Use of soybean protein phosphatase family gene gmpp2c11

Abstract

Provided is a use of a soybean protein phosphatase family gene GmPP2C11. The nucleotide sequence of the soybean GmPP2C11 protein coding gene GmPP2C11 is as shown in SEQ ID NO. 1. A PSCM-GmPP2C11 knockout vector is genetically transformed in a soybean, and it is found that compared with a receptor Jack, the hundred-grain weight and single-plant yield of a gene-edited material are both remarkably increased. Hence, the soybean GmPP2C11 protein coding gene GmPP2C11 can be used to increase the grain weight and yield of plants by means of genetic engineering, thereby providing technical service for increasing the yield of crops, especially soybeans.

Description

Application of a soybean protein phosphatase family gene GmPP2C11

[0001] This application claims priority to the Chinese patent application filed with the China Patent Office on June 13, 2023, with application number CN202310697372.3 and invention name “Application of a soybean protein phosphatase family gene GmPP2C11”, the entire contents of which are incorporated by reference into this application. Technical Field

[0002] The invention belongs to the field of plant genetic engineering and relates to the application of a soybean protein phosphatase family gene GmPP2C11. Background Art

[0003] Soybean (Glycine max (L.) Merr.) is an important food and oil crop, rich in protein and oil, and a major source of protein in animal feed. my country, the origin of soybean, however, currently produces far less than meets the growing demand. Therefore, increasing domestic soybean production is an urgent issue. Research on soybean yield traits is particularly important.

[0004] In this study, our laboratory discovered a QTL (qSW11) on chromosome 11 that is tightly linked to soybean 100-grain weight through linkage analysis and genome-wide association analysis of soybean yield traits. We then identified a candidate gene, GmPP2C11 (Glyma.11g065900V2.0), encoding a soybean PP2C protein phosphatase. This gene may be involved in reversible protein phosphorylation and play an important role in signaling pathways in soybean growth, development, and resistance. Therefore, we further investigated the biological function of GmPP2C11.

[0005] GmPP2C11 belongs to the PP2C protein phosphatase family. Currently, 134 PP2C protein phosphatases have been identified in soybean (Fan et al., 2020). A key feature of plant PP2C protein phosphatases is the presence of 11 conserved structural subdomains within their catalytic domain (Bork et al., 1996). PP2C protein phosphatases are monomeric enzymes that, unlike PPP-type protein phosphatases, lack regulatory subunits. Furthermore, the activity of PP2C protein phosphatases is regulated by magnesium or manganese ions. Other ions, such as copper and zinc, can inactivate PP2C protein phosphatases by competing with PP2C-dependent ions (Lumpp et al., 1998; Baudouin et al., 1999). Most plant PP2C protein phosphatases have a conserved catalytic domain at their C-terminus, while the N-terminus is more diverse, characterized by extended domains of varying lengths. These domains contain sequences associated with intracellular signaling, such as transmembrane regions, contributing to the diverse functions of different PP2C protein phosphatases. For example, the N-terminus of the tobacco PP2C protein phosphatase DBP1 contains a transcription factor sequence that can bind to defense-related gene promoters (Carrasco et al., 2003). Truncation of the N-terminal extension of the ABI1 gene increases its protein phosphatase activity (Sheen, 1998).

[0006] PP2C protein phosphatases are involved in important plant life processes, such as growth and development, and responses to biotic and abiotic stresses. In cucumber seedlings, under drought stress, the core ABA signaling components CsPYL1, CsPYL2, CsPP2C2, and CsSnKR2.2 were found to be upregulated in roots, stems, and leaves. CsPP2C2 is a 2C-type protein phosphatase (Wang et al., 2012). In alfalfa, MP2Cs participate in the drought stress response by regulating MAPK kinase activity (Meskiene et al., 2003). Screening for ABA-sensitive Arabidopsis mutants revealed that AtPP2CA in Arabidopsis negatively regulates ABA signaling (Kuhn et al., 2006).

[0007] Summary of the Invention

[0008] The purpose of the present invention is to disclose the application of a soybean PP2C protein phosphatase family gene GmPP2C11.

