tumor burden was measured by bioluminescence through whole-body fluorescence images, performed twice a week. The results showed that Everolimus inhibited tumor growth in a dose-dependent manner. Partial response was observed in mice treated with varying doses of Lenvatinib（TGIs: 57.94%,76.65% and 60.22%), and no significant dose-effect correlation was found. The dose of Lenvatinib and Attorney Docket No. 11650-002WO1 Everolimus that partially inhibited the orthotopic tumor growth had also been identified and selected for subsequent study investigating drug combinations. The drugs combination study showed that three drug combinations (Archexin / Lenvatinib / Everolimus) had superior efficacy compared to the Lenvatinib and Everolimus combination. The fluorescence signal intensities (Lg10) of the three-drug combination were significantly lower than that of the two-drug combination group with P value <0.05. No severe adverse effects were observed in the three drug combinations group. Three drugs combination of Archexin, Lenvatinib and Everolimus, demonstrated superior anti- tumor efficacy compared to the Lenvatinib and Everolimus combination currently used in the clinic. This finding suggests the three-drug combination warrant investigation in the clinical trial in the patients with advanced renal cancer. Results: Table 1. Groups and Treatment Information Group N Treatment Dose Dosing Volume Dosing Dosing es 8 8 8 8 x 8 x 8 x The study revealed that Everolimus exhibited a dose-dependent inhibitory effect on tumor growth. While varying doses of Lenvatinib resulted in partial response (TGIs: 57.94%, 76.65%, and 60.22%), no significant dose-effect relationship was established. The combination study determined the doses of Lenvatinib and Everolimus that partially inhibited orthotopic tumor growth, which were then used for the subsequent investigation of drug combinations. The findings indicated that the three-drug combination (Archexin / Lenvatinib / Everolimus) demonstrated superior efficacy compared to the Attorney Docket No. 11650-002WO1 Lenvatinib and Everolimus combination, as evidenced by the significantly lower fluorescence signal intensities (Lg10) in the three-drug combination group compared to the two-drug combination group (P value <0.05). Moreover, the three-drug combination did not cause any severe adverse effects. Results are shown in Figure 18 and Table 2. The three-drug combination group showed no significant loss in body weight or mouse mortality, indicating that the combination was safe with no unexpected toxicity. Additionally, the efficacy of the three-drug combinations (TGI: 97.90%, 98.98%, and 99.92%) was consistently better than the corresponding two-drug combinations (TGI: 93.40%, 93.39%, and 97.79%), with the most effective group being RX-020160 mg / kg + Lenvatinib 10 mg / kg + Everolimus 0.5 mg / kg (TGI: 99.92%). The fluorescence signal intensities (Lg10) of the three-drug combination groups (7.47±0.18, 7.29±0.07, and 6.56±0.1) were significantly lower than those of the two-drug combination groups (8.06±0.05, 8.04±0.07, and 7.52±0.15) with a P value <0.05. These results suggest that the three-drug combination may be a promising approach for the treatment of advanced renal cancer and warrant further investigation in clinical trials. Table 2. Results for bioluminescence trace of female Balb / c mice bearing Renca-luc. Treatment Bioluminescence TGI Bioluminescence TGI p (x107photon / s) (%) log10(log10) value 01 01 01 01 01 Attorney Docket No. 11650-002WO1 Lenvatinib + Everolimus + RX- 0.4±0.09 99.92 6.56±0.1 93.40 0.001 0201, 10 mg / kg + 0.5mg / kg + 60 effective in inhibiting tumor growth compared to the Lenvatinib and Everolimus combination currently used in the clinic. These results suggest that the three-drug combination should be further investigated in clinical trials for patients with advanced renal cancer. Equivalent human dosage can be determined using USFDA. Guidance for Industry: Estimating the Maximum Safe Starting Dose in Adult Healthy Volunteer. Rockville, MD: US Food and Drug Administration; 2005, Table 3. Example 2: In Vivo Efficacy Study of Test Articles in the Treatment of Subcutaneous Caki-1 Human Renal Carcinoma Xenograft Model in Female BALB / c Nude Mice This study preclinically evaluate the in vivo therapeutic efficacy of test articles in the subcutaneous Caki-1 human renal carcinoma xenograft model in female BALB / c nude mice. Materials and Methods Materials: Female Mus musculuc BALB / c nude from GemPharmatech Co., Ltd. The mice were 7- 8 weeks old. Mice were housed at a density of up to 5 mice per cage at a temperature of 20-26 C, humidity of 40-70%, 12 hours of light and 12 hours dark, on a standard rodent chow diet, irradiated, ad libitum, and softened water, autoclaved. Mice were monitored daily cage side observations, and weekly clinical observations. The Caki-1 tumor cells (kidney cancer cells) were maintained in vitro with McCoy's 5a medium supplemented with fetal bovine serum of a final concentration of 10% (v / v) at 37ºC with 5% CO2 in air. The tumor cells in an exponential growth phase were harvested and counted for tumor inoculation. RX-0201 (Avecia Biotechnology), Lenvatinib (Selleck), and Everolimus (Selleck). Treatment for Caki-1 model study is shown in Table 3 below.

