Nucleic acid sequence transfer-based treatment for malignant diseases

Abstract

An isolated or purified LEPROT and / or LEPROTL1 nucleic acid sequence for increasing protein production, and methods for using the same in the treatment, prevention or amelioration of the effects of malignant disease in a subject.

Description

Nucleic acid sequence transfer-based treatment for malignant diseasesTECHNICAL FIELD

[0001] The present invention relates to nucleic acid sequences and the use of such nucleic acid sequences in nucleic acid sequence transfer protocols for upregulating the expression of functional LEPROT and / or LEPROTL1 proteins. The invention further provides compositions comprising such nucleic acid sequences and methods of using the same for the treatment of malignant diseases such as cancers.BACKGROUND ART

[0002] Leptin is an obesity-associated adipokine hormone that is known to regulate energy metabolism and reproduction and to control appetite via the leptin receptor. The leptin receptor (LEPR) is a molecule that receives and transmits signals from leptin. LEPR is involved primarily in the regulation of metabolism (including energy balance and neuroendocrine responses to food intake) but also serves roles in bone metabolism, immunity, and reproductive function. Emerging findings have demonstrated the direct and indirect biological effects of leptin in regulating cancer proliferation, metastasis, angiogenesis, wound healing, osteoarthritis, osteoporosis, bone mass and immune system regulation, and chemoresistance.

[0003] Obesity is known to be a general risk factor for cancers, without a very clear mechanistic explanation. Obesity is a result of a reduction in leptin sensitivity by cells, and this can lead to increased circulating leptin levels, which in turn stimulates some cells to proliferate. This situation is known as a dysregulation of the leptin signalling - some cells are not responding to leptin due to insensitivity, but concurrently some cells get overstimulated.

[0004] While the precise function of leptin and the leptin receptor in malignancy is still not clear, many malignancies have dysregulation of leptin signalling. This leads to augmented growth signals and accelerated metabolism. Osteosarcoma is a bone cancer of adolescence, a time of life when growth hormone levels are high. Once the primary tumour is established, leptin triggers cancer cell proliferation, migration, and invasion. Furthermore, it exerts effects on tumour- associated stromal cells (such as endothelial cells, immune cells, and fibroblasts), to enhance angiogenesis and inflammatory processes that support tumour growth. These effects are transmitted through the action of the leptin receptor (LEPR).

[0005] There is a need to modulate and regulate leptin production and sensitivity and leptin receptor activity; or at least the provision of methods to compliment the previously known methods. The present invention seeks to provide an improved or alternative method to modulate and regulate leptin production and sensitivity and leptin receptor activity, through manipulation of the production of LEPROT and / or LEPROTL1 protein.

[0006] The previous discussion of the background art is intended to facilitate an understanding of the present invention only. The discussion is not an acknowledgement or admission that any of the material referred to is or was part of the common general knowledge as at the priority date of the application.SUMMARY OF INVENTION

[0007] Broadly, according to one aspect of the disclosure, there is provided an isolated or purified nucleic acid sequence for increasing protein production of one or more of the following proteins encoded by the respective gene transcript or part thereof: i. LEPROT; and / or ii. LEPROTL1 to induce upregulation of the production of functional LEPROT and / or LEPROTL1 protein.

[0008] Optionally, the nucleic acid sequence transfer is RNA transfer or cDNA transfer. Optionally, the RNA or cDNA is an RNA or cDNA that codes for a functional LEPROT or LEPROTL1 protein, for example the full length LEPROT or LEPROTL1 protein. Optionally, the nucleic acid sequence comprises at least four exons of the LEPROT gene and / or at least four exons of the LEPROTL1 gene. More preferably the RNA or cDNA is SEQ ID NO: 1 and / or SEQ ID NO: 2. Optionally, the nucleic acid sequence transfer of the present disclosure does not affect or alter the genomic sequence of the LEPROT or LEPROTL1 genes.

[0009] The disclosure further provides a method for manipulating production of functional LEPROT and / or LEPROTL1 protein, the method including the step of: a) using nucleic acid sequence transfer to increase the amount of nucleic acid sequence in a cell that codes for a functional LEPROT and / or LEPROTL1 protein.

[0010] The disclosure further provides vector delivery systems that are capable of expressing the nucleic acid sequences of the present disclosure. Optionally, the delivery system used to introduce the nucleic acid sequences of the present disclosure into cells are nucleic acid nanoparticles or viral vectors.

[0011] The present disclosure provides a method for treating a malignant disease by increasing the amount of functional LEPROT and / or LEPROTL1 protein in a subject, the method including the step of: a) using nucleic acid sequence transfer to increase the amount of nucleic acid sequence in the subject that codes for a functional LEPROT and / or LEPROTL1 protein.

[0012] The disclosure further provides a pharmaceutical, prophylactic, or therapeutic composition to treat, prevent or ameliorate the effects of malignant disease in a subject, the composition comprising: a) one or more nucleic acid sequences as described herein, and b) one or more pharmaceutically acceptable carriers and / or diluents.

[0013] The malignant disease to be treated using the nucleic acid sequences of the present disclosure, in a process of nucleic acid sequence transfer-based therapy, is preferably a cancer, for example a solid-tumour cancer. For example, the cancer may be a sarcoma or carcinoma. The cancer may be chosen from: osteosarcoma, breast cancer, colorectal cancer. Most preferably the cancer is osteosarcoma.

[0014] The disclosure provides a method to treat, prevent or ameliorate the effects of malignant disease in a subject, comprising the step of: a) administering to the subject an effective amount of one or more nucleic acid sequences or pharmaceutical composition comprising one or more nucleic acid sequences as described herein.

[0015] The disclosure also provides for the use of purified and isolated nucleic acid sequences as described herein, for the manufacture of a medicament for treatment of malignant disease.

[0016] There is further provided the use of purified and isolated nucleic acid sequences as described herein for the manufacture of a medicament to treat, prevent or ameliorate the effects of malignant disease.

[0017] The present disclosure also provides kits to treat, prevent or ameliorate malignant disease in a subject, which kit comprises at least an isolated or purified nucleic acid sequence according to the present disclosure, packaged in a suitable container, together with instructions for its use.

[0018] Further aspects of the disclosure will now be described with reference to the accompanying non-limiting Examples and Drawings.BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Further features of the present invention are more fully described in the following description of several non-limiting embodiments thereof. This description is included solely for the purposes of exemplifying the present invention. It should not be understood as a restriction on the broad summary, disclosure or description of the invention as set out above. The description will be made with reference to the accompanying drawings in which:Figure 1 is a graph of the relative gene expression of LEPROT gene in osteosarcoma cell lines (143B, LI2-OS and HOS) compared to normal bone cell line (hFOB).Figure 2 shows overexpression (LEPROT-OE) or knockdown (shLEPROT) expression of human LEPROT gene by RT-qPCR analysis (A). Overexpression or knockdown expression of human LEPROT gene reduces or decrease the protein expression of BCL-2, MDM2, IGF1 R and P53 by western blot analysis (C). Overexpression or knockdown expression of human LEPROT gene reduces or promotes cell proliferation by MTS assay (D).Figure 3 shows overexpression or knockdown expression of human LEPROT gene results in reduction or promotion of colony formation of U2-OS OS cells by colony formation assay.Figure 4 is a graph of the upregulation of LEPROT (OE-LEPROT) and downregulation of LEPROT (shLEPROT) in cell lines measured as fluorescence intensity.Figure 5 shows that overexpression or knockdown expression of human LEPROT protein results in respective decreased or increased expression of Ki67 as analysed by confocal microscopy.Figure 6 shows that overexpression of human LEPROT protein results in increased Go / G1 phase and apoptosis, and decreased S phase and G2 / M phase. Knockdown of human LEPROT protein results in decreased Go / G1 phase and apoptosis, and increased S phase and G2 / M phase.DESCRIPTION OF INVENTIONDetailed Description of the Invention

[0020] It is known that leptin and the leptin receptor (LEPR) may be involved in the development of obesity, and the development and growth of cancers such as osteosarcoma. If the production, activity and sensitivity of leptin and the leptin receptor can be modulated, this may be beneficial in the treatment of obesity and cancers.

[0021] Leptin’s signalling is based on ligand-receptor interaction, but it has several levels of cellular regulation. The majority of LEPR proteins are expressed but are stored intracellularly and are not accessible to the circulating leptin. Significant alterations in the leptin levels have been found for variable disease conditions. High levels of leptin have been established as a biomarker for the breast cancer recurrence and leptin has a role in breast cancer development. Leptin also stimulates migration and invasion of colorectal and gastric cancer cells and increased leptin levels reflect the increased carcinogenicity.

[0022] The gene for LEPR contains an additional transcript which is generated from the same locus. This additional transcript encodes a protein called leptin receptor over-lapping transcript (LEPROT), which does not share any sequence similarity with LEPR. Mammals also have a single LEPROT homologue called leptin receptor overlapping transcript-like 1 (LEPROTL1 ), that has 70% amino acid sequence similarity with LEPROT and whose gene maps on chromosome 8 in humans. LEPROTL1 and LEPROT may be involved in protein trafficking. As LEPR and LEPROT are genetically linked, LEPROT regulates the LEPR protein function. As LEPROTL1 is a homolog of LEPROT, LEPROTL1 regulates LEPR function by its molecular homology. The LEPROT family (LEPROT, LEPROTL1 ) are small proteins of 131-140 amino acids with four potential transmembrane domains.

[0023] LEPROT (Leptin Receptor Overlapping Transcript) has many aliases including Endospanin-1 , LEPR, VPS55, OBRGRP, OB-RGRP, OB-R Gene-Related Protein, Endospanin, FLJ90360, LEPR, DnaJ (Hsp40) Homolog Subfamily C Member 6, Leptin Receptor Gene Related Protein, OBR. LEPROT is transcribed from an alternate AUG within the leptin receptor gene. The alternate start site is out of frame with the leptin receptor transcript, such that it produces a 131 amino acid protein that shares no primary sequence with the leptin receptor protein (LEPR).

[0024] LEPROTL1 (Leptin Receptor Overlapping Transcript Like 1) has following aliases: Endospanin-2, My047, Vps55, Leptin Receptor Overlapping Transcript-Like 1 , HSPC112.