[0009] The purpose of the present invention can be achieved through the following technical solutions:

[0010] The soybean GmPP2C11 protein encoding gene GmPP2C11 is used in regulating the 1000-grain weight of Arabidopsis thaliana and the 100-grain weight and single-plant yield of soybean through genetic engineering. The nucleotide sequence of the soybean GmPP2C11 protein encoding gene GmPP2C11 is: SEQ ID NO.1.

[0011] As a preferred embodiment of the present invention, the plant height, 100-grain weight and single-plant yield of soybeans are increased by inhibiting the expression of the soybean GmPP2C11 protein encoding gene GmPP2C11.

[0012] As a preferred embodiment of the present invention, the soybean GmPP2C11 gene is knocked out to increase soybean plant height, 100-grain weight and single-plant yield.

[0013] Application of a recombinant expression vector containing the soybean GmPP2C11 protein encoding gene GmPP2C11 in regulating the 1000-grain weight of Arabidopsis thaliana by genetic engineering means; the soybean GmPP2C11 protein encoding gene GmPP2C11 has a nucleotide sequence of SEQ ID NO.1.

[0014] Application of an sgRNA knockout vector containing the soybean GmPP2C11 protein encoding gene GmPP2C11 in improving soybean plant height, 100-grain weight and single-plant yield through genetic engineering means; the soybean GmPP2C11 protein encoding gene GmPP2C11 has a nucleotide sequence of: SEQ ID NO.1.

[0015] When using GmPP2C11 to construct a plant expression vector, any enhancing or inducible promoter can be added before its transcriptional initiation nucleotide. To facilitate identification and screening of transgenic plant cells or plants, the plant expression vector can be modified, such as by adding a plant-expressible selectable marker gene (such as the GUS gene or the GFP gene) or an antibiotic resistance gene (such as gentamicin, kanamycin, or hygromycin). For the safety of transgenic plants, it is possible to omit the addition of any selectable marker gene and directly screen transformed plants based on phenotypic traits.

[0016] Plant expression vectors carrying the GmPP2C11 of the present invention can be used to transform plant cells or tissues using conventional biological methods such as Ti plasmids, Ri plasmids, plant virus vectors, direct DNA transformation, microinjection, electroporation, and Agrobacterium-mediated transfection, and the transformed plant tissues can be cultivated into plants. The transformed plant hosts can be monocots such as rice, wheat, and corn, as well as dicots such as tobacco, Arabidopsis, soybean, rapeseed, cucumber, tomato, poplar, turf grass, and alfalfa. Beneficial effects:

[0017] The GmPP2C11 of the present invention belongs to the PP2C protein phosphatase family. Tissue expression analysis revealed that GmPP2C11 is primarily expressed at higher levels in pods, and subcellular localization revealed that the GmPP2C11 protein is primarily localized in chloroplasts. Using the gene editing vector PSCM-GmPP2C11, the GmPP2C11 of the present invention is knocked out, which can regulate soybean plant height, 100-grain weight, and yield per plant. Compared with the control Jack, the GmPP2C11 gene-edited material significantly increased soybean plant height, 100-grain weight, and yield per plant. The present invention discloses the utility of this gene in regulating plant seed development and yield. The yield of crops can be increased by targeted modification of crop seed size. Description of the accompanying drawings.

[0018] The present invention will be further described below in conjunction with the accompanying drawings and embodiments. In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the accompanying drawings required for use in the embodiments will be briefly introduced below.

[0019] Figure 1 shows the cloning of the GmPP2C11 gene. Primers were designed based on the GmPP2C11 sequence information predicted by the phytozome website, and PCR amplification was performed using cDNA from the leaves of Nannong 1138-2 as a template, resulting in a 1272 bp DNA fragment. Sequencing analysis confirmed that the sequence of the fragment was consistent with the sequence predicted by the phytozome website, indicating that the 1272 bp fragment was the GmPP2C11 gene. The markers were 2k, 100 bp, 250 bp, 500 bp, 750 bp, 1000 bp, and 2000 bp.

[0020] Figure 2 shows tissue expression analysis of the GmPP2C11 gene; real-time fluorescence quantitative PCR was used to study the expression of GmPP2C11 in different tissues of soybean varieties Nannong 1138-2 and Kefeng No. 1, including roots, stems, leaves, flowers, pods, and seeds.

