Modified escherichia coli and use thereof in production of l-amino acid by means of fermentation

Abstract

A modified Escherichia coli and the use thereof in the production of L-amino acid by means of fermentation. Specifically, disclosed is the use of pyruvate formate lyase, alcohol dehydrogenase, branched-chain amino acid transaminase derived from Escherichia coli, branched-chain amino acid transaminase derived from Bacillus subtilis, thiamine phosphate synthase and malate dehydrogenase in the construction of a genetically engineered bacterium for producing L-amino acid. Experiments prove that the recombinant bacterium, which is conducive to the accumulation of L-amino acid, is obtained by means of knocking out the encoding genes of the pyruvate formate lyase, the alcohol dehydrogenase, the branched-chain amino acid transaminase derived from Escherichia coli, the thiamine phosphate synthase and the malate dehydrogenase of Escherichia coli capable of producing L-amino acid, and introducing the encoding gene of the branched-chain amino acid transaminase derived from Bacillus subtilis. The recombinant bacteria can greatly increase the yield of L-amino acid and reduce the costs, and is of great significance to accelerate the industrial progress of L-amino acid.

Description

Modified Escherichia coli and its application in fermentation production of L-amino acids

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims priority from the following four patent applications: Chinese patent application No. 202310765899.5 filed with the Patent Office of China on June 27, 2023, entitled “Recombinant Escherichia coli for fermentative production of L-valine”; Chinese patent application No. 202310784984.6 filed with the Patent Office of China on June 29, 2023, entitled “Transformed Escherichia coli and its application in fermentative production of L-valine”; The Chinese patent application with application number 202310784863.1 submitted to the Chinese Patent Office on June 29, 2023, and the invention name is “A recombinant bacterium and its application in the production of L-valine”, and the Chinese patent application with application number 202310809284.8 submitted to the Chinese Patent Office on July 4, 2023, and the invention name is “A method for increasing the production of L-valine and the recombinant bacteria used therefor”. The entire contents of the four patent applications are incorporated into this application by reference. Technical Field

[0003] The invention belongs to the field of biotechnology and relates to transformed Escherichia coli and its application in fermentation production of L-amino acids. Background Art

[0004] L-valine has important applications in food, medicine, health supplements, and feed. In the food sector, L-valine supplements nutrition, promotes growth, and provides energy. In the pharmaceutical sector, L-valine can be used in infusions and injections to promote surgical wound healing. Domestic exports of feed-grade L-valine have reached over 30,000 tons, with an average annual growth rate of 20%.

[0005] Currently, many domestic companies are producing L-valine through fermentation, and many laboratories are also conducting research on L-valine fermentation processes. Researchers have found that the process of secreting intracellular L-valine through the cell membrane requires the participation of specific transport proteins. However, during this process, the activity of specific transport proteins cannot meet the needs of timely secretion of intracellular valine through the cell membrane, resulting in the accumulation of intracellular L-valine. At the same time, acetohydroxyacid synthase is contained in bacterial cells. Acetohydroxyacid synthase catalyzes the biosynthesis of L-valine and can promote acid production. However, when the L-valine synthesized in the bacterial cells cannot be excreted in time and accumulates, acetohydroxyacid synthase is strongly inhibited by L-valine, its catalytic activity decreases, and it cannot further catalyze the synthesis of L-valine. The continued synthesis of L-valine is restricted, ultimately resulting in low yields. In addition, studies have found that Escherichia coli is very sensitive to L-valine. When L-valine in the cells of L-valine-producing bacteria cannot be discharged in time and accumulates, it will seriously inhibit the growth of Escherichia coli, thereby inhibiting the synthesis of L-valine in the bacterial cells and resulting in low yield.

[0006] SUMMARY OF THE INVENTION

[0007] The main purpose of the present invention is to increase the yield of L-amino acids. The purpose of the present invention is not limited to the described subject matter, and those skilled in the art can clearly understand other purposes not mentioned herein through the following description.

[0008] The present invention first protects the use of a protein combination, which may be at least one of A1) to A5):

[0009] A1) constructing a genetically engineered bacterium that produces L-amino acids;

[0010] A2) production of L-amino acids;

[0011] A3) regulating the production of L-amino acids;

[0012] A4) preparing products for the production of L-amino acids;

[0013] A5) Preparation of food, feed or medicine containing L-amino acid.

[0014] In the above application, the protein combination may include at least one of pyruvate formate lyase, alcohol dehydrogenase, branched-chain amino acid transaminase derived from Escherichia coli, branched-chain amino acid transaminase derived from Bacillus subtilis, thiamine phosphate synthase and malate dehydrogenase.

[0015] In the above application, the protein combination can specifically consist of at least one of pyruvate formate lyase, alcohol dehydrogenase, branched-chain amino acid transaminase derived from Escherichia coli, branched-chain amino acid transaminase derived from Bacillus subtilis, thiamine phosphate synthase and malate dehydrogenase.

[0016] Any of the above-mentioned pyruvate formate lyases may be B1) or B2) or B3):

[0017] B1) a protein with an amino acid sequence as shown in SEQ ID No. 13;

[0018] B2) a protein having 90% or more identity with the protein of B1) and having the same function as the protein of B1) obtained by substitution and / or deletion and / or addition of amino acid residues of the amino acid sequence of SEQ ID No. 13;

[0019] B3) A fusion protein having the same function obtained by connecting a tag to the N-terminus and / or C-terminus of B1) or B2).

[0020] Any of the above-mentioned alcohol dehydrogenases may be C1) or C2) or C3):

[0021] C1) a protein with an amino acid sequence as shown in SEQ ID No. 14;

[0022] C2) a protein having 90% or more identity with the protein of C1) and having the same function as the protein of C1) obtained by substitution and / or deletion and / or addition of amino acid residues of the amino acid sequence of SEQ ID No. 14;

[0023] C3) A fusion protein having the same function obtained by connecting a tag to the N-terminus and / or C-terminus of C1) or C2).

[0024] Any of the above-mentioned branched-chain amino acid transaminases derived from Escherichia coli may be D1) or D2) or D3):

[0025] D1) a protein with an amino acid sequence as shown in SEQ ID No. 15;

[0026] D2) a protein having 90% or more identity with the protein of D1) and having the same function as the protein of D1) obtained by substitution and / or deletion and / or addition of amino acid residues of the amino acid sequence of SEQ ID No. 15;

[0027] D3) A fusion protein having the same function obtained by connecting a tag to the N-terminus and / or C-terminus of D1) or D2).

[0028] Any of the above-mentioned branched-chain amino acid transaminases derived from Bacillus subtilis may be E1) or E2) or E3):

[0029] E1) a protein with an amino acid sequence as shown in SEQ ID No. 16;

[0030] E2) a protein having 90% or more identity with the protein of E1) and having the same function as the protein of E1) obtained by substitution and / or deletion and / or addition of amino acid residues of the amino acid sequence of SEQ ID No. 16;

[0031] E3) A fusion protein having the same function obtained by connecting a tag to the N-terminus and / or C-terminus of E1) or E2).

[0032] Any of the above-mentioned thiamine phosphate synthases may be F1) or F2) or F3):

[0033] F1) a protein with an amino acid sequence as shown in SEQ ID No. 17;

[0034] F2) a protein having 90% or greater identity to the protein of F1) and having the same function as the protein of F1) obtained by substitution and / or deletion and / or addition of amino acid residues of the amino acid sequence of SEQ ID No. 17;

[0035] F3) A fusion protein having the same function obtained by connecting a tag to the N-terminus and / or C-terminus of F1) or F2).

[0036] Any of the above malate dehydrogenases may be G1) or G2) or G3):

[0037] G1) a protein with an amino acid sequence as shown in SEQ ID No. 18;

[0038] G2) a protein having 90% or more identity with the protein of G1) and having the same function as the protein of G1) obtained by substitution and / or deletion and / or addition of amino acid residues of the amino acid sequence of SEQ ID No. 18;

[0039] G3) A fusion protein having the same function is obtained by connecting a tag to the N-terminus and / or C-terminus of G1) or G2).

[0040] The present invention also protects the use of a nucleic acid molecule encoding any of the above-mentioned protein combinations, which may be at least one of A1) to A5):

[0041] A1) constructing a genetically engineered bacterium that produces L-amino acids;

[0042] A2) production of L-amino acids;

[0043] A3) regulating the production of L-amino acids;

[0044] A4) preparing products for the production of L-amino acids;

[0045] A5) Preparation of food, feed or medicine containing L-amino acid.

[0046] The present invention also protects the use of a substance that inhibits or downregulates the expression and / or activity of any of the above-mentioned pyruvate formate lyases, and / or a substance that inhibits or downregulates the expression and / or activity of any of the above-mentioned alcohol dehydrogenases, and / or a substance that inhibits or downregulates the expression and / or activity of any of the above-mentioned Escherichia coli branched-chain amino acid transaminases, and / or a substance that inhibits or downregulates the expression and / or activity of any of the above-mentioned thiamine phosphate synthases, and / or a substance that inhibits or downregulates the expression and / or activity of any of the above-mentioned malate dehydrogenases, and / or a substance that increases or increases the expression and / or activity of any of the above-mentioned Bacillus subtilis branched-chain amino acid transaminases, which may be at least one of A1) to A5):

[0047] A1) constructing a genetically engineered bacterium that produces L-amino acids;

[0048] A2) production of L-amino acids;

[0049] A3) regulating the production of L-amino acids;

[0050] A4) preparing products for the production of L-amino acids;

[0051] A5) Preparation of food, feed or medicine containing L-amino acid.

[0052] In the above application, the substance that inhibits or downregulates the expression level and / or activity of any of the above pyruvate formate lyases may be sgRNAa shown in SEQ ID No. 1.

[0053] In the above application, the substance that inhibits or downregulates the expression level and / or activity of any of the above-mentioned alcohol dehydrogenases may be sgRNAb shown in SEQ ID No. 4.

[0054] In the above application, the substance that inhibits or downregulates the expression level and / or activity of any of the above-mentioned Escherichia coli-derived branched-chain amino acid transaminases may be the sgRNAc shown in SEQ ID No. 7.

[0055] In the above application, the substance that inhibits or downregulates the expression level and / or activity of any of the above-mentioned thiamine phosphate synthases may be the sgRNAd shown in SEQ ID No.9.

[0056] In the above application, the substance that inhibits or downregulates the expression level and / or activity of any of the above malate dehydrogenases may be the sgRNAe shown in SEQ ID No.11.

[0057] In the above applications, the substance that increases or upregulates the expression and / or activity of any of the aforementioned branched-chain amino acid transaminases derived from Bacillus subtilis can be a nucleic acid molecule. Furthermore, the nucleic acid molecule can be a gene encoding the branched-chain amino acid transaminases derived from Bacillus subtilis, which is activated by PTRC. Furthermore, the nucleotide sequence of the nucleic acid molecule can be as shown in SEQ ID No. 8.

[0058] The present invention also protects the use of an expression cassette, a recombinant vector, a recombinant bacterium, or a recombinant host cell containing any of the aforementioned nucleic acid molecules, the substance that inhibits or downregulates the expression and / or activity of any of the aforementioned pyruvate formate lyases, the substance that inhibits or downregulates the expression and / or activity of any of the aforementioned alcohol dehydrogenases, the substance that inhibits or downregulates the expression and / or activity of any of the aforementioned Escherichia coli branched-chain amino acid transaminases, the substance that inhibits or downregulates the expression and / or activity of any of the aforementioned thiamine phosphate synthases, the substance that inhibits or downregulates the expression and / or activity of any of the aforementioned malate dehydrogenases, and / or the substance that increases or increases the expression and / or activity of any of the aforementioned Bacillus subtilis branched-chain amino acid transaminases, which may be at least one of A1) to A5):

[0059] A1) constructing a genetically engineered bacterium that produces L-amino acids;

[0060] A2) production of L-amino acids;

[0061] A3) regulating the production of L-amino acids;

[0062] A4) preparing products for the production of L-amino acids;

[0063] A5) Preparation of food, feed or medicine containing L-amino acid.

[0064] The present invention also protects a recombinant bacterium, characterized in that: at least one of any of the above-mentioned pyruvate formate lyase, any of the above-mentioned alcohol dehydrogenase, any of the above-mentioned Escherichia coli-derived branched-chain amino acid transaminase, any of the above-mentioned thiamine phosphate synthase, and any of the above-mentioned malate dehydrogenase is weakly expressed or not expressed in the starting bacterium; and / or any of the above-mentioned branched-chain amino acid transaminase derived from Bacillus subtilis is expressed or overexpressed, thereby obtaining a recombinant bacterium.

[0065] In the recombinant bacteria, the weak expression or non-expression is achieved by reducing the expression level and / or activity of any of the above-mentioned pyruvate formate lyases, any of the above-mentioned alcohol dehydrogenases, any of the above-mentioned Escherichia coli-derived branched-chain amino acid transaminases, any of the above-mentioned thiamine phosphate synthases and / or any of the above-mentioned malate dehydrogenases in the starting bacteria.

[0066] In the recombinant bacteria, the expression or overexpression is achieved by introducing a gene encoding a branched-chain amino acid transaminase derived from any of the above-mentioned Bacillus subtilis into the starting bacteria.

[0067] In the recombinant bacteria, the reduction of the expression level and / or activity of any of the above-mentioned pyruvate formate lyase, any of the above-mentioned alcohol dehydrogenase, any of the above-mentioned Escherichia coli-derived branched-chain amino acid transaminase, any of the above-mentioned thiamine phosphate synthase and / or any of the above-mentioned malate dehydrogenase in the starting bacteria can be achieved by gene editing, gene knockout, gene mutation or gene attenuation technology to reduce the expression level, activity or inactivate any of the above-mentioned pyruvate formate lyase, any of the above-mentioned alcohol dehydrogenase, any of the above-mentioned Escherichia coli-derived branched-chain amino acid transaminase, any of the above-mentioned thiamine phosphate synthase and / or any of the above-mentioned malate dehydrogenase in the starting bacteria.

[0068] In the recombinant bacteria, the gene editing is performed using the CRISPR / Cas9 system. The CRISPR / Cas9 system may include a vector expressing an sgRNA targeting any of the genes encoding the pyruvate formate lyase, a vector expressing an sgRNA targeting any of the genes encoding the alcohol dehydrogenase, a vector expressing an sgRNA targeting any of the genes encoding the Escherichia coli branched-chain amino acid transaminases, a vector expressing an sgRNA targeting any of the genes encoding the thiamine phosphate synthase, and / or a vector expressing an sgRNA targeting any of the genes encoding the malate dehydrogenase.

[0069] In the recombinant bacteria, the sgRNA targeting the gene encoding pyruvate formate lyase may be as shown in SEQ ID No. 1. The sgRNA targeting the gene encoding alcohol dehydrogenase may be as shown in SEQ ID No. 4. The sgRNA targeting the gene encoding Escherichia coli-derived branched-chain amino acid transaminase may be as shown in SEQ ID No. 7. The sgRNA targeting the gene encoding thiamine phosphate synthase may be as shown in SEQ ID No. 9. The sgRNA targeting the gene encoding malate dehydrogenase may be as shown in SEQ ID No. 11.

[0070] The recombinant bacteria protected by the present invention may specifically be engineered bacteria A, which may be a microorganism that inhibits or downregulates the expression level and / or activity of any of the above-mentioned pyruvate formate lyases in vivo; the microorganism can produce valine.

[0071] In the above-mentioned engineered bacteria A, the inhibition or downregulation of the expression level and / or activity of pyruvate formate lyase is achieved by knocking out or knocking down the gene encoding pyruvate formate lyase (ie, the pflB gene) in the microorganism.

[0072] The inhibition or downregulation of the expression level and / or activity of pyruvate formate lyase is achieved by introducing the pGRB-pflB sgRNA plasmid and ΔpflB-Up-Down fragment mentioned in the examples into the microorganism.

[0073] The engineered bacteria A also inhibits or downregulates the expression level and / or activity of alcohol dehydrogenase in vivo.

[0074] In the above-mentioned engineered bacteria A, the inhibition or down-regulation of the expression level and / or activity of alcohol dehydrogenase is achieved by knocking out or knocking down the gene encoding alcohol dehydrogenase (ie, the adhE gene) in the microorganism.

[0075] The inhibition or downregulation of the expression level and / or activity of alcohol dehydrogenase is achieved by introducing the pGRB-adhE sgRNA plasmid and ΔadhE-Up-Down fragment mentioned in the examples into the microorganism.

[0076] The engineered bacteria A also inhibits or downregulates the expression level and / or activity of branched-chain amino acid transaminase derived from Escherichia coli and contains or expresses branched-chain amino acid transaminase derived from Bacillus subtilis.

[0077] In the above-mentioned engineered bacteria A, the inhibition or downregulation of the expression level and / or activity of the branched-chain amino acid transaminase derived from Escherichia coli is achieved by knocking out or knocking down the gene encoding the branched-chain amino acid transaminase in the microorganism (i.e., the ilvE (E) gene).

[0078] In the above-mentioned engineered bacteria A, the containing or expression of the branched-chain amino acid transaminase derived from Bacillus subtilis is achieved by knocking in or introducing the gene encoding the branched-chain amino acid transaminase derived from Bacillus subtilis (ie, the ilvE(B) gene) into the microorganism.

[0079] In the aforementioned engineered strain A, the knock-in or introduction of the gene encoding the branched-chain amino acid transaminase derived from Bacillus subtilis into the microorganism is achieved by introducing an expression cassette into the microorganism; the expression cassette comprises a promoter and the gene encoding the branched-chain amino acid transaminase derived from Bacillus subtilis. The promoter may be an inducible promoter. Specifically, the inducible promoter may be the PTRC promoter.

[0080] The inhibition or downregulation of the expression level and / or activity of the branched-chain amino acid transaminase derived from Escherichia coli and the presence or expression of the branched-chain amino acid transaminase derived from Bacillus subtilis can be achieved by introducing the pGRB-ilvE sgRNA plasmid and ptrc-ilvE(B)-Up-Down fragment mentioned in the examples into the microorganism.

[0081] The engineered bacteria A also inhibits or downregulates the expression level and / or activity of thiamine phosphate synthase in vivo.

[0082] In the above-mentioned engineered bacteria A, the inhibition or downregulation of the expression level and / or activity of thiamine phosphate synthase is achieved by knocking out or knocking down the gene encoding thiamine phosphate synthase (i.e., thiE gene) in the microorganism.

[0083] The inhibition or downregulation of the expression level and / or activity of thiamine phosphate synthase can be achieved by introducing the pGRB-thiE sgRNA plasmid and ΔthiE-Up-Down fragment mentioned in the examples into the microorganism.

[0084] The engineered bacteria A also inhibits or downregulates the expression level and / or activity of malate dehydrogenase in vivo.

[0085] In the above-mentioned engineered bacteria A, the inhibition or downregulation of the expression level and / or activity of malate dehydrogenase is achieved by knocking out or knocking down the gene encoding malate dehydrogenase (ie, the mdh gene) in the microorganism.

[0086] The inhibition or downregulation of the expression level and / or activity of malate dehydrogenase can be achieved by introducing the pGRB-mdh sgRNA plasmid and Δmdh-Up-Down fragment mentioned in the examples into the microorganism.

[0087] The recombinant bacteria protected by the present invention may specifically be engineered bacteria B, which may be a microorganism that inhibits or downregulates the expression level and / or activity of alcohol dehydrogenase in vivo; the microorganism can produce valine.

[0088] In the above-mentioned engineered bacteria B, the inhibition or down-regulation of the expression level and / or activity of alcohol dehydrogenase is achieved by knocking out or knocking down the gene encoding alcohol dehydrogenase (ie, the adhE gene) in the microorganism.

[0089] The inhibition or downregulation of the expression level and / or activity of alcohol dehydrogenase is achieved by introducing the pGRB-adhE sgRNA plasmid and ΔadhE-Up-Down fragment mentioned in the examples into the microorganism.

[0090] The engineered bacteria B also inhibits or downregulates the expression level and / or activity of branched-chain amino acid transaminase derived from microorganisms and contains or expresses branched-chain amino acid transaminase derived from Bacillus subtilis.

[0091] In the above-mentioned engineered bacteria B, the inhibition or downregulation of the expression level and / or activity of the branched-chain amino acid transaminase derived from the microorganism is achieved by knocking out or knocking down the gene encoding the branched-chain amino acid transaminase in the microorganism (i.e., the ilvE (E) gene).

[0092] In the above-mentioned engineered bacteria B, the containing or expression of the branched-chain amino acid transaminase derived from Bacillus subtilis is achieved by knocking in or introducing the gene encoding the branched-chain amino acid transaminase derived from Bacillus subtilis (ie, the ilvE(B) gene) into the microorganism.

[0093] In the aforementioned engineered strain B, the knock-in or introduction of the gene encoding the branched-chain amino acid transaminase derived from Bacillus subtilis into the microorganism is achieved by introducing an expression cassette into the microorganism; the expression cassette comprises a promoter and the gene encoding the branched-chain amino acid transaminase derived from Bacillus subtilis. The promoter may be an inducible promoter. Specifically, the inducible promoter may be the PTRC promoter.

[0094] The inhibition or downregulation of the expression level and / or activity of the branched-chain amino acid transaminase derived from the microorganism and the presence or expression of the branched-chain amino acid transaminase derived from Bacillus subtilis can be achieved by introducing the pGRB-ilvE sgRNA plasmid and ptrc-ilvE(B)-Up-Down fragment mentioned in the example into the microorganism.

[0095] The engineered bacteria B also inhibits or downregulates the expression level and / or activity of thiamine phosphate synthase in vivo.

[0096] In the above-mentioned engineered bacteria B, the inhibition or down-regulation of the expression level and / or activity of thiamine phosphate synthase is achieved by knocking out or knocking down the gene encoding thiamine phosphate synthase (i.e., thiE gene) in the microorganism.

[0097] The inhibition or downregulation of the expression level and / or activity of thiamine phosphate synthase can be achieved by introducing the pGRB-thiE sgRNA plasmid and ΔthiE-Up-Down fragment mentioned in the examples into the microorganism.

[0098] The engineered bacteria B also inhibits or downregulates the expression level and / or activity of malate dehydrogenase in vivo.

[0099] In the above-mentioned engineered bacteria B, the inhibition or down-regulation of the expression level and / or activity of malate dehydrogenase is achieved by knocking out or knocking down the gene encoding malate dehydrogenase (ie, the mdh gene) in the microorganism.

[0100] The inhibition or downregulation of the expression level and / or activity of malate dehydrogenase can be achieved by introducing the pGRB-mdh sgRNA plasmid and Δmdh-Up-Down fragment mentioned in the examples into the microorganism.

[0101] The recombinant bacteria protected by the present invention may specifically be engineered bacteria C, which may be a microorganism that inhibits or downregulates the expression and / or activity of branched-chain amino acid transaminase derived from microorganisms in vivo and contains or expresses branched-chain amino acid transaminase derived from Bacillus subtilis; the microorganism can produce valine.

[0102] In the above-mentioned engineered bacteria C, the inhibition or downregulation of the expression level and / or activity of the branched-chain amino acid transaminase derived from the microorganism is achieved by knocking out or knocking down the gene encoding the branched-chain amino acid transaminase in the microorganism (i.e., the ilvE (E) gene).

[0103] In the above-mentioned engineered bacteria C, the containing or expression of the branched-chain amino acid transaminase derived from Bacillus subtilis is achieved by knocking in or introducing the gene encoding the branched-chain amino acid transaminase derived from Bacillus subtilis (ie, the ilvE(B) gene) into the microorganism.

[0104] In the aforementioned engineered strain C, the knock-in or introduction of the gene encoding the branched-chain amino acid transaminase derived from Bacillus subtilis into the microorganism is achieved by introducing an expression cassette into the microorganism; the expression cassette comprises a promoter and the gene encoding the branched-chain amino acid transaminase derived from Bacillus subtilis. The promoter may be an inducible promoter. Specifically, the inducible promoter may be the PTRC promoter.

[0105] The inhibition or downregulation of the expression level and / or activity of the branched-chain amino acid transaminase derived from the microorganism and the presence or expression of the branched-chain amino acid transaminase derived from Bacillus subtilis can be achieved by introducing the pGRB-ilvE sgRNA plasmid and ptrc-ilvE(B)-Up-Down fragment mentioned in the example into the microorganism.

[0106] The engineered bacteria C also inhibits or downregulates the expression level and / or activity of thiamine phosphate synthase in vivo.

[0107] In the above-mentioned engineered bacteria C, the inhibition or down-regulation of the expression level and / or activity of thiamine phosphate synthase is achieved by knocking out or knocking down the gene encoding thiamine phosphate synthase (i.e., thiE gene) in the microorganism.

[0108] The inhibition or downregulation of the expression level and / or activity of thiamine phosphate synthase can be achieved by introducing the pGRB-thiE sgRNA plasmid and ΔthiE-Up-Down fragment mentioned in the examples into the microorganism.

[0109] The engineered bacteria C also inhibits or downregulates the expression level and / or activity of malate dehydrogenase in vivo.