[0002] Attorney Docket No. 11650-002WO1 Table 3. Treatment for Caki-1 Model Study. Q3D – Every three days (one day dosing and 2 days off), QD - Once a day, i.v. - intravenous, p.o. – Oral. Dose Dosing Dosing Group Mice No. Treatment Level Solution Volume ROA Dosing Frequency & D r ti n Methods: Each mouse was inoculated subcutaneously at the right front flank region with Caki-1 tumor cells (6 x 106) in 0.1 mL of PBS for tumor development. The date of inoculation was denoted as Day 0. Randomization started when the mean tumor size reached approximately 152 mm3. A total of 56 mice were enrolled in the study and allocated into 7 groups with 8 mice per group (Table 3). Randomization was performed based on "Matched distribution" method (Study Director TM software, version 3.1.399.19) (Day 6). After tumor inoculation, the animals were checked daily for morbidity and mortality. During routine monitoring, the animals were checked for any effects of tumor growth and treatments on behavior such as mobility, food and water consumption, body weight gain / loss (body weights were measured twice per week after randomization), eye / hair matting, and any other abnormalities. Mortality and observed clinical signs were recorded for individual animals in detail. Attorney Docket No. 11650-002WO1 Tumor volumes were measured twice per week after randomization in two dimensions using a caliper, and the volume was expressed in mm3 using the formula: V = (L x W x W) / 2, where V is tumor volume, L is tumor length (the longest tumor dimension) and W is tumor width (the longest tumor dimension perpendicular to L). Dosing as well as tumor and body weight measurements were conducted in a Laminar Flow Cabinet. The body weights and tumor volumes were measured by using Study Director TM software (version 3.1.399.19). Table 4. Drug Formulation Dose Items Level Concentration (m / mL) Preparation Physical Description Adjust dosing volume for body weight (dosing volume = 10 μL / g). The treatment was initiated on the same day of randomization per study design (Table 3). Dosing of this Caki-1 model study started from Day 6 through Day 23. The study was terminated on Day 52. The body weight of all animals was monitored throughout the study and animals would be euthanized if they lost over 20% of their body weight relative to the weight at the first day of treatment. In this study, no BLW >20% was noted. Individual mice with tumor volume exceeding 3000 mm3 was Attorney Docket No. 11650-002WO1 sacrificed during this study. To deter cannibalization, any animal exhibiting an ulcerated or necrotic tumor was separated immediately and singly housed and monitored daily before the animal was euthanized or until tumor regression was complete. Mouse with tumor ulceration of approximately 25% or greater on the surface of the tumor was euthanized. Severe dehydration, hypothermia, abnormal / labored respiration, lethargy, obvious pain, diarrhea, skin lesions, neurological symptoms, impaired mobility (not able to eat or drink) due to significant ascites and enlarged abdomen, astasia, continuous prone or lateral position, signs of muscular atrophy, paralytic gait, clonic convulsions, tonic convulsions, persistent bleeding from body orifice. To compare tumor volumes of different groups at a pre-specified day, we first used Bartlett's test to check the assumption of homogeneity of variance across all groups. When the p-value of Bartlett's test is ≥0.05, we ran one-way ANOVA to test the overall equality of means across all groups. If the p-value of the one-way ANOVA is <0.05, we further performed post hoc testing by running Tukey's HSD (honest significant difference) tests for all pairwise comparisons, and Dunnett’s tests for comparing each treatment group with the vehicle group. When the p-value of Bartlett's test was <0.05, we ran Kruskal-Wallis test to test the overall equality of medians among all groups. If the p-value of the Kruskal- Wallis test was <0.05, we further performed post hoc testing by running Conover's non-parametric test for all pairwise comparisons or for comparing each treatment group with the vehicle group, both with single-step p-value adjustment. All statistical analyses were done in R-a language and environment for statistical computing and graphics (version 3.3.1). All tests were two-sided unless otherwise specified, and p-values of <0.05 were regarded as statistically significant. Results: Body Weight Growth Curves The results of body weights and body weight changes at different time points (from Day 6 to Day 51) are shown in Figure 1 and Figure 2, respectively. In this study, all Caki-1 tumor-bearing mice were tolerated with the designed dosing regimens. The maximum mean body weight loss in vehicle control, Lenvatinib, Everolimus, RX-0201 (60 mg / kg), Lenvatinib combined with Everolimus, RX-0201 (30 mg / kg) combined with Lenvatinib and Everolimus, RX-0201 (60 mg / kg) combined with Lenvatinib and Everolimus (dosing started from Day 0) treated groups were -1.21% (on Day 9), -1.83% (on Day 9), - 1.73% (on Day 9), -0.64% (on Day 9), -2.49% (on Day 9), -3.89% (on Day 9), and -5.20% (on Day 23), respectively. Tumor Volume Growth Curves Attorney Docket No. 11650-002WO1 The mean tumor growth curves at different time points (from Day 6 to Day 51) are shown in Figure 3. Tumor Growth Inhibition The tumor growth inhibition of test articles in the treatment of subcutaneous Caki-1 human renal carcinoma xenograft model in female BALB / c nude mice on Day 51 is summarized in Table 5 below. Table 5. Antitumor Activity of Test Articles in Caki-1 Model Group Treatment Description Tumor Size (mm3)aT / C (%) on TGI (%) onbon Day 51 Day 51 Day 51 p value 1 Vehicle, 10 µL / g, i.v., Q3D 2569.79±178.22 - - - 2 Lenvatinib, 10 mg / kg, p.o., QD 1760.33±219.80 68.50 31.50 0.0968 3 Everolimus, 5 mg / kg, p.o., QD 1078.18±260.50 41.96 58.04 <0.001 4 RX-0201, 60 mg / kg, i.v., Q3D 437.59±129.47 17.03 82.97 <0.001 5 Lenvatinib, 10 mg / kg, p.o., QD Everolimus, 5 mg / kg, p.o., QD 1127.61±146.84 43.88 56.12 <0.001 Lenvatinib, 10 mg / kg, p.o., QD 6 Everolimus, 5 mg / kg, p.o., QD 1157.62±309.76 45.05 54.95 <0.001 RX-0201, 30 mg / kg, i.v., Q3D Lenvatinib, 10 mg / kg, p.o., QD 7 Everolimus, 5 mg / kg, p.o., QD 581.64±105.22 22.63 77.37 <0.001 RX-0201, 60 mg / kg, i.v., Q3D Note: a. Mean ± SEM; b. compared with the tumor volume of Group 1 on Day 51. The detailed statistical analysis for multiple comparisons on Day 51 is shown below: Test p.values Significance level Bartlett’s test 7.36e-02 ns One-way ANOVA 1.58e-08 *** G01 - G02 9.68e-02 ns G01 - G03 8.93e-05 *** G01 - G04 3.71e-08 *** G01 - G05 1.59e-04 *** G01 - G06 2.25e-04 *** G01 - G07 2.17e-07 *** G02 - G03 2.39e-01 ns G02 - G04 6.25e-04 *** Attorney Docket No. 11650-002WO1 G02 - G05 3.22e-01 ns G02 - G06 3.79e-01 ns G02 - G07 3.03e-03 ** G03 - G04 3.08e-01 ns G03 - G05 1.00e+00 ns G03 - G06 1.00e+00 ns G03 - G07 6.09e-01 ns G04 - G05 2.27e-01 ns G04 - G06 1.86e-01 ns G04 - G07 9.99e-01 ns G05 - G06 1.00e+00 ns G05 - G07 4.99e-01 ns G06 - G07 4.34e-01 ns In this study, the mean tumor size of the vehicle control mice (Group 1) reached 2569.79 mm3on Day 51 post inoculation. Lenvatinib administered at 10 mg / kg, p.o., QD x 18 doses (Group 2) resulted in a slight anti- tumor efficacy in Caki-1 model, with a TGI value of 31.50% on Day 51; however, no statistically significant difference was observed compared with control group (p>0.05). Everolimus administered at 5 mg / kg, p.o., QD x 18 doses (Group 3) resulted in a significant anti- tumor efficacy in Caki-1 model with a TGI value of 58.04% on Day 51; a significant statistical difference of p<0.001 compared with vehicle control group was noted. RX-0201 administered at 60 mg / kg, i.v., Q3D x 6 doses (Group 4) resulted in a significant anti- tumor efficacy in Caki-1 model with a TGI value of 82.97% on Day 51; a significant statistical difference of p<0.001 compared with vehicle control group was noted. Lenvatinib administered at 10 mg / kg, p.o., QD x 18 doses combined with Everolimus administered at 5 mg / kg, p.o., QDx18 doses (Group 5) resulted in a significant anti-tumor efficacy in Caki-1 model with a TGI value of 56.12% on Day 51; a significant statistical difference of p<0.001 compared with vehicle control group was noted. However, no anti-tumor efficacy was noted compared with the single therapy groups (Groups 2 to 4). RX-0201 administered at 30 mg / kg, i.v., Q3D x 6 doses combined with Lenvatinib administered at 10 mg / kg, QD and Everolimus administered at 5 mg / kg, QD (Group 6), resulted in a significant anti- tumor efficacy in Caki-1 model, with a TGI value of 54.95% on Day 51; a significant statistical difference Attorney Docket No. 11650-002WO1 of p<0.001 compared with vehicle control group was noted. However, no anti-tumor efficacy was noted compared with the single therapy groups (Groups 2 to 4). RX-0201 administered at 60 mg / kg, i.v., Q3D x 6 doses combined with Lenvatinib administered at 10 mg / kg, p.o., QDx18 doses and Everolimus administered at 5 mg / kg, p.o., QDx18 doses (Group 7) resulted in a significant anti-tumor efficacy in Caki-1 model with a TGI value of 77.37% on Day 51; a significant statistical difference of p<0.001 compared with vehicle control group was noted. Compared to the single therapy groups, no anti-tumor efficacy was noted compared with Everolimus-treated group (Group 3) and