[0021] FIG3 shows the subcellular localization of GmPP2C11;

[0022] Figure 4 shows the bar test strip test of GmPP2C11 gene-edited soybean plants. 1 represents the recipient material; 2-6 represent five T0-generation transgenic lines, respectively;

[0023] Figure 5 shows the positive identification of GmPP2C11 gene-edited soybean plants; wherein, the markers are 2k, 100bp, 250bp, 500bp, 750bp, 1000bp, and 2000bp; WT represents the Jack amplification result of the recipient material; 1 and 7 represent the positive control; 2-6 represent the five transgenic plants KO-1, KO-3, KO-5, KO-6, and KO-7 detected in the T0 generation, respectively;

[0024] Figure 6 shows the expression analysis of GmPP2C11 in gene-edited materials and receptor Jack;

[0025] Figure 7 is a comparison of plant heights of soybean GmPP2C11 gene-edited material and recipient Jack at maturity;

[0026] Figure 8 is a comparison of the 100-grain weight (b) and single-plant yield (c) of soybean GmPP2C11 gene-edited material and recipient Jack. DETAILED DESCRIPTION

[0027] The present invention will be described in further detail below with reference to the accompanying drawings, examples, and data.

[0028] Example 1

[0029] Cloning and Identification of Soybean GmPP2C11 and Its Encoding Gene

[0030] Primers were designed based on the GmPP2C11 sequence information predicted by the phytozome website, and PCR amplification was performed using the leaf cDNA of Nannong 1138-2 as a template.

[0031] Upstream primer GmPP2C11-F: ACACCCGTGGTTTCACATTA (SEQ ID NO. 9);

[0032] Downstream primer GmPP2C11-R: TCTCTTCCACCAGTTCAAACAT (SEQ ID NO. 10).

[0033] The GmPP2C11 gene was amplified from total RNA from soybean leaves using RT-PCR. Soybean leaf tissue was ground in a mortar and pestle, added to a 1.5 mL EP tube containing lysis buffer, shaken thoroughly, and then transferred to a glass homogenizer. After homogenization, the sample was transferred to a 1.5 mL EP tube and total RNA was extracted using the Plant Total RNA Extraction Kit (TIANGEN DP404). Total RNA quality was assessed by formaldehyde denaturing gel electrophoresis, and RNA content was measured spectrophotometrically. Using the obtained total RNA as a template, reverse transcription was performed according to the instructions of the reverse transcription kit provided by Takara to synthesize the first-strand cDNA. PCR amplification was then performed. The PCR reaction system consisted of 2 μl of cDNA (0.05 μg), 2 μl of each upstream and downstream primer (10 μM), 25 μl of 2× PhantaMax Buffer, 1 μl of 10 mM dNTPs, and 1 U of PhantaMax Super-Fidelity DNA Polymerase (Vazyme). The volume was made up to 50 μl with ultrapure water. The PCR protocol was as follows: 94°C denaturation for 3 min, followed by 35 cycles of denaturation at 94°C for 15 s, annealing at 58°C for 15 s, and extension at 72°C for 45 s. The reaction was terminated by extension at 72°C for 5 min and stored at 4°C. The PCR product was recovered and cloned into the pGEM-Teasy vector. After sequencing, the cDNA sequence of the soybean gene GmPP2C11, 1272 bp in length, encoding the amino acids shown in SEQ ID NO. 2, was obtained.

[0034] Example 2

[0035] Expression characteristics of GmPP2C11 in different soybean organs

[0036] RNA was extracted from roots, stems, leaves, flowers, pods and seeds of Nannong 1138-2 and Kefeng No. 1, and converted into cDNA for RT-PCR analysis.

[0037] Total RNA extraction was performed as in Example 1. Tubulin, a constitutively expressed soybean gene, was used as an internal reference gene. The amplification primers were: Tubulin forward primer sequence: GGAGTTCACAGAGGCAGAG (SEQ ID NO. 11), Tubulin reverse primer sequence: CACTTACGCATCACATAGCA (SEQ ID NO. 12). Real-time fluorescence quantitative PCR analysis was performed using cDNA from different soybean tissues or organs as templates. The amplification primers for GmPP2C11 were: GmPP2C11-qPCR-F: TGCTGATGGTGTAGGTGGCT (SEQ ID NO. 13), GmPP2C11-qPCR-R: ATTTGCGTGAGCTTCCCTTA (SEQ ID NO. 14). Results (Figure 2) indicate that GmPP2C11 is relatively highly expressed in pods.