[0110] In the above-mentioned engineered bacteria C, the inhibition or down-regulation of the expression level and / or activity of malate dehydrogenase is achieved by knocking out or knocking down the gene encoding malate dehydrogenase (ie, the mdh gene) in the microorganism.

[0111] The inhibition or downregulation of the expression level and / or activity of malate dehydrogenase can be achieved by introducing the pGRB-mdh sgRNA plasmid and Δmdh-Up-Down fragment mentioned in the examples into the microorganism.

[0112] The recombinant bacteria protected by the present invention may specifically be engineered bacteria, which may be microorganisms that inhibit or downregulate the expression and / or activity of thiamine phosphate synthase in vivo; the microorganisms may produce valine.

[0113] In the above-mentioned engineered bacteria, the inhibition or downregulation of the expression level and / or activity of thiamine phosphate synthase is achieved by knocking out or knocking down the gene encoding thiamine phosphate synthase (i.e., thiE gene) in the microorganism.

[0114] The inhibition or downregulation of the expression level and / or activity of thiamine phosphate synthase can be achieved by introducing the pGRB-thiE sgRNA plasmid and ΔthiE-Up-Down fragment mentioned in the examples into the microorganism.

[0115] The engineered bacteria also inhibit or downregulate the expression and / or activity of malate dehydrogenase in vivo.

[0116] In the above-mentioned engineered bacteria, the inhibition or downregulation of the expression level and / or activity of malate dehydrogenase is achieved by knocking out or knocking down the gene encoding malate dehydrogenase (i.e., the mdh gene) in the microorganism.

[0117] The inhibition or downregulation of the expression level and / or activity of malate dehydrogenase can be achieved by introducing the pGRB-mdh sgRNA plasmid and Δmdh-Up-Down fragment mentioned in the examples into the microorganism.

[0118] The recombinant bacteria protected by the present invention may specifically be engineered bacteria E, which may be a microorganism that inhibits or downregulates the expression and / or activity of malate dehydrogenase in vivo; the microorganism can produce valine.

[0119] In the above-mentioned engineered bacteria E, the inhibition or downregulation of the expression level and / or activity of malate dehydrogenase is achieved by knocking out or knocking down the gene encoding malate dehydrogenase (i.e., the mdh gene) in the microorganism.

[0120] The inhibition or downregulation of the expression level and / or activity of malate dehydrogenase can be achieved by introducing the pGRB-mdh sgRNA plasmid and Δmdh-Up-Down fragment mentioned in the examples into the microorganism.

[0121] The present invention also protects a method for increasing the yield of L-amino acids, comprising the following steps: reducing the expression level and / or activity of at least one of any of the above-mentioned pyruvate formate lyases, any of the above-mentioned alcohol dehydrogenases, any of the above-mentioned Escherichia coli-derived branched-chain amino acid transaminases, any of the above-mentioned thiamine phosphate synthases, and any of the above-mentioned malate dehydrogenases in a starting bacterium, and / or increasing the expression level and / or activity of any of the above-mentioned branched-chain amino acid transaminases derived from Bacillus subtilis, to obtain a recombinant bacterium; the L-amino acid yield of the recombinant bacterium is higher than that of the starting bacterium.

[0122] In the above method, the reduction of the expression level and / or activity of at least one of the above-mentioned pyruvate formate lyase, any of the above-mentioned alcohol dehydrogenase, any of the above-mentioned Escherichia coli-derived branched-chain amino acid transaminase, any of the above-mentioned thiamine phosphate synthase and any of the above-mentioned malate dehydrogenase in the starting bacteria can be achieved by gene editing, gene knockout, gene mutation or gene attenuation technology to reduce the expression level, activity or inactivate the above-mentioned pyruvate formate lyase, any of the above-mentioned alcohol dehydrogenase, any of the above-mentioned Escherichia coli-derived branched-chain amino acid transaminase, any of the above-mentioned thiamine phosphate synthase and / or any of the above-mentioned malate dehydrogenase in the starting bacteria.

[0123] In the above method, increasing the expression level and / or activity of any of the above-mentioned branched-chain amino acid transaminase derived from Bacillus subtilis can be achieved by introducing a gene encoding the branched-chain amino acid transaminase derived from Bacillus subtilis into the starting bacteria.

[0124] In the above method, the gene editing can be performed using the CRISPR / Cas9 system. The CRISPR / Cas9 system can include a vector expressing an sgRNA targeting any of the genes encoding pyruvate formate lyase, a vector expressing an sgRNA targeting any of the genes encoding alcohol dehydrogenase, a vector expressing an sgRNA targeting any of the genes encoding Escherichia coli branched-chain amino acid transaminases, a vector expressing an sgRNA targeting any of the genes encoding thiamine phosphate synthase, and / or a vector expressing an sgRNA targeting any of the genes encoding malate dehydrogenase.

[0125] In the above method, the sgRNA targeting any of the genes encoding the pyruvate formate lyase described above may be as shown in SEQ ID No. 1. The sgRNA targeting any of the genes encoding the alcohol dehydrogenase described above may be as shown in SEQ ID No. 4. The sgRNA targeting any of the genes encoding the Escherichia coli branched-chain amino acid transaminases described above may be as shown in SEQ ID No. 7. The sgRNA targeting any of the genes encoding the thiamine phosphate synthase described above may be as shown in SEQ ID No. 9. The sgRNA targeting any of the genes encoding the malate dehydrogenase described above may be as shown in SEQ ID No. 11.

[0126] The method for preparing the recombinant bacteria protected by the present invention can specifically be a method for preparing engineered bacteria A, which may include step (a1): reducing the expression level and / or activity of any of the above-mentioned pyruvate formate lyases in the microorganism; the microorganism can produce valine.

[0127] In the preparation method, reducing the expression level and / or activity of pyruvate formate lyase in the microorganism is achieved by knocking out or knocking down the gene encoding pyruvate formate lyase in the microorganism (i.e., the pflB gene).

[0128] The reduction of the expression level and / or activity of pyruvate formate lyase in the microorganism is achieved by introducing the pGRB-pflB sgRNA plasmid and ΔpflB-Up-Down fragment mentioned in the example into the microorganism.

[0129] The preparation method further comprises step (a2): after completing step (a1), reducing the expression level and / or activity of any of the above-mentioned alcohol dehydrogenases in the microorganism.

[0130] In the preparation method, reducing the expression level and / or activity of alcohol dehydrogenase in the microorganism is achieved by knocking out or knocking down the gene encoding alcohol dehydrogenase (i.e., the adhE gene) in the microorganism.

[0131] The reduction of the expression level and / or activity of alcohol dehydrogenase in the microorganism is achieved by introducing the pGRB-adhE sgRNA plasmid and ΔadhE-Up-Down fragment mentioned in the example into the microorganism.

[0132] The preparation method further comprises step (a3): after completing step (a2), reducing the expression level and / or activity of the Escherichia coli-derived branched-chain amino acid transaminase and expressing the Bacillus subtilis-derived branched-chain amino acid transaminase in the microorganism.

[0133] In the preparation method, the reduction of the expression level and / or activity of the branched-chain amino acid transaminase in the microorganism is achieved by knocking out or knocking down the gene encoding the branched-chain amino acid transaminase in the microorganism (i.e., the ilvE (E) gene). The expression of the branched-chain amino acid transaminase derived from Bacillus subtilis in the microorganism is achieved by knocking in or introducing the gene encoding the branched-chain amino acid transaminase derived from Bacillus subtilis (i.e., the ilvE (B) gene) into the microorganism. The knocking in or introducing the gene encoding the branched-chain amino acid transaminase derived from Bacillus subtilis into the microorganism is achieved by introducing an expression cassette into the microorganism; the expression cassette includes a promoter and a gene encoding the branched-chain amino acid transaminase derived from Bacillus subtilis. The promoter may be an inducible promoter. The inducible promoter may specifically be a ptrc promoter.

[0134] The reduction of the expression level and / or activity of the Escherichia coli-derived branched-chain amino acid transaminase and the expression of the Bacillus subtilis-derived branched-chain amino acid transaminase in the microorganism can be achieved by introducing the pGRB-ilvE sgRNA plasmid and ptrc-ilvE(B)-Up-Down fragment mentioned in the example into the microorganism.

[0135] The preparation method further comprises step (a4): after completing step (a3), reducing the expression level and / or activity of any of the above-mentioned thiamine phosphate synthases in the microorganism.

[0136] In the preparation method, reducing the expression level and / or activity of thiamine phosphate synthase in the microorganism is achieved by knocking out or knocking down the gene encoding thiamine phosphate synthase (i.e., thiE gene) in the microorganism.

[0137] The reduction of the expression level and / or activity of thiamine phosphate synthase in the microorganism can be achieved by introducing the pGRB-thiE sgRNA plasmid and ΔthiE-Up-Down fragment mentioned in the examples into the microorganism.

[0138] The preparation method further comprises step (a5): after completing step (a4), reducing the expression level and / or activity of any of the malate dehydrogenases mentioned above in the microorganism.

[0139] In the preparation method, reducing the expression level and / or activity of malate dehydrogenase in the microorganism is achieved by knocking out or knocking down the gene encoding malate dehydrogenase (i.e., the mdh gene) in the microorganism.

[0140] The reduction of the expression level and / or activity of malate dehydrogenase in the microorganism can be achieved by introducing the pGRB-mdh sgRNA plasmid and Δmdh-Up-Down fragment mentioned in the examples into the microorganism.

[0141] The method for preparing the recombinant bacteria protected by the present invention can specifically be a method for preparing engineered bacteria B, which may include step (b1): reducing the expression level and / or activity of any of the above-mentioned alcohol dehydrogenases in the microorganism; the microorganism can produce valine.

[0142] In the method, reducing the expression level and / or activity of alcohol dehydrogenase in the microorganism is achieved by knocking out or knocking down the gene encoding alcohol dehydrogenase (i.e., the adhE gene) in the microorganism.

[0143] The reduction of the expression level and / or activity of alcohol dehydrogenase in the microorganism is achieved by introducing the pGRB-adhE sgRNA plasmid and ΔadhE-Up-Down fragment mentioned in the example into the microorganism.

[0144] The method further comprises step (b2): after completing step (b1), reducing the expression level and / or activity of the branched-chain amino acid transaminase derived from the microorganism and expressing the branched-chain amino acid transaminase derived from Bacillus subtilis in the microorganism.

[0145] In the method, the reduction of the expression level and / or activity of the branched-chain amino acid transaminase in the microorganism is achieved by knocking out or knocking down the gene encoding the branched-chain amino acid transaminase in the microorganism (i.e., the ilvE(E) gene). The expression of the branched-chain amino acid transaminase derived from Bacillus subtilis in the microorganism is achieved by knocking in or introducing the gene encoding the branched-chain amino acid transaminase derived from Bacillus subtilis (i.e., the ilvE(B) gene) into the microorganism. The knocking in or introducing the gene encoding the branched-chain amino acid transaminase derived from Bacillus subtilis into the microorganism is achieved by introducing an expression cassette into the microorganism; the expression cassette includes a promoter and a gene encoding the branched-chain amino acid transaminase derived from Bacillus subtilis. The promoter may be an inducible promoter. The inducible promoter may specifically be a ptrc promoter.

[0146] The reduction of the expression level and / or activity of the branched-chain amino acid transaminase derived from the microorganism and the expression of the branched-chain amino acid transaminase derived from Bacillus subtilis in the microorganism can be achieved by introducing the pGRB-ilvE sgRNA plasmid and ptrc-ilvE(B)-Up-Down fragment mentioned in the example into the microorganism.

[0147] The method further comprises step (b3): ​​after completing step (b2), reducing the expression level and / or activity of any of the above-mentioned thiamine phosphate synthases in the microorganism.

[0148] In the method, reducing the expression level and / or activity of thiamine phosphate synthase in the microorganism is achieved by knocking out or knocking down the gene encoding thiamine phosphate synthase (i.e., thiE gene) in the microorganism.

[0149] The reduction of the expression level and / or activity of any of the above-mentioned thiamine phosphate synthases in the microorganism can be achieved by introducing the pGRB-thiE sgRNA plasmid and ΔthiE-Up-Down fragment mentioned in the examples into the microorganism.

[0150] The method further comprises step (b4): after completing step (b3), reducing the expression level and / or activity of any of the malate dehydrogenases mentioned above in the microorganism.

[0151] In the method, reducing the expression level and / or activity of malate dehydrogenase in the microorganism is achieved by knocking out or knocking down the gene encoding malate dehydrogenase (i.e., the mdh gene) in the microorganism.

[0152] The reduction of the expression level and / or activity of malate dehydrogenase in the microorganism can be achieved by introducing the pGRB-mdh sgRNA plasmid and Δmdh-Up-Down fragment mentioned in the examples into the microorganism.

[0153] The method for preparing the recombinant bacteria protected by the present invention can specifically be a method for preparing engineered bacteria C, which may include step (c1): reducing the expression level and / or activity of a branched-chain amino acid transaminase of microbial origin in a microorganism and expressing a branched-chain amino acid transaminase derived from Bacillus subtilis in the microorganism; the microorganism can produce valine.

[0154] In the preparation method, the reduction of the expression level and / or activity of the branched-chain amino acid transaminase in the microorganism is achieved by knocking out or knocking down the gene encoding the branched-chain amino acid transaminase in the microorganism (i.e., the ilvE (E) gene). The expression of the branched-chain amino acid transaminase derived from Bacillus subtilis in the microorganism is achieved by knocking in or introducing the gene encoding the branched-chain amino acid transaminase derived from Bacillus subtilis (i.e., the ilvE (B) gene) into the microorganism. The knocking in or introducing the gene encoding the branched-chain amino acid transaminase derived from Bacillus subtilis into the microorganism is achieved by introducing an expression cassette into the microorganism; the expression cassette includes a promoter and a gene encoding the branched-chain amino acid transaminase derived from Bacillus subtilis. The promoter may be an inducible promoter. The inducible promoter may specifically be a ptrc promoter.

[0155] The reduction of the expression level and / or activity of the branched-chain amino acid transaminase derived from the microorganism in the microorganism and the expression of the branched-chain amino acid transaminase derived from Bacillus subtilis in the microorganism can be achieved by introducing the pGRB-ilvE sgRNA plasmid and ptrc-ilvE(B)-Up-Down fragment mentioned in the example into the microorganism.

[0156] The preparation method further comprises step (c2): after completing step (c1), reducing the expression level and / or activity of any of the above-mentioned thiamine phosphate synthases in the microorganism.

[0157] In the preparation method, reducing the expression level and / or activity of thiamine phosphate synthase in the microorganism is achieved by knocking out or knocking down the gene encoding thiamine phosphate synthase (i.e., thiE gene) in the microorganism.

[0158] The reduction of the expression level and / or activity of any of the above-mentioned thiamine phosphate synthases in the microorganism can be achieved by introducing the pGRB-thiE sgRNA plasmid and ΔthiE-Up-Down fragment mentioned in the examples into the microorganism.

[0159] The preparation method further comprises step (c3): after completing step (c2), reducing the expression level and / or activity of any of the malate dehydrogenases mentioned above in the microorganism.

[0160] In the preparation method, reducing the expression level and / or activity of malate dehydrogenase in the microorganism is achieved by knocking out or knocking down the gene encoding malate dehydrogenase (i.e., the mdh gene) in the microorganism.

[0161] The reduction of the expression level and / or activity of malate dehydrogenase in the microorganism can be achieved by introducing the pGRB-mdh sgRNA plasmid and Δmdh-Up-Down fragment mentioned in the examples into the microorganism.

[0162] The method for preparing the recombinant bacteria protected by the present invention can specifically be a method for preparing engineered bacteria, which can include step (d1): reducing the expression level and / or activity of any of the above-mentioned thiamine phosphate synthases in the microorganism; the microorganism can produce valine.

[0163] In the preparation method, reducing the expression level and / or activity of thiamine phosphate synthase in the microorganism is achieved by knocking out or knocking down the gene encoding thiamine phosphate synthase (i.e., thiE gene) in the microorganism.

[0164] The reduction of the expression level and / or activity of any of the above-mentioned thiamine phosphate synthases in the microorganism can be achieved by introducing the pGRB-thiE sgRNA plasmid and ΔthiE-Up-Down fragment mentioned in the examples into the microorganism.

[0165] The preparation method further comprises step (d2): after completing step (d1), reducing the expression level and / or activity of any of the malate dehydrogenases mentioned above in the microorganism.

[0166] In the preparation method, reducing the expression level and / or activity of malate dehydrogenase in the microorganism is achieved by knocking out or knocking down the gene encoding malate dehydrogenase (i.e., the mdh gene) in the microorganism.

[0167] The reduction of the expression level and / or activity of malate dehydrogenase in the microorganism can be achieved by introducing the pGRB-mdh sgRNA plasmid and Δmdh-Up-Down fragment mentioned in the examples into the microorganism.

[0168] The method for preparing the recombinant bacteria protected by the present invention can specifically be a method for preparing engineered bacteria E, which may include step (e1): reducing the expression level and / or activity of any of the above-mentioned malate dehydrogenases in the microorganism; the microorganism can produce valine.

[0169] In the preparation method, reducing the expression level and / or activity of malate dehydrogenase in the microorganism is achieved by knocking out or knocking down the gene encoding malate dehydrogenase (i.e., the mdh gene) in the microorganism.

[0170] The reduction of the expression level and / or activity of malate dehydrogenase in the microorganism can be achieved by introducing the pGRB-mdh sgRNA plasmid and Δmdh-Up-Down fragment mentioned in the examples into the microorganism.

[0171] The present invention also protects a method for producing L-amino acids, which may include the following steps: fermenting and culturing any of the above-mentioned recombinant bacteria, collecting the fermentation product, and obtaining L-amino acids therefrom.

[0172] The present invention also protects the use of any of the above-mentioned recombinant bacteria, which may be at least one of A2) to A5):

[0173] A2) production of L-amino acids;

[0174] A3) regulating the production of L-amino acids;

[0175] A4) preparing products for the production of L-amino acids;

[0176] A5) Preparation of food, feed or medicine containing L-amino acid.

[0177] Herein, the culture can be carried out according to conventional methods in the art, including but not limited to well plate culture, shake flask culture, batch culture, continuous culture and fed-batch culture, and various culture conditions such as temperature, time and pH value of the culture medium can be appropriately adjusted according to actual conditions.

[0178] Herein, the L-amino acid may include L-valine, L-isoleucine, L-threonine, L-tryptophan, L-arginine, L-lysine, L-glutamic acid, L-glycine, L-alanine, L-leucine, L-methionine, L-proline, L-serine, L-tyrosine, L-cysteine, L-phenylalanine, L-asparagine, L-glutamine, L-aspartic acid and / or L-histidine.

[0179] Any of the above-mentioned L-amino acids can specifically be L-valine.

[0180] As used herein, identity refers to amino acid sequence identity. Amino acid sequence identity can be determined using a homology search site on the Internet, such as the BLAST page on the NCBI homepage. For example, amino acid sequence identity can be calculated using Advanced BLAST 2.1 by using blastp as the program, setting the Expect value to 10, all filters to OFF, using BLOSUM62 as the matrix, and setting the Gap existence cost, Per residue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values), respectively. The identity value (%) can then be obtained.

[0181] Herein, the 90% or greater identity may be at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity.

[0182] The microorganisms described herein may be yeast, bacteria, algae, or fungi. The bacteria may be from, but are not limited to, Escherichia sp., Erwinia sp., Agrobacterium sp., Flavobacterium sp., Alcaligenes sp., Pseudomonas sp., Bacillus sp., Brevibacterium sp., Corynebacterium sp., Aerobacter sp., Enterobacteria sp., Micrococcus sp., Serratia sp., Salmonella sp., Streptomyces sp., Providencia sp., and the like.

[0183] Further, the bacteria may be Escherichia coli, Corynebacterium glutamicum, Brevibacterium lactofermentum, Brevibacterium flavum, Corynebacterium pekinense, Brevibacterium ammoniagenes, Corynebacterium crenatum or Pantoea, but are not limited thereto.

[0184] Herein, the starting bacteria may be Escherichia coli.

[0185] In one or more embodiments of the present invention, the microorganism is Escherichia coli. Specifically, the Escherichia coli may be Escherichia coli YP045 CGMCC No. 22721 or Escherichia coli W3110.

[0186] The inventors of this application have found through a large number of experiments that: (1) in Escherichia coli (such as Escherichia coli YP045 CGMCC) that can produce valine coli W3110) by “knocking out the pflB gene”, “knocking out the pflB gene and adhE gene”, “knocking out the pflB gene and adhE gene and knocking out the ilvE(E) gene and inserting the ptrc-driven ilvE(B) gene from Bacillus subtilis”, “knocking out the pflB gene, adhE gene and thiE gene and knocking out the ilvE(E) gene and inserting the ptrc-driven ilvE(B) gene from Bacillus subtilis” or “knocking out the pflB gene, adhE gene, thiE gene and mdh gene and knocking out the ilvE(E) gene and inserting the ptrc-driven ilvE(B) gene from Bacillus subtilis” can significantly increase the production of L-amino acids (such as L-valine); (2) in Escherichia coli that can produce valine (such as Escherichia coli YP045 CGMCC No. 22721 or Escherichia coli W3110) by "knocking out the adhE gene", "knocking out the adhE gene and the ilvE(E) gene and inserting the ilvE(B) gene from Bacillus subtilis driven by ptrc", "knocking out the adhE gene and the thiE gene and knocking out the ilvE(E) gene and inserting the ilvE(B) gene from Bacillus subtilis driven by ptrc", or "knocking out the adhE gene, the thiE gene and the mdh gene and knocking out the ilvE(E) gene and inserting the ilvE(B) gene from Bacillus subtilis driven by ptrc" can significantly increase the production of L-amino acids (such as L-valine); in Escherichia coli that can produce valine (such as Escherichia coli YP045 CGMCC No. 22721 or Escherichia coli W3110) by “knocking out the ilvE(E) gene and inserting the ilvE(B) gene from Bacillus subtilis driven by ptrc”, “knocking out the thiE gene and the ilvE(E) gene and inserting the ilvE(B) gene from Bacillus subtilis driven by ptrc”, or “knocking out the thiE gene and the mdh gene and knocking out the ilvE(E) gene and inserting the ilvE(B) gene from Bacillus subtilis driven by ptrc” can significantly increase the production of L-amino acids (such as L-valine); in Escherichia coli that can produce valine (such as Escherichia coli YP045 CGMCC No.The engineered bacteria obtained by knocking out the thiE gene, the mdh gene, or both the thiE and mdh genes in Escherichia coli (E. coli 22721 or E. coli W3110) can significantly increase the production of L-amino acids (such as L-valine). The present invention has important application value.

[0187] Preservation Instructions

[0188] Species name: Escherichia coli

[0189] Latin name: Escherichia coli

[0190] Classification name: Escherichia coli

[0191] Strain ID: YP045

[0192] Depository: General Microbiology Center of China Culture Collection Administration

[0193] Abbreviation of depository unit: CGMCC

[0194] Address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing

[0195] Date of deposit: June 15, 2021

[0196] CGMCC registration number: CGMCC No.22721 Modes for Carrying Out the Invention

[0197] The present application is further described in detail below in conjunction with specific embodiments. The examples provided are only for the purpose of illustrating the present application and are not intended to limit the scope of the present application. The examples provided below can serve as a guide for further improvements by those skilled in the art and do not in any way limit the present application.

[0198] Unless otherwise specified, the experimental methods in the following examples are conventional methods and were performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials and reagents used in the following examples, unless otherwise specified, were all commercially available.

[0199] Escherichia coli YP045 can be used to produce valine. It was deposited with the General Microbiology Center of the China Culture Collection Administration (CGMCC, located at No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing) on ​​June 15, 2021, with the deposit number CGMCC No. 22721. The full name of Escherichia coli YP045 is Escherichia coli YP045 CGMCC No. 22721, hereinafter referred to as the valine-producing strain CGMCC 22721.

[0200] Example 1: Transformation of an engineered bacterium based on the valine-producing bacterium CGMCC 22721

[0201] After extensive experiments, the inventors of the present invention modified the valine-producing strain CGMCC 22721 to obtain engineered strains YPVal-pflB01, YPVal-pflB02, YPVal-pflB03, YPVal-pflB04, and YPVal-pflB05. The genotypes of the engineered strains YPVal-pflB01, YPVal-pflB02, YPVal-pflB03, YPVal-pflB04, and YPVal-pflB05 are shown in Table 1.

[0202] Table 1

[0203] 1. Obtaining the engineered strain YPVal-pflB01

[0204] Based on the Escherichia coli W3110 genome sequence published by NCBI, the pflB gene in the valine-producing bacterium CGMCC 22721 genome was knocked out using CRISPR / Cas9 gene editing technology to obtain the engineered bacterium YPVal-pflB01.

[0205] The pflB gene encodes pyruvate formate lyase, its Gene ID is 945514, and its amino acid sequence is shown in SEQ ID No.13.