[0025] LEPROT and LEPROTL1 are endogenous antagonists of the leptin receptor and can augment or reduce leptin signalling. LEPROT and LEPROTL1 work cooperatively, and their functions overlap completely. Increased LEPROT and / or LEPROTL1 negatively regulates LEPRcell surface expression and reduces the availability of LEPR, and thus decreases a cell’s response to leptin. Importantly, changes in LEPROT and / or LEPROTL1 expressions modified the glucose homeostasis in experimental animals. LEPROT and / or LEPROTL1 negatively regulate the cell surface expression of the growth hormone receptor (GHR) in the liver, and is believed to play a role in liver resistance to growth hormone (GH) during periods of reduced nutrient availability.Involvement in Malignant Disease

[0026] LEPROT is reported to be involved in metabolism regulation and energy balance as well as molecular signalling of breast cancer and osteosarcoma. The LEPROT gene has a range of alternative splicing forms. Some specific splicing forms are significantly downregulated in malignancies such as osteosarcoma. This indicates enhanced growth and proliferation signals in the cancer cells. LEPROT is expressed in various tissues and is suggested to be involved in cancer developments but with contradictory roles. The expressions of LEPROT in cancers were compared with corresponding normal tissues across pan-cancer types. LEPROT expression was found to be significantly aberrant in 15 / 19 (78.9%) cancers compared with corresponding normal tissues. LEPROT has been found to be downregulated in twelve cancers and upregulated in three cancers. LEPROT may also serve as a potential prognostic marker or a target in cancer therapy. The pan-cancer analysis indicated multiple roles for LEPROT across different cancer types.

[0027] In many cancers the loss of function of LEPROTL1 has been detected, indicating the possibility that the loss of function of LEPROTL1 is related to tumorigenesis. Furthermore, as LEPROTL1 is a homolog of LEPROT, it is likely that it may also be involved in metabolism regulation and energy balance as well as molecular signalling of cancers in a similar manner to LEPROT.

[0028] It is known that LEPROT and / or LEPROTL1 may be rendered dysfunctional in osteosarcoma (OS) by alternative splicing (Rothberg et al (2020) Exp Biol Med 245(16):1437- 1443). Alternative splicing can produce a wide variety of isoforms, some of which may be dysfunctional or exhibit additional / other properties.

[0029] Without being held to any theory, it is believed that upregulation of LEPROT and / or LEPROTL1 may reduce tumour growth and as such could be used as treatment strategy in oncology.Up Regulation

[0030] Up regulation of one or more of the LEPROT family proteins of the present disclosure is preferably achieved by nucleic acid sequence transfer. Optionally, the nucleic acid sequence transfer is RNA transfer or cDNA transfer.

[0031] The LEPROT and LEPROTL1 genes produce a range of expressed transcript variants. The number of exons for each protein have been variously determined to be four, five or even six exons; a number of transcripts with less than four exons have also been identified for each gene, but the purpose or functionality of these has not been clarified. However, the most canonical sequence for the expressed transcript variants is as presented below as SEQ ID NO: 1 and SEQ ID NO: 2, which each have four exons.

[0032] Optionally, the RNA or cDNA is an RNA or cDNA that codes for a functional LEPROT or LEPROTL1 protein, for example the full length LEPROT or LEPROTL1 protein. Optionally, the nucleic acid sequence comprises at least four exons of the LEPROT gene and / or at least four exons of the LEPROTL1 gene. More preferably the RNA or cDNA is SEQ ID NO: 1 or SEQ ID NO: 2. Optionally, the nucleic acid sequence transfer of the present disclosure does not affect or alter the genomic sequence of the LEPROT or LEPROTL1 genes.SEQ ID NO: 1 - LEPROT mRNA sequence:GAATTCGCCACCATGGCGGGCGTTAAAGCTCTCGTGGCATTATCCTTCAGTGGGGCTATT GGACTGACTTTTCTTATGCTGGGATGTGCCTTAGAGGATTATGGCGTTTACTGGCCCTTATT CGTCCTGATTTTCCACGCCATCTCCCCCATCCCCCATTTCATTGCCAAAAGAGTCACCTAT GACTCAGATGCAACCAGTAGTGCCTGTCGGGAACTGGCATATTTCTTCACTACTGGAATTG TTGTTTCTGCCTTTGGATTTCCTGTTATTCTTGCTCGTGTGGCTGTGATCAAATGGGGAGCC TGCGGCCTTGTGTTGGCAGGCAATGCAGTCATTTTCCTTACAATTCAAGGGTTTTTCCTTAT ATTTGGAAGAGGAGATGATTTTAGCTGGGAGCAGTGGGGATCC (SEQ ID NO:1)SEQ ID NO:2 - LEPROTL1 mRNA sequence:ATGGCAGGCATCAAAGCTTTGATTAGTTTGTCCTTTGGAGGAGCAATCGGACTGATGTTTTT GATGCTTGGATGTGCCCTTCCAATATACAACAAATACTGGCCCCTCTTTGTTCTATTTTTTTA CATCCTTTCACCTATTCCATACTGCATAGCAAGAAGATTAGTGGATGATACAGATGCTATGA GTAACGCTTGTAAGGAACTTGCCATCTTTCTTACAACGGGCATTGTCGTGTCAGCTTTTGG ACTCCCTATTGTATTTGCCAGAGCACATCTGATGGGGCGCCTACCCTTCTTCAGCAAGATG GGAACAGCTGAGTCTGAAGGAAGAGAAACACTGACACAGCAGCTGCCTCTCCCAGCAGCC GCCATGAGAAGATTGTTACCTGCAAGCAGAGTGTCCACTCAACCCGTGCTGAGGCTGGCA GACAGTGCTGAGTCACTTCTGGGCAGGCCTGCTCTGTGGGCTCTAGGATTCCTGCTTTGC CCTCCCTCTCAGGCACAATGA (SEQ ID NO:2)

[0033] Any of these techniques leads to an increase in production of functional LEPROT family target proteins.

[0034] It is known that LEPROT and LEPROTL1 proteins come in a range of isoforms. The present disclosure may not increase all RNA transcripts and thus all isoforms. Rather, it seeks to increase the production of one or more functional protein isoforms compared to the production of one or more non-functional isoforms. Furthermore, the nucleic acid sequence transfer method of the present disclosure may not affect the transcription of the genomic LEPROT or LEPROTL1 sequences. Thus, the genomically-based protein production from the LEPROT or LEPROTL1 genes may not be increased.

[0035] Optionally, the nucleic acid sequence transfer-induced manipulation of protein expression of the present disclosure results in the following:- LEPROT - increasing the amount of RNA or cDNA coding for functional isoforms of LEPROT to increase the number of functionally active protein isoforms;- LEPROTL1 - increasing the amount of RNA or cDNA coding for functional isoforms of LEPROTL1 to increase the number of functionally active protein isoforms.

[0036] Optionally, the nucleic acid transfer of the LEPROT and / or LEPROTL1 RNA or cDNA is achieved by one or more of the following: transformation; conjugation; electroporation; liposome- mediated gene transfer; transduction; and direct transfer of RNA and / or cDNA.

[0037] The term “nucleic acid sequence” refers to a sequence of cyclic subunits, each bearing a base-pairing moiety, linked by inter-subunit linkages. The cyclic subunits are based on ribose or another pentose sugar. The nucleic acid sequences may have exact or near sequence complementarity to the mRNA sequence for LEPROT or LEPROTL1 protein; variations in sequence near the termini of a nucleic acid sequence are generally preferable to variations in the interior. The nucleic acid sequence may be an RNA or a cDNA. If the nucleic acid sequence is an RNA, preferably it is an mRNA.

[0038] By “isolated” is meant material that is substantially or essentially free from components that normally accompany it in its native state. For example, an “isolated nucleic acid sequence” as used herein, may refer to a polynucleotide that has been purified or removed from the sequences that flank it in a naturally occurring state, e.g., a DNA fragment that is removed from the sequences that are adjacent to the fragment in the genome. The term “isolating” as it relates to cells refers to the purification of cells (e.g., fibroblasts, lymphoblasts) from a source subject (e.g., a subject with malignant disease). In the context of mRNA or protein, “isolating” refers to the recovery of mRNA or protein from a source, e.g., cells.

[0039] In certain embodiments, nucleic acid sequences may be 100% complementary to the LEPROT or LEPROTL1 mRNA target sequences, or may include mismatches, e.g., to accommodate variants. Hence, certain nucleic acid sequences may have about or at least about 70% sequence complementarity, e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence complementarity, between the nucleic acid sequences and the LEPROT or LEPROTL1 mRNA target sequences.

[0040] Additional examples of variants include nucleic acid sequences having about or at least about 70% sequence identity or homology, e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity or homology, over the entire length of SEQ ID NOs: 1 or 2.Method of Use

[0041] The disclosure further provides a method for manipulating production of functional LEPROT and / or LEPROTL1 protein, the method including the step of: a) using nucleic acid sequence transfer to increase the amount of nucleic acid sequence in a cell that codes for a functional LEPROT and / or LEPROTL1 protein.

[0042] Optionally, the nucleic acid sequence is an RNA or cDNA nucleic acid sequence. Optionally, the nucleic acid sequence is an RNA or cDNA nucleic acid sequence encoding a function or full length LEPROT or LEPROTL1 protein. Optionally, the nucleic acid sequence comprises at least four exons of the LEPROT gene and / or at least four exons of the LEPROTL1 gene. More preferably the nucleic acid sequence is SEQ ID NO: 1 or SEQ ID NO: 2. Optionally, nucleic acid sequence transfer-induced manipulation of protein expression of the present disclosure results in the following:- LEPROT - increasing the amount of RNA or cDNA coding for functional isoforms of LEPROT to increase the number of functionally active protein isoforms;- LEPROTL1 - increasing the amount of RNA or cDNA coding for functional isoforms of LEPROTL1 to increase the number of functionally active protein isoforms.