[0038] Example 3

[0039] Subcellular localization of GmPP2C11

[0040] Subcellular localization was performed using transient expression in Nicotiana benthamiana using the pAN580 vector and the following primers: GmPP2C11-F: acaaatctatctctctcgagATGCCTGGCATTCTCTCAAG (SEQ ID NO. 15) and GmPP2C11-R: gctcaccatggatccCTCACTCACTGAACCTGATATG (SEQ ID NO. 16). PCR amplification was performed and the target band was identified by rubber tapping. The recovered product was then ligated into the vector via homologous recombination to construct the subcellular localization vector pAN580-GmPP2C11 (with the gene at the N-terminus of GFP). After expression in Nicotiana benthamiana, cells were cultured for 48 hours and illuminated with a laser confocal microscope (Zeiss, LSM780) to generate a green fluorescent signal, localizing the protein and observing and photographing it. The results are shown in Figure 3. The empty vector was distributed throughout the cells, and the GmPP2C11:GFP fusion protein was also distributed in the chloroplasts and fused with the chloroplast's spontaneous red fluorescence, indicating that GmPP2C11 may function in the chloroplasts.

[0041] Example 4

[0042] Genetic Engineering Application of GmPP2C11

[0043] The CDS region sequence of the GmPP2C11 gene was inserted into CRISPR-P (http: / / crispr.hzau.edu.cn / CRISPR2 / ) to obtain sgRNA. SgRNAs with high on-target efficiency and low off-target rate were selected and linked to the PSCM vector driven by the U3 and U6 promoters. To improve the on-target efficiency, three sgRNAs were selected:

[0044] GmPP2C11-sgF1: TAATCTGACAAGAGTGTTAAgttttagagctagaaatagcaag (SEQ ID NO.3), GmPP2C11-sgR1: TTAACACTCTTGTCAGATTAaatccatatgttttcctgggac (SEQ ID NO.4);

[0045] GmPP2C11-sgF2: TCCCATATCAGTTGGAGAGTgttttagagctagaaatagcaag (SEQ ID NO.5), GmPP2C11-sgR2: ACTCTCCAACTGATATGGGAtgaccagacatgtcacgcttagt (SEQ ID NO.6);

[0046] GmPP2C11-sgF3: GTTGAACATGCAATTAGGGCgttttagagctagaaatagcaag (SEQ ID NO.7), GmPP2C11-sgR3: GCCCTAATTGCATGTTCAACaatccatatgttttcctgggac (SEQ ID NO.8);

[0047] The two successfully connected PSCM vectors were then double-ligated to construct a quadruple-linked vector for multi-sgRNA editing for soybean target gene knockout experiments. The PSCM vectors were then transferred into Agrobacterium tumefaciens strain EHA105 using the freeze-thaw method.

[0048] Soybean seeds with no surface defects, plump grains, and uniform color of large and small seed coats were selected and sterilized in a fume hood. The chemical reaction HCl (concentrated) + NaClO → Cl2↑ + NaOH (the volume ratio of concentrated hydrochloric acid to sodium hypochlorite is about 1:10) produces chlorine gas for disinfection. In the experiment, 120ml of NaClO was placed in a conical flask. At this time, the beans in the culture dish were placed in the dryer, the conical flask was placed in the middle of the dryer, and the lid was covered. Then 15ml of concentrated HCl was slowly added from the top of the dryer through a separatory funnel, and the disinfection time was 7 hours.

[0049] Seed germination: After sterilization, fully blow away the chlorine in the clean bench, and vertically insert the seeds into the pre-prepared solid SG4 germination medium so that the medium covers half of the hilum.

[0050] Inoculation: Add about 120 ml of YEB liquid medium with antibiotics Kan and Rif to a conical flask, add 1.5 ml of a small amount of bacterial solution, and shake at 28°C and 200 rpm until the OD 600 =0.9.