[0206] SEQ ID NO.13 (pyruvate formate lyase pflB):

[0207] The specific steps are as follows:

[0208] 1. Construction of pGRB-pflB sgRNA plasmid

[0209] Based on the Escherichia coli W3110 genome sequence published by NCBI, the sgRNA target sequence for knocking out the pflB gene was designed using CRISPR RGEN Tools (http: / / www.rgenome.net / cas-designer / ): GCGAATTTCTTGAAGTTCAGCGG (shown in SEQ ID No. 1). Linearized pGRB vector homology arm sequences were added to the 5' and 3' ends of the target sequence for construction of the sgRNA plasmid.

[0210] (1) Primer sgRNA-1F was synthesized by Invitrogen:

[0211] 5'-TGACAGCTAGCTCAGTCCTAGGTATAATACTAGTgcgaatttcttgaagttcagcggGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGG-3' (shown in SEQ ID No. 19, the underline is the homology arm sequence of the pGRB vector), primer sgRNA-1R:

[0212] 5'-CCTTATTTTAACTTGCTATTTCTAGCTCTAAAACccgctgaacttcaagaaattcgcACTAGTATTATACCTAGGACTGAGCTAGCTGTCA-3' (shown in SEQ ID No. 20, the underline is the homology arm sequence of the pGRB vector), primer sgRNA-PF:

[0213] 5'-GTCTCATGAGCGGATACATATTTG-3' (SEQ ID No. 21) and primer sgRNA-PR: 5'-ATGAGAAAGCGCCACGCT-3' (SEQ ID No. 22).

[0214] (2) Primer sgRNA-1F and primer sgRNA-1R were annealed (reaction procedure: denaturation at 95°C for 5 minutes, annealing at 50°C for 1 minute), and then the target fragment was recovered using a DNA purification kit, its DNA concentration was determined, and the concentration was diluted to 100 ng / μL to obtain an annealing product. The annealing product contained the sgRNA-1 fragment with the nucleotide sequence shown in SEQ ID No. 1.

[0215] (3) The pGRB vector (product of Addgene, catalog number 71539) was digested with the restriction endonuclease SpeI (product of Takara, catalog number 1631), and a DNA fragment of approximately 2700 bp was recovered using a DNA recovery kit (QIAGEN Gel Extraction Kit).

[0216] The enzyme digestion system is 50 μL, consisting of 5 μL 10× Buffer (provided with restriction endonuclease SpeI), 2.5 μL restriction endonuclease SpeI, 3000-5000 ng pGRB vector and ddH2O.

[0217] Enzyme digestion procedure: 37°C for 3 h.

[0218] (4) The DNA fragment recovered in step (3) was subjected to a dephosphorylation reaction (to prevent the pGRB vector from self-ligating), and recovered using a DNA recovery kit to obtain a linearized pGRB vector.

[0219] The dephosphorylation system is 50 μL, consisting of 5 μL 10× Buffer (provided by CIAP), 1000-2000 ng of DNA fragments recovered in step (3), 2.5 μL CIAP (product of Takara, catalog number 2250A) and ddH2O.

[0220] Dephosphorylation procedure: 37°C for 1 h.

[0221] (5) The linearized pGRB vector obtained in step (4) and the annealed product obtained in step (2) were recombined using the Gibson Assembly kit (New England), and then transformed into Escherichia coli DH5α competent cells (TAKARA) to obtain the pGRB-pflB sgRNA plasmid.

[0222] The recombinant system was 5 μL, consisting of 2 μL of linearized pGRB vector, 0.5 μL of annealed product, and 2.5 μL of assembly enzyme (provided by the Gibson Assembly kit).

[0223] Recombination procedure: 50°C for 30 min.

[0224] 2. Obtaining the ΔpflB-Up-Down fragment

[0225] (1) Based on the Escherichia coli W3110 genome sequence published by NCBI, a primer pair for amplifying the upstream homology arm and a primer pair for amplifying the downstream homology arm were designed and synthesized by Invitrogen.

[0226] The primer pair used to amplify the upstream homology arm consists of primer P1:

[0227] 5'-CGTTGGTGTCCAGACAGGTATG-3' (shown in SEQ ID No. 23) and primer P2:

[0228] 5'-GACATCCTGCGTTGCCGTAAATGAACCGTGAAATGCTGCTCG-3' (shown in SEQ ID No. 24).

[0229] The primer pair used to amplify the downstream homology arms consists of primer P3:

[0230] 5'-CGAGCAGCATTTCACGGTTCATTTACGGCAACGCAGGATGTC-3' (shown in SEQ ID No. 25) and primer P4: 5'-TTTCTCACCTGACCGTGATG-3' (shown in SEQ ID No. 26).

[0231] (2) Using the genomic DNA of Escherichia coli W3110 as a template, a primer pair consisting of primer P1 and primer P2 was used for PCR amplification using the high-fidelity amplification enzyme KAPA HiFi HotStart, and a DNA recovery kit was used to recover the upstream homology arm of 686 bp.

[0232] (3) Using the genomic DNA of Escherichia coli W3110 as a template, a primer pair consisting of primer P3 and primer P4 was used for PCR amplification using the high-fidelity amplification enzyme KAPA HiFi HotStart, and a downstream homology arm of 695 bp was recovered using a DNA recovery kit.

[0233] (4) The upstream homology arm recovered in step (2) and the downstream homology arm recovered in step (3) were mixed and used as templates, and overlap PCR was performed using a primer pair consisting of primer P1 and primer P4 to obtain the ΔpflB-Up-Down fragment shown in SEQ ID No. 2.

[0234] SEQ ID No.2:ΔpflB-Up-Down(1339bp)

[0235] 3. Acquisition of CGMCC 22721-Cas9 strain

[0236] (1) The plasmid pREDCas9 (product of Addgene, catalog number 71541; containing the spectinomycin resistance gene) was transformed into valine-producing bacteria CGMCC 22721 competent cells, and then spread on 2-YT agar plates containing 100 mg / L spectinomycin and cultured at 32°C to obtain spectinomycin-resistant single colonies.

[0237] 2-YT agar plates were prepared as follows: 16 g of tryptone, 10 g of yeast extract powder, 5 g of sodium chloride, and 16 g of agar powder were dissolved in an appropriate amount of water, and the volume was made up to 1 L with water. The pH value was adjusted to 7.0 with sodium hydroxide, and the plates were sterilized at 121°C for 20 minutes.

[0238] (2) Using the single colonies obtained in step (1) as templates, PCR amplification was performed using a primer pair consisting of primer pRedCas9-PF: 5'-GCAGTGGCGGTTTTCATG-3' (SEQ ID No. 27) and primer pRedCas9-PR: 5'-CCTTGGTGATCTCGCCTTTC-3' (SEQ ID No. 28) to obtain PCR amplification products. If the PCR amplification product obtained from a single colony contains a DNA fragment with a nucleotide sequence as shown in SEQ ID No. 3, the colony contains plasmid pREDCas9. The strain of the colony was named CGMCC 22721-Cas9 strain.

[0239] SEQ ID No.3: Identification primers pRedCas9-F / pRedCas9-R PCR amplified sequence (943 bp)

[0240] 4. Obtaining the engineered bacteria YPVal-pflB01

[0241] (1) Cultivate CGMCC 22721-Cas9 strain; when CGMCC 22721-Cas9 strain grows to OD 600nm When the OD value was 0.1, IPTG was added to make the concentration of IPTG in the system 0.1 mM, and the culture was continued to induce λ-Red-mediated homologous recombination; when the CGMCC 22721-Cas9 strain grew to OD 600nm When the p-value was 0.6, the bacteria were collected and CGMCC 22721-Cas9 competent cells were prepared.

[0242] (2) The pGRB-pflB sgRNA plasmid obtained in step 1 and the ΔpflB-Up-Down fragment obtained in step 2 were transformed into CGMCC 22721-Cas9 competent cells, spread on 2-YT agar plates containing 100 mg / L spectinomycin and 100 mg / L ampicillin, and cultured at 32°C to obtain single colonies.

[0243] (3) Using the single colonies obtained in step (2) as templates, PCR amplification is performed using a primer pair consisting of primer P1 and primer P4 to obtain PCR amplification products. If the PCR amplification product obtained from a single colony contains a DNA fragment of 1339 bp, the colony is preliminarily identified as a positive transformant.

[0244] (4) The positive transformants obtained in step (3) were inoculated on 2-YT agar plates containing 100 mg / L spectinomycin and 0.2% (m / v) arabinose and cultured at 32°C (for eliminating the pGRB-pflB sgRNA plasmid); then, colonies that grew on 2-YT agar plates containing 100 mg / L spectinomycin but did not grow on 2-YT agar plates containing 100 mg / L ampicillin were selected, and these colonies were transferred to 2-YT agar plates and cultured at 42°C (for eliminating the plasmid pREDCas9); finally, colonies that did not grow on 2-YT agar plates containing 100 mg / L spectinomycin but grew on 2-YT agar plates without antibiotics were selected.

[0245] (5) Using the single colony obtained in step (4) as a template, PCR amplification is performed using a primer pair consisting of primer P1 and primer P4 to obtain a PCR amplification product. If the PCR amplification product obtained from a single colony contains a DNA fragment of 1339 bp in size, the colony is identified as a positive transformant. The positive transformant is a knockout of the pflB gene in the genome of the valine-producing bacterium CGMCC 22721, and the positive transformant is named the engineered bacterium YPVal-pflB01.

[0246] 2. Obtaining the engineered bacteria YPVal-pflB02

[0247] The engineered bacteria YPVal-pflB01 obtained in step 1 was used as the starting bacteria. Based on the Escherichia coli W3110 genome sequence published by NCBI, the adhE gene in the genome of the engineered bacteria YPVal-pflB01 was knocked out using CRISPR / Cas9 gene editing technology.

[0248] The adhE gene encodes alcohol dehydrogenase, its Gene ID is 945837, and its amino acid sequence is shown in SEQ ID No.14.

[0249] SEQ ID NO.14 (alcohol dehydrogenase adhE)

[0250] The specific steps are as follows:

[0251] 1. Construction of pGRB-adhE sgRNA plasmid

[0252] Based on the Escherichia coli W3110 genome sequence published by NCBI, the sgRNA target sequence for knocking out the adhE gene was designed using CRISPR RGEN Tools (http: / / www.rgenome.net / cas-designer / ): AAGAACCACAACCCAGAGTCAGG (shown in SEQ ID No. 4). Linearized pGRB vector homology arm sequences were added to the 5' and 3' ends of the target sequence to construct the sgRNA plasmid.

[0253] (1) Primer sgRNA-2F was synthesized by Invitrogen:

[0254] 5'-TGACAGCTAGCTCAGTCCTAGGTATAATACTAGTaagaaccacaacccagagtcaggGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGG-3' (shown in SEQ ID No. 29, the underline is the homology arm sequence of the pGRB vector) and primer sgRNA-2R:

[0255] 5′-CCTTATTTTAACTTGCTATTTCTAGCTCTAAAACcctgactctgggttgtggttcttACTAGTATTATACCTAGGACTGAGCTAGCTGTCA-3′ (shown in SEQ ID No. 30, the underlined sequence is the homology arm sequence of the pGRB vector).

[0256] (2) Primer sgRNA-2F and primer sgRNA-2R were annealed (reaction procedure: denaturation at 95°C for 5 minutes, annealing at 50°C for 1 minute), and then the target fragment was recovered using a DNA purification kit, its DNA concentration was determined, and the concentration was diluted to 100 ng / μL to obtain an annealing product. The annealing product contained the sgRNA-2 fragment with the nucleotide sequence shown in SEQ ID No. 4.

[0257] (3) The pGRB vector was digested with the restriction endonuclease SpeI, and a DNA fragment of approximately 2700 bp was recovered using a QIAGEN Gel Extraction Kit.

[0258] The enzyme digestion system is 50 μL, consisting of 5 μL 10× Buffer (provided with restriction endonuclease SpeI), 2.5 μL restriction endonuclease SpeI, 3000-5000 ng pGRB vector and ddH2O.

[0259] Enzyme digestion procedure: 37°C for 3 h.

[0260] (4) The DNA fragment recovered in step (3) was subjected to a dephosphorylation reaction (to prevent the pGRB vector from self-ligating), and recovered using a DNA recovery kit to obtain a linearized pGRB vector.

[0261] The dephosphorylation system is 50 μL, consisting of 5 μL 10× Buffer (provided by CIAP), 1000-2000 ng of DNA fragments recovered in step (3), 2.5 μL CIAP and ddH2O.

[0262] Dephosphorylation procedure: 37°C for 1 h.

[0263] (5) The linearized pGRB vector obtained in step (4) and the annealing product obtained in step (2) were recombined using the Gibson Assembly kit, and then transformed into Escherichia coli DH5α competent cells to obtain the pGRB-adhE sgRNA plasmid.

[0264] The recombinant system was 5 μL, consisting of 2 μL of linearized pGRB vector, 0.5 μL of annealed product, and 2.5 μL of assembly enzyme (provided by the Gibson Assembly kit).

[0265] Recombination procedure: 50°C for 30 min.

[0266] 2. Obtaining the ΔadhE-Up-Down Fragment

[0267] (1) Based on the Escherichia coli W3110 genome sequence published by NCBI, a primer pair for amplifying the upstream homology arm and a primer pair for amplifying the downstream homology arm were designed and synthesized by Invitrogen.

[0268] The primer pair used to amplify the upstream homology arm consists of primer P5:

[0269] 5'-GTGCCAGTCATCCTTCAGGT-3' (SEQ ID No. 31) and primer P6:

[0270] Composed of 5'-CGTTCCGACCACTAACCCGACTTGGGTATTCCGAAATCTATCC-3' (SEQ ID No. 32).

[0271] The primer pair used to amplify the downstream homology arms consists of primer P7:

[0272] 5'-GGATAGATTTCGGAATACCCAAGTCGGGTTAGTGGTCGGAACG-3' (SEQ ID No. 33) and primer P8: 5'-AAGCGATGCTGAAAGGTGTC-3' (SEQ ID No. 34).

[0273] (2) Using the genomic DNA of Escherichia coli W3110 as a template, a primer pair consisting of primer P5 and primer P6 was used for PCR amplification using the high-fidelity amplification enzyme KAPA HiFi HotStart, and a DNA recovery kit was used to recover the upstream homology arm of 765 bp in size.

[0274] (3) Using the genomic DNA of Escherichia coli W3110 as a template, a primer pair consisting of primer P7 and primer P8 was used for PCR amplification using the high-fidelity amplification enzyme KAPA HiFi HotStart, and a downstream homology arm of 643 bp was recovered using a DNA recovery kit.

[0275] (4) The upstream homology arm recovered in step (2) and the downstream homology arm recovered in step (3) were mixed and used as templates, and overlap PCR was performed using a primer pair consisting of primer P5 and primer P8 to obtain the ΔadhE-Up-Down fragment shown in SEQ ID No. 5.

[0276] SEQ ID No.5:ΔadhE-Up-Down(1365bp)

[0277] 3. Acquisition of YPVal-pflB01-Cas9 strain

[0278] (1) The plasmid pREDCas9 was transformed into the competent cells of the engineered bacteria YPVal-pflB01, and then spread on 2-YT agar plates containing 100 mg / L spectinomycin and cultured at 32°C to obtain single colonies resistant to spectinomycin.

[0279] (2) Using the single colonies obtained in step (1) as templates, PCR amplification was performed using a primer pair consisting of primers pRedCas9-PF and primers pRedCas9-PR to obtain PCR amplification products. If the PCR amplification product obtained from a single colony contains a DNA fragment with a nucleotide sequence as shown in SEQ ID No. 3, then the colony contains the plasmid pREDCas9. The strain of the colony was named YPVal-pflB01-Cas9 strain.

[0280] 4. Obtaining the engineered bacteria YPVal-pflB02

[0281] (1) Cultivate the YPVal-pflB01-Cas9 strain; when the YPVal-pflB01-Cas9 strain grows to OD 600nm When the OD value was 0.1, IPTG was added to make the concentration of IPTG in the system 0.1 mM, and the culture was continued to induce λ-Red-mediated homologous recombination; when the YPVal-pflB01-Cas9 strain grew to OD 600nm When the p-value was 0.6, the bacteria were collected and competent cells of the YPVal-pflB01-Cas9 strain were prepared.

[0282] (2) The pGRB-adhE sgRNA plasmid obtained in step 1 and the ΔadhE-Up-Down fragment obtained in step 2 were transformed into the competent cells of the YPVal-pflB01-Cas9 strain, spread on a 2-YT agar plate containing 100 mg / L spectinomycin and 100 mg / L ampicillin, and cultured at 32°C to obtain single colonies.

[0283] (3) Using the single colonies obtained in step (2) as templates, PCR amplification was performed using a primer pair consisting of primers P5 and P8 to obtain PCR amplification products. If the PCR amplification product obtained from a single colony contains a DNA fragment of 1365 bp, the colony is preliminarily identified as a positive transformant.

[0284] (4) The positive transformants obtained in step (3) were inoculated on 2-YT agar plates containing 100 mg / L spectinomycin and 0.2% (m / v) arabinose and cultured at 32°C (for eliminating the pGRB-adhE sgRNA plasmid); then, colonies that grew on 2-YT agar plates containing 100 mg / L spectinomycin but did not grow on 2-YT agar plates containing 100 mg / L ampicillin were selected, and these colonies were transferred to 2-YT agar plates and cultured at 42°C (for eliminating the plasmid pREDCas9); finally, colonies that did not grow on 2-YT agar plates containing 100 mg / L spectinomycin but grew on 2-YT agar plates without antibiotics were selected.

[0285] (5) Using the single colony obtained in step (4) as a template, PCR amplification was performed using a primer pair consisting of primers P5 and P8 to obtain a PCR amplification product. If the PCR amplification product obtained from a single colony contains a DNA fragment of 1365 bp, the colony is identified as a positive transformant lacking the adhE gene in the genome of the engineered strain YPVal-pflB01. The positive transformant is named engineered strain YPVal-pflB02.

[0286] 3. Obtaining the engineered bacteria YPVal-pflB03

[0287] Based on the genome sequences of Escherichia coli W3110 and Bacillus subtilis subsp. subtilis str. 168 published by NCBI, CRISPR / Cas9 gene editing technology was used to knock out the ilvE(E) gene from the engineered strain YPVal-pflB02 genome obtained in step 2 and simultaneously insert the Bacillus subtilis ilvE gene driven by the ptrc promoter (i.e., the ptrc-ilvE(B) sequence), resulting in the engineered strain YPVal-pflB03, hereinafter referred to as YPVal-pflB03. The nucleotide sequence of the ptrc-ilvE(B) sequence is shown in SEQ ID No. 6. In SEQ ID No. 6, from the 5' end, positions 1096-1169 represent the nucleotide sequence of the ptrc promoter, and positions 1-1095 represent the Bacillus subtilis ilvE(B) gene.

[0288] SEQ ID No.6:

[0289] The ilvE (E) gene of the engineered bacterium YPVal-pflB02 encodes branched-chain amino acid transaminase, its Gene ID is 948278, and the amino acid sequence is shown in SEQ ID No.15.

[0290] SEQ ID NO.15 (branched chain amino acid transaminase ilvE)

[0291] The ilvE(B) gene of Bacillus subtilis encodes branched-chain amino acid transaminase, its Gene ID is 938420, and the amino acid sequence is shown in SEQ ID No.16.

[0292] SEQ ID NO.16 (branched chain amino acid transaminase ilvE)

[0293] The specific steps are as follows:

[0294] 1. Construction of pGRB-ilvE sgRNA plasmid

[0295] (1) Primer sgRNA-3F was synthesized by Invitrogen:

[0296] 5'-TGACAGCTAGCTCAGTCCTAGGTATAATACTAGTgaaagcagcgataatcacgtcggGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGG-3' (shown in SEQ ID No. 35, the underlined sequence is the homology arm sequence of the pGRB vector) and primer sgRNA-3R:

[0297] 5'-CCTTATTTTAACTTGCTATTTCTAGCTCTAAAACccgacgtgattatcgctgctttcACTAGTATTATACCTAGGACTGAGCTAGCTGTCA-3' (shown in SEQ ID No. 36, the underlined sequence is the homology arm sequence of the pGRB vector).

[0298] (2) Primers sgRNA-3F and sgRNA-3R were annealed (reaction procedure: denaturation at 95°C for 5 min, annealing at 50°C for 1 min), and then the target fragment was recovered using a DNA purification kit. The DNA concentration was determined and diluted to 100 ng / μL to obtain an annealed product. The annealed product contained the sgRNA-3 fragment with the nucleotide sequence: GAAAGCAGCGATAATCACGTCGG (as shown in SEQ ID No. 7).

[0299] (3) The pGRB vector (product of Addgene, catalog number 71539) was digested with the restriction endonuclease SpeI (product of Takara, catalog number 1631), and a DNA fragment of approximately 2700 bp was recovered using a DNA recovery kit (QIAGEN Gel Extraction Kit).

[0300] The enzyme digestion system is 50 μL, consisting of 5 μL 10× Buffer (provided with restriction endonuclease SpeI), 2.5 μL restriction endonuclease SpeI, 3000-5000 ng pGRB vector and ddH2O.

[0301] Enzyme digestion procedure: 37°C for 3 h.

[0302] (4) The DNA fragment recovered in step (3) was subjected to a dephosphorylation reaction (to prevent the pGRB vector from self-ligating), and recovered using a DNA recovery kit to obtain a linearized pGRB vector.

[0303] The dephosphorylation system is 50 μL, consisting of 5 μL 10× Buffer (provided by CIAP), 1000-2000 ng of DNA fragments recovered in step (3), 2.5 μL CIAP (product of Takara, catalog number 2250A) and ddH2O.

[0304] Dephosphorylation procedure: 37°C for 1 h.

[0305] (5) The linearized pGRB vector obtained in step (4) and the annealed product obtained in step (2) were recombined using the Gibson Assembly kit (New England), and then transformed into Escherichia coli DH5α competent cells (TAKARA) to obtain the pGRB-ilvE sgRNA plasmid.

[0306] The recombinant system was 5 μL, consisting of 2 μL of linearized pGRB vector, 0.5 μL of annealed product, and 2.5 μL of assembly enzyme (provided by the Gibson Assembly kit).

[0307] Recombination procedure: 50°C for 30 min.

[0308] 2. Obtaining the ptrc-ilvE(B)-Up-Down segment

[0309] (1) Based on the Escherichia coli W3110 genome sequence published by NCBI, a primer pair for amplifying the upstream homology arm and a primer pair for amplifying the downstream homology arm were designed and synthesized by Invitrogen. Based on the Bacillus subtilis subsp. subtilis str. 168 genome sequence published by NCBI, a primer pair for amplifying ptrc-ilvE(B) was designed and synthesized by Invitrogen.

[0310] The primer pair used to amplify the upstream homology arm consists of primer P9:

[0311] 5'-CAGGCAGTTCATTGAGTTAGCG-3' (SEQ ID No. 37) and primer P10:

[0312] Composed of 5'-CACAGTGTATTAAGCAGACGTTAAATACAAAAAATGGGACGGCAC-3' (SEQ ID No. 38).

[0313] The primer pair used to amplify the downstream homology arms consists of primer P13:

[0314] 5'-GTTATCCGCTCACAATTCCACACATTATACGAGCCGGATGATTAATTGTCAATTTTATATTCCTTTTGCGCTC-3' (shown in SEQ ID No. 39, the underlined portion is the sequence of the ptrc promoter) and primer P14: 5'-ACGGTTAGGGATGGTTCGAC-3' (SEQ ID No. 40).

[0315] The primer pair used to amplify ptrc-ilvE(B) consisted of primer P11:

[0316] 5'-GTGCCGTCCCATTTTTTGTATTTAACGTCTGCTTAATACACTGTG-3' (SEQ ID No. 41) and primer P12:

[0317] 5'-GTATAATGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGACCATGGAACTTTTTAAATATATGGAG-3' (shown in SEQ ID No. 42, the underlined portion is the sequence of the ptrc promoter).

[0318] (2) Using the genomic DNA of Escherichia coli W3110 as a template, a primer pair consisting of primer P9 and primer P10 was used for PCR amplification using the high-fidelity amplification enzyme KAPA HiFi HotStart, and a DNA recovery kit was used to recover the upstream homology arm of 709 bp in size.

[0319] (3) Using the genomic DNA of Escherichia coli W3110 as a template, a primer pair consisting of primer P13 and primer P14 was used for PCR amplification using the high-fidelity amplification enzyme KAPA HiFi HotStart, and a downstream homology arm of 611 bp in size was recovered using a DNA recovery kit.

[0320] (4) Using the genomic DNA of Bacillus subtilis subsp. subtilis str.168 as a template, PCR amplification was performed using a primer pair consisting of primers P11 and P12 using the high-fidelity amplification enzyme KAPA HiFi HotStart, and a DNA recovery kit was used to recover the ilvE(B) fragment with a size of 1168 bp.