RX-0201-treated group (Group 4); an anti-tumor efficacy was noted compared with Lenvatinib-treated group (Group 2) with a significant statistical difference of p < 0.01. The tolerability and efficacy of test articles in subcutaneous Caki-1 human renal carcinoma xenograft model in female BALB / c nude mice were investigated in this study. Animals were dosed on Day 6 to Day 23 and sacrificed on Day 51. In summary, Caki-1 tumor-bearing mice treated with test articles per the designed dosing regimens were well tolerated. The most body weight loss was -5.20% in Group 7 on Day 23. Lenvatinib (10 mg / kg, p.o., QDx18 doses) resulted in a slight anti-tumor efficacy without a significant difference compared with vehicle control group, while both of Everolimus (5 mg / kg, p.o., QDx18 doses) and RX- 0201 (60 mg / kg, i.v., Q3Dx6 doses) as a single therapy resulted in significant anti-tumor efficacies in Caki-1 model. All the three combination therapies also showed significant anti-tumor efficacies; compared to the single therapy groups, no anti-tumor efficacy was noted except for the Lenvatinib- treated group. Equivalent human dosage can be determined using USFDA. Guidance for Industry: Estimating the Maximum Safe Starting Dose in Adult Healthy Volunteer. Rockville, MD: US Food and Drug Administration; 2005, Table 3. Example 3: In vivo efficacy evaluation of RX-0201 combined with Lenvatinib and Everolimus in the treatment of murine renal cancer Renca-luc orthotopic model in the female Balb / c mice The study evaluates the in vivo efficacy of RX-0201 combined with Lenvatinib and Everolimus in the treatment of murine renal cancer Renca-luc orthotopic model in the female Balb / c mice. Experimental Design Attorney Docket No. 11650-002WO1 Table 6. Groups and Treatment Information Dosing Group NaTreatmentbDose Volume Dosing Dosing e Observation formulated in saline. c. Dosing volume: adjust dosing volume based on body weight 10 µL / g. d. Dosing schedule of Lenvatinib and Everolimus were QD, dosing schedule of vehicle and RX-0201 were Q3D. e.Treatment was suspended from PG-O19 to PG-O35 for survival observation, the body weight was measured twice weekly from PG-O19 to PG-O25, and was measured daily from PG-O26 to PG- O35. f. The dosing of Lenvatinib was adjusted from 5 mg / kg to 2 mg / kg on PG-O10. Materials: 6-8 weeks old female Mus musculus BALB / c mice. The mice body weight ranged from 19-22 g. Mice were housed at a density of 4 mice per cage at a temperature of 20-26 C, humidity of 40- 70%. Animals had free access to irradiation sterilized dry granule food and sterile drinking water during the entire study. After inoculation, the animals were checked daily for morbidity and mortality. At the time of routine monitoring, the animals were checked for any effects of tumor growth and treatments on normal behavior such as mobility, food and water consumption, body weight gain / loss, eye / hair matting and any other abnormal effect. Death and observed clinical signs were recorded on the basis of the numbers of animals within each subset. RX-0201 (Zhejiang HAICHANG Bio-Tech Co., Ltd.), Lenvatinib (Selleck), and Everolimus (Selleck). The Renca-luc (WuXi) tumor cells were maintained in vitro in RPMI 1640 medium supplemented with 10% fetal bovine serum,1 mM NEAA, 1mM sodium pyruvate, 2 mM L- glutamine, 2 µg / ml puromycin and 1% P / S at 37°C in an atmosphere of 5% CO2 in air. The tumor cells were routinely subcultured twice weekly. The cells growing in an exponential growth phase were harvested and counted for tumor inoculation. Each mouse was inoculated on kidney with the tumor cells (1 x 10⁵) in 0.02 ml of DPBS mixed with Matrigel (Volume Ratio=3:1) for tumor development. The animals were randomized and Attorney Docket No. 11650-002WO1 treatments were started when the average bioluminescence reached appropriate 2.85 x 10⁶ photon / second in efficacy study. The animals were assigned into groups using an Excel-based randomization software performing stratified randomization based upon their bioluminescence. Each group consisted of 8 tumor-bearing mice. The test articles were administrated to the mice according to the predetermined regimen. Vehicle Solvent Preparation: Preparation of 0.5% CMC-Na: dissolved 1 g CMC-Na in 200 ml ddH20, and vortexed to obtain a clear solution. Preparation of 2% DMSO + 98% (0.5% CMC-Na): dissolved 4 ml DMSO in 196 ml 0.5% CMC-Na, and vortexed to obtain a clear solution. Formulation Preparation Table 7. Formulation of Articles Concentration Compounds Preparation (mg / mL)b Tumor Measurements and the Endpoints The surgically inoculated mice were weighed and intraperitoneally administered luciferin at a dose of 150 mg / kg. Fourteen minutes after the luciferin injection, the animals were pre-anesthetized Attorney Docket No. 11650-002WO1 with the mixture gas of oxygen and isoflurane. When the animals were in a complete anesthetic state, the mice were moved into the imaging chamber for bioluminescence measurements with an IVIS (Lumina Ill) imaging system. The major endpoint was to see if the tumor bioluminescence growth can be delayed, decreased, or vanished. Tumor bioluminescence metastasis can be prevented or mice can be cured. The body weights were measured twice weekly or once a day when the mice show obvious morbidity. The bioluminescence of the whole animal body, including primary and metastatic tumors, was measured and recorded twice per week during treatment. The tumor bioluminescence was used for the calculation of T / C value (in percent), T and C are the mean bioluminescence of the treated and control groups, respectively, on a given day. TGI is calculated for each group using the formula: TGI (%) = [1-(Ti-To) / (Vi-Vo)] x100; Ti is the average tumor bioluminescence of a treatment group on a given day, To is the average tumor bioluminescence of the treatment group on the day of treatment start, Vi is the average tumor bioluminescence of the vehicle control group on the same day with Ti, and Vo is the average tumor bioluminescence of the vehicle group on the day of treatment start. Mean survival time (Days) of each group were calculated based on the survival time of the animal within, increased life span was analyzed according to the mean survival time in treatment groups and vehicle group. Summary statistics, including mean and the standard error of the mean (SEM), are provided for the bioluminescence of each group at each time point. One-way ANOVA was performed to compare bioluminescence on PG-D14 among groups. All data were analyzed using SPSS. p<0.05 was considered to be statistically significant. Results Mortality, Morbidity and Body Weight Gain or Loss Animal body weight was monitored regularly as an indirect measurement of toxicity. After the treatment, the mouse #1-2 in group 1 (Vehicle, 10 ml / kg, i.v., Q3D x 18 days) exhibited body weight loss over 10% on PG-D14 to PG-D17, and died on PG-D19, the mouse #1-7 in group 1 (Vehicle, 10 ml / kg, i.v., Q3D x 18 days) exhibited body weight loss over 10% on PG-D14, the mouse #2-1 in group 2 (RX-0201, 60 mg / kg, i.v., Q3D x 18 days) died on PG- D17, the mice #2-2 and #2-4 in group 2 (RX-0201, 60 mg / kg, i.v., Q3D x 18 days) exhibited body weight loss over 10% on PG-D14, and died on PG-D17, the mouse #2-5 in group 2 (RX-0201, 60 mg / kg, i.v., Q3D x 18 days) died on PG-D19. Mice in group 1 were provided with Diet Gel and Sunflower seed from PG-D13 Attorney Docket No. 11650-002WO1 to PG-D19 due to the body weight loss, mice in group 2 were provided with Diet Gel and Sunflower seed from PG-D14 to PG-D19 due to the body weight loss. The body weight (BW) and BW change curves of Renca-luc efficacy study are showed in Figure 4 and Figure 5. Bioluminescence Curve Tumor Bioluminescence curve after female Balb / c mice with Renca-luc tumors dosed test articles is showed in Figure 6. Bioluminescence Intensity Mean bioluminescence over time in female Balb / c mice bearing murine renal cancer cell Renca- luc is shown in Table 8. Table 8. Bioluminescence over Time (x107photons / s). a. b. Days after grouping. c. Bioluminescence data of PG-D19 was incomplete due to the animal death. Tumor Growth Inhibition Analysis Tumor growth inhibition of test articles in the treatment of female Balb / c mice bearing murine renal cancer Renca-luc was calculated based on bioluminescence measured on PG -D14. The data is shown in Table 9. Attorney Docket No. 11650-002WO1 Table 9. Tumor Growth Inhibition Analysis (Calculated based on the bioluminescence data obtained on PG-D14) a. Data is shown as Mean ± SEM. b. The data analysis was based on the bioluminescence of PG-D14 instead of PG-D19 because the bioluminescence data of PG-D19 was incomplete due to animal death. c. Tumor Growth Inhibition (TGI) was calculated using the formula: TGI (° / 0) = [1 -(T14-To) / (V14-V0)] x100, where T14 = mean bioluminescence at the PG-D14 of treatment group, V14 = mean bioluminescence at the PG-D14 of control group. Antitumor activity (T / C) was calculated using the formula: T / C% = TRTB / CRTB X 100, where TRTB = mean RTB at the PG-D14 of treatment group, CRTB = mean RTB at the PG-D14 of control group. d. A one-way ANOVA followed by Games-Howell multiple comparison test was performed to compare the bioluminescence among vehicle group and treatment groups. p<0.05 was considered to be statistically significant. ns indicates p>0.05, * indicates p <0.05.