[0051] Agrobacterium infection: Centrifuge the shaken bacterial suspension at 5000 rpm for 10 minutes at room temperature, discard the supernatant, then add co-culture medium (CCM) to two centrifuge tubes and oscillate to suspend the suspension until the OD600 is adjusted to 0.6. Five days after germination, remove a portion of the hypocotyl, leaving 5-10 mm. Cut the seeds along the cotyledonary and hypocotyl sections, remove the true leaves, and then gently score several wounds along the hypocotyl at the cotyledonary nodes. Place the treated explants and the suspended bacterial suspension into a sterilized jar and co-culture at 28°C, 120 rpm, for 30-40 minutes. Finally, remove the explants, cotyledonary node side down, and place them on a solid co-culture medium (CCM) covered with filter paper. Place 14 explants per dish and incubate at 25°C in the dark for 5 days.

[0052] Induction of clustered shoots: After 5 days of co-cultivation, explants were sterilized with sterile water and Wash-Liquid. Excess hypocotyls were cut, leaving approximately 5-10 mm. The explants were then inserted at a 45° angle, with the growing point upward, into SIM solid medium without glufosinate, 8 per dish. Incubate at 26°C in the light for 15 days. After 15 days, the large buds and part of the hypocotyls were removed. Explants that had produced clustered shoots were then transferred to SIM solid medium supplemented with 6 mg / L glufosinate for selection and culture for 15 days.

[0053] Elongation: Remove the cotyledons, dead leaves, and part of the hypocotyl from any explants that have not completely withered. Culture the medium on SEM solid medium supplemented with 4 mg / L glufosinate for 15 days. Remove the dead leaves and part of the hypocotyl and replace the medium with fresh SEM solid medium, gradually decreasing the glufosinate concentration.

[0054] Rooting: When the bud of the explant grows to about 6 cm, cut off the bottom, make a cross-shaped wound at the bottom of the stem, and transfer it to rooting medium RM for culture. The induced roots can be seen after about 10 days.

[0055] Hardening: Pour an appropriate amount of sterile water into the bottle and incubate at 26°C for approximately 5 days. Transplant. When the roots are of appropriate length and number, separate the tissue culture seedlings from the medium, transfer them to sterilized soil, and place them in an artificial incubator (16 hours light / 8 hours dark, 25°C).

[0056] T0 seedlings were tested using bar test strips and marker gene Bar primers Bar-F: CGAGACAAGCACGGTCAACTT (SEQ ID NO. 17); Bar-R: AAACCCACGTCATGCCAGTTC (SEQ ID NO. 18) (Figures 4 and 5). Three homozygous edited lines were obtained by indoor multiplication to the T3 generation and GmPP2C11 expression analysis was performed GmPP2C11-qPCR-F: TGCTGATGGTGTAGGTGGCT (SEQ ID NO. 19) and GmPP2C11-qPCR-RATTTGCGTGAGCTTCCCTTA (SEQ ID NO. 20). The expression level of the GmPP2C11 gene in the three homozygous lines was significantly decreased (Figure 6). Compared with the recipient material Jack, the three homozygous lines had higher mature plants than the recipient material Jack, and the 100-grain weight and single-plant yield were significantly increased (Figures 7 and 8).

[0057] Although the above embodiment provides a detailed description of the present invention, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the scope of protection of the present invention.

Claims

1. Application of soybean GmPP2C11 protein encoding gene GmPP2C11 in regulating plant yield and / or plant height by genetic engineering means; the nucleotide sequence of the soybean GmPP2C11 protein encoding gene GmPP2C11 is shown in SEQ ID NO.

1.

2. The use according to claim 1, characterized in that: The regulation includes: inhibiting the expression of soybean GmPP2C11 protein encoding gene GmPP2C11, and increasing soybean plant height, 100-grain weight and single-plant yield.

3. The use according to claim 1, characterized in that: The genetic engineering method includes: knocking out the soybean GmPP2C11 gene.

4. The use according to claim 3, characterized in that: The method for knocking out the soybean GmPP2C11 gene includes: knocking out the soybean GmPP2C11 gene using an sgRNA knockout vector.

5. The use according to claim 4, characterized in that: Using a biological method to transform the sgRNA knockout vector into plant cells or tissues, and cultivating the transformed plant cells or tissues into plants; The biological methods include Ti plasmid, Ri plasmid, plant virus vector, direct DNA transformation, microinjection, electroporation and Agrobacterium-mediated.