[0321] (5) The upstream homology arm recovered in step (2), the downstream homology arm recovered in step (3), and the ilvE(B) fragment recovered in step (4) were mixed and used as templates. Overlap PCR was performed using a primer pair consisting of primer P9 and primer P14 to obtain the ptrc-ilvE(B)-Up-Down fragment shown in SEQ ID No. 8.

[0322] SEQ ID No.8:ptrc-ilvE(B)-Up-Down(2413bp)

[0323] 3. Acquisition of YPVal-pflB02-Cas9 strain

[0324] (1) The plasmid pREDCas9 was transformed into the competent cells of the engineered bacteria YPVal-pflB02, and then spread on 2-YT agar plates containing 100 mg / L spectinomycin and cultured at 32°C to obtain single colonies resistant to spectinomycin.

[0325] (2) Using the single colonies obtained in step (1) as templates, PCR amplification was performed using a primer pair consisting of primers pRedCas9-PF and primers pRedCas9-PR to obtain PCR amplification products. If the PCR amplification product obtained from a single colony contains a DNA fragment with a nucleotide sequence as shown in SEQ ID No. 3, then the colony contains plasmid pREDCas9. The strain of the colony was named YPVal-pflB02-Cas9 strain.

[0326] 4. Obtaining the engineered bacteria YPVal-pflB03

[0327] (1) Cultivate the YPVal-pflB02-Cas9 strain; when the YPVal-pflB02-Cas9 strain grows to OD 600nm When the OD value was 0.1, IPTG was added to make the concentration of IPTG in the system 0.1 mM, and the culture was continued to induce λ-Red-mediated homologous recombination; when the YPVal-pflB02-Cas9 strain grew to OD 600nm When the p-value was 0.6, the bacteria were collected and competent cells of the YPVal-pflB02-Cas9 strain were prepared.

[0328] (2) The pGRB-ilvE sgRNA plasmid obtained in step 1 and the ptrc-ilvE(B)-Up-Down fragment obtained in step 2 were transformed into the competent cells of the YPVal-pflB02-Cas9 strain, spread on a 2-YT agar plate containing 100 mg / L spectinomycin and 100 mg / L ampicillin, and cultured at 32°C to obtain single colonies.

[0329] (3) Using the single colonies obtained in step (2) as templates, PCR amplification was performed using a primer pair consisting of primers P11 and P12 to obtain PCR amplification products. If the PCR amplification product obtained from a single colony contains a DNA fragment of 1168 bp, the colony is preliminarily identified as a positive transformant.

[0330] (4) The positive transformants obtained in step (3) were inoculated on 2-YT agar plates containing 100 mg / L spectinomycin and 0.2% (m / v) arabinose and cultured at 32°C (for eliminating the pGRB-ilvE sgRNA plasmid); then, colonies that grew on 2-YT agar plates containing 100 mg / L spectinomycin but did not grow on 2-YT agar plates containing 100 mg / L ampicillin were selected, and these colonies were transferred to 2-YT agar plates and cultured at 42°C (for eliminating the plasmid pREDCas9); finally, colonies that did not grow on 2-YT agar plates containing 100 mg / L spectinomycin but grew on 2-YT agar plates without antibiotics were selected.

[0331] (5) Using the single colony obtained in step (4) as a template, PCR amplification is performed using a primer pair consisting of primers P11 and P12 to obtain a PCR amplification product. If the PCR amplification product obtained from a single colony contains a DNA fragment of 1168 bp in size, the colony is identified as a positive transformant. The positive transformant is a knockout of the ilvE (E) gene of the engineered bacterium YPVal-pflB02 genome and a knockout of the ilvE (B) gene of Bacillus subtilis driven by the ptrc promoter (i.e., the ptrc-ilvE (B) sequence). The positive transformant is named the engineered bacterium YPVal-pflB03.

[0332] IV. Obtaining the Engineered Bacteria YPVal-pflB04

[0333] Using the engineered bacteria YPVal-pflB03 as the starting bacteria, the thiE gene in the genome of the engineered bacteria YPVal-pflB03 was knocked out using CRISPR / Cas9 gene editing technology based on the Escherichia coli W3110 genome sequence published by NCBI.

[0334] The thiE gene encodes thiamine phosphate synthase, its Gene ID is 948491, and the amino acid sequence is shown in SEQ ID No.17.

[0335] SEQ ID NO.17 (thiamine phosphate synthase thiE)

[0336] The specific steps are as follows:

[0337] 1. Construction of pGRB-thiE sgRNA plasmid

[0338] Based on the Escherichia coli W3110 genome sequence published by NCBI, the sgRNA target sequence for knocking out the thiE gene was designed using CRISPR RGEN Tools (http: / / www.rgenome.net / cas-designer / ): CGCCCCTCTTATATCGCGCTGGG (SEQ ID No. 9). Linearized pGRB vector homology arm sequences were added to the 5' and 3' ends of the target sequence to construct the sgRNA plasmid.

[0339] (1) Primer sgRNA-4F was synthesized by Invitrogen:

[0340] 5'-TGACAGCTAGCTCAGTCCTAGGTATAATACTAGTcgcccctcttatatcgcgctgggGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGG-3' (shown in SEQ ID No. 43, the underlined sequence is the homology arm sequence of the pGRB vector) and primer sgRNA-4R:

[0341] 5′-CCTTATTTTAACTTGCTATTTCTAGCTCTAAAACcccagcgcgatataagaggggcgACTAGTATTATACCTAGGACTGAGCTAGCTGTCA-3′ (shown in SEQ ID No. 44, the underlined sequence is the homology arm sequence of the pGRB vector).

[0342] (2) Primer sgRNA-4F and primer sgRNA-4R were annealed (reaction procedure: denaturation at 95°C for 5 minutes, annealing at 50°C for 1 minute), and then the target fragment was recovered using a DNA purification kit, its DNA concentration was determined, and the concentration was diluted to 100 ng / μL to obtain an annealing product. The annealing product contained the sgRNA-4 fragment with the nucleotide sequence shown in SEQ ID No. 9.

[0343] (3) The pGRB vector was digested with the restriction endonuclease SpeI, and a DNA fragment of approximately 2700 bp was recovered using a QIAGEN Gel Extraction Kit.

[0344] The enzyme digestion system is 50 μL, consisting of 5 μL 10× Buffer (provided with restriction endonuclease SpeI), 2.5 μL restriction endonuclease SpeI, 3000-5000 ng pGRB vector and ddH2O.

[0345] Enzyme digestion procedure: 37°C for 3 h.

[0346] (4) The DNA fragment recovered in step (3) was subjected to a dephosphorylation reaction (to prevent the pGRB vector from self-ligating), and recovered using a DNA recovery kit to obtain a linearized pGRB vector.

[0347] The dephosphorylation system is 50 μL, consisting of 5 μL 10× Buffer (provided by CIAP), 1000-2000 ng of DNA fragments recovered in step (3), 2.5 μL CIAP and ddH2O.

[0348] Dephosphorylation procedure: 37°C for 1 h.

[0349] (5) The linearized pGRB vector obtained in step (4) and the annealing product obtained in step (2) were recombined using the Gibson Assembly kit, and then transformed into Escherichia coli DH5α competent cells to obtain the pGRB-thiE sgRNA plasmid.

[0350] The recombinant system was 5 μL, consisting of 2 μL of linearized pGRB vector, 0.5 μL of annealed product, and 2.5 μL of assembly enzyme (provided by the Gibson Assembly kit).

[0351] Recombination procedure: 50°C for 30 min.

[0352] 2. Obtaining the ΔthiE-Up-Down Fragment

[0353] (1) Based on the Escherichia coli W3110 genome sequence published by NCBI, a primer pair for amplifying the upstream homology arm and a primer pair for amplifying the downstream homology arm were designed and synthesized by Invitrogen.

[0354] The primer pair used to amplify the upstream homology arm consists of primer P15:

[0355] 5'-TTCTATTCAGGACGCCAACG-3' (SEQ ID No. 45) and primer P16:

[0356] Composed of 5'-GCTATAACGCATAAAGTCACGGCACGCTTCCTCCTTACGCAGG-3' (SEQ ID No. 46).

[0357] The primer pair used to amplify the downstream homology arms consists of primer P17:

[0358] 5'-CCTGCGTAAGGAGGAAGCGTGCCGTGACTTTATGCGTTATAGC-3' (SEQ ID No. 47) and primer P18: 5'-GCCTGCAAAGTGCCCATAACCC-3' (SEQ ID No. 48).

[0359] (2) Using the genomic DNA of Escherichia coli W3110 as a template, a primer pair consisting of primer P15 and primer P16 was used for PCR amplification using the high-fidelity amplification enzyme KAPA HiFi HotStart, and a DNA recovery kit was used to recover the upstream homology arm with a size of 721 bp.

[0360] (3) Using the genomic DNA of Escherichia coli W3110 as a template, a primer pair consisting of primer P17 and primer P18 was used for PCR amplification using the high-fidelity amplification enzyme KAPA HiFi HotStart, and a downstream homology arm of 618 bp was recovered using a DNA recovery kit.

[0361] (4) The upstream homology arm recovered in step (2) and the downstream homology arm recovered in step (3) were mixed and used as templates, and overlap PCR was performed using a primer pair consisting of primer P15 and primer P18 to obtain the ΔthiE-Up-Down fragment shown in SEQ ID No. 10.

[0362] SEQ ID No.10:ΔthiE-Up-Down(1296bp)

[0363] 3. Acquisition of YPVal-pflB03-Cas9 strain

[0364] (1) The plasmid pREDCas9 was transformed into the competent cells of the engineered bacteria YPVal-pflB03, and then spread on 2-YT agar plates containing 100 mg / L spectinomycin and cultured at 32°C to obtain single colonies resistant to spectinomycin.

[0365] (2) Using the single colonies obtained in step (1) as templates, PCR amplification was performed using a primer pair consisting of primers pRedCas9-PF and primers pRedCas9-PR to obtain PCR amplification products. If the PCR amplification product obtained from a single colony contains a DNA fragment with a nucleotide sequence as shown in SEQ ID No. 3, then the colony contains the plasmid pREDCas9. The strain of the colony was named YPVal-pflB03-Cas9 strain.

[0366] 4. Obtaining the engineered bacteria YPVal-pflB04

[0367] (1) Cultivate the YPVal-pflB03-Cas9 strain; when the YPVal-pflB03-Cas9 strain grows to OD 600nm When the OD value was 0.1, IPTG was added to make the concentration of IPTG in the system 0.1 mM, and the culture was continued to induce λ-Red-mediated homologous recombination; when the YPVal-pflB03-Cas9 strain grew to OD 600nm When the p-value was 0.6, the bacteria were collected and competent cells of the YPVal-pflB03-Cas9 strain were prepared.

[0368] (2) The pGRB-thiE sgRNA plasmid obtained in step 1 and the ΔthiE-Up-Down fragment obtained in step 2 were transformed into the competent cells of the YPVal-pflB03-Cas9 strain, spread on a 2-YT agar plate containing 100 mg / L spectinomycin and 100 mg / L ampicillin, and cultured at 32°C to obtain single colonies.

[0369] (3) Using the single colonies obtained in step (2) as templates, PCR amplification was performed using a primer pair consisting of primers P15 and P18 to obtain PCR amplification products. If the PCR amplification product obtained from a single colony contains a DNA fragment of 1296 bp, the colony is preliminarily identified as a positive transformant.

[0370] (4) The positive transformants obtained in step (3) were inoculated on 2-YT agar plates containing 100 mg / L spectinomycin and 0.2% (m / v) arabinose and cultured at 32°C (for eliminating the pGRB-thiE sgRNA plasmid); then, colonies that grew on 2-YT agar plates containing 100 mg / L spectinomycin but did not grow on 2-YT agar plates containing 100 mg / L ampicillin were selected, and these colonies were transferred to 2-YT agar plates and cultured at 42°C (for eliminating the plasmid pREDCas9); finally, colonies that did not grow on 2-YT agar plates containing 100 mg / L spectinomycin but grew on 2-YT agar plates without antibiotics were selected.

[0371] (5) Using the single colony obtained in step (4) as a template, PCR amplification was performed using a primer pair consisting of primers P15 and P18 to obtain a PCR amplification product. If the PCR amplification product obtained from a single colony contains a DNA fragment of 1296 bp, the colony is identified as a positive transformant of the engineered strain YPVal-pflB03 lacking the thiE gene in its genome. The positive transformant is designated as engineered strain YPVal-pflB04.

[0372] 5. Obtaining the Engineered Bacteria YPVal-pflB05

[0373] Using the engineered bacteria YPVal-pflB04 as the starting bacteria, the mdh gene in the genome of the engineered bacteria YPVal-pflB04 was knocked out using CRISPR / Cas9 gene editing technology based on the Escherichia coli W3110 genome sequence published by NCBI.

[0374] The mdh gene encodes malate dehydrogenase, its Gene ID is 947854, and the amino acid sequence is shown in SEQ ID No.18.

[0375] SEQ ID NO.18 (malate dehydrogenase mdh)

[0376] The specific steps are as follows:

[0377] 1. Construction of pGRB-mdh sgRNA plasmid

[0378] Based on the Escherichia coli W3110 genome sequence published by NCBI, the sgRNA target sequence for knocking out the mdh gene was designed using CRISPR RGEN Tools (http: / / www.rgenome.net / cas-designer / ): GCCTTTCAGTTCCGCAACAAAGG (shown in SEQ ID No. 11). Linearized pGRB vector homology arm sequences were added to the 5' and 3' ends of the target sequence to construct the sgRNA plasmid.

[0379] (1) Primer sgRNA-5F was synthesized by Invitrogen:

[0380] 5'-TGACAGCTAGCTCAGTCCTAGGTATAATACTAGTgcctttcagttccgcaacaaaggGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGG-3' (shown in SEQ ID No. 49, the underlined sequence is the homology arm sequence of the pGRB vector) and primer sgRNA-5R:

[0381] 5′-CCTTATTTTAACTTGCTATTTCTAGCTCTAAAACcctttgttgcggaactgaaaggcACTAGTATTATACCTAGGACTGAGCTAGCTGTCA-3′ (shown in SEQ ID No. 50, the underlined sequence is the homology arm sequence of the pGRB vector).

[0382] (2) Primer sgRNA-5F and primer sgRNA-5R were annealed (reaction procedure: denaturation at 95°C for 5 minutes, annealing at 50°C for 1 minute), and then the target fragment was recovered using a DNA purification kit, its DNA concentration was determined, and the concentration was diluted to 100 ng / μL to obtain an annealing product. The annealing product contained the sgRNA-5 fragment with the nucleotide sequence shown in SEQ ID No. 11.

[0383] (3) The pGRB vector was digested with the restriction endonuclease SpeI, and a DNA fragment of approximately 2700 bp was recovered using a QIAGEN Gel Extraction Kit.

[0384] The enzyme digestion system is 50 μL, consisting of 5 μL 10× Buffer (provided with restriction endonuclease SpeI), 2.5 μL restriction endonuclease SpeI, 3000-5000 ng pGRB vector and ddH2O.

[0385] Enzyme digestion procedure: 37°C for 3 h.

[0386] (4) The DNA fragment recovered in step (3) was subjected to a dephosphorylation reaction (to prevent the pGRB vector from self-ligating), and recovered using a DNA recovery kit to obtain a linearized pGRB vector.

[0387] The dephosphorylation system is 50 μL, consisting of 5 μL 10× Buffer (provided by CIAP), 1000-2000 ng of DNA fragments recovered in step (3), 2.5 μL CIAP and ddH2O.

[0388] Dephosphorylation procedure: 37°C for 1 h.

[0389] (5) The linearized pGRB vector obtained in step (4) and the annealing product obtained in step (2) were recombined using the Gibson Assembly kit, and then transformed into Escherichia coli DH5α competent cells to obtain the pGRB-mdh sgRNA plasmid.

[0390] The recombinant system was 5 μL, consisting of 2 μL of linearized pGRB vector, 0.5 μL of annealed product, and 2.5 μL of assembly enzyme (provided by the Gibson Assembly kit).

[0391] Recombination procedure: 50°C for 30 min.

[0392] 2. Obtaining the Δmdh-Up-Down Fragment

[0393] (1) Based on the Escherichia coli W3110 genome sequence published by NCBI, a primer pair for amplifying the upstream homology arm and a primer pair for amplifying the downstream homology arm were designed and synthesized by Invitrogen.

[0394] The primer pair used to amplify the upstream homology arm consists of primer P19:

[0395] 5'-AACTTCCTCCAAACCGATGC-3' (SEQ ID No. 51) and primer P20:

[0396] Composed of 5'-CAATATAATAAGGAGTTTAGGTTGATTAGCGGATAATAAAAAACC-3' (SEQ ID No. 52).

[0397] The primer pair used to amplify the downstream homology arms consists of primer P21:

[0398] 5'-GGTTTTTTATTATCCGCTAATCAACCTAAACTCCTTATTATATTG-3' (SEQ ID No. 53) and primer P22: 5'-TCTTCAATGGACTGGAGGTG-3' (SEQ ID No. 54).

[0399] (2) Using the genomic DNA of Escherichia coli W3110 as a template, a primer pair consisting of primer P19 and primer P20 was used for PCR amplification using the high-fidelity amplification enzyme KAPA HiFi HotStart, and a DNA recovery kit was used to recover the upstream homology arm of 590 bp in size.

[0400] (3) Using the genomic DNA of Escherichia coli W3110 as a template, a primer pair consisting of primer P21 and primer P22 was used for PCR amplification using the high-fidelity amplification enzyme KAPA HiFi HotStart, and a downstream homology arm of 708 bp in size was recovered using a DNA recovery kit.

[0401] (4) The upstream homology arm recovered in step (2) and the downstream homology arm recovered in step (3) were mixed and used as templates, and overlap PCR was performed using a primer pair consisting of primer P19 and primer P22 to obtain the Δmdh-Up-Down fragment shown in SEQ ID No. 12.

[0402] SEQ ID No.12:Δmdh-Up-Down(1253bp)

[0403] 3. Acquisition of YPVal-pflB04-Cas9 strain

[0404] (1) The plasmid pREDCas9 was transformed into the competent cells of the engineered bacteria YPVal-pflB04, and then spread on 2-YT agar plates containing 100 mg / L spectinomycin and cultured at 32°C to obtain single colonies resistant to spectinomycin.

[0405] (2) Using the single colonies obtained in step (1) as templates, PCR amplification was performed using a primer pair consisting of primers pRedCas9-PF and primers pRedCas9-PR to obtain PCR amplification products. If the PCR amplification product obtained from a single colony contains a DNA fragment with a nucleotide sequence as shown in SEQ ID No. 3, then the colony contains the plasmid pREDCas9. The strain of the colony was named YPVal-pflB04-Cas9 strain.

[0406] 4. Obtaining the engineered bacteria YPVal-pflB05

[0407] (1) Cultivate the YPVal-pflB04-Cas9 strain; when the YPVal-pflB04-Cas9 strain grows to OD 600nm When the OD value was 0.1, IPTG was added to make the concentration of IPTG in the system 0.1 mM, and the culture was continued to induce λ-Red-mediated homologous recombination; when the YPVal-pflB04-Cas9 strain grew to OD 600nm When the p-value was 0.6, the bacteria were collected and competent cells of the YPVal-pflB04-Cas9 strain were prepared.

[0408] (2) The pGRB-mdh sgRNA plasmid obtained in step 1 and the Δmdh-Up-Down fragment obtained in step 2 were transformed into the competent cells of the YPVal-pflB04-Cas9 strain, spread on a 2-YT agar plate containing 100 mg / L spectinomycin and 100 mg / L ampicillin, and cultured at 32°C to obtain single colonies.

[0409] (3) Using the single colonies obtained in step (2) as templates, PCR amplification was performed using a primer pair consisting of primers P19 and P22 to obtain PCR amplification products. If the PCR amplification product obtained from a single colony contains a DNA fragment of 1253 bp, the colony is preliminarily identified as a positive transformant.

[0410] (4) The positive transformants obtained in step (3) were inoculated on 2-YT agar plates containing 100 mg / L spectinomycin and 0.2% (m / v) arabinose and cultured at 32°C (for eliminating the pGRB-thiE sgRNA plasmid); then, colonies that grew on 2-YT agar plates containing 100 mg / L spectinomycin but did not grow on 2-YT agar plates containing 100 mg / L ampicillin were selected, and these colonies were transferred to 2-YT agar plates and cultured at 42°C (for eliminating the plasmid pREDCas9); finally, colonies that did not grow on 2-YT agar plates containing 100 mg / L spectinomycin but grew on 2-YT agar plates without antibiotics were selected.

[0411] (5) Using the single colony obtained in step (4) as a template, PCR amplification was performed using a primer pair consisting of primers P19 and P22 to obtain a PCR amplification product. If the PCR amplification product obtained from a single colony contains a DNA fragment of 1253 bp, the colony is identified as a positive transformant lacking the mdh gene in the genome of the engineered strain YPVal-pflB04. The positive transformant is designated as the engineered strain YPVal-pflB05.

[0412] Example 2: Transformation of an engineered bacterium based on Escherichia coli W3110

[0413] After extensive experiments, the inventors of the present invention modified Escherichia coli W3110 to obtain engineered strains YPVal-pflB06, YPVal-pflB07, YPVal-pflB08, YPVal-pflB09, and YPVal-pflB10. The genotypes of the engineered strains YPVal-pflB06, YPVal-pflB07, YPVal-pflB08, YPVal-pflB09, and YPVal-pflB10 are shown in Table 2.

[0414] Table 2

[0415] 1. Obtaining the engineered strain YPVal-pflB06

[0416] 1. Construction of pGRB-pflB sgRNA plasmid

[0417] Same as step 1 in Example 1.

[0418] 2. Obtaining the ΔpflB-Up-Down fragment

[0419] Same as step 2 in Example 1.

[0420] 3. Acquisition of W3110-Cas9 strain

[0421] According to step 3 in step 1 of Example 1, the valine-producing bacteria CGMCC 22721 competent cells were replaced with Escherichia coli W3110 competent cells, and the other steps remained unchanged to obtain the W3110-Cas9 strain.

[0422] 4. Obtaining the engineered bacteria YPVal-pflB06

[0423] According to step 4 in step 1 of Example 1, the CGMCC 22721-Cas9 strain was replaced with the W3110-Cas9 strain, and the other steps remained unchanged to obtain the engineered bacteria YPVal-pflB06.

[0424] 2. Obtaining the engineered strain YPVal-pflB07

[0425] 1. Construction of pGRB-adhE sgRNA plasmid

[0426] Same as step 1 in step 2 of Example 1.

[0427] 2. Obtaining the ΔadhE-Up-Down Fragment

[0428] Same as step 2 in Example 1.

[0429] 3. Acquisition of YPVal-pflB06-Cas9 strain

[0430] According to step 3 in step 2 of Example 1, the engineered bacteria YPVal-pflB01 competent cells were replaced with engineered bacteria YPVal-pflB06 competent cells, and the other steps remained unchanged to obtain the YPVal-pflB06-Cas9 strain.

[0431] 4. Obtaining the engineered bacteria YPVal-pflB07

[0432] According to step 4 in step 2 of Example 1, the YPVal-pflB01-Cas9 strain was replaced with the YPVal-pflB06-Cas9 strain, and the other steps remained unchanged to obtain the engineered bacteria YPVal-pflB07.

[0433] 3. Obtaining the engineered bacteria YPVal-pflB08

[0434] 1. Construction of pGRB-ilvE sgRNA plasmid

[0435] Same as step 1 in step 3 of Example 1.

[0436] 2. Obtaining the ptrc-ilvE(B)-Up-Down segment

[0437] Same as step 2 in step 3 of Example 1.

[0438] 3. Acquisition of YPVal-pflB07-Cas9 strain

[0439] According to step 3 in step 3 of Example 1, the engineered bacteria YPVal-pflB02 competent cells were replaced with the engineered bacteria YPVal-pflB07 competent cells, and the other steps remained unchanged to obtain the YPVal-pflB07-Cas9 strain.

[0440] 4. Obtaining the engineered bacteria YPVal-pflB08

[0441] According to step 4 in step 3 of Example 1, the YPVal-pflB02-Cas9 strain was replaced with the YPVal-pflB07-Cas9 strain, and the other steps remained unchanged to obtain the engineered bacteria YPVal-pflB08.

[0442] IV. Obtaining the Engineered Bacteria YPVal-pflB09

[0443] 1. Construction of pGRB-thiE sgRNA plasmid

[0444] Same as step 1 in step 4 of Example 1.

[0445] 2. Obtaining the ΔthiE-Up-Down Fragment

[0446] Same as step 2 in step 4 of Example 1.

[0447] 3. Acquisition of YPVal-pflB08-Cas9 strain

[0448] According to step 3 in step 4 of Example 1, the engineered bacteria YPVal-pflB03 competent cells were replaced with engineered bacteria YPVal-pflB08 competent cells, and the other steps remained unchanged to obtain the YPVal-pflB08-Cas9 strain.