[0043] The nucleic acid sequences of the present disclosure may have regions of reduced homology, and regions of exact homology with the LEPROT or LEPROTL1 mRNA target sequence. It is not necessary for the nucleic acid sequence to have exact homology for its entire length. For example, the nucleic acid sequence may have continuous stretches of at least 4 or 5 bases that are identical to the target sequence, preferably continuous stretches of at least 6 or 7 bases that areidentical to the target sequence, more preferably continuous stretches of at least 8 or 9 bases that are identical to the target sequence. The nucleic acid sequence may have stretches of at least 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25 or 26 bases that are identical to the target sequence. The remaining stretches of nucleic acid sequence may be intermittently identical with the target sequence; for example, the remaining sequence may have an identical base, followed by a non-identical base, followed by an identical base. Alternatively (or as well) the nucleic acid sequence may have several stretches of identical sequence (for example 3, 4, 5 or 6 bases) interspersed with stretches of less than perfect homology. Nucleic acid sequences with such sequence mismatches will preferably still generate a functional LEPROT or LEPROTL1 protein.

[0044] By "enhance" or "enhancing," or "increase" or "increasing," or "stimulate" or "stimulating," refers generally to the ability of one or nucleic acid sequences or compositions to produce or cause a greater physiological response (i.e., downstream effects) in a cell or a subject, as compared to the response caused by either no nucleic acid sequence transfer or a control compound. A measurable physiological response may include increased expression of a functional form of a target protein, among other responses apparent from the understanding in the art and the description herein. An "increased" or "enhanced" amount is typically a "statistically significant" amount, and may include an increase that is 1 .1 , 1 .2, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50 or more times (e.g., 500, 1000 times) or a 1 %, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% increase (including all integers and decimal points in between) in the amount produced by no nucleic acid sequence transfer (the absence of an agent) or a control compound.

[0045] The terms “decreasing” or “decrease” refer generally to the ability of one or more nucleic acid sequences or compositions to produce or cause a reduced physiological response (i.e., downstream effects) in a cell or a subject relative to the response caused by either no nucleic acid sequence or a control compound. The term "reduce" or "inhibit" may relate generally to the ability of one or more nucleic acid sequences of the disclosure to "decrease" a relevant physiological or cellular response, such as a symptom of a disease or condition described herein, as measured according to routine techniques in the diagnostic art. Relevant physiological or cellular responses ( / n vivo or in vitro} will be apparent to persons skilled in the art, and may include reductions in the symptoms or pathology of malignant disease. A "decrease" in a response may be statistically significant as compared to the response produced by no nucleic acid sequence transfer or a control composition, and may include a decrease that is 1 .1 , 1 .2, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50 or more times (e.g., 500, 1000 times) or a 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% decrease (includingall integers and decimal points in between) in the amount produced by no nucleic acid sequence transfer (the absence of an agent) or a control compound.

[0046] In some embodiments, the nucleic acid sequences have the chemical composition of a naturally occurring nucleic acid molecule, i.e., the nucleic acid sequences do not include a modified or substituted base, sugar, or inter-subunit linkage.Modification of Nucleic Acid Sequences

[0047] In a preferred embodiment, the nucleic acid sequences of the present disclosure are non- naturally occurring nucleic acid molecules, or “nucleic acid sequence analogues”. For example, non-naturally occurring nucleic acids can include one or more non-natural base, sugar, and / or inter-subunit linkage, e.g., a base, sugar, and / or linkage that has been modified or substituted with respect to that found in a naturally occurring nucleic acid molecule. Exemplary modifications are described below. In some embodiments, non-naturally occurring nucleic acids include more than one type of modification, e.g. sugar and base modifications, sugar and linkage modifications, base and linkage modifications, or base, sugar, and linkage modifications. For example, in some embodiments, the nucleic acid sequences contain a non-natural (e.g. modified or substituted) base. In some embodiments, the nucleic acid sequences contain a non-natural (e.g. modified or substituted) sugar. In some embodiments, the nucleic acid sequences contain a non-natural (e.g. modified or substituted) inter-subunit linkage. In some embodiments, the nucleic acid sequences contain more than one type of modification or substitution, e.g. a non-natural base and / or a non- natural sugar, and / or a non-natural inter-subunit linkage.

[0048] Thus, included are non-naturally-occurring nucleic acid sequences having (i) a modified backbone structure, e.g., a backbone other than the standard phosphodiester linkage found in naturally-occurring oligo- and polynucleotides, and / or (ii) modified sugar moieties, e.g., morpholino moieties rather than ribose or deoxyribose moieties. Nucleic acid sequence analogues support bases capable of hydrogen bonding by Watson-Crick base pairing to standard polynucleotide bases, where the analogue backbone presents the bases in a manner to permit such hydrogen bonding in a sequence-specific fashion between the nucleic acid sequence analogue molecule and bases in a standard polynucleotide (e.g., single-stranded RNA or singlestranded DNA). Preferred analogues are those having a substantially uncharged, phosphorus containing backbone.

[0049] One method for producing nucleic acid sequences is the methylation of the 2' hydroxyribose position and the incorporation of a phosphorothioate backbone produces molecules that superficially resemble RNA but that are much more resistant to nuclease degradation, although persons skilled in the art of the disclosure will be aware of other forms of suitable backbones that may be useable in the objectives of the disclosure.

[0050] To avoid degradation of pre-RNA during duplex formation with the nucleic acid sequences, the nucleic acid sequences used in the method may be adapted to minimise or prevent cleavage by endogenous RNase H. Nucleic acid sequences that do not activate RNase H can be made in accordance with known techniques (see, e.g., U.S. Pat. No. 5,149,797). Such nucleic acid sequences, which may be deoxyribonucleotide or ribonucleotide sequences, simply contain any structural modification which sterically hinders or prevents binding of RNase H to a duplex molecule containing the nucleic acid sequence as one member thereof, which structural modification does not substantially hinder or disrupt duplex formation. Because the portions of the nucleic acid sequence involved in duplex formation are substantially different from those portions involved in RNase H binding thereto, numerous nucleic acid sequences that do not activate RNase H are available. This property is highly preferred, as the treatment of the RNA with the unmethylated nucleic acid sequences, either intracellular or in crude extracts that contain RNase H, leads to degradation of the pre-mRNA: nucleic acid sequence duplexes. Any form of modified nucleic acid sequences that is capable of by-passing or not inducing such degradation may be used in the present method. The nuclease resistance may be achieved by modifying the nucleic acid sequences of the disclosure so that it comprises partially unsaturated aliphatic hydrocarbon chain and one or more polar or charged groups including carboxylic acid groups, ester groups, and alcohol groups.

[0051] An example of nucleic acid sequences which when duplexed with RNA are not cleaved by cellular RNase H is 2'-O-methyl derivatives. Such 2'-0-methyl-oligoribonucleotides are stable in a cellular environment and in animal tissues, and their duplexes with RNA have higher Tm values than their ribo- or deoxyribo- counterparts. Alternatively, the nuclease resistant nucleic acid sequences of the disclosure may have at least one of the last 3'-terminus nucleotides fluoridated. Still alternatively, the nuclease resistant nucleic acid sequences of the disclosure have phosphorothioate bonds linking between at least two of the last 3-terminus nucleotide bases, preferably having phosphorothioate bonds linking between the last four 3'-terminal nucleotide bases.

[0052] Modified or modulated RNA splicing may also be achieved with alternative nucleic acid sequence chemistry (see, e.g., U.S. Pat. No. 5,149,797). For example, the nucleic acid sequence may be chosen from the list comprising: phosphoramidate or phosphorodiamidate morpholino (PMO); PMO-X; PPMO; thiophosphoramidate morpholinos (TMO); peptide nucleic acid (PNA); locked nucleic acids (LNA) and derivatives including alpha-L-LNA, 2’-amino LNA, 4’-methyl LNA and 4’-O-methyl LNA; ethylene bridged nucleic acids (ENA) and their derivatives; phosphorothioate; tricyclo-DNA (tcDNA); tricyclophosphorothioate; 2’O-Methyl-modified (2’- OMe); 2’-O-methoxy ethyl (2’-MOE); 2’-fluoro, 2’-fluroarabino (FANA); unlocked nucleic acid (UNA); hexitol nucleic acid (HNA); cyclohexenyl nucleic acid (CeNA); 2’-amino (2’-NH2); 2’-O-ethyleneamine nucleic acid sequences or any combination of the foregoing as mixmers or as gapmers.

[0053] To further improve the delivery efficacy, the nucleic acid sequences of the present disclosure may be conjugated with fatty acids / lipids / cholesterol, amino acids, carbohydrates / polysaccharides, nanoparticles etc. to the sugar or nucleobase moieties. When alternative chemistries are used to generate the nucleic acid sequences of the present disclosure, the uracil (U) of the sequences provided herein may be replaced by a thymine (T).

[0054] For example, such nucleic acid sequences may have at least one, or all, of the internucleotide bridging phosphate residues as modified phosphates, such as methyl phosphonates, methyl phosphorothioates, phosphoromorpholidates, phosphoropiperazidates and phosphor amidates. For example, every other one of the internucleotide bridging phosphate residues may be modified as described. In another non-limiting example, such nucleic acid sequences are molecules wherein at least one, or all, of the nucleotides contain a 2' lower alkyl moiety (e.g., C1 - C4, linear or branched, saturated or unsaturated alkyl, such as methyl, ethyl, ethenyl, propyl, 1 - propenyl, 2-propenyl, and isopropyl). For example, every other one of the nucleotides may be modified as described.

[0055] Specific examples of nucleic acid sequences useful in this disclosure include nucleic acid sequences containing modified backbones or non-natural inter-subunit linkages.

[0056] Nucleic acid sequences having modified backbones include those that retain a phosphorus atom in the backbone and those that do not have a phosphorus atom in the backbone. Modified nucleic acid sequences that do not have a phosphorus atom in their internucleoside backbone can also be considered to be oligonucleosides.

[0057] In other nucleic acid sequences, both the sugar and the inter-nucleoside linkage, i.e., the backbone, of the nucleotide units are replaced with novel groups. The base units are maintained for hybridization with an appropriate nucleic acid target compound. One such nucleic acid sequence, a nucleic acid sequence mimetic that has been shown to have excellent hybridization properties, is referred to as a peptide nucleic acid (PNA). In PNA compounds, the sugar-backbone of a nucleic acid sequence is replaced with an amide containing backbone, in particular an aminoethylglycine backbone. The nucleo-bases are retained and are bound directly or indirectly to aza nitrogen atoms of the amide portion of the backbone.

[0058] Modified nucleic acid sequences may also contain one or more substituted sugar moieties. Nucleic acid sequences may also include nucleobase (often referred to in the art simply as "base") modifications or substitutions. Nucleic acid sequences containing a modified or substituted baseinclude nucleic acid sequences in which one or more purine or pyrimidine bases most commonly found in nucleic acids are replaced with less common or non-natural bases.