6. The use according to claim 1, characterized in that: The plants include monocots or dicots; The monocotyledonous plants include rice, wheat, and corn; The dicotyledonous plants include tobacco, Arabidopsis, soybean, rapeseed, cucumber, tomato, poplar, lawn grass and alfalfa.

7. Application of a sgRNA knockout vector containing the soybean GmPP2C11 protein encoding gene GmPP2C11 in improving soybean plant height, 100-grain weight and single-plant yield through genetic engineering means; the nucleotide sequence of the soybean GmPP2C11 protein encoding gene GmPP2C11 is shown in SEQ ID NO.

1.

8. The use according to claim 7, characterized in that: The sgRNA knockout vector is a quadruple vector edited by multiple sgRNAs; The multi-sgRNA edited quadruple vector includes a quadruple vector edited by sgRNA1, a quadruple vector edited by sgRNA2, and a quadruple vector edited by sgRNA3; The sgRNA1 is connected to two PSCM vectors, and the two successfully connected PSCM vectors are double-connected to obtain the sgRNA1-edited quadruple vector; the sgRNA1 includes GmPP2C11-sgF1 and GmPP2C11-sgR1; the nucleotide sequence of the GmPP2C11-sgF1 is shown in SEQ ID NO.3; the nucleotide sequence of the GmPP2C11-sgR1 is shown in SEQ ID NO.4; Connect sgRNA2 to two PSCM vectors, and load the two successfully connected PSCM vectors The sgRNA2 is double-ligated to obtain a quadruple vector edited by the sgRNA2; the sgRNA2 includes GmPP2C11-sgF2 and GmPP2C11-sgR2; the nucleotide sequence of the GmPP2C11-sgF2 is shown in SEQ ID NO.5; the nucleotide sequence of the GmPP2C11-sgR2 is shown in SEQ ID NO.6; The sgRNA3 was connected to two PSCM vectors, and the two successfully connected PSCM vectors were double-connected to obtain the sgRNA3-edited four-linked vector; the sgRNA3 included GmPP2C11-sgF3 and GmPP2C11-sgR3; the nucleotide sequence of the GmPP2C11-sgF3 was shown in SEQ ID NO.7; the nucleotide sequence of the GmPP2C11-sgR3 was shown in SEQ ID NO.

8.

9. The use according to claim 8, characterized in that: The PSCM vector is driven by U3 and U6 promoters.

10. A sgRNA knockout vector for soybean GmPP2C11 protein encoding gene GmPP2C11, characterized in that: The sgRNA knockout vector knocks out the soybean GmPP2C11 gene.

11. The sgRNA knockout vector according to claim 10, characterized in that The sgRNA knockout vector is a quadruple vector edited by multiple sgRNAs; The multi-sgRNA edited quadruple vector includes a quadruple vector edited by sgRNA1, a quadruple vector edited by sgRNA2, and a quadruple vector edited by sgRNA3; The sgRNA1 is connected to two PSCM vectors, and the two successfully connected PSCM vectors are double-connected to obtain the sgRNA1-edited quadruple vector; the sgRNA1 includes GmPP2C11-sgF1 and GmPP2C11-sgR1; the nucleotide sequence of the GmPP2C11-sgF1 is shown in SEQ ID NO.3; the nucleotide sequence of the GmPP2C11-sgR1 is shown in SEQ ID NO.4; The sgRNA2 is connected to two PSCM vectors, and the two successfully connected PSCM vectors are double-connected to obtain the sgRNA2-edited quadruple vector; the sgRNA2 includes GmPP2C11-sgF2 and GmPP2C11-sgR2; the nucleotide sequence of the GmPP2C11-sgF2 is shown in SEQ ID NO.5; the nucleotide sequence of the GmPP2C11-sgR2 is shown in SEQ ID NO.6; The sgRNA3 was connected to two PSCM vectors, and the two successfully connected PSCM vectors were double-connected to obtain the sgRNA3-edited four-linked vector; the sgRNA3 included GmPP2C11-sgF3 and GmPP2C11-sgR3; the nucleotide sequence of the GmPP2C11-sgF3 was shown in SEQ ID NO.7; the nucleotide sequence of the GmPP2C11-sgR3 was shown in SEQ ID NO.

8.

12. The sgRNA knockout vector according to claim 10, characterized in that The PSCM vector is driven by U3 and U6 promoters.

Images