[0449] 4. Obtaining the engineered bacteria YPVal-pflB09

[0450] According to step 4 in step 4 of Example 1, the YPVal-pflB03-Cas9 strain was replaced with the YPVal-pflB08-Cas9 strain, and the other steps remained unchanged to obtain the engineered bacteria YPVal-pflB09.

[0451] 5. Obtaining the Engineered Bacteria YPVal-pflB10

[0452] 1. Construction of pGRB-mdh sgRNA plasmid

[0453] Same as step 1 in step 5 of Example 1.

[0454] 2. Obtaining the Δmdh-Up-Down Fragment

[0455] Same as step 2 in step 5 of Example 1.

[0456] 3. Acquisition of YPVal-pflB09-Cas9 strain

[0457] According to step 3 in step 5 of Example 1, the engineered bacteria YPVal-pflB04 competent cells were replaced with engineered bacteria YPVal-pflB09 competent cells, and the other steps remained unchanged to obtain the YPVal-pflB09-Cas9 strain.

[0458] 4. Obtaining the engineered bacteria YPVal-pflB10

[0459] According to step 4 in step 5 of Example 1, the YPVal-pflB04-Cas9 strain was replaced with the YPVal-pflB09-Cas9 strain, and the other steps remained unchanged to obtain the engineered bacteria YPVal-pflB10.

[0460] Example 3: Fermentation production of L-valine using the engineered bacteria obtained from Examples 1 and 2

[0461] 1. The engineered bacteria YPVal-pflB01, YPVal-pflB02, YPVal-pflB03, YPVal-pflB04, YPVal-pflB05, YPVal-pflB06, YPVal-pflB07, YPVal-pflB08, YPVal-pflB09 and YPVal-pflB10 obtained by transformation in Example 1 and Example 2, as well as the starting bacteria valine-producing bacteria CGMCC 22721 and Escherichia coli W3110, were fermented in a fermenter (Shanghai Bailun Biotechnology Co., Ltd., model BLBIO-5GC-4-H) to obtain a fermentation broth.

[0462] Fermentation was repeated three times for each strain.

[0463] The composition of the fermentation medium used during fermentation is shown in Table 3.

[0464] The fermentation control process is shown in Table 4.

[0465] Table 3

[0466] Table 4

[0467] 2. Use high performance liquid chromatography to detect the L-valine production in the fermentation broth.

[0468] The test results of three fermentations using the valine-producing strain CGMCC 22721 and the engineered strains YPVal-pflB01, YPVal-pflB02, YPVal-pflB03, YPVal-pflB04, and YPVal-pflB05 derived from the valine-producing strain CGMCC 22721 are shown in Table 5 (P values ​​< 0.01 indicate extremely significant differences). The results showed that compared with the valine-producing strain CGMCC 22721, YPVal-pflB01, YPVal-pflB02, YPVal-pflB03, YPVal-pflB04, and YPVal-pflB05 significantly increased L-valine production. That is, in the valine-producing bacteria CGMCC 22721, the engineered bacteria obtained by "knocking out the pflB gene", "knocking out the pflB gene and the adhE gene", "knocking out the pflB gene and the adhE gene and knocking out the ilvE(E) gene and inserting the ptrc-driven ilvE(B) from Bacillus subtilis", "knocking out the pflB gene, the adhE gene and the thiE gene and knocking out the ilvE(E) gene and inserting the ptrc-driven ilvE(B) from Bacillus subtilis" or "knocking out the pflB gene, the adhE gene, the thiE gene and the mdh gene and knocking out the ilvE gene (E) and inserting the ptrc-driven ilvE(B) from Bacillus subtilis" can all increase the production of L-valine.

[0469] Table 5

[0470] The test results of three fermentations using E. coli W3110 and the engineered strains YPVal-pflB06, YPVal-pflB07, YPVal-pflB08, YPVal-pflB09, and YPVal-pflB10 derived from E. coli W3110 are shown in Table 6 (P values ​​< 0.01 indicate extremely significant differences). The results showed that compared with E. coli W3110, YPVal-pflB06, YPVal-pflB07, YPVal-pflB08, YPVal-pflB09, and YPVal-pflB10 significantly increased L-valine production. That is, in Escherichia coli W3110, the engineered bacteria obtained by "knocking out the pflB gene", "knocking out the pflB gene and the adhE gene", "knocking out the pflB gene and the adhE gene and knocking out the ilvE(E) gene and inserting the ptrc-driven ilvE(B) from Bacillus subtilis", "knocking out the pflB gene, the adhE gene and the thiE gene and knocking out the ilvE(E) gene and inserting the ptrc-driven ilvE(B) from Bacillus subtilis" or "knocking out the pflB gene, the adhE gene, the thiE gene and the mdh gene and knocking out the ilvE(E) gene and inserting the ptrc-driven ilvE(B) from Bacillus subtilis" can all increase the production of L-valine.

[0471] Table 6

[0472] Example 4: Transformation of the engineered bacteria based on the valine-producing strain CGMCC 22721

[0473] After extensive experiments, the inventors of the present invention modified the valine-producing strain CGMCC 22721 to obtain engineered strains YPVal-adhE01, YPVal-adhE02, YPVal-adhE03, and YPVal-adhE04. The genotypes of the engineered strains YPVal-adhE01, YPVal-adhE02, YPVal-adhE03, and YPVal-adhE04 are shown in Table 7.

[0474] Table 7

[0475] 1. Obtaining the engineered strain YPVal-adhE01

[0476] Based on the Escherichia coli W3110 genome sequence published by NCBI, the adhE gene in the genome of the valine-producing bacteria CGMCC 22721 was knocked out using CRISPR / Cas9 gene editing technology.

[0477] The adhE gene encodes alcohol dehydrogenase, its Gene ID is 945837, and its amino acid sequence is shown in SEQ ID No.14.

[0478] The specific steps are as follows:

[0479] 1. Construction of pGRB-adhE sgRNA plasmid

[0480] Based on the Escherichia coli W3110 genome sequence published by NCBI, the sgRNA target sequence for knocking out the adhE gene (shown in SEQ ID No. 4) was designed using CRISPR RGEN Tools (http: / / www.rgenome.net / cas-designer / ). Linearized pGRB vector homology arm sequences were added to the 5' and 3' ends of the target sequence to construct the sgRNA plasmid.

[0481] (1) Primer sgRNA-2F was synthesized by Invitrogen:

[0482] 5'-TGACAGCTAGCTCAGTCCTAGGTATAATACTAGTaagaaccacaacccagagtcaggGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGG-3' (shown in SEQ ID No. 29, the underline is the homology arm sequence of the pGRB vector), primer sgRNA-2R:

[0483] 5'-CCTTATTTTAACTTGCTATTTCTAGCTCTAAAACcctgactctgggttgtggttcttACTAGTATTATACCTAGGACTGAGCTAGCTGTCA-3' (shown in SEQ ID No.30, the underline is the homology arm sequence of the pGRB vector), primer sgRNA-PF:

[0484] 5'-GTCTCATGAGCGGATACATATTTG-3' (SEQ ID No. 21) and primer sgRNA-PR:

[0485] 5'-ATGAGAAAGCGCCACGCT-3' (SEQ ID No. 22).

[0486] (2) Primer sgRNA-2F and primer sgRNA-2R were annealed (reaction procedure: denaturation at 95°C for 5 minutes, annealing at 50°C for 1 minute), and then the target fragment was recovered using a DNA purification kit, its DNA concentration was determined, and the concentration was diluted to 100 ng / μL to obtain an annealing product. The annealing product contained the sgRNA-2 fragment with the nucleotide sequence shown in SEQ ID No. 4.

[0487] (3) The pGRB vector was digested with the restriction endonuclease SpeI, and a DNA fragment of approximately 2700 bp was recovered using a QIAGEN Gel Extraction Kit.

[0488] The enzyme digestion system is 50 μL, consisting of 5 μL 10× Buffer (provided with restriction endonuclease SpeI), 2.5 μL restriction endonuclease SpeI, 3000-5000 ng pGRB vector and ddH2O.

[0489] Enzyme digestion procedure: 37°C for 3 h.

[0490] (4) The DNA fragment recovered in step (3) was subjected to a dephosphorylation reaction (to prevent the pGRB vector from self-ligating), and recovered using a DNA recovery kit to obtain a linearized pGRB vector.

[0491] The dephosphorylation system is 50 μL, consisting of 5 μL 10× Buffer (provided by CIAP), 1000-2000 ng of DNA fragments recovered in step (3), 2.5 μL CIAP and ddH2O.

[0492] Dephosphorylation procedure: 37°C for 1 h.

[0493] (5) The linearized pGRB vector obtained in step (4) and the annealing product obtained in step (2) were recombined using the Gibson Assembly kit, and then transformed into Escherichia coli DH5α competent cells to obtain the pGRB-adhE sgRNA plasmid.

[0494] The recombinant system was 5 μL, consisting of 2 μL of linearized pGRB vector, 0.5 μL of annealed product, and 2.5 μL of assembly enzyme (provided by the Gibson Assembly kit).

[0495] Recombination procedure: 50°C for 30 min.

[0496] 2. Obtaining the ΔadhE-Up-Down Fragment

[0497] (1) Based on the Escherichia coli W3110 genome sequence published by NCBI, a primer pair for amplifying the upstream homology arm and a primer pair for amplifying the downstream homology arm were designed and synthesized by Invitrogen.

[0498] The primer pair used to amplify the upstream homology arm consists of primer P5:

[0499] 5'-GTGCCAGTCATCCTTCAGGT-3' (SEQ ID No. 31) and primer P6:

[0500] Composed of 5'-CGTTCCGACCACTAACCCGACTTGGGTATTCCGAAATCTATCC-3' (SEQ ID No. 32).

[0501] The primer pair used to amplify the downstream homology arms consists of primer P7:

[0502] 5'-GGATAGATTTCGGAATACCCAAGTCGGGTTAGTGGTCGGAACG-3' (SEQ ID No. 33) and primer P8: 5'-AAGCGATGCTGAAAGGTGTC-3' (SEQ ID No. 34).

[0503] (2) Using the genomic DNA of Escherichia coli W3110 as a template, a primer pair consisting of primer P5 and primer P6 was used for PCR amplification using the high-fidelity amplification enzyme KAPA HiFi HotStart, and a DNA recovery kit was used to recover the upstream homology arm of 765 bp in size.

[0504] (3) Using the genomic DNA of Escherichia coli W3110 as a template, a primer pair consisting of primer P7 and primer P8 was used for PCR amplification using the high-fidelity amplification enzyme KAPA HiFi HotStart, and a downstream homology arm of 643 bp was recovered using a DNA recovery kit.

[0505] (4) The upstream homology arm recovered in step (2) and the downstream homology arm recovered in step (3) were mixed and used as templates, and overlap PCR was performed using a primer pair consisting of primer P5 and primer P8 to obtain the ΔadhE-Up-Down fragment shown in SEQ ID No. 5.

[0506] 3. Acquisition of CGMCC 22721-Cas9 strain

[0507] (1) The plasmid pREDCas9 (Addgene, product catalog number 71541; containing the spectinomycin resistance gene) was transformed into valine-producing bacteria CGMCC 22721 competent cells, and then spread on 2-YT agar plates containing 100 mg / L spectinomycin and cultured at 32°C to obtain spectinomycin-resistant single colonies.

[0508] 2-YT agar plates were prepared as follows: 16 g of tryptone, 10 g of yeast extract powder, 5 g of sodium chloride, and 16 g of agar powder were dissolved in an appropriate amount of water, and the volume was made up to 1 L with water. The pH value was adjusted to 7.0 with sodium hydroxide, and the plates were sterilized at 121°C for 20 minutes.

[0509] (2) Using the single colonies obtained in step (1) as templates, PCR amplification was performed using a primer pair consisting of primer pRedCas9-PF: 5'-GCAGTGGCGGTTTTCATG-3' (SEQ ID No. 27) and primer pRedCas9-PR: 5'-CCTTGGTGATCTCGCCTTTC-3' (SEQ ID No. 28) to obtain PCR amplification products. If the PCR amplification product obtained from a single colony contains a DNA fragment with a nucleotide sequence as shown in SEQ ID No. 3, the colony contains plasmid pREDCas9. The strain of the colony was named CGMCC 22721-Cas9 strain.

[0510] 4. Obtaining the engineered bacteria YPVal-adhE01

[0511] (1) Cultivate CGMCC 22721-Cas9 strain; when CGMCC 22721-Cas9 strain grows to OD 600nm When the OD value was 0.1, IPTG was added to make the concentration of IPTG in the system 0.1 mM, and the culture was continued to induce λ-Red-mediated homologous recombination; when the CGMCC 22721-Cas9 strain grew to OD 600nm When the p-value was 0.6, the bacteria were collected and CGMCC 22721-Cas9 competent cells were prepared.

[0512] (2) The pGRB-adhE sgRNA plasmid obtained in step 1 and the ΔadhE-Up-Down fragment obtained in step 2 were transformed into CGMCC 22721-Cas9 competent cells, spread on 2-YT agar plates containing 100 mg / L spectinomycin and 100 mg / L ampicillin, and cultured at 32°C to obtain single colonies.

[0513] (3) Using the single colonies obtained in step (2) as templates, PCR amplification was performed using a primer pair consisting of primers P5 and P8 to obtain PCR amplification products. If the PCR amplification product obtained from a single colony contains a DNA fragment of 1365 bp, the colony is preliminarily identified as a positive transformant.

[0514] (4) The positive transformants obtained in step (3) were inoculated on 2-YT agar plates containing 100 mg / L spectinomycin and 0.2% (m / v) arabinose and cultured at 32°C (for eliminating the pGRB-adhE sgRNA plasmid); then, colonies that grew on 2-YT agar plates containing 100 mg / L spectinomycin but did not grow on 2-YT agar plates containing 100 mg / L ampicillin were selected, and these colonies were transferred to 2-YT agar plates and cultured at 42°C (for eliminating the plasmid pREDCas9); finally, colonies that did not grow on 2-YT agar plates containing 100 mg / L spectinomycin but grew on 2-YT agar plates without antibiotics were selected.

[0515] (5) Using the single colony obtained in step (4) as a template, PCR amplification is performed using a primer pair consisting of primers P5 and P8 to obtain a PCR amplification product. If the PCR amplification product obtained from a single colony contains a DNA fragment of 1365 bp in size, the colony is identified as a positive transformant. The positive transformant is a knockout of the adhE gene in the genome of the valine-producing bacterium CGMCC 22721, and the positive transformant is named the engineered bacterium YPVal-adhE01.

[0516] 2. Obtaining the engineered strain YPVal-adhE02

[0517] Based on the genome sequences of Escherichia coli W3110 and Bacillus subtilis subsp. subtilis str. 168 published by NCBI, CRISPR / Cas9 gene editing technology was used to knock out the ilvE(E) gene from the genome of the engineered strain YPVal-adhE01 obtained in step 1 and simultaneously insert the Bacillus subtilis ilvE gene driven by the ptrc promoter (i.e., the ptrc-ilvE(B) sequence), resulting in the engineered strain YPVal-adhE02, hereinafter referred to as YPVal-adhE02. The nucleotide sequence of the ptrc-ilvE(B) sequence is shown in SEQ ID No. 6. In SEQ ID No. 6, from the 5' end, positions 1096-1169 represent the nucleotide sequence of the ptrc promoter, and positions 1-1095 represent the Bacillus subtilis ilvE(B) gene.

[0518] The ilvE (E) gene of the engineered bacterium YPVal-adhE01 encodes branched-chain amino acid transaminase, its Gene ID is 948278, and its amino acid sequence is shown in SEQ ID No.15.

[0519] The ilvE(B) gene of Bacillus subtilis encodes branched-chain amino acid transaminase, its Gene ID is 938420, and its amino acid sequence is shown in SEQ ID No.16.

[0520] The specific steps are as follows:

[0521] 1. Construction of pGRB-ilvE sgRNA plasmid

[0522] (1) Primer sgRNA-3F was synthesized by Invitrogen:

[0523] 5'-TGACAGCTAGCTCAGTCCTAGGTATAATACTAGTgaaagcagcgataatcacgtcggGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGG-3' (shown in SEQ ID No. 35, the underlined sequence is the homology arm sequence of the pGRB vector) and primer sgRNA-3R:

[0524] 5'-CCTTATTTTAACTTGCTATTTCTAGCTCTAAAACccgacgtgattatcgctgctttcACTAGTATTATACCTAGGACTGAGCTAGCTGTCA-3' (shown in SEQ ID No. 36, the underlined sequence is the homology arm sequence of the pGRB vector).

[0525] (2) Primer sgRNA-3F and primer sgRNA-3R were annealed (reaction procedure: denaturation at 95°C for 5 min, annealing at 50°C for 1 min), and then the target fragment was recovered using a DNA purification kit, its DNA concentration was determined, and the concentration was diluted to 100 ng / μL to obtain an annealing product. The annealing product contained the sgRNA-3 fragment with the nucleotide sequence shown in SEQ ID No. 7.

[0526] (3) The pGRB vector (product of Addgene, catalog number 71539) was digested with the restriction endonuclease SpeI (product of Takara, catalog number 1631), and a DNA fragment of approximately 2700 bp was recovered using a DNA recovery kit (QIAGEN Gel Extraction Kit).

[0527] The enzyme digestion system is 50 μL, consisting of 5 μL 10× Buffer (provided with restriction endonuclease SpeI), 2.5 μL restriction endonuclease SpeI, 3000-5000 ng pGRB vector and ddH2O.

[0528] Enzyme digestion procedure: 37°C for 3 h.

[0529] (4) The DNA fragment recovered in step (3) was subjected to a dephosphorylation reaction (to prevent the pGRB vector from self-ligating), and recovered using a DNA recovery kit to obtain a linearized pGRB vector.

[0530] The dephosphorylation system is 50 μL, consisting of 5 μL 10× Buffer (provided by CIAP), 1000-2000 ng of DNA fragments recovered in step (3), 2.5 μL CIAP (product of Takara, catalog number 2250A) and ddH2O.

[0531] Dephosphorylation procedure: 37°C for 1 h.

[0532] (5) The linearized pGRB vector obtained in step (4) and the annealed product obtained in step (2) were recombined using the Gibson Assembly kit (New England), and then transformed into Escherichia coli DH5α competent cells (TAKARA) to obtain the pGRB-ilvE sgRNA plasmid.

[0533] The recombinant system was 5 μL, consisting of 2 μL of linearized pGRB vector, 0.5 μL of annealed product, and 2.5 μL of assembly enzyme (provided by the Gibson Assembly kit).

[0534] Recombination procedure: 50°C for 30 min.

[0535] 2. Obtaining the ptrc-ilvE(B)-Up-Down segment

[0536] (1) Based on the Escherichia coli W3110 genome sequence published by NCBI, a primer pair for amplifying the upstream homology arm and a primer pair for amplifying the downstream homology arm were designed and synthesized by Invitrogen. Based on the Bacillus subtilis subsp. subtilis str. 168 genome sequence published by NCBI, a primer pair for amplifying ptrc-ilvE(B) was designed and synthesized by Invitrogen.

[0537] The primer pair used to amplify the upstream homology arm consists of primer P9:

[0538] 5'-CAGGCAGTTCATTGAGTTAGCG-3' (SEQ ID No. 37) and primer P10:

[0539] Composed of 5'-CACAGTGTATTAAGCAGACGTTAAATACAAAAAATGGGACGGCAC-3' (SEQ ID No. 38).

[0540] The primer pair used to amplify the downstream homology arms consists of primer P13:

[0541] 5'-GTTATCCGCTCACAATTCCACACATTATACGAGCCGGATGATTAATTGTCAATTTTATATTCCTTTTGCGCTC-3' (shown in SEQ ID No. 39, the underlined portion is the sequence of the ptrc promoter) and primer P14: 5'-ACGGTTAGGGATGGTTCGAC-3' (SEQ ID No. 40).

[0542] The primer pair used to amplify ptrc-ilvE(B) consisted of primer P11:

[0543] 5'-GTGCCGTCCCATTTTTTGTATTTAACGTCTGCTTAATACACTGTG-3' (SEQ ID No. 41) and primer P12:

[0544] 5'-GTATAATGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGACCATGGAACTTTTTAAATATATGGAG-3' (shown in SEQ ID No. 42, the underlined portion is the sequence of the ptrc promoter).

[0545] (2) Using the genomic DNA of Escherichia coli W3110 as a template, a primer pair consisting of primer P9 and primer P10 was used for PCR amplification using the high-fidelity amplification enzyme KAPA HiFi HotStart, and a DNA recovery kit was used to recover the upstream homology arm of 709 bp in size.

[0546] (3) Using the genomic DNA of Escherichia coli W3110 as a template, a primer pair consisting of primer P13 and primer P14 was used for PCR amplification using the high-fidelity amplification enzyme KAPA HiFi HotStart, and a downstream homology arm of 611 bp in size was recovered using a DNA recovery kit.

[0547] (4) Using the genomic DNA of Bacillus subtilis subsp. subtilis str.168 as a template, PCR amplification was performed using a primer pair consisting of primers P11 and P12 using the high-fidelity amplification enzyme KAPA HiFi HotStart, and a DNA recovery kit was used to recover the ilvE(B) fragment with a size of 1168 bp.

[0548] (6) The upstream homology arm recovered in step (2), the downstream homology arm recovered in step (3), and the ilvE(B) fragment recovered in step (4) were mixed and used as templates. Overlap PCR was performed using a primer pair consisting of primer P9 and primer P14 to obtain the ptrc-ilvE(B)-Up-Down fragment shown in SEQ ID No. 8.

[0549] 3. Acquisition of YPVal-adhE01-Cas9 strain

[0550] (1) The plasmid pREDCas9 was transformed into the competent cells of the engineered bacteria YPVal-adhE01, and then spread on 2-YT agar plates containing 100 mg / L spectinomycin and cultured at 32°C to obtain single colonies resistant to spectinomycin.

[0551] (2) Using the single colonies obtained in step (1) as templates, PCR amplification was performed using a primer pair consisting of primers pRedCas9-PF and primers pRedCas9-PR to obtain PCR amplification products. If the PCR amplification product obtained from a single colony contains a DNA fragment with a nucleotide sequence as shown in SEQ ID No. 3, then the colony contains the plasmid pREDCas9. The strain of the colony was named YPVal-adhE01-Cas9 strain.

[0552] 4. Obtaining the engineered bacteria YPVal-adhE02

[0553] (1) Cultivate the YPVal-adhE01-Cas9 strain; when the YPVal-adhE01-Cas9 strain grows to OD 600nm When the OD value was 0.1, IPTG was added to make the concentration of IPTG in the system 0.1 mM, and the culture was continued to induce λ-Red-mediated homologous recombination; when the YPVal-adhE01-Cas9 strain grew to OD 600nm When the p-value was 0.6, the bacteria were collected and competent cells of the YPVal-adhE01-Cas9 strain were prepared.

[0554] (2) The pGRB-ilvE sgRNA plasmid obtained in step 1 and the ptrc-ilvE(B)-Up-Down fragment obtained in step 2 were transformed into the competent cells of the YPVal-adhE01-Cas9 strain, spread on a 2-YT agar plate containing 100 mg / L spectinomycin and 100 mg / L ampicillin, and cultured at 32°C to obtain single colonies.

[0555] (3) Using the single colonies obtained in step (2) as templates, PCR amplification was performed using a primer pair consisting of primers P11 and P12 to obtain PCR amplification products. If the PCR amplification product obtained from a single colony contains a DNA fragment of 1168 bp, the colony is preliminarily identified as a positive transformant.

[0556] (4) The positive transformants obtained in step (3) were inoculated on 2-YT agar plates containing 100 mg / L spectinomycin and 0.2% (m / v) arabinose and cultured at 32°C (for eliminating the pGRB-ilvE sgRNA plasmid); then, colonies that grew on 2-YT agar plates containing 100 mg / L spectinomycin but did not grow on 2-YT agar plates containing 100 mg / L ampicillin were selected, and these colonies were transferred to 2-YT agar plates and cultured at 42°C (for eliminating the plasmid pREDCas9); finally, colonies that did not grow on 2-YT agar plates containing 100 mg / L spectinomycin but grew on 2-YT agar plates without antibiotics were selected.

[0557] (5) Using the single colony obtained in step (4) as a template, PCR amplification is performed using a primer pair consisting of primers P11 and P12 to obtain a PCR amplification product. If the PCR amplification product obtained from a single colony contains a DNA fragment of 1168 bp in size, the colony is identified as a positive transformant. The positive transformant is a knockout of the ilvE (E) gene of the engineered bacterium YPVal-adhE01 genome and a knockout of the ilvE (B) gene of Bacillus subtilis driven by the ptrc promoter (i.e., the ptrc-ilvE (B) sequence), and the positive transformant is named the engineered bacterium YPVal-adhE02.