[0059] Purine bases comprise a pyrimidine ring fused to an imidazole ring; adenine and guanine are the two purine nucleobases most commonly found in nucleic acids. These may be substituted with other naturally-occurring purines, including but not limited to N6-methyladenine, N2- methylguanine, hypoxanthine, and 7-methylguanine.

[0060] Pyrimidine bases comprise a six-membered pyrimidine ring; cytosine, uracil, and thymine are the pyrimidine bases most commonly found in nucleic acids. These may be substituted with other naturally-occurring pyrimidines, including but not limited to 5-methylcytosine, 5- hydroxymethylcytosine, pseudouracil, and 4-thiouracil. In one embodiment, the nucleic acid sequences described herein contain thymine bases in place of uracil.

[0061] Other modified or substituted bases include, but are not limited to, 2,6-diaminopurine, orotic acid, agmatidine, lysidine, 2-thiopyrimidine (e.g. 2-thiouracil, 2-thiothymine), G-clamp and its derivatives, 5-substituted pyrimidine (e.g. 5-halouracil, 5-propynyluracil, 5-propynylcytosine, 5- aminomethyluracil, 5-hydroxymethyluracil, 5-aminomethylcytosine, 5-hydroxymethylcytosine, Super T), 7-deazaguanine, 7-deazaadenine, 7-aza-2,6-diaminopurine, 8-aza-7-deazaguanine, 8- aza- 7-deazaadenine, 8-aza-7-deaza-2,6-diaminopurine, Super G, Super A, and N4- ethylcytosine, or derivatives thereof; N2-cyclopentylguanine (cPent-G), N2-cyclopentyl-2- aminopurine (cPent-AP), and N2-propyl-2-aminopurine (Pr-AP), pseudouracil or derivatives thereof; and degenerate or universal bases, like 2,6-difluorotoluene or absent bases like abasic sites (e.g. 1 -deoxyribose, 1 ,2- dideoxyribose, 1 -deoxy-2-O-methylribose; or pyrrolidine derivatives in which the ring oxygen has been replaced with nitrogen (azaribose)). Examples of derivatives of Super A, Super G and Super T can be found in U.S. Patent 6,683, 173 (Epoch Biosciences). cPent-G, cPent-AP and Pr-AP were shown to reduce immunostimulatory effects when incorporated in siRNA (Peacock H. et al. J. Am. Chem. Soc. 2011 , 133, 9200). Pseudouracil is a naturally occurring isomerized version of uracil, with a C-glycoside rather than the regular N- glycoside as in uridine. Pseudouridine -containing synthetic mRNA may have an improved safety profile compared to uridine-containing mPvNA (see WO 2009127230).

[0062] Certain modified or substituted nucleo-bases are particularly useful for increasing the binding affinity of the nucleic acid sequences of the disclosure. These include 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and 0-6 substituted purines, including 2- aminopropyladenine, 5-propynyluracil and 5-propynylcytosine. 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2°C and are presently preferred base substitutions, even more particularly when combined with 2'-0-methoxyethyl sugar modifications.

[0063] In some embodiments, modified or substituted nucleo-bases are useful for facilitating purification of nucleic acid sequences. For example, in certain embodiments, nucleic acid sequences may contain three or more (e.g., 3, 4, 5, 6 or more) consecutive guanine bases. In certain nucleic acid sequences, a string of three or more consecutive guanine bases can result in aggregation of the nucleic acid sequences, complicating purification. In such nucleic acid sequences, one or more of the consecutive guanines can be substituted with inosine. The substitution of inosine for one or more guanines in a string of three or more consecutive guanine bases can reduce aggregation of the nucleic acid sequence, thereby facilitating purification.

[0064] In one embodiment, another modification of the nucleic acid sequences involves chemically linking to the nucleic acid sequence one or more moieties or conjugates that enhance the activity, cellular distribution or cellular uptake of the nucleic acid sequence. Such moieties include but are not limited to lipid moieties such as a cholesterol moiety, cholic acid, a thioether, e.g., hexyl-5- tritylthiol, a thiocholesterol, an aliphatic chain, e.g., dodecandiol or undecyl residues, a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethylammonium 1 ,2-di-O-hexadecyl-rac- glycero-3-H-phosphonate, a polyamine or a polyethylene glycol chain, or adamantane acetic acid, a palmityl moiety, or an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety. In one exemplary embodiment, an arginine-rich polypeptide is covalently coupled at its N-terminal or C- terminal residue to the 3' or 5' end of the nucleic acid sequence.

[0065] Cell penetrating peptides may be added to nucleic acid sequences of the present disclosure to enhance cellular uptake and nuclear localization. Different peptide tags have been shown to influence efficiency of uptake and target tissue specificity, as shown in Jearawiriyapaisarn et al. (2008), Mol. Ther. 169, 1624-1629. The terms "cell penetrating peptide" and "CPP" are used interchangeably and refer to cationic cell penetrating peptides, also called transport peptides, carrier peptides, or peptide transduction domains. The peptides, as shown herein, have the capability of inducing cell penetration within 100% of cells of a given cell culture population and allow macromolecular translocation within multiple tissues in vivo upon systemic administration.

[0066] While the nucleic acid sequences described above are a preferred form of the nucleic acid sequences of the present disclosure, the present disclosure includes other nucleic acid sequences, including but not limited to nucleic acid sequence mimetics such as are described below.

[0067] Another preferred chemistry is the phosphorodiamidate morpholino (PMO) nucleic acid sequences, which are not degraded by any known nuclease or protease. These compounds are uncharged, do not activate RNase H activity when bound to an RNA strand and have been shownto exert sustained cleavage factor binding modulation after in vivo administration (Summerton and Weller, Antisense Nucleic Acid Drug Development, 7, 187-197).

[0068] Certain nucleobases are particularly useful for increasing the binding affinity of the nucleic acid sequences of the disclosure. These include 5-substituted pyrimidines, 6-azapyrimidines, and N-2, N-6 and 0-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil and 5- propynylcytosine. 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1 .2°C, even more particularly when combined with 2'-0-methoxyethyl sugar modifications. In one embodiment, at least one pyrimidine base of the nucleic acid sequence comprises a 5-substituted pyrimidine base, wherein the pyrimidine base is selected from the group consisting of cytosine, thymine and uracil. In one embodiment, the 5- substituted pyrimidine base is 5-methylcytosine. In another embodiment, at least one purine base of the nucleic acid sequence comprises an N-2, N-6 substituted purine base. In one embodiment, the N- 2, N-6 substituted purine base is 2, 6-diaminopurine.

[0069] In one embodiment, the nucleic acid sequences include one or more 5-methylcytosine substitutions alone or in combination with another modification, such as 2'-O-methoxyethyl sugar modifications. In yet another embodiment, the nucleic acid sequence includes one or more 2, 6- diaminopurine substitutions alone or in combination with another modification.

[0070] It is not necessary for all positions in a nucleic acid sequence to be uniformly modified, and in fact more than one of the aforementioned modifications may be incorporated in a single compound or even at a single nucleoside within a nucleic acid sequence. The present disclosure also includes nucleic acid sequences that are chimeric compounds. "Chimeric" nucleic acid sequences or "chimeras," in the context of this disclosure, are nucleic acid sequences which contain two or more chemically distinct regions, each made up of at least one monomer unit, i.e., a nucleotide in the case of a nucleic acid sequence. These nucleic acid sequences typically contain at least one region wherein the nucleic acid sequence is modified so as to confer upon the nucleic acid sequence increased resistance to nuclease degradation, increased cellular uptake, and an additional region for increased binding affinity for the target nucleic acid.

[0071] In another aspect, the disclosure provides expression vectors that incorporate the nucleic acid sequences of the present disclosure. In some embodiments, the expression vector is a modified retrovirus or non-retroviral vector, such as an adeno-associated viral vector.Assaying Activity

[0072] The activity of nucleic acid sequences and variants thereof can be assayed according to routine techniques in the art. For example, isoform forms and expression levels of surveyed RNAs and proteins may be assessed by any of a wide variety of well-known methods for detecting isoforms and / or expression of a transcribed nucleic acid or protein. Non-limiting examples of suchmethods include RT-PCR of isoforms of RNA followed by size separation of PCR products, nucleic acid hybridization methods e.g., Northern blots and / or use of nucleic acid arrays; fluorescent in situ hybridization to detect RNA transcripts inside cells; nucleic acid amplification methods; immunological methods for detection of proteins; protein purification methods; and protein function or activity assays.

[0073] RNA expression levels can be assessed by preparing RNA or cDNA (i.e., a transcribed polynucleotide) from a cell, tissue or organism, and by hybridizing the RNA or cDNA with a reference polynucleotide, which is a complement of the assayed nucleic acid, or a fragment thereof. cDNA can, optionally, be amplified using any of a variety of polymerase chain reaction or in vitro transcription methods prior to hybridization with the complementary polynucleotide; preferably, it is not amplified. Expression of one or more transcripts can also be detected using quantitative PCR to assess the level of expression of the transcripts.

[0074] The present disclosure provides nucleic acid sequences that code for functional LEPROT and / or LEPROTL1 proteins to therapeutic levels. As such, it is demonstrated herein that increased amounts of functional LEPROT and / or LEPROTL1 protein can be produced by using nucleic acid sequence transfer to increase the amount of nucleic acid sequence in a cell that codes for a functional LEPROT and / or LEPROTL1 protein. In this way functionally significant increases in the amount of the target protein can be obtained, thereby reducing the pathology of malignant disease.Synthesis

[0075] The nucleic acid sequences used in accordance with this disclosure may be conveniently made through the well-known technique of solid phase synthesis. Equipment for such synthesis is sold by several vendors including, for example, Applied Biosystems (Foster City, Calif.). One method for synthesising nucleic acid sequences on a modified solid support is described in U.S. Pat. No. 4,458,066.

[0076] Any other means for such synthesis known in the art may additionally or alternatively be employed. It is well known to use similar techniques to prepare nucleic acid sequences such as the phosphorothioates and alkylated derivatives. In one such automated embodiment, diethyl- phosphoramidites are used as starting materials and may be synthesized as described by Beaucage, et al., (1981 ) Tetrahedron Letters, 22:1859-1862.