[0003] Attorney Docket No. 11650-002WO1 Table 10. Tumor Growth Inhibition Analysis (Calculated based on the bioluminescence data obtained on PG-D14). a. Independent-Samples T Test was performed to compare the bioluminescence between group 3 and group 4. p<0.05 was considered to be statistically significant. ns indicates p>0.05, * indicates p<0.05. Survival Death occurred at 17 days post treatment initiation, then animals in each group died or were euthanized in accordance to the IACUC protocol due to obvious weight loss or deterioration of health status. The survival time of the animals was observed for 35 days. The mean survival time of animals in vehicle group is 22 days. The survival time of the animals from Group 2 (RX- 0201, 60 mg / kg), Group 3 (Lenvatinib + Everolimus, 5 / 2 mg / kg + 0.1 mg / kg) and Group 4 (Lenvatinib + Everolimus + RX-0201, 5 / 2 mg / kg+ 0.1 mg / kg+ 60 mg / kg) were 23.38, 26.75, 27.75 days respectively. The mean survival rates of each treatment group were 106.25%, 121.59%, 126.14%, respectively. The Kaplan-Meier survival curves for animals in each group was shown in Figure 7. The result of survival time analysis is shown in Table 11.

[0004] Attorney Docket No. 11650-002WO1 Table 11. Survival Time Analysis Results and Discussion In this study, the efficacy of RX-0201 combined with Lenvatinib and Everolimus in the treatment of murine renal cancer Renca-luc orthotopic model in the female Balb / c mice was investigated. Animal body weight was monitored regularly as an indirect measurement of toxicity. Body weight and body weight changes after administration of test articles are shown in Figure 4 and Figure 5. Renca-luc cells could cause the animals to be in poor physical condition and lose the bodyweight. The bodyweight of animals in vehicle group could be basically maintained by nutrition supplement, but death still occurred with the tumor growth. After the treatment, the mice treated with Lenvatinib + Everolimus at dose level of 5 / 2 mg / kg + 0.1 mg / kg and RX-0201 combined with Lenvatinib + Everolimus at dose level of 60 mg / kg + 5 / 2 mg / kg + 0.1 mg / kg could maintain their bodyweight well. Bioluminescence of all treatment groups at various time points are displayed in Table 8 and Figure 6. The calculated TIC and TGI data on PG-D14 are shown in Table 9 and Table 10. Compared with vehicle group (Bioluminescence =80.19 x107photon / s), Lenvatinib + Everolimus at dose level of 5 / 2 mg / kg + 0.1 mg / kg and RX-0201 combined with Lenvatinib + Everolimus at dose level of 60 mg / kg + 5 / 2 Attorney Docket No. 11650-002WO1 mg / kg + 0.1 mg / kg exhibited significant anti- tumor activity with mean Bioluminescence of 17.49 x107photon / s (T / C=18.42%, TGl=78.47%, p=0.017) and 6.59 x107 photon / s (T / C=7.64%, TGl=92.11% , p=0.008), while the test article RX-0201 at dose level of 60 mg / kg showed minor tumor inhibitory effects with mean Bioluminescence of 34.65 x107photon / s (T / C=40.71%, TGl=57.00%, p=0.103). Compared with Lenvatinib + Everolimus group (5 / 2 mg / kg + 0.1 mg / kg), the RX- 0201 combined with Lenvatinib + Everolimus (60 mg / kg + 5 / 2 mg / kg+ 0.1 mg / kg) exhibited more significant anti-tumor efficacy than Lenvatinib + Everolimus group with mean Bioluminescence of 6.59 x107photon / s (p=0.033). The survival time of the animals was observed for 35 days. The animals were died or euthanized in accordance to the IACUC protocol due to obvious weight loss or deterioration of health status. The mean survival time of animals in vehicle group is 22 days. The mean survival time of the animals from Group 2 (RX-0201, 60 mg / kg), Group 3 (Lenvatinib + Everolimus, 5 / 2 mg / kg+ 0.1 mg / kg) and Group 4 (Lenvatinib + Everolimus + RX-0201, 5 / 2 mg / kg + 0.1 mg / kg + 60 mg / kg) were 23.38, 26.75, 27.75 days respectively. The mean survival rates of each treatment group were 106.25%, 121.59%, 126.14%, respectively. Compared with vehicle group, Group 3 (Lenvatinib + Everolimus, 5 / 2 mg / kg + 0.1 mg / kg) and Group 4 (Lenvatinib + Everolimus + RX-0201, 5 / 2 mg / kg+ 0.1 mg / kg+ 60 mg / kg) could prolong the survival time of Renca-luc orthotopic homograft tumor model to a certain extent. Equivalent human dosage can be determined using USFDA. Guidance for Industry: Estimating the Maximum Safe Starting Dose in Adult Healthy Volunteer. Rockville, MD: US Food and Drug Administration; 2005, Table 3. Example 4: A Multicenter, Randomized, Open-label, Phase Ib / II Study to Evaluate the Safety and Efficacy of HC-0201 in Combination with Lenvatinib and Everolimus versus Lenvatinib plus Everolimus for Advanced Clear Cell Renal Cell Carcinoma This study will be a 2-stage multi-center, open-label, randomized study to assess the safety, tolerability, and preliminary efficacy of HC-0201 in combination with Lenvatinib and Everolimus versus Lenvatinib plus Everolimus to treat subjects with advanced clear cell renal cell carcinoma. Stage 1 will be an open-label, dose-escalation study to identify a safe and tolerable dose of HC- 0201 up to a target dose of 350 mg / m2(starting dose 150 mg / m2, other predefined dose-escalation levels at 250, 315, 350 mg / m2) via IV infusion within 4 hours, 4 weeks as a treatment cycle when given in combination with dose of Lenvatinib (18 mg) and Everolimus (5 mg), which will be taken orally once daily on a continuous basis. This stage will apply accelerated dose escalation method in order to minimize suboptimal drug exposures, followed by a conventional 3+3 dose escalation phase to achieve MTD when first DLT identified. Initially, one subject per dose cohort will be recruited (accelerated dose Attorney Docket No. 11650-002WO1 escalation phase, starting dose 150 mg / m2) until the first instance of a DLT. Further cohorts will be recruited in blocks of three subjects (3+3 dose escalation phase). The dose limiting toxicity (DLT) assessment window will be 28 days (Days 1−28 of Cycle 1). A scheme of stage 1 is shown in Figure 8. Stage 2 will be a randomized, open-label study. Eligible subjects will be randomly assigned to each arm in a 2:1 ratio: HC-0201 in combination with Lenvatinib and Everolimus versus Lenvatinib plus Everolimus. Subjects will receive HC-0201, at the dose identified in Stage 1, in combination with Lenvatinib (18 mg) and Everolimus (5 mg) or just Lenvatinib (18 mg) plus Everolimus (5 mg) to determine safety and efficacy of the newly proposed regimen. To mimic real world epidemiology of advanced ccRCC based on IMDC criteria, enrollment of intermediate / poor risk patients should conclude between 75% and 80% of total subjects. To mimic real world epidemiology of advanced ccRCC based on IMDC criteria, enrollment of intermediate / poor risk patients should conclude between 75% and 80% of total subjects. A scheme of stage 2 is shown in Figure 9. Anti-tumor activity will be assessed by radiological tumor assessments conducted at baseline, then at 8 weeks thereafter, using RECIST version 1.1. In addition, radiological tumor assessments will also be conducted whenever disease progression is suspected (eg, symptomatic deterioration), and at the end of treatment / withdraw from study (if not done in the previous 6 weeks). Patients may be treated beyond radiologic progression if the patient is deemed to be clinically benefitting by the study treatment, however two assessments documenting progression will necessitate the patient be removed from the study. A DLT is defined as any treatment-emergent adverse event (TEAE) not attributable to disease or disease-related processes that occurs during the DLT evaluation period (Cycle 1) according to NCI-CTCAE V5.0. Study Participants: Stage 1: n = approximately 6-9 subjects will be enrolled in Stage 1, Stage 2: n = approximately 120 subjects will be enrolled in Stage 2. Inclusion Criteria PHASE 2 ONLY: Histologically confirmed advanced or metastatic renal cell carcinoma with a clear cell component that has progressed by investigator assessment on treatment with one and only one prior immunotherapy (interleukin-2 or interferon-alpha or immune checkpoint inhibitor or tumor vaccine) or immunotherapy plus a VEGFR inhibitor (not including Lenvatinib). Archival tumor biospecimen (when available) must be procured for correlative evaluation. If tumor tissue is not available or accessible despite good faith efforts, subject may still be treated on study. Attorney Docket No. 11650-002WO1 PHASE 1 ONLY: Histologically confirmed advanced or metastatic renal cell carcinoma that has progressed by investigator assessment on treatment with no more than TWO LINES of systemic therapy. Prior VEGF inhibitors (e.g., sunitinib, pazopanib, sorafenib, tivozanib, cabozantinib, bevacizumab) and immunotherapy (interleukin-2 or interferon-alpha or immune checkpoint inhibitor or tumor vaccine) are allowed. Measurable or evaluable disease defined by Response Evaluation Criteria for Solid Tumors (RECIST) 1.1. No other prior malignancy is allowed except for the following: adequately treated basal cell or squamous cell skin cancer, adequately treated Stage I or II cancer from which the patient is currently in complete remission per investigators' clinical judgment. Tissue blocks or tissue sections from initial diagnosis or upon diagnosis of advanced metastatic disease will be available for submission to the central laboratory within approximately 4 weeks after initiation of study treatment; exceptions (e.g., histology determined by fine needle aspirate or tissue is no longer available) require written documentation of why a sample is not available and prior approval by the sponsor before enrollment / randomization. ECOG performance status of 0, 1. Life expectancy > 12 months. Males and females ≥ 18 years of age at the time of informed consent, voluntarily agree to provide written informed consent, and are willing and able to comply with all aspects of the protocol. Subjects must have recovered adequately from the