[0558] 3. Obtaining the engineered bacteria YPVal-adhE03

[0559] Using the engineered bacteria YPVal-adhE02 as the starting bacteria, the thiE gene in the genome of the engineered bacteria YPVal-adhE02 was knocked out using CRISPR / Cas9 gene editing technology based on the Escherichia coli W3110 genome sequence published by NCBI.

[0560] The thiE gene encodes thiamine phosphate synthase, its Gene ID is 948491, and its amino acid sequence is shown in SEQ ID No.17.

[0561] The specific steps are as follows:

[0562] 1. Construction of pGRB-thiE sgRNA plasmid

[0563] Based on the Escherichia coli W3110 genome sequence published by NCBI, the sgRNA target sequence for knocking out the thiE gene (shown in SEQ ID No. 9) was designed using CRISPR RGEN Tools (http: / / www.rgenome.net / cas-designer / ). Linearized pGRB vector homology arm sequences were added to the 5' and 3' ends of the target sequence to construct the sgRNA plasmid.

[0564] (1) Primer sgRNA-4F was synthesized by Invitrogen:

[0565] 5'-TGACAGCTAGCTCAGTCCTAGGTATAATACTAGTcgcccctcttatatcgcgctgggGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGG-3' (shown in SEQ ID No. 43, the underlined sequence is the homology arm sequence of the pGRB vector) and primer sgRNA-4R:

[0566] 5′-CCTTATTTTAACTTGCTATTTCTAGCTCTAAAACcccagcgcgatataagaggggcgACTAGTATTATACCTAGGACTGAGCTAGCTGTCA-3′ (shown in SEQ ID No. 44, the underlined sequence is the homology arm sequence of the pGRB vector).

[0567] (2) Primer sgRNA-4F and primer sgRNA-4R were annealed (reaction procedure: denaturation at 95°C for 5 minutes, annealing at 50°C for 1 minute), and then the target fragment was recovered using a DNA purification kit, its DNA concentration was determined, and the concentration was diluted to 100 ng / μL to obtain an annealing product. The annealing product contained the sgRNA-4 fragment with the nucleotide sequence shown in SEQ ID No. 9.

[0568] (3) The pGRB vector was digested with the restriction endonuclease SpeI, and a DNA fragment of approximately 2700 bp was recovered using a QIAGEN Gel Extraction Kit.

[0569] The enzyme digestion system is 50 μL, consisting of 5 μL 10× Buffer (provided with restriction endonuclease SpeI), 2.5 μL restriction endonuclease SpeI, 3000-5000 ng pGRB vector and ddH2O.

[0570] Enzyme digestion procedure: 37°C for 3 h.

[0571] (4) The DNA fragment recovered in step (3) was subjected to a dephosphorylation reaction (to prevent the pGRB vector from self-ligating), and recovered using a DNA recovery kit to obtain a linearized pGRB vector.

[0572] The dephosphorylation system is 50 μL, consisting of 5 μL 10× Buffer (provided by CIAP), 1000-2000 ng of DNA fragments recovered in step (3), 2.5 μL CIAP and ddH2O.

[0573] Dephosphorylation procedure: 37°C for 1 h.

[0574] (5) The linearized pGRB vector obtained in step (4) and the annealing product obtained in step (2) were recombined using the Gibson Assembly kit, and then transformed into Escherichia coli DH5α competent cells to obtain the pGRB-thiE sgRNA plasmid.

[0575] The recombinant system was 5 μL, consisting of 2 μL of linearized pGRB vector, 0.5 μL of annealed product, and 2.5 μL of assembly enzyme (provided by the Gibson Assembly kit).

[0576] Recombination procedure: 50°C for 30 min.

[0577] 2. Obtaining the ΔthiE-Up-Down Fragment

[0578] (1) Based on the Escherichia coli W3110 genome sequence published by NCBI, a primer pair for amplifying the upstream homology arm and a primer pair for amplifying the downstream homology arm were designed and synthesized by Invitrogen.

[0579] The primer pair used to amplify the upstream homology arm consists of primer P15:

[0580] 5'-TTCTATTCAGGACGCCAACG-3' (SEQ ID No. 45) and primer P16:

[0581] Composed of 5'-GCTATAACGCATAAAGTCACGGCACGCTTCCTCCTTACGCAGG-3' (SEQ ID No. 46).

[0582] The primer pair used to amplify the downstream homology arms consists of primer P17:

[0583] 5'-CCTGCGTAAGGAGGAAGCGTGCCGTGACTTTATGCGTTATAGC-3' (SEQ ID No. 47) and primer P18: 5'-GCCTGCAAAGTGCCCATAACCC-3' (SEQ ID No. 48).

[0584] (2) Using the genomic DNA of Escherichia coli W3110 as a template, a primer pair consisting of primer P15 and primer P16 was used for PCR amplification using the high-fidelity amplification enzyme KAPA HiFi HotStart, and a DNA recovery kit was used to recover the upstream homology arm with a size of 721 bp.

[0585] (3) Using the genomic DNA of Escherichia coli W3110 as a template, a primer pair consisting of primer P17 and primer P18 was used for PCR amplification using the high-fidelity amplification enzyme KAPA HiFi HotStart, and a downstream homology arm of 618 bp was recovered using a DNA recovery kit.

[0586] (4) The upstream homology arm recovered in step (2) and the downstream homology arm recovered in step (3) were mixed and used as templates, and overlap PCR was performed using a primer pair consisting of primer P15 and primer P18 to obtain the ΔthiE-Up-Down fragment shown in SEQ ID No. 10.

[0587] 3. Acquisition of YPVal-adhE02-Cas9 strain

[0588] (1) The plasmid pREDCas9 was transformed into the competent cells of the engineered bacteria YPVal-adhE02, and then spread on 2-YT agar plates containing 100 mg / L spectinomycin and cultured at 32°C to obtain single colonies resistant to spectinomycin.

[0589] (2) Using the single colonies obtained in step (1) as templates, PCR amplification was performed using a primer pair consisting of primers pRedCas9-PF and primers pRedCas9-PR to obtain PCR amplification products. If the PCR amplification product obtained from a single colony contains a DNA fragment with a nucleotide sequence as shown in SEQ ID No. 3, then the colony contains the plasmid pREDCas9. The strain of the colony was named YPVal-adhE02-Cas9 strain.

[0590] 4. Obtaining the engineered bacteria YPVal-adhE03

[0591] (1) Cultivate the YPVal-adhE02-Cas9 strain; when the YPVal-adhE02-Cas9 strain grows to OD 600nm When the OD value was 0.1, IPTG was added to make the concentration of IPTG in the system 0.1 mM, and the culture was continued to induce λ-Red-mediated homologous recombination; when the YPVal-adhE02-Cas9 strain grew to OD 600nm When the p-value was 0.6, the bacteria were collected and competent cells of the YPVal-adhE02-Cas9 strain were prepared.

[0592] (2) The pGRB-thiE sgRNA plasmid obtained in step 1 and the ΔthiE-Up-Down fragment obtained in step 2 were transformed into YPVal-adhE02-Cas9 competent cells, spread on 2-YT agar plates containing 100 mg / L spectinomycin and 100 mg / L ampicillin, and cultured at 32°C to obtain single colonies.

[0593] (3) Using the single colonies obtained in step (2) as templates, PCR amplification was performed using a primer pair consisting of primers P15 and P18 to obtain PCR amplification products. If the PCR amplification product obtained from a single colony contains a DNA fragment of 1296 bp, the colony is preliminarily identified as a positive transformant.

[0594] (4) The positive transformants obtained in step (3) were inoculated on 2-YT agar plates containing 100 mg / L spectinomycin and 0.2% (m / v) arabinose and cultured at 32°C (for eliminating the pGRB-thiE sgRNA plasmid); then, colonies that grew on 2-YT agar plates containing 100 mg / L spectinomycin but did not grow on 2-YT agar plates containing 100 mg / L ampicillin were selected, and these colonies were transferred to 2-YT agar plates and cultured at 42°C (for eliminating the plasmid pREDCas9); finally, colonies that did not grow on 2-YT agar plates containing 100 mg / L spectinomycin but grew on 2-YT agar plates without antibiotics were selected.

[0595] (5) Using the single colony obtained in step (4) as a template, PCR amplification was performed using a primer pair consisting of primers P15 and P18 to obtain a PCR amplification product. If the PCR amplification product obtained from a single colony contains a DNA fragment of 1296 bp, the colony is identified as a positive transformant of the engineered strain YPVal-adhE02 in which the thiE gene is deleted from the genome. The positive transformant is named engineered strain YPVal-adhE03.

[0596] IV. Obtaining the Engineered Bacteria YPVal-adhE04

[0597] Using the engineered bacteria YPVal-adhE03 as the starting bacteria, the mdh gene in the genome of the engineered bacteria YPVal-adhE03 was knocked out using CRISPR / Cas9 gene editing technology based on the Escherichia coli W3110 genome sequence published by NCBI.

[0598] The mdh gene encodes malate dehydrogenase, its Gene ID is 947854, and its amino acid sequence is shown in SEQ ID No.18.

[0599] The specific steps are as follows:

[0600] 1. Construction of pGRB-mdh sgRNA plasmid

[0601] Based on the Escherichia coli W3110 genome sequence published by NCBI, the sgRNA target sequence for knocking out the mdh gene (shown in SEQ ID No. 11) was designed using CRISPR RGEN Tools (http: / / www.rgenome.net / cas-designer / ). Linearized pGRB vector homology arm sequences were added to the 5' and 3' ends of the target sequence to construct the sgRNA plasmid.

[0602] (1) Primer sgRNA-5F was synthesized by Invitrogen:

[0603] 5'-TGACAGCTAGCTCAGTCCTAGGTATAATACTAGTgcctttcagttccgcaacaaaggGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGG-3' (shown in SEQ ID No. 49, the underlined sequence is the homology arm sequence of the pGRB vector) and primer sgRNA-5R:

[0604] 5′-CCTTATTTTAACTTGCTATTTCTAGCTCTAAAACcctttgttgcggaactgaaaggcACTAGTATTATACCTAGGACTGAGCTAGCTGTCA-3′ (shown in SEQ ID No. 50, the underlined sequence is the homology arm sequence of the pGRB vector).

[0605] (2) Primer sgRNA-5F and primer sgRNA-5R were annealed (reaction procedure: denaturation at 95°C for 5 minutes, annealing at 50°C for 1 minute), and then the target fragment was recovered using a DNA purification kit, its DNA concentration was determined, and the concentration was diluted to 100 ng / μL to obtain an annealing product. The annealing product contained the sgRNA-5 fragment with the nucleotide sequence shown in SEQ ID No. 11.

[0606] (3) The pGRB vector was digested with the restriction endonuclease SpeI, and a DNA fragment of approximately 2700 bp was recovered using a QIAGEN Gel Extraction Kit.

[0607] The enzyme digestion system is 50 μL, consisting of 5 μL 10× Buffer (provided with restriction endonuclease SpeI), 2.5 μL restriction endonuclease SpeI, 3000-5000 ng pGRB vector and ddH2O.

[0608] Enzyme digestion procedure: 37°C for 3 h.

[0609] (4) The DNA fragment recovered in step (3) was subjected to a dephosphorylation reaction (to prevent the pGRB vector from self-ligating), and recovered using a DNA recovery kit to obtain a linearized pGRB vector.

[0610] The dephosphorylation system is 50 μL, consisting of 5 μL 10× Buffer (provided by CIAP), 1000-2000 ng of DNA fragments recovered in step (3), 2.5 μL CIAP and ddH2O.

[0611] Dephosphorylation procedure: 37°C for 1 h.

[0612] (5) The linearized pGRB vector obtained in step (4) and the annealing product obtained in step (2) were recombined using the Gibson Assembly kit, and then transformed into Escherichia coli DH5α competent cells to obtain the pGRB-mdh sgRNA plasmid.

[0613] The recombinant system was 5 μL, consisting of 2 μL of linearized pGRB vector, 0.5 μL of annealed product, and 2.5 μL of assembly enzyme (provided by the Gibson Assembly kit).

[0614] Recombination procedure: 50°C for 30 min.

[0615] 2. Obtaining the Δmdh-Up-Down Fragment

[0616] (1) Based on the Escherichia coli W3110 genome sequence published by NCBI, a primer pair for amplifying the upstream homology arm and a primer pair for amplifying the downstream homology arm were designed and synthesized by Invitrogen.

[0617] The primer pair used to amplify the upstream homology arm consists of primer P19:

[0618] 5'-AACTTCCTCCAAACCGATGC-3' (SEQ ID No. 51) and primer P20:

[0619] Composed of 5'-CAATATAATAAGGAGTTTAGGTTGATTAGCGGATAATAAAAAACC-3' (SEQ ID No. 52).

[0620] The primer pair used to amplify the downstream homology arms consists of primer P21:

[0621] 5'-GGTTTTTTATTATCCGCTAATCAACCTAAACTCCTTATTATATTG-3' (SEQ ID No. 53) and primer P22: 5'-TCTTCAATGGACTGGAGGTG-3' (SEQ ID No. 54).

[0622] (2) Using the genomic DNA of Escherichia coli W3110 as a template, a primer pair consisting of primer P19 and primer P20 was used for PCR amplification using the high-fidelity amplification enzyme KAPA HiFi HotStart, and a DNA recovery kit was used to recover the upstream homology arm of 590 bp in size.

[0623] (3) Using the genomic DNA of Escherichia coli W3110 as a template, a primer pair consisting of primer P21 and primer P22 was used for PCR amplification using the high-fidelity amplification enzyme KAPA HiFi HotStart, and a downstream homology arm of 708 bp in size was recovered using a DNA recovery kit.

[0624] (4) The upstream homology arm recovered in step (2) and the downstream homology arm recovered in step (3) were mixed and used as templates, and overlap PCR was performed using a primer pair consisting of primer P19 and primer P22 to obtain the Δmdh-Up-Down fragment shown in SEQ ID No. 12.

[0625] 3. Acquisition of YPVal-adhE03-Cas9 strain

[0626] (1) The plasmid pREDCas9 was transformed into the competent cells of the engineered bacteria YPVal-adhE03, and then spread on 2-YT agar plates containing 100 mg / L spectinomycin and cultured at 32°C to obtain single colonies resistant to spectinomycin.

[0627] (2) Using the single colonies obtained in step (1) as templates, PCR amplification was performed using a primer pair consisting of primers pRedCas9-PF and pRedCas9-PR to obtain PCR amplification products. If the PCR amplification product obtained from a single colony contains a DNA fragment with a nucleotide sequence as shown in SEQ ID No. 3, then the colony contains the plasmid pREDCas9. The strain of the colony was named YPVal-adhE03-Cas9 strain.

[0628] 4. Obtaining the engineered bacteria YPVal-adhE04

[0629] (1) Cultivate the YPVal-adhE03-Cas9 strain; when the YPVal-adhE03-Cas9 strain grows to OD 600nm When the OD value was 0.1, IPTG was added to make the concentration of IPTG in the system 0.1 mM, and the culture was continued to induce λ-Red-mediated homologous recombination; when the YPVal-adhE03-Cas9 strain grew to OD 600nm When the p-value was 0.6, the bacteria were collected and competent cells of the YPVal-adhE03-Cas9 strain were prepared.

[0630] (2) The pGRB-mdh sgRNA plasmid obtained in step 1 and the Δmdh-Up-Down fragment obtained in step 2 were transformed into the competent cells of the YPVal-adhE03-Cas9 strain, spread on a 2-YT agar plate containing 100 mg / L spectinomycin and 100 mg / L ampicillin, and cultured at 32°C to obtain single colonies.

[0631] (3) Using the single colonies obtained in step (2) as templates, PCR amplification was performed using a primer pair consisting of primers P19 and P22 to obtain PCR amplification products. If the PCR amplification product obtained from a single colony contains a DNA fragment of 1253 bp, the colony is preliminarily identified as a positive transformant.

[0632] (4) The positive transformants obtained in step (3) were inoculated on 2-YT agar plates containing 100 mg / L spectinomycin and 0.2% (m / v) arabinose and cultured at 32°C (for eliminating the pGRB-thiE sgRNA plasmid); then, colonies that grew on 2-YT agar plates containing 100 mg / L spectinomycin but did not grow on 2-YT agar plates containing 100 mg / L ampicillin were selected, and these colonies were transferred to 2-YT agar plates and cultured at 42°C (for eliminating the plasmid pREDCas9); finally, colonies that did not grow on 2-YT agar plates containing 100 mg / L spectinomycin but grew on 2-YT agar plates without antibiotics were selected.

[0633] (5) Using the single colony obtained in step (4) as a template, PCR amplification was performed using a primer pair consisting of primers P19 and P22 to obtain a PCR amplification product. If the PCR amplification product obtained from a single colony contains a DNA fragment of 1253 bp, the colony is identified as a positive transformant of the engineered strain YPVal-adhE03 in which the thiE gene is deleted from the genome. The positive transformant is designated as engineered strain YPVal-adhE04.

[0634] Example 5: Transformation of an engineered bacterium based on Escherichia coli W3110

[0635] After extensive experiments, the inventors of the present invention modified Escherichia coli W3110 to obtain engineered strains YPVal-adhE05, YPVal-adhE06, YPVal-adhE07, and YPVal-adhE08. The genotypes of the engineered strains YPVal-adhE05, YPVal-adhE06, YPVal-adhE07, and YPVal-adhE08 are shown in Table 8.

[0636] Table 8

[0637] 1. Obtaining the engineered strain YPVal-adhE05

[0638] 1. Construction of pGRB-adhE sgRNA plasmid

[0639] Same as step 1 in Example 4.

[0640] 2. Obtaining the ΔadhE-Up-Down Fragment

[0641] Same as step 2 in Example 4.

[0642] 3. Acquisition of W3110-Cas9 strain

[0643] According to step 3 in step 1 of Example 4, the valine-producing bacteria CGMCC 22721 competent cells were replaced with Escherichia coli W3110 competent cells, and the other steps remained unchanged to obtain the W3110-Cas9 strain.

[0644] 4. Obtaining the engineered bacteria YPVal-adhE05

[0645] According to step 4 in step 1 of Example 4, the CGMCC 22721-Cas9 strain was replaced with the W3110-Cas9 strain, and the other steps remained unchanged to obtain the engineered strain YPVal-adhE05.

[0646] 2. Obtaining the engineered strain YPVal-adhE06

[0647] 1. Construction of pGRB-ilvE sgRNA plasmid

[0648] Same as step 1 in step 2 of Example 4.

[0649] 2. Obtaining the ptrc-ilvE(B)-Up-Down segment

[0650] Same as step 2 in Example 4.

[0651] 3. Acquisition of YPVal-adhE05-Cas9 strain

[0652] According to step 3 in step 2 of Example 4, the competent cells of the engineering bacteria YPVal-adhE01 were replaced with the competent cells of the engineering bacteria YPVal-adhE05, and the other steps remained unchanged to obtain the YPVal-adhE05-Cas9 strain.

[0653] 4. Obtaining the engineered bacteria YPVal-adhE06

[0654] According to step 4 in step 2 of Example 4, the YPVal-adhE01-Cas9 strain was replaced with the YPVal-adhE05-Cas9 strain, and the other steps remained unchanged to obtain the engineered strain YPVal-adhE06.

[0655] 3. Obtaining the engineered bacteria YPVal-adhE07

[0656] 1. Construction of pGRB-thiE sgRNA plasmid

[0657] Same as step 1 in step 3 of Example 4.

[0658] 2. Obtaining the ΔthiE-Up-Down Fragment

[0659] Same as 2 in step 3 of Example 4.

[0660] 3. Acquisition of YPVal-adhE06-Cas9 strain

[0661] According to step 3 in step 3 of Example 4, the competent cells of the engineering bacteria YPVal-adhE02 were replaced with the competent cells of the engineering bacteria YPVal-adhE06, and the other steps remained unchanged to obtain the YPVal-adhE06-Cas9 strain.

[0662] 4. Obtaining the engineered bacteria YPVal-adhE07

[0663] According to step 4 in step 3 of Example 4, the YPVal-adhE02-Cas9 strain was replaced with the YPVal-adhE06-Cas9 strain, and the other steps remained unchanged to obtain the engineered strain YPVal-adhE07.

[0664] IV. Obtaining the engineered strain YPVal-adhE08

[0665] 1. Construction of pGRB-mdh sgRNA plasmid

[0666] Same as step 1 in step 4 of Example 4.

[0667] 2. Obtaining the Δmdh-Up-Down Fragment

[0668] Same as step 2 in step 4 of Example 4.

[0669] 3. Acquisition of YPVal-adhE07-Cas9 strain

[0670] According to step 3 in step 4 of Example 4, the competent cells of the engineering bacteria YPVal-adhE03 were replaced with the competent cells of the engineering bacteria YPVal-adhE07, and the other steps remained unchanged to obtain the YPVal-adhE07-Cas9 strain.

[0671] 4. Obtaining the engineered bacteria YPVal-adhE08

[0672] According to step 4 in step 4 of Example 4, the YPVal-adhE03-Cas9 strain was replaced with the YPVal-adhE07-Cas9 strain, and the other steps remained unchanged to obtain the engineered strain YPVal-adhE08.

[0673] Example 6: Fermentation production of L-valine using the engineered bacteria obtained from Examples 4 and 5

[0674] 1. The engineered bacteria YPVal-adhE01, YPVal-adhE02, YPVal-adhE03, YPVal-adhE04, YPVal-adhE05, YPVal-adhE06, YPVal-adhE07 and YPVal-adhE08 obtained by transformation in Example 4 and Example 5, as well as the starting bacteria valine-producing bacteria CGMCC 22721 and Escherichia coli W3110, were fermented in a fermenter (Shanghai Bailun Biotechnology Co., Ltd., model BLBIO-5GC-4-H) to obtain a fermentation broth.

[0675] Fermentation was repeated three times for each strain.

[0676] The composition of the fermentation medium used during fermentation is shown in Table 3.

[0677] The fermentation control process is shown in Table 4.

[0678] 2. Use high performance liquid chromatography to detect the L-valine production in the fermentation broth.

[0679] The results of three fermentations using the valine-producing strain CGMCC 22721 and the engineered strains YPVal-adhE01, YPVal-adhE02, YPVal-adhE03, and YPVal-adhE04 derived from the valine-producing strain CGMCC 22721 are shown in Table 9 (P values ​​< 0.01 indicate extremely significant differences). The results showed that compared with the valine-producing strain CGMCC 22721, YPVal-adhE01, YPVal-adhE02, YPVal-adhE03, and YPVal-adhE04 significantly increased L-valine production. That is, in the valine-producing bacteria CGMCC 22721, the engineered bacteria obtained by "knocking out the adhE gene", "knocking out the adhE gene and the ilvE gene (E) and simultaneously inserting the ilvE (B) from Bacillus subtilis with a ptrc promoter", "knocking out the adhE gene and the thiE gene and simultaneously inserting the ilvE (B) from Bacillus subtilis with a ptrc promoter", or "knocking out the adhE gene, the thiE gene and the mdh gene and simultaneously inserting the ilvE (B) from Bacillus subtilis with a ptrc promoter" can all increase the production of L-valine.

[0680] Table 9

[0681] The test results of three fermentations using E. coli W3110 and the engineered strains YPVal-adhE05, YPVal-adhE06, YPVal-adhE07, and YPVal-adhE08 derived from E. coli W3110 are shown in Table 10 (P values ​​< 0.01 indicate extremely significant differences). The results showed that compared with E. coli W3110, YPVal-adhE05, YPVal-adhE06, YPVal-adhE07, and YPVal-adhE08 significantly increased L-valine production. That is, in Escherichia coli W3110, the engineered bacteria obtained by "knocking out the adhE gene", "knocking out the adhE gene and the ilvE gene (E) and inserting the ptrc-driven ilvE (B) from Bacillus subtilis", "knocking out the adhE gene and the thiE gene and knocking out the ilvE gene (E) and inserting the ptrc-driven ilvE (B) from Bacillus subtilis" or "knocking out the adhE gene, the thiE gene and the mdh gene and knocking out the ilvE gene (E) and inserting the ptrc-driven ilvE (B) from Bacillus subtilis" can all increase the production of L-valine.

[0682] Table 10

[0683] Example 7: Transformation of the engineered bacteria based on the valine-producing strain CGMCC 22721

[0684] After extensive experiments, the inventors of the present invention modified the valine-producing strain CGMCC 22721 to obtain engineered strains YPVal-ilvE01, YPVal-ilvE02, and YPVal-ilvE03. The genotypes of the engineered strains YPVal-ilvE01, YPVal-ilvE02, and YPVal-ilvE03 are shown in Table 11.

[0685] Table 11

[0686] 1. Obtaining the engineered strain YPVal-ilvE01

[0687] Based on the genome sequences of Escherichia coli W3110 and Bacillus subtilis subsp. subtilis str. 168 published by NCBI, CRISPR / Cas9 gene editing technology was used to knock out the ilvE(E) gene in the genome of the valine-producing strain CGMCC 22721 and simultaneously insert the Bacillus subtilis ilvE gene driven by the ptrc promoter (i.e., the ptrc-ilvE(B) sequence). This resulted in the engineered strain YPVal-ilvE01, hereinafter referred to as YPVal-ilvE01. The nucleotide sequence of the ptrc-ilvE(B) sequence is shown in SEQ ID No. 6. In SEQ ID No. 6, from the 5' end, positions 1096-1169 represent the ptrc promoter sequence, and positions 1-1095 represent the Bacillus subtilis ilvE(B) gene.