[0077] The nucleic acid sequences of the disclosure are synthesised in vitro and do not include nucleic acid sequences of biological origin, or genetic vector constructs designed to direct the in vivo synthesis of nucleic acid sequences . The molecules of the disclosure may also be mixed, encapsulated, conjugated or otherwise associated with other molecules, molecule structures ormixtures of compounds, as for example, liposomes, receptor targeted molecules, oral, rectal, topical or other formulations, for assisting in uptake, distribution and / or absorption.Vectors

[0078] Also included are vector delivery systems that are capable of expressing the nucleic acid sequences of the present disclosure, such as vectors that express RNA or cDNA for members of the LEPROT family (LEPROT, LEPROTL1 ), or a polynucleotide sequence comprising SEQ ID NOs: 1 or 2, as described herein. By "vector" or "nucleic acid construct" is meant a polynucleotide molecule, preferably a DNA molecule derived, for example, from a plasmid, bacteriophage, yeast or virus, into which a polynucleotide can be inserted or cloned. A vector preferably contains one or more unique restriction sites and can be capable of autonomous replication in a defined host cell including a target cell or tissue or a progenitor cell or tissue thereof, or be integrable with the genome of the defined host such that the cloned sequence is reproducible. Accordingly, the vector can be an autonomously replicating vector, i.e., a vector that exists as an extra-chromosomal entity, the replication of which is independent of chromosomal replication, e.g., a linear or closed circular plasmid, an extra-chromosomal element, a mini-chromosome, or an artificial chromosome. The vector can contain any means for assuring self-replication. Alternatively, the vector can be one which, when introduced into the host cell, is integrated into the genome and replicated together with the chromosome(s) into which it has been integrated.Delivery Systems

[0079] The nucleic acid sequences of the present disclosure may be introduced into cells using standard methods of nucleic acid transfer (for example methods of RNA transfer).- Nanoparticles

[0080] Both DNA and RNA can be used to build various nanostructures, which can be functionalized toward therapeutic or diagnostic applications.- Viral Vectors

[0081] Viral vectors may be used to transport the nucleic acid sequences of the present disclosure into cells. Viral vectors have the capacity to transfer genes at high efficiency rates. A range of viral vectors may be used, for example retroviruses (RV), adenoviruses (AV), adeno- associated viruses (AAV), lentiviruses (LV), and herpes simplex viruses (HSV).

[0082] Optionally, the viral vector used in the present disclosure to deliver the nucleic acid sequences for nucleic acid sequence transfer-based therapies are safe, non-toxic, stable, and specific to the type of cell it is desired to deliver the nucleic acid sequences to for maximumefficiency. For example, the virus used as the viral vector may specifically target the cell type that is involved in the malignant disease, such as a bone cell for osteosarcoma.Method of Treatment

[0083] The nucleic acid sequences of the present disclosure also can be used as a prophylactic or therapeutic, which may be utilised for the purpose of treatment of a disease. Accordingly, in one embodiment the present disclosure provides nucleic acid sequences that are introduced into a cell using nucleic acid sequence transfer to increase the amount of nucleic acid sequence in the cell that codes for a functional LEPROT and / or LEPROTL1 protein as described herein, in a therapeutically effective amount, admixed with a pharmaceutically acceptable carrier, diluent, or excipient.

[0084] An "effective amount" or "therapeutically effective amount" refers to an amount of therapeutic compound, such as a nucleic acid sequence, administered to a mammalian subject, either as a single dose or as part of a series of doses, which is effective to produce a desired therapeutic effect.

[0085] The present disclosure provides a method for treating a malignant disease by increasing the amount of functional LEPROT and / or LEPROTL1 protein in a subject, the method including the step of: a) using nucleic acid sequence transfer to increase the amount of nucleic acid sequence in the subject that codes for a functional LEPROT and / or LEPROTL1 protein.

[0086] The disclosure further provides a pharmaceutical, prophylactic, or therapeutic composition to treat, prevent or ameliorate the effects of malignant disease in a subject, the composition comprising: a) one or more nucleic acid sequences as described herein, and b) one or more pharmaceutically acceptable carriers and / or diluents.

[0087] The malignant disease to be treated using the nucleic acid sequences of the present disclosure, in a process of nucleic acid sequence transfer-based therapy, is preferably a cancer, for example a solid-tumour cancer. For example, the cancer may be a sarcoma or carcinoma. The cancer may be chosen from: osteosarcoma, breast cancer, colorectal cancer. Most preferably the cancer is osteosarcoma. Optionally, the cancer is not a cancer of the blood or lymph (leukemia, lymphoma or myeloma).

[0088] Optionally, the nucleic acid sequence used in the present disclosure is chosen from the list comprising:• RNA or cDNA that codes for a functional LEPROT and / or LEPROTL1 protein;• RNA or cDNA that codes for the full length LEPROT and / or LEPROTL1 protein;• SEQ ID NO: 1 and / or SEQ ID NO: 2.

[0089] Optionally, nucleic acid sequence transfer of the nucleic acid sequences of the present disclosure results in an increase in production of functional LEPROT and / or LEPROTL1 target proteins.

[0090] The composition may comprise about 1 nM to 1000 nM of each of the desired nucleic acid sequences of the disclosure. Optionally, the composition may comprise about 1 nM to 500 nM, 10 nM to 500 nM, 50 nM to 750 nM, 10 nM to 500 nM, 1 nM to 100 nM, 1 nM to 50 nM, 1 nM to 40 nM, 1 nM to 30 nM, 1 nM to 20 nM, most preferably between 1 nM and 10 nM of each of the nucleic acid sequences of the disclosure.

[0091] The composition may comprise about 1 nm, 2nm, 3nm, 4nm, 5nm, 6nm, 7nm, 8nm, 9nm, 10nm, 20nm, 50nm, 75nm, 100nm, 150nm, 200nm, 250nm, 300nm, 350nm, 400nm, 450nm, 500nm, 550nm, 600nm, 650nm, 700nm, 750nm, 800nm, 850nm, 900nm, 950nm or 1000nm of each of the desired nucleic acid sequences of the disclosure.

[0092] The present disclosure further provides one or more nucleic acid sequences adapted to aid in the prophylactic or therapeutic treatment, prevention or amelioration of symptoms of malignant disease in a form suitable for delivery to a subject.

[0093] The phrase "pharmaceutically acceptable" refers to molecular entities and compositions that are physiologically tolerable and do not typically produce an allergic or similarly untoward reaction, such as gastric upset and the like, when administered to a subject. The term "carrier" refers to a diluent, adjuvant, excipient, or vehicle with which the compound is administered. Such pharmaceutical carriers can be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like. Water or saline solutions and aqueous dextrose and glycerol solutions are preferably employed as carriers, particularly for injectable solutions. Suitable pharmaceutical carriers are described in Martin, Remington's Pharmaceutical Sciences, 18th Ed., Mack Publishing Co., Easton, PA, (1990).Pharmaceutical Compositions

[0094] In a form of the disclosure there are provided pharmaceutical compositions comprising therapeutically effective amounts of one or more nucleic acid sequences of the disclosuretogether with pharmaceutically acceptable diluents, preservatives, solubilizers, emulsifiers, adjuvants, and / or carriers. Such compositions include diluents of various buffer content (e.g. Tris- HCI, acetate, phosphate), pH and ionic strength and additives such as detergents and solubilizing agents (e.g. Tween 80, Polysorbate 80), anti-oxidants (e.g., ascorbic acid, sodium metabisulfite), preservatives (e.g. Thimersol, benzyl alcohol) and bulking substances (e.g., lactose, mannitol). The material may be incorporated into particulate preparations of polymeric compounds such as polylactic acid, polyglycolic acid, etc. or into liposomes. Hylauronic acid may also be used. Such compositions may influence the physical state, stability, rate of in vivo release, and rate of in vivo clearance of the present nucleic acid sequences and derivatives. See, for example, Martin, Remington's Pharmaceutical Sciences, 18th Ed. (1990, Mack Publishing Co., Easton, PA 18042) pages 1435-1712 that are herein incorporated by reference. The compositions may be prepared in liquid form, or may be in dried powder, such as a lyophilised form.

[0095] It will be appreciated that pharmaceutical compositions provided according to the present disclosure may be administered by any means known in the art. Optionally, the pharmaceutical compositions for administration are administered by injection, orally, topically or by the pulmonary or nasal route. The nucleic acid sequences may be delivered by intravenous, intra-arterial, intraperitoneal, intramuscular or subcutaneous routes of administration. The appropriate route may be determined by one of skill in the art, as appropriate to the condition of the subject under treatment. Vascular or extravascular circulation, the blood or lymph system, and the cerebrospinal fluid are some non-limiting sites where the nucleic acid sequences may be introduced. Direct CNS delivery may be employed, for instance, intracerebral ventricular or intrathecal administration may be used as routes of administration.

[0096] As the present nucleic acid sequences are used for the treatment of malignant disease, an injectable or oral delivery route is preferred.

[0097] Formulations for topical administration include those in which the nucleic acid sequences of the disclosure are in admixture with a topical delivery agent such as lipids, liposomes, fatty acids, fatty acid esters, steroids, chelating agents and surfactants. Lipids and liposomes include neutral (e.g. dioleoylphosphatidyl DOPE ethanolamine, dimyristoylphosphatidyl choline DMPC, distearolyphosphatidyl choline) negative (e.g. dimyristoylphosphatidyl glycerol DMPG) and cationic (e.g. dioleoyltetramethylaminopropyl DOTAP and dioleoylphosphatidyl ethanolamine DOTMA). For topical or other administration, nucleic acid sequences of the disclosure may be encapsulated within liposomes or may form complexes thereto, in particular to cationic liposomes. Alternatively, nucleic acid sequences may be complexed to lipids, in particular to cationic lipids. Fatty acids and esters, pharmaceutically acceptable salts thereof, and their uses are further described in U.S. Pat. No. 6,287,860 and / or U.S. patent application Ser. No. 09 / 315,298 filed on May 20, 1999.

[0098] In certain embodiments, the nucleic acid sequences of the disclosure can be delivered by transdermal methods (e.g., via incorporation of the nucleic acid sequences into, e.g., emulsions, with such nucleic acid sequences optionally packaged into liposomes). Such transdermal and emulsion / liposome-mediated methods of delivery are described for delivery of nucleic acid sequences in the art, e.g., in U.S. Pat. No. 6,965,025.