toxicity and / or complications from the intervention prior to starting therapy. Subject must not have history or current evidence of any condition, therapy, or laboratory abnormality that might confound the results of the trial, interfere with the subject’s participation for the full duration of the trial, or is not in the best interest of the subject to participate, in the opinion of the treating investigator. Female subjects of childbearing / reproductive potential must have a negative urine or serum pregnancy test within 7 days prior to receiving the first dose of study medication. Female / male subjects of childbearing potential must be willing to use an adequate method of contraception, for the course of the study through 30 days after the last dose of study medication. Exclusion Criteria Laboratory values: Absolute neutrophil count < 1.5 × 109 / L, Platelet count < 100 × 109 / L, Bilirubin > 1.5 × upper limit of normal (ULN), Aspartate aminotransferase (AST) or alanine aminotransferase (ALT) > 2.5 × ULN (OR > 5 × ULN in the presence of known liver metastases), inadequate renal function as calculated glomerular filtration rate (eGRF) ≥ 50 mL / min, partial thromboplastin time (PTT) > 1.25 × ULN unless subject is receiving anticoagulant therapy as long as PT or PTT is within therapeutic range of intended use of anticoagulants, prothrombin time (PT) > 1.25 × ULN and / or international normalization ratio (INR) > 1.4 unless subject is receiving anticoagulant therapy as long as PT or PTT is within therapeutic range of intended use of anticoagulants. Attorney Docket No. 11650-002WO1 Medications: Radiation therapy for bone metastasis within 2 weeks, any other external radiation therapy within 4 weeks before planned first dose of study drug. Systemic treatment with radionuclides within 6 weeks before planned first dose of study drug. Subjects with clinically relevant ongoing complications from prior radiation therapy are not eligible. History of using Lenvatinib or Everolimus. Receipt of systemic anticancer therapy, including investigational agents, within 28 days of starting study treatment. If anticancer therapy was given within 28 days of starting study treatment, patients may be included if 5 times the elimination half-life of the drug passed. Current use or anticipated need for strong inducers or inhibitors of CYP450s. Chronic treatment with corticosteroids or other immunosuppressive agents. Subjects with a known hypersensitivity to study drugs or drugs with a similar chemical structure or their excipients. Currently enrolled in and has not yet completed at least 30 days since ending other investigational device or drug study before planned first dose of study drug, or subject is currently receiving other investigational agent(s) Live vaccines within 30 days prior to the first dose of trial treatment. General: History of any medical, psychiatric, or social (e.g., addictive disorder) conditions, or laboratory abnormality that in the opinion of the investigator, may increase the risks associated with study participation or treatments that may interfere with the conduct of the study or the interpretation of study results. Known active CNS metastases and / or carcinomatous meningitis. Subjects with previously treated brain metastases may participate provided they are stable, i.e., without evidence of progression for at least 4 weeks by repeat imaging (note that the repeat imaging should be performed during study screening), without requirement of steroid treatment for at least 4 weeks prior to randomization and with any neurologic symptoms resolved or have returned to baseline of prior treatment for brain metastasis. Major surgery within 2 months before planned first dose of study drug. Complete wound healing from major surgery must have occurred within 1 month before planned first dose of study drug and from minor surgery at least 10 days before planned first dose of study drug, or who has not recovered from AEs (i.e.,＞ CTACE Grade 1, except for grade 2 hair loss) due to prior treatment. History of the following cardiovascular conditions within the previous 6 months before planned first dose of study drug: Myocardial infarction, Unstable angina pectoris, Cardiac angioplasty or stenting, Coronary / peripheral artery bypass graft, Class III or IV congestive heart failure per New York Heart Association, Cerebrovascular accident or transient ischemic attack. Active infection requiring systemic therapy within 2 weeks before planned first dose of study drug. Diagnosis of another malignancy before planned first dose of study drug, except for superficial skin cancers, or localized, low- grade tumors. Prior or current history of hepatitis B, hepatitis C or human immunodeficiency virus. Attorney Docket No. 11650-002WO1 Pregnant, planning a pregnancy or breastfeeding during the study. Has a known history of Human Immunodeficiency Virus (HIV) (HIV 1 / 2 antibodies). Has a clinically significant gastrointestinal (GI) abnormality including: Inability to take oral medication, Requirement for IV alimentation, Prior surgical procedures affecting absorption including total gastric resection, Treatment for active peptic ulcer within the past 6 months, Active GI bleeding, as evidenced by hematemesis, hematochezia, or melena in the past 3 months without evidence of resolution documented by endoscopy or colonoscopy, Intraluminal metastatic lesion with suspected bleeding, inflammatory bowel disease, ulcerative colitis or other GI condition associated with increased risk of perforation, or history of GI perforation, Malabsorption syndromes, Inflammatory bowel disease. Subjects with any poorly controlled systemic diseases, such as uncontrolled hypertension (blood pressure of 150 / 90 mmHg or higher with or without stable treatments). Known psychiatric or substance abuse that would interfere with cooperation with the requirements of the trial. Unwilling or unable to comply with study requirements or not available for follow-up assessments. Dosage and Route of Administration In stage 1 and stage 2, Lenvatinib and Everolimus will be taken orally once daily on a continuous basis. In stage 1, HC-0201 will be administered in combination with Lenvatinib (18 mg) and Everolimus (5 mg) at a starting dose of 150 mg / m2 / day, by a continuous intravenous infusion within 4 hours (twice weekly and 4 weeks as a treatment cycle). HC-0201 doses will be escalated until a maximum tolerated dose (MTD) or a target dose of 350 mg / m2 / day is reached. The MTD or the target dose will be tested further in Stage 2. In stage 2, subjects will receive HC-0201 in combination with Lenvatinib (18 mg) and Everolimus (5 mg) or just Lenvatinib (18 mg) plus Everolimus (5 mg) at RP2D in a 2:1 ratio. Subjects in Stage 1 and Stage 2 may receive continuous therapy until the end of the study, withdrawal of consent, substantial non-compliance with study procedures, intolerable adverse event, disease progression or death, or other condition, per the investigator’s judgment, that require discontinuation of treatment. Recommendations for Lenvatinib dose interruption, reduction and discontinuation for adverse reactions are listed as follows. In stage 2, when administering Lenvatinib in combination with Everolimus, withhold or reduce the Lenvatinib dose first and then the Everolimus dose for adverse reactions of both Lenvatinib and Everolimus. Attorney Docket No. 11650-002WO1 Recommended Dosage Modifications for Lenvatinib for Adverse Reactions Adverse Reaction Severity Dosage Modifications for Lenvatinib al is e. g n. e. e of e. g of Attorney Docket No. 11650-002WO1 RCC 14 mg 10 mg 8 mg Both Phase 1b and Phase 2 trials will not perform the formal sample size estimations. Randomization will follow a predefined randomization scheme based on the following stratification factors: IMDC prognostic criteria (favorable, intermediate / poor risk). Phase 2: Eligible subjects will have measurable disease according to Response Evaluation Criteria in Solid Tumors Version 1.1 (RECIST 1.1) and will be randomly assigned to each treatment arm in a 2:1 ratio. The total sample size will be approximately 120 subjects, with 80 subjects in treatment group (HC- 0201 plus Lenvatinib (18 mg / day) plus Everolimus) and 40 subjects in control group (Lenvatinib (18 mg / day) plus Everolimus), respectively. If the treatment effects refer to ORR (INV assessed) of 43% (95% CI [29–58]) in the 18-mg arm (Robert J, 2015). Arm 1: HC-0201 plus Lenvatinib (18 mg / day) plus Everolimus, if expected ORR will reach to 55.9% (OR=1.68), Arm 2: Assumed ORR of 43% (95% CI [29–58]) in the Lenvatinib (18 mg / day) plus Everolimus group. All estimations are based on the hypotheses as follows: H0:OR≤1 vs.H1:OR>1 α = 0.15 (one-sided) p1: ORR (INV assessed) of treatment (Arm 1) p2: ORR (INV assessed) of treatment (Arm 2) It is expected that about 108 patients (72 subjects in treatment group vs.36 subjects in control group) will be enrolled. A superiority test at 1-sided α = 0.15 will give about 59% statistical power to detect an improvement in ORR from 43% in the Lenvatinib (18 mg / day) plus Everolimus group to 55.9% in the HC-0201 plus Lenvatinib (18 mg / day) plus Everolimus group. Assuming 10% dropout rate, 120 subjects will be enrolled into this study totally. Data Analysis Set Phase 1b: ITT: The ITT population will include all consenting subjects enrolled into this study. Descriptive analysis will be conducted on DLT for each subject and summarized by dose cohort. Adverse events will be summarized by MedDRA term, appropriate MedDRA levels (system organ class [SOC] and preferred term [PT]), and by NCI CTCAE grade. Phase 2: ITT: The ITT population will include all consenting subjects randomized to study treatment (HC-0201 plus Lenvatinib (18 mg / day) plus Everolimus or Lenvatinib (18 mg / day) plus Attorney Docket No. 11650-002WO1 Everolimus). This will be a primary analysis set for efficacy