[0688] The ilvE (E) gene of the valine-producing bacterium CGMCC 22721 encodes a branched-chain amino acid transaminase, its Gene ID is 948278, and its amino acid sequence is shown in SEQ ID No. 15.

[0689] The ilvE(B) gene of Bacillus subtilis encodes branched-chain amino acid transaminase, its Gene ID is 938420, and its amino acid sequence is shown in SEQ ID No.16.

[0690] The specific steps are as follows:

[0691] 1. Construction of pGRB-ilvE sgRNA plasmid

[0692] (1) Primer sgRNA-3F was synthesized by Invitrogen:

[0693] 5'-TGACAGCTAGCTCAGTCCTAGGTATAATACTAGTgaaagcagcgataatcacgtcggGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGG-3' (shown in SEQ ID No. 35, the underlined sequence is the homology arm sequence of the pGRB vector), primer sgRNA-3R:

[0694] 5'-CCTTATTTTAACTTGCTATTTCTAGCTCTAAAACccgacgtgattatcgctgctttcACTAGTATTATACCTAGGACTGAGCTAGCTGTCA-3' (shown in SEQ ID No. 36, the underline is the homology arm sequence of the pGRB vector), primer sgRNA-PF:

[0695] 5'-GTCTCATGAGCGGATACATATTTG-3' (SEQ ID No. 21) and primer sgRNA-PR:

[0696] 5'-ATGAGAAAGCGCCACGCT-3' (SEQ ID No. 22).

[0697] (2) Primer sgRNA-3F and primer sgRNA-3R were annealed (reaction procedure: denaturation at 95°C for 5 min, annealing at 50°C for 1 min), and then the target fragment was recovered using a DNA purification kit, its DNA concentration was determined, and the concentration was diluted to 100 ng / μL to obtain an annealing product. The annealing product contained the sgRNA-3 fragment with the nucleotide sequence shown in SEQ ID No. 7.

[0698] (3) The pGRB vector (product of Addgene, catalog number 71539) was digested with the restriction endonuclease SpeI (product of Takara, catalog number 1631), and a DNA fragment of approximately 2700 bp was recovered using a DNA recovery kit (QIAGEN Gel Extraction Kit).

[0699] The enzyme digestion system is 50 μL, consisting of 5 μL 10× Buffer (provided with restriction endonuclease SpeI), 2.5 μL restriction endonuclease SpeI, 3000-5000 ng pGRB vector and ddH2O.

[0700] Enzyme digestion procedure: 37°C for 3 h.

[0701] (4) The DNA fragment recovered in step (3) was subjected to a dephosphorylation reaction (to prevent the pGRB vector from self-ligating), and recovered using a DNA recovery kit to obtain a linearized pGRB vector.

[0702] The dephosphorylation system is 50 μL, consisting of 5 μL 10× Buffer (provided by CIAP), 1000-2000 ng of DNA fragments recovered in step (3), 2.5 μL CIAP (product of Takara, catalog number 2250A) and ddH2O.

[0703] Dephosphorylation procedure: 37°C for 1 h.

[0704] (5) The linearized pGRB vector obtained in step (4) and the annealed product obtained in step (2) were recombined using the Gibson Assembly kit (New England), and then transformed into Escherichia coli DH5α competent cells (TAKARA) to obtain the pGRB-ilvE sgRNA plasmid.

[0705] The recombinant system was 5 μL, consisting of 2 μL of linearized pGRB vector, 0.5 μL of annealed product, and 2.5 μL of assembly enzyme (provided by the Gibson Assembly kit).

[0706] Recombination procedure: 50°C for 30 min.

[0707] 2. Obtaining the ptrc-ilvE(B)-Up-Down segment

[0708] (1) Based on the Escherichia coli W3110 genome sequence published by NCBI, a primer pair for amplifying the upstream homology arm and a primer pair for amplifying the downstream homology arm were designed and synthesized by Invitrogen. Based on the Bacillus subtilis subsp. subtilis str. 168 genome sequence published by NCBI, a primer pair for amplifying ptrc-ilvE(B) was designed and synthesized by Invitrogen.

[0709] The primer pair used to amplify the upstream homology arm consists of primer P9:

[0710] 5'-CAGGCAGTTCATTGAGTTAGCG-3' (SEQ ID No. 37) and primer P10:

[0711] Composed of 5'-CACAGTGTATTAAGCAGACGTTAAATACAAAAAATGGGACGGCAC-3' (SEQ ID No. 38).

[0712] The primer pair used to amplify the downstream homology arms consists of primer P13:

[0713] 5'-GTTATCCGCTCACAATTCCACACATTATACGAGCCGGATGATTAATTGTCAATTTTATATTCCTTTTGCGCTC-3' (shown in SEQ ID No. 39, the underlined portion is the sequence of the ptrc promoter) and primer P14: 5'-ACGGTTAGGGATGGTTCGAC-3' (SEQ ID No. 40).

[0714] The primer pair used to amplify ptrc-ilvE(B) consisted of primer P11:

[0715] 5'-GTGCCGTCCCATTTTTTGTATTTAACGTCTGCTTAATACACTGTG-3' (SEQ ID No. 41) and primer P12:

[0716] 5'-GTATAATGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGACCATGGAACTTTTTAAATATATGGAG-3' (shown in SEQ ID No. 42, the underlined portion is the sequence of the ptrc promoter).

[0717] (2) Using the genomic DNA of Escherichia coli W3110 as a template, a primer pair consisting of primer P9 and primer P10 was used for PCR amplification using the high-fidelity amplification enzyme KAPA HiFi HotStart, and a DNA recovery kit was used to recover the upstream homology arm of 709 bp in size.

[0718] (3) Using the genomic DNA of Escherichia coli W3110 as a template, a primer pair consisting of primer P13 and primer P14 was used for PCR amplification using the high-fidelity amplification enzyme KAPA HiFi HotStart, and a downstream homology arm of 611 bp in size was recovered using a DNA recovery kit.

[0719] (4) Using genomic DNA of Bacillus subtilis subsp. subtilis str.168 as a template, PCR amplification was performed using a primer pair consisting of primers P11 and P12 using the high-fidelity amplification enzyme KAPA HiFi HotStart, and a DNA recovery kit was used to recover the ilvE(B) fragment of 1168 bp.

[0720] (5) The upstream homology arm recovered in step (2), the downstream homology arm recovered in step (3), and the ilvE(B) fragment recovered in step (4) were mixed and used as templates. Overlap PCR was performed using a primer pair consisting of primer P9 and primer P14 to obtain the ptrc-ilvE(B)-Up-Down fragment shown in SEQ ID No. 8.

[0721] 3. Acquisition of CGMCC 22721-Cas9 strain

[0722] (1) The plasmid pREDCas9 (product of Addgene, catalog number 71541; containing the spectinomycin resistance gene) was transformed into valine-producing bacteria CGMCC 22721 competent cells, and then spread on 2-YT agar plates containing 100 mg / L spectinomycin and cultured at 32°C to obtain spectinomycin-resistant single colonies.

[0723] 2-YT agar plates were prepared as follows: 16 g of tryptone, 10 g of yeast extract powder, 5 g of sodium chloride, and 16 g of agar powder were dissolved in an appropriate amount of water, and the volume was made up to 1 L with water. The pH value was adjusted to 7.0 with sodium hydroxide, and the plates were sterilized at 121°C for 20 minutes.

[0724] (2) Using the single colonies obtained in step (1) as templates, PCR amplification was performed using a primer pair consisting of primer pRedCas9-PF: 5'-GCAGTGGCGGTTTTCATG-3' (SEQ ID No. 27) and primer pRedCas9-PR: 5'-CCTTGGTGATCTCGCCTTTC-3' (SEQ ID No. 28) to obtain PCR amplification products. If the PCR amplification product obtained from a single colony contains a DNA fragment with a nucleotide sequence as shown in SEQ ID No. 3, the colony contains plasmid pREDCas9. The strain of the colony was named CGMCC 22721-Cas9 strain.

[0725] 4. Obtaining the engineered bacteria YPVal-ilvE01

[0726] (1) Cultivate CGMCC 22721-Cas9 strain; when CGMCC 22721-Cas9 strain grows to OD 600nm When the OD value was 0.1, IPTG was added to make the concentration of IPTG in the system 0.1 mM, and the culture was continued to induce λ-Red-mediated homologous recombination; when the CGMCC 22721-Cas9 strain grew to OD 600nm When the p-value was 0.6, the bacteria were collected and CGMCC 22721-Cas9 competent cells were prepared.

[0727] (2) The pGRB-ilvE sgRNA plasmid obtained in step 1 and the ptrc-ilvE(B)-Up-Down fragment obtained in step 2 were transformed into CGMCC 22721-Cas9 competent cells, spread on 2-YT agar plates containing 100 mg / L spectinomycin and 100 mg / L ampicillin, and cultured at 32°C to obtain single colonies.

[0728] (3) Using the single colonies obtained in step (2) as templates, PCR amplification was performed using a primer pair consisting of primers P11 and P12 to obtain PCR amplification products. If the PCR amplification product obtained from a single colony contains a DNA fragment of 1168 bp, the colony is preliminarily identified as a positive transformant.

[0729] (4) The positive transformants obtained in step (3) were inoculated on 2-YT agar plates containing 100 mg / L spectinomycin and 0.2% (m / v) arabinose and cultured at 32°C (for eliminating the pGRB-ilvE sgRNA plasmid); then, colonies that grew on 2-YT agar plates containing 100 mg / L spectinomycin but did not grow on 2-YT agar plates containing 100 mg / L ampicillin were selected, and these colonies were transferred to 2-YT agar plates and cultured at 42°C (for eliminating the plasmid pREDCas9); finally, colonies that did not grow on 2-YT agar plates containing 100 mg / L spectinomycin but grew on 2-YT agar plates without antibiotics were selected.

[0730] (5) Using the single colony obtained in step (4) as a template, PCR amplification is performed using a primer pair consisting of primer P11 and primer P12 to obtain a PCR amplification product. If the PCR amplification product obtained from a single colony contains a DNA fragment of 1168 bp in size, the colony is identified as a positive transformant. The positive transformant is a strain in which the ilvE(E) gene of the valine-producing bacterium CGMCC 22721 genome is knocked out and the ilvE(B) gene of Bacillus subtilis driven by the ptrc promoter is knocked in (i.e., the ptrc-ilvE(B) sequence). The positive transformant is named the engineered strain YPVal-ilvE01.

[0731] 2. Obtaining the engineered bacteria YPVal-ilvE02

[0732] The engineered bacteria YPVal-ilvE01 obtained in step 1 was used as the starting bacteria. Based on the Escherichia coli W3110 genome sequence published by NCBI, the thiE gene in the genome of the engineered bacteria YPVal-ilvE01 was knocked out using CRISPR / Cas9 gene editing technology.

[0733] The thiE gene encodes thiamine phosphate synthase, its Gene ID is 948491, and its amino acid sequence is shown in SEQ ID No.17.

[0734] The specific steps are as follows:

[0735] 1. Construction of pGRB-thiE sgRNA plasmid

[0736] Based on the Escherichia coli W3110 genome sequence published by NCBI, the sgRNA target sequence for knocking out the thiE gene (shown in SEQ ID No. 9) was designed using CRISPR RGEN Tools (http: / / www.rgenome.net / cas-designer / ). Linearized pGRB vector homology arm sequences were added to the 5' and 3' ends of the target sequence to construct the sgRNA plasmid.

[0737] (1) Primer sgRNA-4F was synthesized by Invitrogen:

[0738] 5'-TGACAGCTAGCTCAGTCCTAGGTATAATACTAGTcgcccctcttatatcgcgctgggGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGG-3' (shown in SEQ ID No. 43, the underlined sequence is the homology arm sequence of the pGRB vector) and primer sgRNA-4R:

[0739] 5′-CCTTATTTTAACTTGCTATTTCTAGCTCTAAAACcccagcgcgatataagaggggcgACTAGTATTATACCTAGGACTGAGCTAGCTGTCA-3′ (shown in SEQ ID No. 44, the underlined sequence is the homology arm sequence of the pGRB vector).

[0740] (2) Primer sgRNA-4F and primer sgRNA-4R were annealed (reaction procedure: denaturation at 95°C for 5 minutes, annealing at 50°C for 1 minute), and then the target fragment was recovered using a DNA purification kit, its DNA concentration was determined, and the concentration was diluted to 100 ng / μL to obtain an annealing product. The annealing product contained the sgRNA-4 fragment with the nucleotide sequence shown in SEQ ID No. 9.

[0741] (3) The pGRB vector was digested with the restriction endonuclease SpeI, and a DNA fragment of approximately 2700 bp was recovered using a QIAGEN Gel Extraction Kit.

[0742] The enzyme digestion system is 50 μL, consisting of 5 μL 10× Buffer (provided with restriction endonuclease SpeI), 2.5 μL restriction endonuclease SpeI, 3000-5000 ng pGRB vector and ddH2O.

[0743] Enzyme digestion procedure: 37°C for 3 h.

[0744] (4) The DNA fragment recovered in step (3) was subjected to a dephosphorylation reaction (to prevent the pGRB vector from self-ligating), and recovered using a DNA recovery kit to obtain a linearized pGRB vector.

[0745] The dephosphorylation system is 50 μL, consisting of 5 μL 10× Buffer (provided by CIAP), 1000-2000 ng of DNA fragments recovered in step (3), 2.5 μL CIAP and ddH2O.

[0746] Dephosphorylation procedure: 37°C for 1 h.

[0747] (5) The linearized pGRB vector obtained in step (4) and the annealing product obtained in step (2) were recombined using the Gibson Assembly kit, and then transformed into Escherichia coli DH5α competent cells to obtain the pGRB-thiE sgRNA plasmid.

[0748] The recombinant system was 5 μL, consisting of 2 μL of linearized pGRB vector, 0.5 μL of annealed product, and 2.5 μL of assembly enzyme (provided by the Gibson Assembly kit).

[0749] Recombination procedure: 50°C for 30 min.

[0750] 2. Obtaining the ΔthiE-Up-Down Fragment

[0751] (1) Based on the Escherichia coli W3110 genome sequence published by NCBI, a primer pair for amplifying the upstream homology arm and a primer pair for amplifying the downstream homology arm were designed and synthesized by Invitrogen.

[0752] The primer pair used to amplify the upstream homology arm consists of primer P15:

[0753] 5'-TTCTATTCAGGACGCCAACG-3' (SEQ ID No. 45) and primer P16:

[0754] Composed of 5'-GCTATAACGCATAAAGTCACGGCACGCTTCCTCCTTACGCAGG-3' (SEQ ID No. 46).

[0755] The primer pair used to amplify the downstream homology arms consists of primer P17:

[0756] 5'-CCTGCGTAAGGAGGAAGCGTGCCGTGACTTTATGCGTTATAGC-3' (SEQ ID No. 47) and primer P18: 5'-GCCTGCAAAGTGCCCATAACCC-3' (SEQ ID No. 48).

[0757] (2) Using the genomic DNA of Escherichia coli W3110 as a template, a primer pair consisting of primer P15 and primer P16 was used for PCR amplification using the high-fidelity amplification enzyme KAPA HiFi HotStart, and a DNA recovery kit was used to recover the upstream homology arm with a size of 721 bp.

[0758] (3) Using the genomic DNA of Escherichia coli W3110 as a template, a primer pair consisting of primer P17 and primer P18 was used for PCR amplification using the high-fidelity amplification enzyme KAPA HiFi HotStart, and a downstream homology arm of 618 bp was recovered using a DNA recovery kit.

[0759] (4) The upstream homology arm recovered in step (2) and the downstream homology arm recovered in step (3) were mixed and used as templates, and overlap PCR was performed using a primer pair consisting of primer P15 and primer P18 to obtain the ΔthiE-Up-Down fragment shown in SEQ ID No. 10.

[0760] 3. Acquisition of YPVal-ilvE01-Cas9 strain

[0761] (1) The plasmid pREDCas9 was transformed into the competent cells of the engineered bacteria YPVal-ilvE01, and then spread on 2-YT agar plates containing 100 mg / L spectinomycin and cultured at 32°C to obtain single colonies resistant to spectinomycin.

[0762] (2) Using the single colonies obtained in step (1) as templates, PCR amplification was performed using a primer pair consisting of primers pRedCas9-PF and pRedCas9-PR to obtain PCR amplification products. If the PCR amplification product obtained from a single colony contains a DNA fragment with a nucleotide sequence as shown in SEQ ID No. 3, then the colony contains the plasmid pREDCas9. The strain of the colony was named YPVal-ilvE01-Cas9 strain.

[0763] 4. Obtaining the engineered bacteria YPVal-ilvE02

[0764] (1) Cultivate the YPVal-ilvE01-Cas9 strain; when the YPVal-ilvE01-Cas9 strain grows to OD 600nmWhen the OD value was 0.1, IPTG was added to make the concentration of IPTG in the system 0.1 mM, and the culture was continued to induce λ-Red-mediated homologous recombination; when the YPVal-ilvE01-Cas9 strain grew to OD 600nm When the p-value was 0.6, the bacteria were collected and competent cells of the YPVal-ilvE01-Cas9 strain were prepared.

[0765] (2) The pGRB-thiE sgRNA plasmid obtained in step 1 and the ΔthiE-Up-Down fragment obtained in step 2 were transformed into the competent cells of the YPVal-ilvE01-Cas9 strain, spread on a 2-YT agar plate containing 100 mg / L spectinomycin and 100 mg / L ampicillin, and cultured at 32°C to obtain single colonies.

[0766] (3) Using the single colonies obtained in step (2) as templates, PCR amplification was performed using a primer pair consisting of primers P15 and P18 to obtain PCR amplification products. If the PCR amplification product obtained from a single colony contains a DNA fragment of 1296 bp, the colony is preliminarily identified as a positive transformant.

[0767] (4) The positive transformants obtained in step (3) were inoculated on 2-YT agar plates containing 100 mg / L spectinomycin and 0.2% (m / v) arabinose and cultured at 32°C (for eliminating the pGRB-thiE sgRNA plasmid); then, colonies that grew on 2-YT agar plates containing 100 mg / L spectinomycin but did not grow on 2-YT agar plates containing 100 mg / L ampicillin were selected, and these colonies were transferred to 2-YT agar plates and cultured at 42°C (for eliminating the plasmid pREDCas9); finally, colonies that did not grow on 2-YT agar plates containing 100 mg / L spectinomycin but grew on 2-YT agar plates without antibiotics were selected.

[0768] (5) Using the single colony obtained in step (4) as a template, PCR amplification was performed using a primer pair consisting of primers P15 and P18 to obtain a PCR amplification product. If the PCR amplification product obtained from a single colony contains a DNA fragment of 1296 bp, the colony is identified as a positive transformant of the engineered strain YPVal-ilvE01 genome lacking the thiE gene. The positive transformant is designated as engineered strain YPVal-ilvE02.

[0769] 3. Obtaining the engineered bacteria YPVal-ilvE03

[0770] The engineered bacteria YPVal-ilvE02 obtained in step 2 was used as the starting bacteria. Based on the Escherichia coli W3110 genome sequence published by NCBI, the CRISPR / Cas9 gene editing technology was used to knock out the mdh gene in the genome of the engineered bacteria YPVal-ilvE02.

[0771] The mdh gene encodes malate dehydrogenase, its Gene ID is 947854, and its amino acid sequence is shown in SEQ ID No.18.

[0772] The specific steps are as follows:

[0773] 1. Construction of pGRB-mdh sgRNA plasmid

[0774] Based on the Escherichia coli W3110 genome sequence published by NCBI, the sgRNA target sequence for knocking out the mdh gene (shown in SEQ ID No. 11) was designed using CRISPR RGEN Tools (http: / / www.rgenome.net / cas-designer / ). Linearized pGRB vector homology arm sequences were added to the 5' and 3' ends of the target sequence to construct the sgRNA plasmid.

[0775] (1) Primer sgRNA-5F was synthesized by Invitrogen:

[0776] 5'-TGACAGCTAGCTCAGTCCTAGGTATAATACTAGTgcctttcagttccgcaacaaaggGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGG-3' (shown in SEQ ID No. 49, the underlined sequence is the homology arm sequence of the pGRB vector) and primer sgRNA-5R:

[0777] 5′-CCTTATTTTAACTTGCTATTTCTAGCTCTAAAACcctttgttgcggaactgaaaggcACTAGTATTATACCTAGGACTGAGCTAGCTGTCA-3′ (shown in SEQ ID No. 50, the underlined sequence is the homology arm sequence of the pGRB vector).

[0778] (2) Primer sgRNA-5F and primer sgRNA-5R were annealed (reaction procedure: denaturation at 95°C for 5 minutes, annealing at 50°C for 1 minute), and then the target fragment was recovered using a DNA purification kit, its DNA concentration was determined, and the concentration was diluted to 100 ng / μL to obtain an annealing product. The annealing product contained the sgRNA-5 fragment with the nucleotide sequence shown in SEQ ID No. 11.

[0779] (3) The pGRB vector was digested with the restriction endonuclease SpeI, and a DNA fragment of approximately 2700 bp was recovered using a QIAGEN Gel Extraction Kit.

[0780] The enzyme digestion system is 50 μL, consisting of 5 μL 10× Buffer (provided with restriction endonuclease SpeI), 2.5 μL restriction endonuclease SpeI, 3000-5000 ng pGRB vector and ddH2O.

[0781] Enzyme digestion procedure: 37°C for 3 h.

[0782] (4) The DNA fragment recovered in step (3) was subjected to a dephosphorylation reaction (to prevent the pGRB vector from self-ligating), and recovered using a DNA recovery kit to obtain a linearized pGRB vector.

[0783] The dephosphorylation system is 50 μL, consisting of 5 μL 10× Buffer (provided by CIAP), 1000-2000 ng of DNA fragments recovered in step (3), 2.5 μL CIAP and ddH2O.

[0784] Dephosphorylation procedure: 37°C for 1 h.

[0785] (5) The linearized pGRB vector obtained in step (4) and the annealing product obtained in step (2) were recombined using the Gibson Assembly kit, and then transformed into Escherichia coli DH5α competent cells to obtain the pGRB-mdh sgRNA plasmid.

[0786] The recombinant system was 5 μL, consisting of 2 μL of linearized pGRB vector, 0.5 μL of annealed product, and 2.5 μL of assembly enzyme (provided by the Gibson Assembly kit).

[0787] Recombination procedure: 50°C for 30 min.

[0788] 2. Obtaining the Δmdh-Up-Down Fragment

[0789] (1) Based on the Escherichia coli W3110 genome sequence published by NCBI, a primer pair for amplifying the upstream homology arm and a primer pair for amplifying the downstream homology arm were designed and synthesized by Invitrogen.

[0790] The primer pair used to amplify the upstream homology arm consists of primer P19:

[0791] 5'-AACTTCCTCCAAACCGATGC-3' (SEQ ID No. 51) and primer P20:

[0792] Composed of 5'-CAATATAATAAGGAGTTTAGGTTGATTAGCGGATAATAAAAAACC-3' (SEQ ID No. 52).

[0793] The primer pair used to amplify the downstream homology arms consists of primer P21:

[0794] 5'-GGTTTTTTATTATCCGCTAATCAACCTAAACTCCTTATTATATTG-3' (SEQ ID No. 53) and primer P22: 5'-TCTTCAATGGACTGGAGGTG-3' (SEQ ID No. 54).

[0795] (2) Using the genomic DNA of Escherichia coli W3110 as a template, a primer pair consisting of primer P19 and primer P20 was used for PCR amplification using the high-fidelity amplification enzyme KAPA HiFi HotStart, and a DNA recovery kit was used to recover the upstream homology arm of 590 bp in size.

[0796] (3) Using the genomic DNA of Escherichia coli W3110 as a template, a primer pair consisting of primer P21 and primer P22 was used for PCR amplification using the high-fidelity amplification enzyme KAPA HiFi HotStart, and a downstream homology arm of 708 bp in size was recovered using a DNA recovery kit.

[0797] (4) The upstream homology arm recovered in step (2) and the downstream homology arm recovered in step (3) were mixed and used as templates, and overlap PCR was performed using a primer pair consisting of primer P19 and primer P22 to obtain the Δmdh-Up-Down fragment shown in SEQ ID No. 12.

[0798] 3. Acquisition of YPVal-ilvE02-Cas9 strain

[0799] (1) The plasmid pREDCas9 was transformed into the competent cells of the engineered bacteria YPVal-ilvE02, and then spread on 2-YT agar plates containing 100 mg / L spectinomycin and cultured at 32°C to obtain single colonies resistant to spectinomycin.