[0099] The nucleic acid sequences described herein may also be delivered via an implantable device. Design of such a device is an art-recognized process, with, e.g., synthetic implant design described in, e.g., U.S. Pat. No. 6,969,400.

[0100] Compositions and formulations for oral administration include powders or granules, microparticulates, nanoparticulates, suspensions or solutions in water or non-aqueous media, capsules, gel capsules, sachets, tablets or minitablets. Thickeners, flavouring agents, diluents, emulsifiers, dispersing aids or binders may be desirable. Oral formulations are those in which nucleic acid sequences of the disclosure are administered in conjunction with one or more penetration enhancers surfactants and chelators. Surfactants include fatty acids and / or esters or salts thereof, bile acids and / or salts thereof. Bile acids / salts and fatty acids and their uses are further described in U.S. Pat. No. 6,287,860. In some embodiments, the present disclosure provides combinations of penetration enhancers, for example, fatty acids / salts in combination with bile acids / salts. An exemplary combination is the sodium salt of lauric acid, capric acid and UDCA. Further penetration enhancers include polyoxyethylene-9-lauryl ether, polyoxyethylene-20-cetyl ether. Nucleic acid sequences of the disclosure may be delivered orally, in granular form including sprayed dried particles, or complexed to form micro or nanoparticles. Oral formulations for nucleic acid sequences and their preparation are described in detail in US 6,887,906 and / or US 20030027780.

[0101] Compositions and formulations for parenteral, intrathecal or intraventricular administration may include sterile aqueous solutions which may also contain buffers, diluents and other suitable additives such as, but not limited to, penetration enhancers, carrier compounds and other pharmaceutically acceptable carriers or excipients.

[0102] The delivery of a therapeutically useful amount of nucleic acid sequence may be achieved by methods previously published. For example, intracellular delivery of the nucleic acid sequence may be via a composition comprising an admixture of the nucleic acid sequence and an effective amount of a block copolymer. An example of this method is described in US patent application US20040248833. Other methods of delivery of nucleic acid sequences to the nucleus are described in Mann CJ et al. (2001) Proc, Natl. Acad. Science, 98(1) 42-47, and in Gebski et al. (2003) Human Molecular Genetics, 12(15): 1801-1811 . A method for introducing a nucleic acid molecule into a cell by way of an expression vector either as naked DNA or complexed to lipid carriers, is described in US 6,806,084.

[0103] It may be desirable to deliver the nucleic acid sequence in a colloidal dispersion system. Colloidal dispersion systems include macromolecule complexes, nanocapsules, microspheres, beads, and lipid-based systems including oil-in-water emulsions, micelles, mixed micelles, and liposomes or liposome formulations. These colloidal dispersion systems can be used in the manufacture of therapeutic pharmaceutical compositions.

[0104] Liposomes are artificial membrane vesicles, which are useful as delivery vehicles in vitro and in vivo. These formulations may have net cationic, anionic, or neutral charge characteristics and have useful characteristics for in vitro, in vivo and ex vivo delivery methods. It has been shown that large unilamellar vesicles can encapsulate a substantial percentage of an aqueous buffer containing large macromolecules. RNA and DNA can be encapsulated within the aqueous interior and be delivered to cells in a biologically active form (Fraley, et al., Trends Biochem. Sci. 6:77, 1981).

[0105] In order for a liposome to be an efficient gene transfer vehicle, the following characteristics should be present: (1 ) encapsulation of the nucleic acid sequences at high efficiency while not compromising their biological activity; (2) preferential and substantial binding to a target cell in comparison to non-target cells; (3) delivery of the aqueous contents of the vesicle to the target cell cytoplasm at high efficiency; and (4) accurate and effective expression of genetic information (Mannino, et al., Biotechniques, 6:682, 1988). The composition of the liposome is usually a combination of phospholipids, particularly high phase-transition-temperature phospholipids, usually in combination with steroids, especially cholesterol. Other phospholipids or other lipids may also be used. The physical characteristics of liposomes depend on pH, ionic strength, and the presence of divalent cations. Cationic liposomes are positively charged liposomes which are believed to interact with negatively charged DNA molecules to form a stable complex. Liposomes that are pH-sensitive or negatively charged are believed to entrap DNA rather than complex with it. Both cationic and noncationic liposomes have been used to deliver DNA to cells.

[0106] Liposomes also include “sterically stabilized” liposomes, a term which, as used herein, refers to liposomes comprising one or more specialized lipids that, when incorporated into liposomes, result in enhanced circulation lifetimes relative to liposomes lacking such specialized lipids. Examples of sterically stabilized liposomes are those in which part of the vesicle-forming lipid portion of the liposome comprises one or more glycolipids or is derivatized with one or more hydrophilic polymers, such as a polyethylene glycol (PEG) moiety. Liposomes and their uses are further described in U.S. 6,287,860.

[0107] The nucleic acid sequences described herein may also be delivered via an implantable device. Design of such a device is an art-recognized process, with, e.g., syntheticimplant design described in, e.g., US 6,969,400, the contents of which are incorporated in their entirety by reference herein.

[0108] Nucleic acid sequences can be introduced into cells using art-recognized techniques (e.g., transfection, electroporation, fusion, liposomes, colloidal polymeric particles and viral and non-viral vectors as well as other means known in the art). The method of delivery selected will depend at least on the cells to be treated and the location of the cells and will be apparent to the skilled artisan. For instance, localization can be achieved by liposomes with specific markers on the surface to direct the liposome, direct injection into tissue containing target cells, specific receptor-mediated uptake, or the like.

[0109] As known in the art, nucleic acid sequences may be delivered using, for example, methods involving liposome-mediated uptake, lipid conjugates, polylysine-mediated uptake, nanoparticle-mediated uptake, and receptor-mediated endocytosis, as well as additional non- endocytic modes of delivery, such as microinjection, permeabilization (e.g., streptolysin-0 permeabilization, anionic peptide permeabilization), electroporation, and various non-invasive non-endocytic methods of delivery that are known in the art (refer to Dokka and Rojanasakul, Advanced Drug Delivery Reviews 44, 35-49, incorporated by reference in its entirety).

[0110] The nucleic acid sequences may also be combined with other pharmaceutically acceptable carriers or diluents to produce a pharmaceutical composition. Suitable carriers and diluents include isotonic saline solutions, for example phosphate-buffered saline. The composition may be formulated for parenteral, intramuscular, intravenous, subcutaneous, intraocular, oral, or transdermal administration.

[0111] The routes of administration described are intended only as a guide since a skilled practitioner will be able to readily determine the optimum route of administration and any dosage for any particular animal and condition.

[0112] Multiple approaches for introducing functional new genetic material into cells, both in vitro and in vivo have been attempted (Friedmann (1989) Science, 244:1 75-1280). These approaches include integration of the gene to be expressed into modified retroviruses (Friedmann (1989) supra; Rosenberg (1991 ) Cancer Research 51 (18), suppl. : 5074S-5079S); integration into non-retrovirus vectors (Rosenfeld, et al. (1992) Cell, 68:143-155; Rosenfeld, et al. (1991) Science, 252:431-434); or delivery of a transgene linked to a heterologous promoter-enhancer element via liposomes (Friedmann (1989), supra; Brigham, et al. (1989) Am. J. Med. Sci., 298:278-281 ; Nabel, et al. (1990) Science, 249:1285-1288; Hazinski, et al. (1991 ) Am. J. Resp. Cell Molec. Biol., 4:206-209; and Wang and Huang (1987) Proc. Natl. Acad. Sci. (USA), 84:7851 -7855); coupled to ligand-specific, cation-based transport systems (Wu and Wu (1988) J. Biol. Chem., 263:14621 -14624) or the use of naked DNA, expression vectors (Nabel et al. (1990), supra); Wolffet al. (1990) Science, 247:1465-1468). The Brigham et al. group (Am. J. Med. Sci. (1989) 298:278-281 and Clinical Research (1991) 39 (abstract)) have reported in vivo transfection only of lungs of mice following either intravenous or intratracheal administration of a DNA liposome complex. An example of a review article of human gene therapy procedures is: Anderson, Science (1992) 256:808-813; Barteau et al. (2008), Curr Gene Ther; 8(5):313-23; Mueller et al. (2008). Clin Rev Allergy Immunol; 35(3):164-78; Li et al. (2006) Gene Ther., 13(18):1313-9; Simoes et al. (2005) Expert Opin Drug Deliv; 2(2):237-54.

[0113] The nucleic acid sequences of the disclosure encompass any pharmaceutically acceptable salts, esters, or salts of such esters, or any other compound which, upon administration to an animal including a human, is capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. Accordingly, as an example, the disclosure is also drawn to prodrugs and pharmaceutically acceptable salts of the compounds of the disclosure, pharmaceutically acceptable salts of such pro-drugs, and other bioequivalents.

[0114] The term "pharmaceutically acceptable salts" refers to physiologically and pharmaceutically acceptable salts of the compounds of the disclosure: i.e. salts that retain the desired biological activity of the parent compound and do not impart undesired toxicological effects thereto. For nucleic acid sequences, preferred examples of pharmaceutically acceptable salts include but are not limited to (a) salts formed with cations such as sodium, potassium, ammonium, magnesium, calcium, polyamines such as spermine and spermidine, etc.; (b) acid addition salts formed with inorganic acids, for example hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, nitric acid and the like; (c) salts formed with organic acids such as, for example, acetic acid, oxalic acid, tartaric acid, succinic acid, maleic acid, fumaric acid, gluconic acid, citric acid, malic acid, ascorbic acid, benzoic acid, tannic acid, palmitic acid, alginic acid, polyglutamic acid, naphthalenesulfonic acid, methanesulfonic acid, p-toluenesulfonic acid, naphthalenedisulfonic acid, polygalacturonic acid, and the like; and (d) salts formed from elemental anions such as chlorine, bromine, and iodine. The pharmaceutical compositions of the present disclosure may be administered in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be treated. Administration may be topical (including ophthalmic and mucous membranes, as well as rectal delivery), pulmonary, e.g., by inhalation or insufflation of powders or aerosols (including by nebulizer, intratracheal, intranasal, epidermal and transdermal), oral or parenteral. Parenteral administration includes intravenous, intra-arterial, subcutaneous, intraperitoneal or intramuscular injection or infusion; or intracranial, e.g., intrathecal or intraventricular, administration

[0115] The pharmaceutical formulations of the present disclosure, which may conveniently be presented in unit dosage form, may be prepared according to conventional techniques well known in the pharmaceutical industry. Such techniques include the step ofbringing into association the active ingredients with the pharmaceutical carrier(s) or excipient(s). In general, the formulations are prepared by uniformly and intimately bringing into association the active ingredients with liquid carriers or finely divided solid carriers or both, and then, if necessary, shaping the product.Administration

[0116] The nucleic acid sequences may be administered at regular intervals for a short time period, e.g., daily for two weeks or less. However, in some cases the nucleic acid sequence is administered intermittently over a longer period of time. Administration may be followed by, or concurrent with, administration of chemotherapy, surgery or radiotherapy or other therapeutic treatment. The treatment regimen may be adjusted (dose, frequency, route, etc.) as indicated, based on the results of immunoassays, other biochemical tests and physiological examination of the subject under treatment.