endpoints. PPS: The PP population is a subgroup of the ITT population which will include all subjects who do not have any deviations from the protocol deemed significant enough for exclusion from efficacy analysis and received at least 1 dose of study medication. SS: The safety population will include all subjects who received at least 1 dose of study medication (HC-0201 plus Lenvatinib (18 mg / day) plus Everolimus or Lenvatinib (18 mg / day) plus Everolimus). Subjects will be assigned to treatment groups based on treatment actually received. PKS: The PK population will include all subjects who received at least 1 dose of study medication (HC-0201 plus Lenvatinib (18 mg / day) plus Everolimus or Lenvatinib (18 mg / day) plus Everolimus) and have at least 1 measured concentration at a scheduled PK time point after start of dosing. Primary efficacy analyses: ORR will be compared between treatment arms using the Cochran-Mantel-Haenszel test, difference in ORR between two groups will also be estimated along with 95% CIs based on the asymptotic normal approximation. Secondary efficacy analyses: treatment comparisons for PFS / OS / TTP will be based on the log-rank test. The HR will be estimated using the Cox regression model, and the 95% CI for the HR will be provided. Kaplan-Meier methodology will be used to estimate median PFS / OS / TTP for each treatment arm and to construct survival curves for each treatment arm. The Brookmeyer-Crowley methodology will be used to construct the 95% CI for the median PFS / OS / TTP for each treatment arm. Analysis of DOR will be performed on the subjects who achieved a best overall response of CR or PR. Median DOR with 2-sided 95% CI will be estimated using the Kaplan-Meier method. The clinical benefit rate (CBR) with corresponding 2-sided 95% CI based on the asymptotic normal approximation will be provided. Safety analyses: adverse events will be summarized by counts and proportion of total subjects, by MedDRA term, appropriate MedDRA levels (system organ class [SOC] and preferred term [PT]), and by NCI CTCAE grade. Statistical Methods Phase 1b: Descriptive analysis will be conducted on DLT for each subject and summarized by dose cohort rates for each dose. Adverse events will be summarized by MedDRA term, appropriate MedDRA levels (system organ class [SOC] and preferred term [PT]), and by NCI CTCAE grade. Phase 2: Primary efficacy analyses: ORR will be compared between treatment arms using the Cochran- Mantel-Haenszel test, difference in ORR between two groups will also be estimated along with 95% CiIs based on the asymptotic normal approximation. Secondary efficacy analyses: Treatment comparisons for PFS / OS / TTP will be based on the log-rank Attorney Docket No. 11650-002WO1 test. The HR will be estimated using the Cox regression model, and the 95% CI for the HR will be provided. Kaplan-Meier methodology will be used to estimate median PFS / OS / TTP for each treatment arm and to construct survival curves for each treatment arm. The Brookmeyer-Crowley methodology will be used to construct the 95% CI for the median PFS / OS / TTP for each treatment arm. Analysis of DOR will be performed on the subjects who achieved a best overall response of CR or PR. Median DOR with 2-sided 95% CI will be estimated using the Kaplan-Meier method. The clinical benefit rate (CBR) with corresponding 2-sided 95% CI based on the asymptotic normal approximation will be provided Example 5: Western blotting analysis of pPRAS40, Akt1, p-GSK-3β, PTEN, and pAkt1 expression in Caki-1 kidney tissues Figures 10A-13C show the results for the western blot analysis of pPRAS40 expression (Figures 10A-10C), Akt1 and pGSK-3β (Figures 11A-11C), PTEN expression (Figures 12A-12C) in Caki-1 kidney tissues, and pAkt1 (Figures 13A-13C). Antibody information: Antibody Source Dilution MW Phospho-PRAS40 (Thr246) (D4D2) Rabbit 1:1000 40 KDa Sample groups: Group Sample time Animal No. Sample ID Attorney Docket No. 11650-002WO1 p.o. + p.o.,QD + QD 8 h 2-4 10 2-5 11 Attorney Docket No. 11650-002WO1 Lenvatinib 10 mg / kg 8-2 44 + Everolimus 5 mg / kg 8-3 45 Example 6: Western blotting analysis of pPRAS40, Akt1, p-GSK-3β, PTEN, and pAkt1 expression in Caki-1 tumor and kidney tissues Figures 14A-17 show the results for the western blot analysis of Akt-1, pAkt-1, pPRAS40, pGSK-3β and PTEN expression in Caki-1 tumor tissues (Figure 14A) and Caki-1 kidney tissue (Figure 14B), pAkt-1 expression in Caki-1 tumor tissues and kidney tissue (Figure 15), pGSK-3β expression in Caki-1 tumor tissues and kidney tissue (Figure 16), and pAkt-1 and pGSK-3β expression in Caki-1 tumor tissues and kidney tissue (Figure 17). Antibody information: Antibody Source Dilution MW Attorney Docket No. 11650-002WO1 Sample groups: Group Sample Animal Sample ID Sample time No. type Example 7. Phase 1 Study of RX-0201 in Patients with Advanced or Metastatic Solid Tumors Attorney Docket No. 11650-002WO1 AKT-1 (Archexin), a protein product of akt-1 proto-oncogene, plays a role in cancer progression by stimulating proliferation and inhibiting apoptosis of cancer cells. RX-0201, a 20-mer oligonucleotide with sequence complementary to akt-1 mRNA, is designed to inhibit the expression of akt-1 within cancer cells in cancer patients. Non-clinical studies conducted on RX-0201 demonstrated that RX-0201 bears significant in vitro and in vivo anti-cancer activities with favorable safety. The objectives of the phase I trial were to determine the maximum tolerated dose (MTD) and to establish safety and pharmacokinetic (PK) profiles of RX-0201 in pts with an advanced cancer. Experimental: RX-0201 was administered to pts with an advance cancer for up to 2 cycles (See Fig. 20). Each treatment cycle consisted of a 14-day continuous infusion phase of RX-0201 followed by a 7-day rest period. Phase I trial of RX-0201 is an open-label, single-arm, dose escalation study to determine safety and tolerability and to recommend a Phase II dose level. Eligibility criteria: histologically confirmed diagnosis of solid tumor or lymphoma. Standard therapies are either ineffective or not tolerated. Measurable or evaluable tumors. Karnofsky performance status of <70. Escalation Strategy: The initial starting dose was 6 mg / m2 / d. Doses doubled until the occurrence of > Grade 2 treatment-related toxicity. After the initial > Grade 2 treatment-related toxicity, the dose increased by up to 66% for the next dose level and by up to 33% for subsequent dose levels. (See Table 12). Table 12. Dose escalation. Pharmacokinetics: Blood samples were collected from each subject into tubes containing heparin at the following time points: Cycle I: Pre-dose, 1, 2, 3, 4, 6 hours post infusion on Day 1; on Day 8; prior to Attorney Docket No. 11650-002WO1 end of infusion and 1, 2, 3, 4, and 6 hours on Day 15; and 24 hours post-infusion completion (on Day 16). Cycle II (if applicable): Pre-dose on Day 1. Plasma samples generated were store frozen and shipped to analysis site where they were stored frozen before measurement. Measurement of RX-0201 was conducted using a validated LC-MS / MS method. Plasma concentration-time data were subjected to non- compartmental pharmacokinetic evaluation using WinNonlin 1.5 Model 201 (Pharsight Corp). Immunohistochemistry: Tumor biopsy samples were collected into neutral-buffered formalin (NBF) during screening. NBF-fixed tumor samples were embedded in paraffin and a 5-μm section was made from each sample. Paraffin tissue sections were stain immunohistochemically for AKT-1 with mouse anti-human AKT-1 monoclonal antibody (MAB17751, R&D Systems, Inc.; Minneapolis, MN) following the following procedure: deparaffinized in xylene; hydrated from 100% alcohol gradient to water; antigen retrieval (steam); incubated with 3% H2O2, blocking serum, and primary antibody sequentially; rinsed and incubated with horse anti-mouse HRP (ImmPRESS Universal Antibody Kit, Vector Labs); rinsed and incubated with DAB substrate (Vector Labs); counterstained with heatoxylin; dehydrated through a gradient of alcohol to xylene; and mounted. Results: Seventeen patients were successfully enrolled and treated at a dose level of RX-0201 ranging from 6 to 315 mg / m2 / d on D1-14, repeated q 21d (when applicable). (See Tables 13 and 14 and Fig. 21) Compound-related G3 fatigue was observed in two pts at the 315 mg / m2 / d dose; three Pts dosed at 250 mg / m2 / d were not noted with any G3 toxicity. (See Tables 15 and 16) No other significant, compound- related, adverse events were observed in those 17 Pts participated. Table 13. Patient Demographics. Table 14. Patient Enlistment. Attorney Docket No. 11650-002WO1 Table 15. adverse events. 5 Attorney Docket No. 11650-002WO1 Table 16. Karnofsky Score. Pharmacokinetics: On Day 1, a gradual, dose-proportioned increase in plasma concentration of RX-0201 was noted from 48-315 mg / m2 / d with respective volume of distribution increased from 70.1 L / m2 to 116 L / m2 proportionally; Css increased approximately proportionally to dose. On Day 15, an apparent mono-phasic or bi-phasic decline was observed from Cmax (observed at the end of infusion (Tmax)). Clearance of RX-0201 was independent of dose or cycle, with value ranged from 24.2 to 42 L / h.m2; mean terminal half-lives at the dose of 250-315 mg / m2 / d ranged from 1.9- 4 hrs. At 250 mg / m2 / d, the estimated volumes of distribution, the mean Cmax, mean AUClast, and mean Css for both Cycle 1 and Cycle 2 were comparable; which indicates absence of system drug from Cycle 1 at the start of Cycle 2 infusion. Plasma concentration of RX-0201 at dose of: 6 mg / m2 / d were <LLOQ; 12 and 24 mg / m2 / d concentration were insufficient; and 48 to 315 mg / m2 / d had gradual increase in concentration through 6 hrs post-dose; at 24hrs post-dose, the concentration of RX-0201 reached steady state; and on Day 15, a monophasic or bi-phasic decline from Cmax was noted. (See Figs 22A-22D and Table 17)