[0117] Dosing is dependent on severity and responsiveness of the disease state to be treated, with the course of treatment lasting from several days to several months, or until a cure is effected or a diminution of the disease state is achieved. Optimal dosing schedules can be calculated from measurements of drug accumulation in the body of the subject. Persons of ordinary skill can easily determine optimum dosages, dosing methodologies and repetition rates. Optimum dosages may vary depending on the relative potency of individual nucleic acid sequences, and can generally be estimated based on EC50s found to be effective in in vitro and in vivo animal models. In general, dosages may be given once or more daily, weekly, monthly or yearly, or even once every 2 to 20 years. Persons of ordinary skill in the art can easily estimate repetition rates for dosing based on measured residence times and concentrations of the drug in bodily fluids or tissues. Following successful treatment, it may be desirable to have the subject undergo maintenance therapy to prevent the recurrence of the disease state, wherein the nucleic acid sequence is administered in maintenance doses, once or more daily, to once every 20 years.

[0118] An effective in vivo treatment regimen using the nucleic acid sequences of the disclosure may vary according to the duration, dose, frequency and route of administration, as well as the condition of the subject under treatment (i.e., prophylactic administration versus administration in response to localized or systemic infection). Accordingly, such in vivo therapy will often require monitoring by tests appropriate to the particular type of disorder under treatment, and corresponding adjustments in the dose or treatment regimen, in order to achieve an optimal therapeutic outcome.

[0119] Treatment may be monitored, e.g., by general indicators of disease known in the art. As used herein, “treatment” of a subject (e.g. a mammal, such as a human) or a cell is any type of intervention used in an attempt to alter the natural course of the individual or cell.T reatment includes, but is not limited to, administration of a pharmaceutical composition, and may be performed either prophylactically or subsequent to the initiation of a pathologic event or contact with an etiologic agent. Treatment includes any desirable effect on the symptoms or pathology of malignant disease, and may include, for example, minimal changes or improvements in one or more measurable markers of the malignant disease being treated. Also included are “prophylactic” treatments, which can be directed to reducing the rate of progression of the malignant disease being treated, delaying the onset of the malignant disease, or reducing the severity of its onset. “Treatment” or “prophylaxis” does not necessarily indicate complete eradication, cure, or prevention of the disease or condition, or associated symptoms thereof.

[0120] A "subject," as used herein, includes any animal that exhibits a symptom, or is at risk for exhibiting a symptom, which can be treated with nucleic acid sequences of the disclosure, or any of the symptoms associated with the condition (e.g. malignant disease). Suitable subjects include laboratory animals (such as mouse, rat, rabbit, or guinea pig), farm animals, and domestic animals or pets (such as a cat or dog). Non-human primates and, preferably, human subjects, are included.

[0121] The efficacy of an in vivo administered nucleic acid sequences of the disclosure may be determined from biological samples (tissue, blood, urine etc.) taken from a subject prior to, during and subsequent to administration of the nucleic acid sequence. Assays of such samples include (1) monitoring the amount of introduced RNA and / or cDNA in relation to a reference normal RNA or protein as determined by standard techniques such as RT-PCR, Northern blotting, ELISA, Western blotting, etc; or (2) monitoring the amount of functional and / or full length LEPROT and / or LEPROTL1 protein as determined by standard techniques such as ELISA, Western blotting etc.

[0122] Intranuclear nucleic acid sequence delivery is a major challenge for nucleic acid sequence transfer-based therapies. Different cell-penetrating peptides (CPP) localize nucleic acid sequences to varying degrees in different conditions and cell lines. The terms CPP or “a peptide moiety which enhances cellular uptake” are used interchangeably and refer to cationic cell penetrating peptides, also called “transport peptides”, “carrier peptides”, or “peptide transduction domains”. Optionally, CPPs used in the present disclosure have the capability of inducing cell penetration within about or at least about 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% of cells of a given cell culture population and allow macromolecular translocation within multiple tissues in vivo upon systemic administration. CPPs are well-known in the art and are disclosed, for example in US 20100016215, which is incorporated by reference in its entirety.

[0123] The present disclosure therefore provides nucleic acid sequences of the present disclosure in combination with cell-penetrating peptides for manufacturing therapeutic pharmaceutical compositions.

[0124] According to a still further aspect of the disclosure, there is provided one or more nucleic acid sequences as described herein for use in a nucleic acid transfer-based therapy. Optionally, the therapy is for malignant disease. More specifically, the RNA or cDNA is an RNA or cDNA that codes for a functional LEPROT or LEPROTL1 protein, for example the full length LEPROT or LEPROTL1 protein. Optionally, the nucleic acid sequence comprises at least the four exons of the LEPROT gene and / or at least the four exons of the LEPROTL1 gene. More preferably the RNA or cDNA is SEQ ID NO: 1 or SEQ ID NO: 2. Optionally, nucleic acid sequence transfer induced manipulation of protein expression of the present disclosure results in the following:- LEPROT - increasing the amount of RNA or cDNA coding for functional isoforms of LEPROT to increase the number of functionally active protein isoforms;- LEPROTL1 - increasing the amount of RNA or cDNA coding for functional isoforms of LEPROTL1 to increase the number of functionally active protein isoforms.

[0125] The disclosure extends also to a combination of two or more nucleic acid sequences for functional LEPROT and / or LEPROTL1 proteins. The combination may be a cocktail of two or more nucleic acid sequences, a construct comprising two or more or two or more nucleic acid sequences joined together for use in a nucleic acid transfer-based therapy.

[0126] The disclosure provides a method to treat, prevent or ameliorate the effects of malignant disease in a subject, comprising the step of: a) administering to the subject an effective amount of one or more nucleic acid sequences or pharmaceutical composition comprising one or more nucleic acid sequences as described herein.

[0127] The increase in target protein (functional LEPROT and / or LEPROTL1 protein) will preferably lead to a reduction in the quantity, duration or severity of the symptoms of malignant disease.Use

[0128] The disclosure also provides for the use of purified and isolated nucleic acid sequences as described herein, for the manufacture of a medicament for treatment of malignant disease.

[0129] There is provided the use of purified and isolated nucleic acid sequences as described herein for the manufacture of a medicament to treat, prevent or ameliorate the effects of malignant disease.

[0130] Optionally, the nucleic acid sequence is an RNA or cDNA nucleic acid sequence. Optionally, the nucleic acid sequence is an RNA or cDNA nucleic acid sequence encoding a function or full length LEPROT and / or LEPROTL1 protein. More preferably the nucleic acid sequence is SEQ ID NO: 1 and / or SEQ ID NO: 2. Optionally, nucleic acid sequence transfer- induced manipulation of protein expression of the present disclosure results in the following:- LEPROT - increasing the amount of RNA or cDNA coding for functional isoforms of LEPROT to increase the number of functionally active protein isoforms;- LEPROTL1 - increasing the amount of RNA or cDNA coding for functional isoforms of LEPROTL1 to increase the number of functionally active protein isoforms.Kits

[0131] The disclosure also provides kits to treat, prevent or ameliorate malignant disease in a subject, which kit comprises at least an isolated or purified nucleic acid sequence according to the present disclosure, packaged in a suitable container, together with instructions for its use. Optionally, the nucleic acid sequence is an RNA or cDNA nucleic acid sequence. Optionally, the nucleic acid sequence is an RNA or cDNA nucleic acid sequence encoding a function or full length LEPROT and / or LEPROTL1 protein. More preferably the nucleic acid sequence is SEQ ID NO: 1 and / or SEQ ID NO: 2. The kits may also contain peripheral reagents such as buffers, stabilizers, etc.

[0132] The components of the kit may also be provided in dried or lyophilized forms. When reagents or components are provided as a dried form, reconstitution generally is by the addition of a suitable solvent. The kit can additionally contain a suitable solvent for reconstitution of the lyophilized components. Individual components of the kit may be packaged in separate containers. Irrespective of the number or type of containers, the kits of the disclosure also may comprise, or be packaged with, an instrument for assisting with the injection / administration or placement of the ultimate complex composition within the body of an animal. Such an instrument may be an inhalant, syringe, pipette, forceps, measured spoon, eye dropper or any such medically approved delivery vehicle.

[0133] Notices in the form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals or biological products, may be provided in the kit, such notices reflecting approval by the agency of manufacture, use or sale for human administration.

[0134] When the components of the kit are provided in one or more liquid solutions, the liquid solution can be an aqueous solution, for example a sterile aqueous solution. For in vivo use, the expression construct may be formulated into a pharmaceutically acceptable syringeablecomposition. In this case the container means may itself be an inhalant, syringe, pipette, eye dropper, or other such like apparatus, from which the formulation may be applied to an affected area of the animal, such as the skin, injected into an animal, or even applied to and mixed with the other components of the kit.

[0135] The nucleic acid sequences of the present disclosure may also be used in conjunction with alternative therapies, such as drug therapies.

[0136] The present disclosure therefore provides a method of treating, preventing or ameliorating the effects of malignant disease, wherein the nucleic acid sequences of the present disclosure and administered sequentially or concurrently with another alternative therapy associated with treating, preventing or ameliorating malignant disease. The nucleic acid sequences of the present disclosure may be used in conjunction with alternative therapies, such as drug therapies including chemotherapy, surgery or radiotherapy.General

[0137] Those skilled in the art will appreciate that the invention described herein is susceptible to variations and modifications other than those specifically described. The invention includes all such variation and modifications. The invention also includes all of the steps, features, formulations and compounds referred to or indicated in the specification, individually or collectively and any and all combinations or any two or more of the steps or features.