[0005] Attorney Docket No. 11650-002WO1 Table 17. RX-0201 Parmacokinetic Parametres in Patients with Solid Tumors. Immunohistochemistry analysis results showed AKT-1 was present in cytoplasm and the nucleus of cancer cells. (See Figures 23A-23F) Conclusion: No significant dose-limiting toxicity was noted, except for Grade 3 fatigue, which was noted only at 315 mg / m2 / day. MTD for RX-0201 after up to 2 cycles of continuous RX-0201 infusion was 315 mg / m2 / day in pts with an advanced cancer; Phase II trial dose was set at 250 mg / m2 / day and will be dosed for up to 8 cycles. Continuous intravenous infusion of RX-0201, initial phase: Dose-proportioned increase in plasma concentration of RX-0201; steady status: increase proportionally to dose; termination phase: an apparent mono-phasic or bi-phasic decline; between cycles: no systemic drug residue of RX- 0201 from Cycle I was found in the blood before Cycle II started. Example 8. Phase Ib / II Study of RX-0201, a novel AKT-1 antisense, combined with everolimus to treat metastatic clear cell renal carcinoma – Phase Ib results RX-0201, a novel, oligonucleotide that binds native AKT-1 mRNA, prevents downstream phosphorylation to p-AKT. RX-0201, in combination with everolimus, additively inhibited Caki-1 cell Attorney Docket No. 11650-002WO1 growth in vitro and is in development for the treatment of metastatic clear cell renal carcinoma Experimental: The phase 1b / 2 proof of concept, multicenter, open label study is conducted in 2 stages. The Phase 1b was a dose-escalation study of RX-0201 administered in combination with everolimus. RX-0201 was administered as a continuous intravenous infusion for 14 days followed by 7 days of rest; everolimus was administered at a starting dose of 10mg once daily. Subjects were enrolled at increasing doses of RX-0201 in a modified 3+3 design. Plasma concentrations were measured in Phase 1b and noncompartmental pharmacokinetic parameters were calculated using WinNonlin, Version 6.4. The dose of RX-0201 identified in Phase 1 is being studied further in Phase 2, which is the randomized, 2- arm study of RX-0201 in combination with everolimus versus everolimus alone. Demographics: 7 Males; 3 Females; Median Age: 60 years; Range: 44-78 years; Median Number of Prior Therapies: 1; Median ECOG Performance status at screening = 1; range 0-2 Results: In the Phase 1b, seven males and three females, (median age 60 years) were treated with 125 mg / m2 / day (n=3), 200 mg / m2 / day (n=4), and 250 mg / m2 / day (n=3) RX-0201 in combination with 10 mg everolimus. They received 1-3 lines of therapy prior to study entry (median = 1). The most common toxicities attributed to the combination were rash, mouth ulceration, weight loss, thrombocytopenia, facial edema, fatigue, and pruritus. No significant events were attributed to RX-0201 alone. Most events (81%) were mild or moderate in severity. Based on the tolerability, 250 mg / m2 / day RX-0201 dose was declared the recommended phase 2 dose. Three subjects in the phase 1b have experienced stable disease for 383, 191, and 122 days; a tumor burden reduction of 16 and 36% was seen in 2 subjects. RX-0201 PK demonstrated a dose proportional exposure. RX-0201 Pharmacokinetic Data: RX-0201 exposure rapidly rises to steady state in Day 1 and accumulates slightly during the dosing period. Upon cessation of the 14-day infusion, plasma concentrations decline rapidly with a mean T1 / 2 of 4.0 hours (125 mg / m2 / day), 2.7 hours (200 mg / m2 / day), and 6.0 hours (250 mg / m2 / day). Further testing of peak RX-0201 concentrations will occur in Stage 2. See Figs.24A, 24B and Tables 18 and 19. Table 18. PK Parameters at day 1. Parameter Day 1 y 9 Attorney Docket No. 11650-002WO1 Table 19. PK Parameters at day 15. PK Parameter Day 15 Dose 125 mg / m2 / day 200 mg / m2 / day 250 mg / m2 / day Respo , able disease for a median of 183.5 days, (range 106-383 days.) At the lowest dose level (125 mg / m2 / day) one subject has had stable disease for more than 1 year and experienced a 16% reduction in a right adrenal lesion after 4 cycles of treatment. See Figure 25A. At the second dose level (200 mg / m2 / day) one subject’s hypervascular mass just anterior to the nephrectomy bed has decreased 36% in size after 2 cycles of treatment. See Figure 25B. At the target dose level (250 mg / m2 / day) one subject experienced an unconfirmed 17% overall reduction in lesions (RECIST v 1.1) range 6% to 37.5% after 2 cycles. A single right hilar lesion is shown in Figure 25C. Previous RX-0201 Number of Days of Best Reason for Therapies Dose Cycles received Stable Response / Discontinuation al al Attorney Docket No. 11650-002WO1 IL-2 (PR) 250 <2 37 PD PD Pazopanib D = Progressive Disease; SD = Stable Disease; U = Unknown Safety: At least one subject experienced an event graded as Severe. Most events (79%) were reported as mild or moderate. No dose limiting toxicities occurred. Conclusions: RX-0201, in combination with everolimus is safe and well tolerated in patients with metastatic renal cancer at doses up to 250 mg / m2 / day. Exposure of RX-0201 is dose proportional and declines rapidly upon cessation of infusion. RX-0201, in combination with everolimus, continues to show early signs of clinical activity. Clinical activity is being further assessed in the randomized Phase 2 portion of the study testing RX-0201 + everolimus vs everolimus alone. Example 9. Results of a Phase 2 Study to Evaluate the Safety and Efficacy of Rx-0201 in Combination with Everolimus in Subjects with Metastatic Renal Cell Carcinoma (mRCC) Background: RX-0201 is a novel 20-mer oligonucleotide that binds to mRNA coding for AKT-1, preventing AKT-1 expression and limiting the amount of downstream p-AKT. In vitro RX-0201, in combination with everolimus, additively inhibited Caki-1 cell growth. RX-0201, in combination with everolimus, to treat mRCCwas evaluated in a Phase 1b / 2 clinical study. The Phase 1b / 2 study is a 2-stage, multicenter, open label study to assess the safety and tolerability of RX-0201 in combination with everolimus vs. everolimus alone to treat subjects with advanced renal cell carcinoma. Phase 2 Design: an open-label, phase 2 study of RX-0201 in combination with everolimus. Treatment: RX-0201 (250 mg / m2 / day)is administered by continuous IV infusion for 14 days followed by 1 week of rest. Everolimus (10 mg) was administered orally once daily. The dose was determined in the Phase 1 portion of the study (Agarwal N, et al., Journal of Clinical Oncology 34, no. 15_suppl (May 2016) 2559-2559). Phase 2 Objectives: determine progression free survival in subjects with advanced renal cell carcinoma treated with the combination of RX-0201 and everolimus versus everolimus alone. Evaluate parameters of clinical benefit as measured by duration of response, time to response, and response rate (Stage 2). Evaluate the safety and tolerability of RX-0201 in combination with everolimus versus Attorney Docket No. 11650-002WO1 everolimus alone (Stage 1 and Stage 2). Baseline characteristics (N=11) Age (No.of yr.) Sex —no. (%) Median 64 Male 7 (64) Range 53-72 Female 4 (36) Race and EthnicGroup —no. (%) ECOG score —no. (%) Black or African American 1 (9) ECOG = 0 6 (55) American Indian orAlaska Native 1 (9) ECOG = 1 5 (45) Asian 1 (9) Prior Therapies —no. (%) White 8 (72) 1 1 Hispanic 1 (9) 2 4 Non-Hispanic 10 (91) ≥3 6 Methods: This Phase 1b / 2 study (2-stage design, NCT02089334) evaluated the efficacy and safety of RX-0201 in combination with everolimus in eligible subjects with mRCC. Eligible subjects must have had confirmed histologic or cytologicevidence of renal cancer with a clear cell component, measurable disease as defined by RECIST v1.1, received at least 1 course of therapy with a VEGFR inhibitor and progressed within 6 months of planned first dose of on study treatment. In Phase 1 subjects were enrolled at increasing doses of RX-0201 (delivered via continuous IV for 14 days) in combination with 10 mg / day everolimus in a modified 3+3 design. The target dose of RX-0201 identified in Phase 1, 250 mg / m2 / day, was further evaluated in Phase 2. Primary objectives included the safety and efficacy at the recommended Phase 2 dose. The Phase 2 primary endpoint was progression free survival (PFS) benefit for at least 4.5 months. Results: Recruitment for this study was significantly affected by a change in the standard of care for advanced RCC due to the approval of 3 new therapies (nivolumab, cabozantinib, and lenvatinib+ everolimus). Therefore, enrollment in the everolimus alone arm was stopped early in the study due to a change in the standard of care and slow accrual. Eleven subjects 7 males, 4 females) were enrolled and treated with 250 mg / m2 / day IV RX-0201 14-day in combination with 10 mg everolimus. The median age was 64 years, ECOG performance status at screening was 0 to 1, and 55% received ≥ 3 prior therapies.8 subjects were response evaluable with at least 1 on-study scan. The median PFS in evaluable subjects was 4.9 months. Four subjects had stable disease after 6 months of treatment. The median PFS (Analysis Dataset) was 110 days (3.7 months). The most frequent related adverse events (>15%) were G1 / 2 epistaxis, G3 fatigue, G1 / 2 nausea and G1 vomiting. Most Treatment Emergent Adverse Events (TEAEs) related to the combination were Grade 1 -2 Attorney Docket No. 11650-002WO1 (68%). The most common related Grade 3 / 4 TEAE was fatigue (2 / 18%). See Figure 26. Pharmacokinetics PK Parameter RX-0201 Dose (mg / m2 / day) 125 200 250 Css(ng / mL) 1,626 [73.5] (2) 3,283 [.] (1) 5,147 [.] (1) λz ( / hr) —† 0.6348 [.] (1) —† t½ (hr) —† 1.09 [.] (1) —† CL 93,090 [50.9] (2) 73,731 [.] (1) 56,797 [.] (1) (mL / hr) 990 [57.2] (2) 998 [.] (1) 0,699 [.] (1) (mL / hr / kg) Vz —† 116 [.] (1) —† (L) —† 1.57 [.] (1) (L / kg) *Geometric mean [geometric %CV] (N). †Parameter could not be esImated for any subject in this dose group. Conclusions: Due to the low numbers of subjects treated it was not possible to adequately evaluate an efficacy or safety benefit of RX-0201, when combined with everolimus as a salvage treatment of subjects with advanced RCC. Historical progression free survival of everolimus alone is 4.0 months. The median progression free survival of this study was 4.9 when the data were censored. The PK of RX-0201 does not appear to be altered when combined with everolimus. In this mRCC population with extensive prior therapy, RX-0201 in combination with everolimus was safe, well-tolerated, and showed promising efficacy. The results also support the therapeutic significance of the AKT-1 / mTORpathway in mRCC. The compositions and methods of the appended claims are not limited in scope by the specific compositions and methods described herein, which are intended as illustrations of a few aspects of the claims and any compositions and methods that are functionally equivalent are intended to fall within the scope of the claims. Various modifications of the compositions and methods in addition to those shown and described herein are intended to fall within the scope of the appended claims. Further, while only certain representative compositions and method steps disclosed herein are specifically described, other combinations of the compositions and method steps also are intended to fall within the scope of the appended claims, even if not specifically recited. Thus, a combination of steps, elements, components, or constituents may be explicitly mentioned herein or less, however, other combinations of steps, elements, components, and constituents are included, even though not explicitly stated. The term “comprising” and variations thereof as used herein is used synonymously with the term “including” and variations thereof and are open, non-limiting terms. Although the terms “comprising” and “including” have been used herein Attorney Docket No. 11650-002WO1 to describe various embodiments, the terms “consisting essentially of” and “consisting of” can be used in place of “comprising” and “including” to provide for more specific embodiments of the invention and are also disclosed. Other than in the examples, or where otherwise noted, all numbers expressing quantities of ingredients, reaction conditions, and so forth used in the specification and claims are to be understood at the very least, and not as an attempt to limit the application of the doctrine of equivalents to the scope of the claims, to be construed in light of the number of significant digits and ordinary rounding approaches