[0138] Each document, reference, patent application or patent cited in this text is expressly incorporated herein in their entirety by reference, which means that it should be read and considered by the reader as part of this text. That the document, reference, patent application or patent cited in this text is not repeated in this text is merely for reasons of conciseness.

[0139] Any manufacturer’s instructions, descriptions, product specifications, and product sheets for any products mentioned herein or in any document incorporated by reference herein, are hereby incorporated herein by reference, and may be employed in the practice of the invention.

[0140] The present invention is not to be limited in scope by any of the specific embodiments described herein. These embodiments are intended for the purpose of exemplification only. Functionally equivalent products, formulations and methods are clearly within the scope of the invention as described herein.

[0141] The invention described herein may include one or more range of values (eg. Size, displacement and field strength etc). A range of values will be understood to include all values within the range, including the values defining the range, and values adjacent to the range which lead to the same or substantially the same outcome as the values immediately adjacent to thatvalue which defines the boundary to the range. Accordingly, unless indicated to the contrary, the numerical parameters set forth in the specification and claims are approximations that may vary depending upon the desired properties sought to be obtained by the present invention. Hence “about 80 %” means “about 80 %” and also “80 %”. At the very least, each numerical parameter should be construed in light of the number of significant digits and ordinary rounding approaches.

[0142] Throughout this specification, unless the context requires otherwise, the word “comprise” or variations such as “comprises” or “comprising”, will be understood to imply the inclusion of a stated integer or group of integers but not the exclusion of any other integer or group of integers. It is also noted that in this disclosure and particularly in the claims and / or paragraphs, terms such as “comprises”, “comprised”, “comprising” and the like can have the meaning attributed to it in U.S. Patent law; e.g., they can mean “includes”, “included”, “including”, and the like; and that terms such as “consisting essentially of’ and “consists essentially of’ have the meaning ascribed to them in U.S. Patent law, e.g., they allow for elements not explicitly recited, but exclude elements that are found in the prior art or that affect a basic or novel characteristic of the invention.

[0143] Other definitions for selected terms used herein may be found within the detailed description of the invention and apply throughout. Unless otherwise defined, all other scientific and technical terms used herein have the same meaning as commonly understood to one of ordinary skill in the art to which the invention belongs. The term “active agent” may mean one active agent, or may encompass two or more active agents.

[0144] The following examples serve to more fully describe the manner of using the abovedescribed invention, as well as to set forth the best modes contemplated for carrying out various aspects of the invention. It is understood that these methods in no way serve to limit the true scope of this invention, but rather are presented for illustrative purposes.EXAMPLES

[0145] Further features of the present invention are more fully described in the following nonlimiting Examples. This description is included solely for the purposes of exemplifying the present invention. It should not be understood as a restriction on the broad description of the invention as set out above.Example 1MethodologyGeneration of overexpression of LEPROT constructs using lentivirus-based vectors

[0146] Plasmids including pLVX-Puro vector, pLVX-Puro-LEPROT, pLK0.1 -Puro vector and pLK0.1-Puro containing LEPROT gene sequence and shRNA sequence were constructed using sequences specific to human LEPROT. Control vector or target construct were cotransfected with the packaging vectors psPAX2 and pMD2G into HEK293T cells. Supernatants containing lentivirus were collected 48 h post-transfection. Lentiviruses (mixed with 5 pg / ml polybrene) were used to transduce human osteosarcoma cell line U2-OS. To select stable clones, cells were treated with 2 pg / ml puromycin until resistant cells were obtained.

[0147] The sequences are listed below: shControlTTCTCCGAACGTGTCACGT (SEQ ID NO: 3) shLEPROTCCTTGTGTTGGCAGGCAAT (SEQ ID NO: 4)LEPROT Over expressionGAATTCGCCACCATGGCGGGCGTTAAAGCTCTCGTGGCATTATCCTTCAGTGGGGCTAT TGGACTGACTTTTCTTATGCTGGGATGTGCCTTAGAGGATTATGGCGTTTACTGGCCCTT ATTCGTCCTGATTTTCCACGCCATCTCCCCCATCCCCCATTTCATTGCCAAAAGAGTCAC CTATGACTCAGATGCAACCAGTAGTGCCTGTCGGGAACTGGCATATTTCTTCACTACTG GAATTGTTGTTTCTGCCTTTGGATTTCCTGTTATTCTTGCTCGTGTGGCTGTGATCAAAT GGGGAGCCTGCGGCCTTGTGTTGGCAGGCAATGCAGTCATTTTCCTTACAATTCAAGG GTTTTTCCTTATATTTGGAAGAGGAGATGATTTTAGCTGGGAGCAGTGGGGATCC (SEQ ID NO: 1 )LEPR0TL1 cDNA sequenceATGGCAGGCATCAAAGCTTTGATTAGTTTGTCCTTTGGAGGAGCAATCGGACTGATGTT TTTGATGCTTGGATGTGCCCTTCCAATATACAACAAATACTGGCCCCTCTTTGTTCTATTT TTTTACATCCTTTCACCTATTCCATACTGCATAGCAAGAAGATTAGTGGATGATACAGAT GCTATGAGTAACGCTTGTAAGGAACTTGCCATCTTTCTTACAACGGGCATTGTCGTGTCA GCTTTTGGACTCCCTATTGTATTTGCCAGAGCACATCTGATGGGGCGCCTACCCTTCTT CAGCAAGATGGGAACAGCTGAGTCTGAAGGAAGAGAAACACTGACACAGCAGCTGCCT CTCCCAGCAGCCGCCATGAGAAGATTGTTACCTGCAAGCAGAGTGTCCACTCAACCCG TGCTGAGGCTGGCAGACAGTGCTGAGTCACTTCTGGGCAGGCCTGCTCTGTGGGCTCT AGGATTCCTGCTTTGCC CTCCCTCTCAGGCACAATGA (SEQ ID NO: 2)Investigation of the role of LEPROT in OS cell growth via its silencing and overexpression

[0148] Human osteosarcoma cell line U2-OS with either knockdown or overexpression of LEPROT was assessed for cell proliferation rate by MTS assay. In addition, antibody to Ki-67 nuclear protein was used to determine Ki67 protein expression by fluorescence imaging. Flow cytometry was used to analyse OS cell cycle status.Results

[0149] Overexpression of human LEPROT gene results in reduction of colony formation of the osteosarcoma U2-OS cell line (Fig 3), a reduction in cell proliferation of the osteosarcoma U2-OS cell line (Fig 2D), a reduction in protein expression of BCL-2 (Fig 2C), MDM2 (Fig 2A, 2C), IGF1 R (Fig 2A, 2C), P53 (Fig 2C), and Ki67 (Fig 5), increased expression of filamentous actin, increased Go / G1 phase and apoptosis (Fig 6B), accompanied by decreased S phase and G2 / M phase (Fig 6B).

[0150] Knockdown of human LEPROT gene results in promotion of colony formation of the osteosarcoma U2-OS (Fig 3), an increase in cell proliferation of the osteosarcoma U2-OS cell line (Fig 2D), an increase in protein expression of BCL-2 (Fig 2C), MDM2 (Fig 2A, 2C), IGF1 R (Fig 2A, 2C), P53 (Fig 2C), and Ki67 (Fig 5), decreased expression of filamentous actin, decreased Go / G1 phase and apoptosis (Fig 6B), accompanied by increased S phase and G2 / M phase (Fig 6B).

[0151] It would be expected that, as LEPROTL1 is a homolog of LEPROT, overexpression or knockdown of LEPROTL1 would produce similar results to those observed in LEPROT in relation to colony formation, cell proliferation, protein expression, filamentous actin expression, and cell phase.

Claims

CLAIMS1 . An isolated or purified nucleic acid sequence for increasing protein production of one or more of the following proteins encoded by the respective gene transcript or part thereof: i. LEPROT; and / or ii. LEPROTL1 to induce upregulation of the production of functional LEPROT and / or LEPROTL1 protein.

2. The nucleic acid sequence of claim 1 wherein the nucleic acid sequence transfer is RNA transfer or cDNA transfer.

3. The nucleic acid sequence of claim 1 wherein the nucleic acid sequence is: i. an RNA or cDNA that codes for a functional LEPROT and / or LEPROTL1 protein; or ii. the RNA or cDNA of SEQ ID NO: 1 and / or SEQ ID NO:

24. A method for manipulating production of functional LEPROT and / or LEPROTL1 protein, the method including the step of: a) using nucleic acid sequence transfer to increase the amount of nucleic acid sequence in a cell that codes for a functional LEPROT and / or LEPROTL1 protein.

5. Vector delivery systems capable of expressing the nucleic acid sequences of claim 1 .

6. The vector delivery systems of claim 5 that are nucleic acid nanoparticles or viral vectors.

7. A method for treating a malignant disease by increasing the amount of functional LEPROT and / or LEPROTL1 protein in a subject, the method including the step of: a) using nucleic acid sequence transfer to increase the amount of nucleic acid sequence that codes for a functional LEPROT and / or LEPROTL1 protein in the subject.

8. A pharmaceutical, prophylactic, or therapeutic composition to treat, prevent or ameliorate the effects of malignant disease in a subject, the composition comprising: a) one or more nucleic acid sequences of claim 1 , and b) one or more pharmaceutically acceptable carriers and / or diluents.

9. The malignant disease of claim 8, that is a cancer.

10. The cancer of 9, that is osteosarcoma.11 . A method to treat, prevent or ameliorate the effects of malignant disease in a subject, comprising the step of:a) administering to the subject an effective amount of one or more nucleic acid sequences of claim 1 , or a pharmaceutical composition comprising one or more nucleic acid sequences of claim 1 .

12. The use of purified and isolated nucleic acid sequences of claim 1 , for the manufacture of a medicament for treatment of malignant disease.

13. The use of purified and isolated nucleic acid sequences of claim 1 , for the manufacture of a medicament to treat, prevent or ameliorate the effects of malignant disease.

14. A kit to treat, prevent or ameliorate malignant disease in a subject, which kit comprises at least an isolated or purified nucleic acid sequence of claim 1 , packaged in a suitable container, together with instructions for its use.

Images