Claims

Attorney Docket No. 11650-002WO1 CLAIMS What is claimed is:

1. A method of treating cancer, preventing cancer, preventing cancer metastasis, and / or preventing cancer recurrence in a subject in need thereof comprising: administering a therapeutic effective amount of Archexin, or a pharmaceutically acceptable salt thereof, to the subject to treat the cancer, wherein the therapeutically effective amount does not substantially inhibit Akt-1 expression in the subject.

2. The method of claim 1, wherein the Archexin has a nucleic acid sequence of SEQ. ID. NO.

1.

3. The method of any one of claims 1-2, wherein the therapeutically effective amount of the Archexin is administered over a period of 4 weeks or more, such as from 4 weeks to 8 weeks or from 4 weeks to 12 weeks.

4. The method of any of claims 1-3, wherein the Archexin, or a pharmaceutically acceptable salt thereof, is administered twice weekly.

5. The method of any of claims 1-4, wherein the Archexin, or a pharmaceutically acceptable salt thereof, is administered in a total dose of less than 1960 mg / m2, such as a total dose of less than 1800 mg / m2.

6. The method of claim 5, wherein the total dose is from 1000 mg / m2to 1900 mg / m2, such as from 1200 mg / m2to 1800 mg / m2.

7. The method of any one of claims 1-6, wherein the Archexin, or a pharmaceutically acceptable salt thereof, is administered at a weekly dose of from 300 mg / m2to 500 mg / m2.

8. The method of any one of claims 1-7, wherein the Archexin, or a pharmaceutically acceptable salt thereof, is administered parenterally, such as via intravenous infusion.Attorney Docket No. 11650-002WO1 9. The method of any one of claims 1-8, wherein Archexin, or pharmaceutically acceptable salts thereof, is administered at a dose of 150 mg / m2to 350 mg / m2per intravenous infusion.

10. The method of any one of claims 1-9, wherein Archexin, or pharmaceutically acceptable salts thereof, is administered over a period of at least 30 minutes.

11. The method of any one of claims 1-10, wherein Archexin, or pharmaceutically acceptable salts thereof, is administered over a period of from 30 minutes to 6 hours, such as from 1 hour to 4 hours.

12. The method of any one of claims 1-11, further comprising administering everolimus, or a pharmaceutically acceptable salt, prodrug, or derivative thereof; lenvatinib, or a pharmaceutically acceptable salt, prodrug, or derivative thereof; or any combination thereof to the subject.

13. The method of any one of claims 1-12, further comprising administering everolimus, or a pharmaceutically acceptable salt, prodrug, or derivative thereof, and lenvatinib, or a pharmaceutically acceptable salt, prodrug, or derivative thereof, to the subject.

14. The method of any one of claims 12-13, wherein the everolimus, or a pharmaceutically acceptable salt, prodrug, or derivatives thereof, is administered orally to the subject at a dose of from 0.5 mg to 5 mg per day, such as 5 mg per day.

15. The method of claim 14, wherein the everolimus, or a pharmaceutically acceptable salt, prodrug, or derivatives thereof, is administered daily for a period of 4 weeks or more, such as from 4 weeks to 12 weeks or from 4 weeks to 8 weeks.

16. The method of any one of claims 12-15, wherein the lenvatinib, or a pharmaceutically acceptable salt, prodrug, or derivative thereof, is administered to the subject orally at a dose of from 8 mg to 24 mg per day, such as 18 mg per day.Attorney Docket No. 11650-002WO1 17. The method of claim 16, wherein the lenvatinib, or a pharmaceutically acceptable salt, prodrug, or derivatives thereof, is administered daily for a period of 4 weeks or more, such as from 4 weeks to 8 weeks or from 4 weeks to 12 weeks.

18. A method of stimulating an immune response in a subject, the method comprising: administering to the subject an immunosImulatory amount of Archexin, or a pharmaceuIcally acceptable salt thereof.

19. The method of claim 18, wherein the immunostimulatory amount does not substantially inhibit Akt-1 expression in the subject.

20. The method of any of claims 18-19, wherein the Archexin, or a pharmaceutically acceptable salt thereof, is co-administered with an active agent or therapy.

21. The method of claim 20, wherein the active agent or therapy comprises radiotherapy, a chemotherapeutic agent, an immunomodulating agent, an antigen, or any combination thereof.

22. The method of any one of claims 18-21, wherein the Archexin has a nucleic acid sequence of SEQ. ID. NO.

1.

23. The method of any one of claims 18-22, wherein the therapeutically effective amount of the Archexin is administered over a period of 4 weeks or more, such as from 4 weeks to 8 weeks or from 4 weeks to 12 weeks.

24. The method of any of claims 18-23, wherein the Archexin, or a pharmaceutically acceptable salt thereof, is administered twice weekly.

25. The method of any of claims 18-24, wherein the Archexin, or a pharmaceutically acceptable salt thereof, is administered in a total dose of less than 1960 mg / m2, such as a total dose of less than 1800 mg / m2.Attorney Docket No. 11650-002WO1 26. The method of claim 25, wherein the total dose is from 1000 mg / m2to 1900 mg / m2, such as from 1200 mg / m2to 1800 mg / m2.

27. The method of any one of claims 18-26, wherein the Archexin, or a pharmaceutically acceptable salt thereof, is administered at a weekly dose of from 300 mg / m2to 500 mg / m2.

28. The method of any one of claims 18-27, wherein the Archexin, or a pharmaceutically acceptable salt thereof, is administered parenterally, such as via intravenous infusion.

29. The method of any one of claims 18-28, wherein Archexin, or pharmaceutically acceptable salts thereof, is administered at a dose of 150 mg / m2to 350 mg / m2per intravenous infusion.

30. The method of any one of claims 18-29, wherein Archexin, or pharmaceutically acceptable salts thereof, is administered over a period of at least 30 minutes.

31. The method of any one of claims 18-30, wherein Archexin, or pharmaceutically acceptable salts thereof, is administered over a period of from 30 minutes to 6 hours, such as from 1 hour to 4 hours.

32. The method of any one of claims 18-31, further comprising administering everolimus, or a pharmaceutically acceptable salt, prodrug, or derivative thereof; lenvatinib, or a pharmaceutically acceptable salt, prodrug, or derivative thereof; or any combination thereof to the subject.

33. The method of any one of claims 18-32, further comprising administering everolimus, or a pharmaceutically acceptable salt, prodrug, or derivative thereof, and lenvatinib, or a pharmaceutically acceptable salt, prodrug, or derivative thereof, to the subject.

34. The method of any one of claims 32-33, wherein the everolimus, or a pharmaceutically acceptable salt, prodrug, or derivatives thereof, is administered orally to the subject at a dose of from 0.5 mg to 5 mg per day, such as 5 mg per day.Attorney Docket No. 11650-002WO1 35. The method of claim 34, wherein the everolimus, or a pharmaceutically acceptable salt, prodrug, or derivatives thereof, is administered daily for a period of 4 weeks or more, such as from 4 weeks to 12 weeks or from 4 weeks to 8 weeks.

36. The method of any one of claims 32-35, wherein the lenvatinib, or a pharmaceutically acceptable salt, prodrug, or derivative thereof, is administered to the subject orally at a dose of from 8 mg to 24 mg per day, such as 18 mg per day.

37. The method of claim 36, wherein the lenvatinib, or a pharmaceutically acceptable salt, prodrug, or derivatives thereof, is administered daily for a period of 4 weeks or more, such as from 4 weeks to 8 weeks or from 4 weeks to 12 weeks.

38. A kit comprising: (i) Archexin, or a pharmaceutically acceptable salt thereof; and (ii) Everolimus, or a pharmaceutically acceptable salt thereof, Lenvatinib, or a pharmaceutically acceptable salt thereof, or any combination thereof.

39. The kit of claim 38, wherein Archexin has a nucleic acid sequence of SEQ. ID. NO.

1.

40. A composition comprising: (i) Archexin, or a pharmaceutically acceptable salt thereof; and (ii) Everolimus, or a pharmaceutically acceptable salt thereof, Lenvatinib, or a pharmaceutically acceptable salt thereof, or any combination thereof.

41. The composition of claim 40, wherein Archexin has a nucleic acid sequence of SEQ. ID. NO.1.

Images