[0800] (2) Using the single colonies obtained in step (1) as templates, PCR amplification was performed using a primer pair consisting of primers pRedCas9-PF and primers pRedCas9-PR to obtain PCR amplification products. If the PCR amplification product obtained from a single colony contains a DNA fragment with a nucleotide sequence as shown in SEQ ID No. 3, then the colony contains the plasmid pREDCas9. The strain of the colony was named YPVal-ilvE02-Cas9 strain.

[0801] 4. Obtaining the engineered bacteria YPVal-ilvE03

[0802] (1) Cultivate the YPVal-ilvE02-Cas9 strain; when the YPVal-ilvE02-Cas9 strain grows to OD 600nm When the OD value was 0.1, IPTG was added to make the concentration of IPTG in the system 0.1 mM, and the culture was continued to induce λ-Red-mediated homologous recombination; when the YPVal-ilvE02-Cas9 strain grew to OD 600nm When the p-value was 0.6, the bacteria were collected and competent cells of the YPVal-ilvE02-Cas9 strain were prepared.

[0803] (2) The pGRB-mdh sgRNA plasmid obtained in step 1 and the Δmdh-Up-Down fragment obtained in step 2 were transformed into the competent cells of the YPVal-ilvE02-Cas9 strain, spread on a 2-YT agar plate containing 100 mg / L spectinomycin and 100 mg / L ampicillin, and cultured at 32°C to obtain single colonies.

[0804] (3) Using the single colonies obtained in step (2) as templates, PCR amplification was performed using a primer pair consisting of primers P19 and P22 to obtain PCR amplification products. If the PCR amplification product obtained from a single colony contains a DNA fragment of 1253 bp, the colony is preliminarily identified as a positive transformant.

[0805] (4) The positive transformants obtained in step (3) were inoculated on 2-YT agar plates containing 100 mg / L spectinomycin and 0.2% (m / v) arabinose and cultured at 32°C (for eliminating the pGRB-thiE sgRNA plasmid); then, colonies that grew on 2-YT agar plates containing 100 mg / L spectinomycin but did not grow on 2-YT agar plates containing 100 mg / L ampicillin were selected, and these colonies were transferred to 2-YT agar plates and cultured at 42°C (for eliminating the plasmid pREDCas9); finally, colonies that did not grow on 2-YT agar plates containing 100 mg / L spectinomycin but grew on 2-YT agar plates without antibiotics were selected.

[0806] (5) Using the single colony obtained in step (4) as a template, PCR amplification was performed using a primer pair consisting of primers P19 and P22 to obtain a PCR amplification product. If the PCR amplification product obtained from a single colony contains a DNA fragment of 1253 bp, the colony is identified as a positive transformant lacking the mdh gene in the genome of the engineered strain YPVal-ilvE02. The positive transformant is designated as the engineered strain YPVal-ilvE03.

[0807] Example 8: Transformation of the engineered bacteria based on Escherichia coli W3110

[0808] After extensive experiments, the inventors of the present invention modified E. coli W3110 to obtain engineered strains YPVal-ilvE04, YPVal-ilvE05, and YPVal-ilvE06. The genotypes of the engineered strains YPVal-ilvE04, YPVal-ilvE05, and YPVal-ilvE06 are shown in Table 12.

[0809] Table 12

[0810] 1. Obtaining the engineered strain YPVal-ilvE04

[0811] 1. Construction of pGRB-ilvE sgRNA plasmid

[0812] Same as step 1 in Example 7.

[0813] 2. Obtaining the ptrc-ilvE(B)-Up-Down segment

[0814] Same as step 2 in Example 7.

[0815] 3. Acquisition of W3110-Cas9 strain

[0816] According to step 3 in step 1 of Example 7, the valine-producing bacteria CGMCC 22721 competent cells were replaced with Escherichia coli W3110 competent cells, and the other steps remained unchanged to obtain the W3110-Cas9 strain.

[0817] 4. Obtaining the engineered bacteria YPVal-ilvE04

[0818] According to step 4 in step 1 of Example 7, the CGMCC 22721-Cas9 strain was replaced with the W3110-Cas9 strain, and the other steps remained unchanged to obtain the engineered bacteria YPVal-ilvE04.

[0819] 2. Obtaining the engineered bacteria YPVal-ilvE05

[0820] 1. Construction of pGRB-thiE sgRNA plasmid

[0821] Same as step 1 in step 2 of Example 7.

[0822] 2. Obtaining the ΔthiE-Up-Down Fragment

[0823] Same as step 2 in Example 7.

[0824] 3. Acquisition of YPVal-ilvE04-Cas9 strain

[0825] According to step 3 in step 2 of Example 7, the competent cells of the engineered bacteria YPVal-ilvE01 were replaced with the competent cells of the engineered bacteria YPVal-ilvE04, and the other steps remained unchanged to obtain the YPVal-ilvE04-Cas9 strain.

[0826] 4. Obtaining the engineered bacteria YPVal-ilvE05

[0827] According to step 4 in step 2 of Example 7, the YPVal-ilvE01-Cas9 strain was replaced with the YPVal-ilvE04-Cas9 strain, and the other steps remained unchanged to obtain the engineered bacteria YPVal-ilvE05.

[0828] 3. Obtaining the engineered bacteria YPVal-ilvE06

[0829] 1. Construction of pGRB-mdh sgRNA plasmid

[0830] Same as step 1 in step 3 of Example 7.

[0831] 2. Obtaining the Δmdh-Up-Down Fragment

[0832] Same as step 2 in step 3 of Example 7.

[0833] 3. Acquisition of YPVal-ilvE05-Cas9 strain

[0834] According to step 3 in step 3 of Example 7, the competent cells of the engineered bacteria YPVal-ilvE02 were replaced with the competent cells of the engineered bacteria YPVal-ilvE05, and the other steps remained unchanged to obtain the YPVal-ilvE05-Cas9 strain.

[0835] 4. Obtaining the engineered bacteria YPVal-ilvE06

[0836] According to step 4 in step 3 of Example 7, the YPVal-ilvE02-Cas9 strain was replaced with the YPVal-ilvE05-Cas9 strain, and the other steps remained unchanged to obtain the engineered bacteria YPVal-ilvE06.

[0837] Example 9: Fermentation production of L-valine using the engineered bacteria obtained from Examples 7 and 8

[0838] 1. The engineered bacteria YPVal-ilvE01, YPVal-ilvE02, YPVal-ilvE03, YPVal-ilvE04, YPVal-ilvE05 and YPVal-ilvE06 obtained in Example 7 and Example 8, as well as the starting bacteria valine-producing bacteria CGMCC 22721 and Escherichia coli W3110 were fermented in a fermenter (Shanghai Bailun Biotechnology Co., Ltd., model BLBIO-5GC-4-H) to obtain a fermentation broth.

[0839] Fermentation was repeated three times for each strain.

[0840] The composition of the fermentation medium used during fermentation is shown in Table 3.

[0841] The fermentation control process is shown in Table 4.

[0842] 2. Use high performance liquid chromatography to detect the L-valine production in the fermentation broth.

[0843] The results of three fermentations using the valine-producing strain CGMCC 22721 and the engineered strains YPVal-ilvE01, YPVal-ilvE02, and YPVal-ilvE03 derived from this strain are shown in Table 13 (P values ​​< 0.01 indicate a highly significant difference). The results showed that YPVal-ilvE01, YPVal-ilvE02, and YPVal-ilvE03 all significantly increased L-valine production compared to the valine-producing strain CGMCC 22721. That is, in the valine-producing bacteria CGMCC 22721, the engineered bacteria obtained by knocking out the ilvE (E) gene and simultaneously inserting the ilvE (B) from Bacillus subtilis driven by ptrc, or knocking out the ilvE gene (E) and simultaneously inserting the ilvE (B) from Bacillus subtilis driven by ptrc and knocking out the thiE gene, or knocking out the ilvE gene (E) and simultaneously inserting the ilvE (B) from Bacillus subtilis driven by ptrc and knocking out the thiE gene and the mdh gene can all increase the production of L-valine.

[0844] Table 13

[0845] The results of three fermentations using E. coli W3110 and the engineered strains YPVal-ilvE04, YPVal-ilvE05, and YPVal-ilvE06 derived from E. coli W3110 are shown in Table 14 (P values ​​< 0.01 indicate a highly significant difference). The results demonstrate that YPVal-ilvE04, YPVal-ilvE05, and YPVal-ilvE06 significantly increased L-valine production compared to E. coli W3110. That is, in Escherichia coli W3110, the engineered bacteria obtained by knocking out the ilvE gene (E) and simultaneously inserting the ilvE (B) from Bacillus subtilis driven by ptrc, or knocking out the ilvE gene (E) and simultaneously inserting the ilvE (B) from Bacillus subtilis driven by ptrc and knocking out the thiE gene, or knocking out the ilvE gene (E) and simultaneously inserting the ilvE (B) from Bacillus subtilis driven by ptrc and knocking out the thiE gene and the mdh gene can all increase the production of L-valine.

[0846] Table 14

[0847] Example 10: Transformation of the engineered bacteria based on the valine-producing strain CGMCC 22721

[0848] After extensive experiments, the inventors of the present invention modified the valine-producing strain CGMCC 22721 to obtain engineered strains YPVal-thiE01, YPVal-thiE02, and YPVal-mdh01. The genotypes of the engineered strains YPVal-thiE01, YPVal-thiE02, and YPVal-mdh01 are shown in Table 15.

[0849] Table 15

[0850] 1. Obtaining the engineered bacteria YPVal-thiE01

[0851] Based on the Escherichia coli W3110 genome sequence published by NCBI, the thiE gene in the genome of the valine-producing bacterium CGMCC 22721 was knocked out using CRISPR / Cas9 gene editing technology to obtain the engineered bacterium YPVal-thiE01, hereinafter referred to as YPVal-thiE01.

[0852] The thiE gene encodes thiamine phosphate synthase, its Gene ID is 948491, and its amino acid sequence is shown in SEQ ID No.17.

[0853] The specific steps are as follows:

[0854] 1. Construction of pGRB-thiE sgRNA plasmid

[0855] Based on the Escherichia coli W3110 genome sequence published by NCBI, the sgRNA target sequence for knocking out the thiE gene (shown in SEQ ID No. 9) was designed using CRISPR RGEN Tools (http: / / www.rgenome.net / cas-designer / ). Linearized pGRB vector homology arm sequences were added to the 5' and 3' ends of the target sequence to construct the sgRNA plasmid.

[0856] (1) Primer sgRNA-4F was synthesized by Invitrogen:

[0857] 5'-TGACAGCTAGCTCAGTCCTAGGTATAATACTAGTcgcccctcttatatcgcgctgggGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGG-3' (shown in SEQ ID No. 43, the underlined sequence is the homology arm sequence of the pGRB vector) and primer sgRNA-4R:

[0858] 5'-CCTTATTTTAACTTGCTATTTCTAGCTCTAAAACcccagcgcgatataagaggggcgACTAGTATTATACCTAGGACTGAGCTAGCTGTCA-3' (shown in SEQ ID No.44, the underline is the homology arm sequence of the pGRB vector), primer sgRNA-PF:

[0859] 5'-GTCTCATGAGCGGATACATATTTG-3' (SEQ ID No. 21) and primer sgRNA-PR:

[0860] 5'-ATGAGAAAGCGCCACGCT-3' (SEQ ID No. 22).

[0861] (2) Primer sgRNA-4F and primer sgRNA-4R were annealed (reaction procedure: denaturation at 95°C for 5 minutes, annealing at 50°C for 1 minute), and then the target fragment was recovered using a DNA purification kit, its DNA concentration was determined, and the concentration was diluted to 100 ng / μL to obtain an annealing product. The annealing product contained the sgRNA-4 fragment with the nucleotide sequence shown in SEQ ID No. 9.

[0862] (3) The pGRB vector was digested with the restriction endonuclease SpeI, and a DNA fragment of approximately 2700 bp was recovered using a QIAGEN Gel Extraction Kit.

[0863] The enzyme digestion system is 50 μL, consisting of 5 μL 10× Buffer (provided with restriction endonuclease SpeI), 2.5 μL restriction endonuclease SpeI, 3000-5000 ng pGRB vector and ddH2O.

[0864] Enzyme digestion procedure: 37°C for 3 h.

[0865] (4) The DNA fragment recovered in step (3) was subjected to a dephosphorylation reaction (to prevent the pGRB vector from self-ligating), and recovered using a DNA recovery kit to obtain a linearized pGRB vector.

[0866] The dephosphorylation system is 50 μL, consisting of 5 μL 10× Buffer (provided by CIAP), 1000-2000 ng of DNA fragments recovered in step (3), 2.5 μL CIAP and ddH2O.

[0867] Dephosphorylation procedure: 37°C for 1 h.

[0868] (5) The linearized pGRB vector obtained in step (4) and the annealing product obtained in step (2) were recombined using the Gibson Assembly kit, and then transformed into Escherichia coli DH5α competent cells to obtain the pGRB-thiE sgRNA plasmid.

[0869] The recombinant system was 5 μL, consisting of 2 μL of linearized pGRB vector, 0.5 μL of annealed product, and 2.5 μL of assembly enzyme (provided by the Gibson Assembly kit).

[0870] Recombination procedure: 50°C for 30 min.

[0871] 2. Obtaining the ΔthiE-Up-Down Fragment

[0872] (1) Based on the Escherichia coli W3110 genome sequence published by NCBI, a primer pair for amplifying the upstream homology arm and a primer pair for amplifying the downstream homology arm were designed and synthesized by Invitrogen.

[0873] The primer pair used to amplify the upstream homology arm consists of primer P15:

[0874] 5'-TTCTATTCAGGACGCCAACG-3' (SEQ ID No. 45) and primer P16:

[0875] Composed of 5'-GCTATAACGCATAAAGTCACGGCACGCTTCCTCCTTACGCAGG-3' (SEQ ID No. 46).

[0876] The primer pair used to amplify the downstream homology arms consists of primer P17:

[0877] 5'-CCTGCGTAAGGAGGAAGCGTGCCGTGACTTTATGCGTTATAGC-3' (SEQ ID No. 47) and primer P18: 5'-GCCTGCAAAGTGCCCATAACCC-3' (SEQ ID No. 48).

[0878] (2) Using the genomic DNA of Escherichia coli W3110 as a template, a primer pair consisting of primer P15 and primer P16 was used for PCR amplification using the high-fidelity amplification enzyme KAPA HiFi HotStart, and a DNA recovery kit was used to recover the upstream homology arm with a size of 721 bp.

[0879] (3) Using the genomic DNA of Escherichia coli W3110 as a template, a primer pair consisting of primer P17 and primer P18 was used for PCR amplification using the high-fidelity amplification enzyme KAPA HiFi HotStart, and a downstream homology arm of 618 bp was recovered using a DNA recovery kit.

[0880] (4) The upstream homology arm recovered in step (2) and the downstream homology arm recovered in step (3) were mixed and used as templates, and overlap PCR was performed using a primer pair consisting of primer P15 and primer P18 to obtain the ΔthiE-Up-Down fragment shown in SEQ ID No. 10.

[0881] 3. Acquisition of CGMCC 22721-Cas9 strain

[0882] (1) The plasmid pREDCas9 (product of Addgene, catalog number 71541; containing the spectinomycin resistance gene) was transformed into valine-producing bacteria CGMCC 22721 competent cells, and then spread on 2-YT agar plates containing 100 mg / L spectinomycin and cultured at 32°C to obtain spectinomycin-resistant single colonies.

[0883] 2-YT agar plates were prepared as follows: 16 g of tryptone, 10 g of yeast extract powder, 5 g of sodium chloride, and 16 g of agar powder were dissolved in an appropriate amount of water, and the volume was made up to 1 L with water. The pH value was adjusted to 7.0 with sodium hydroxide, and the plates were sterilized at 121°C for 20 minutes.

[0884] (2) Using the single colonies obtained in step (1) as templates, PCR amplification was performed using a primer pair consisting of primer pRedCas9-PF: 5'-GCAGTGGCGGTTTTCATG-3' (SEQ ID No. 27) and primer pRedCas9-PR: 5'-CCTTGGTGATCTCGCCTTTC-3' (SEQ ID No. 28) to obtain PCR amplification products. If the PCR amplification product obtained from a single colony contains a DNA fragment with a nucleotide sequence as shown in SEQ ID No. 3, the colony contains plasmid pREDCas9. The strain of the colony was named CGMCC 22721-Cas9 strain.

[0885] 4. Obtaining the engineered bacteria YPVal-thiE01

[0886] (1) Cultivate CGMCC 22721-Cas9 strain; when CGMCC 22721-Cas9 strain grows to OD 600nmWhen the OD value was 0.1, IPTG was added to make the concentration of IPTG in the system 0.1 mM, and the culture was continued to induce λ-Red-mediated homologous recombination; when the CGMCC 22721-Cas9 strain grew to OD 600nm When the p-value was 0.6, the bacteria were collected and CGMCC 22721-Cas9 competent cells were prepared.

[0887] (2) The pGRB-thiE sgRNA plasmid obtained in step 1 and the ΔthiE-Up-Down fragment obtained in step 2 were transformed into CGMCC 22721-Cas9 competent cells, spread on 2-YT agar plates containing 100 mg / L spectinomycin and 100 mg / L ampicillin, and cultured at 32°C to obtain single colonies.

[0888] (3) Using the single colonies obtained in step (2) as templates, PCR amplification was performed using a primer pair consisting of primers P15 and P18 to obtain PCR amplification products. If the PCR amplification product obtained from a single colony contains a DNA fragment of 1296 bp, the colony is preliminarily identified as a positive transformant.

[0889] (4) The positive transformants obtained in step (3) were inoculated on 2-YT agar plates containing 100 mg / L spectinomycin and 0.2% (m / v) arabinose and cultured at 32°C (for eliminating the pGRB-thiE sgRNA plasmid); then, colonies that grew on 2-YT agar plates containing 100 mg / L spectinomycin but did not grow on 2-YT agar plates containing 100 mg / L ampicillin were selected, and these colonies were transferred to 2-YT agar plates and cultured at 42°C (for eliminating the plasmid pREDCas9); finally, colonies that did not grow on 2-YT agar plates containing 100 mg / L spectinomycin but grew on 2-YT agar plates without antibiotics were selected.

[0890] (5) Using the single colony obtained in step (4) as a template, PCR amplification is performed using a primer pair consisting of primers P15 and P18 to obtain a PCR amplification product. If the PCR amplification product obtained from a single colony contains a DNA fragment of 1296 bp, the colony is identified as a positive transformant lacking the thiE gene in the genome of the valine-producing bacterium CGMCC 22721. The positive transformant is named the engineered bacterium YPVal-thiE01.

[0891] 2. Obtaining the engineered strain YPVal-mdh01

[0892] Based on the Escherichia coli W3110 genome sequence published by NCBI, the mdh gene in the genome of the valine-producing bacterium CGMCC 22721 was knocked out using CRISPR / Cas9 gene editing technology to obtain the engineered bacterium YPVal-mdh01, hereinafter referred to as YPVal-mdh01.

[0893] The mdh gene encodes malate dehydrogenase, its Gene ID is 947854, and its amino acid sequence is shown in SEQ ID No.18.

[0894] The specific steps are as follows:

[0895] 1. Construction of pGRB-mdh sgRNA plasmid

[0896] Based on the Escherichia coli W3110 genome sequence published by NCBI, the sgRNA target sequence for knocking out the mdh gene (shown in SEQ ID No. 11) was designed using CRISPR RGEN Tools (http: / / www.rgenome.net / cas-designer / ). Linearized pGRB vector homology arm sequences were added to the 5' and 3' ends of the target sequence to construct the sgRNA plasmid.

[0897] (1) Primer sgRNA-5F was synthesized by Invitrogen:

[0898] 5'-TGACAGCTAGCTCAGTCCTAGGTATAATACTAGTgcctttcagttccgcaacaaaggGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGG-3' (shown in SEQ ID No. 49, the underlined sequence is the homology arm sequence of the pGRB vector) and primer sgRNA-5R:

[0899] 5′-CCTTATTTTAACTTGCTATTTCTAGCTCTAAAACcctttgttgcggaactgaaaggcACTAGTATTATACCTAGGACTGAGCTAGCTGTCA-3′ (shown in SEQ ID No. 50, the underlined sequence is the homology arm sequence of the pGRB vector).

[0900] (2) Primer sgRNA-5F and primer sgRNA-5R were annealed (reaction procedure: denaturation at 95°C for 5 minutes, annealing at 50°C for 1 minute), and then the target fragment was recovered using a DNA purification kit, its DNA concentration was determined, and the concentration was diluted to 100 ng / μL to obtain an annealing product. The annealing product contained the sgRNA-5 fragment with the nucleotide sequence shown in SEQ ID No. 11.

[0901] (3) The pGRB vector was digested with the restriction endonuclease SpeI, and a DNA fragment of approximately 2700 bp was recovered using a QIAGEN Gel Extraction Kit.

[0902] The enzyme digestion system is 50 μL, consisting of 5 μL 10× Buffer (provided with restriction endonuclease SpeI), 2.5 μL restriction endonuclease SpeI, 3000-5000 ng pGRB vector and ddH2O.

[0903] Enzyme digestion procedure: 37°C for 3 h.

[0904] (4) The DNA fragment recovered in step (3) was subjected to a dephosphorylation reaction (to prevent the pGRB vector from self-ligating), and recovered using a DNA recovery kit to obtain a linearized pGRB vector.

[0905] The dephosphorylation system is 50 μL, consisting of 5 μL 10× Buffer (provided by CIAP), 1000-2000 ng of DNA fragments recovered in step (3), 2.5 μL CIAP and ddH2O.

[0906] Dephosphorylation procedure: 37°C for 1 h.

[0907] (5) The linearized pGRB vector obtained in step (4) and the annealing product obtained in step (2) were recombined using the Gibson Assembly kit, and then transformed into Escherichia coli DH5α competent cells to obtain the pGRB-mdh sgRNA plasmid.

[0908] The recombinant system was 5 μL, consisting of 2 μL of linearized pGRB vector, 0.5 μL of annealed product, and 2.5 μL of assembly enzyme (provided by the Gibson Assembly kit).

[0909] Recombination procedure: 50°C for 30 min.

[0910] 2. Obtaining the Δmdh-Up-Down Fragment

[0911] (1) Based on the Escherichia coli W3110 genome sequence published by NCBI, a primer pair for amplifying the upstream homology arm and a primer pair for amplifying the downstream homology arm were designed and synthesized by Invitrogen.

[0912] The primer pair used to amplify the upstream homology arm consists of primer P19:

[0913] 5'-AACTTCCTCCAAACCGATGC-3' (SEQ ID No. 51) and primer P20:

[0914] Composed of 5'-CAATATAATAAGGAGTTTAGGTTGATTAGCGGATAATAAAAAACC-3' (SEQ ID No. 52).

[0915] The primer pair used to amplify the downstream homology arms consists of primer P21:

[0916] 5'-GGTTTTTTATTATCCGCTAATCAACCTAAACTCCTTATTATATTG-3' (SEQ ID No. 53) and primer P22: 5'-TCTTCAATGGACTGGAGGTG-3' (SEQ ID No. 54).

[0917] (2) Using the genomic DNA of Escherichia coli W3110 as a template, a primer pair consisting of primer P19 and primer P20 was used for PCR amplification using the high-fidelity amplification enzyme KAPA HiFi HotStart, and a DNA recovery kit was used to recover the upstream homology arm of 590 bp in size.

[0918] (3) Using the genomic DNA of Escherichia coli W3110 as a template, a primer pair consisting of primer P21 and primer P22 was used for PCR amplification using the high-fidelity amplification enzyme KAPA HiFi HotStart, and a downstream homology arm of 708 bp in size was recovered using a DNA recovery kit.

[0919] (4) The upstream homology arm recovered in step (2) and the downstream homology arm recovered in step (3) were mixed and used as templates, and overlap PCR was performed using a primer pair consisting of primer P19 and primer P22 to obtain the Δmdh-Up-Down fragment shown in SEQ ID No. 12.

[0920] 3. Acquisition of CGMCC 22721-Cas9 strain

[0921] Same as step 1, step 3.

[0922] 4. Acquisition of engineered bacteria YPVal-mdh01

[0923] (1) Cultivate CGMCC 22721-Cas9 strain; when CGMCC 22721-Cas9 strain grows to OD 600nm When the OD value was 0.1, IPTG was added to make the concentration of IPTG in the system 0.1 mM, and the culture was continued to induce λ-Red-mediated homologous recombination; when the CGMCC 22721-Cas9 strain grew to OD 600nm When the p-value was 0.6, the bacteria were collected and CGMCC 22721-Cas9 competent cells were prepared.

[0924] (2) The pGRB-mdh sgRNA plasmid obtained in step 1 and the Δmdh-Up-Down fragment obtained in step 2 were transformed into CGMCC 22721-Cas9 competent cells, spread on 2-YT agar plates containing 100 mg / L spectinomycin and 100 mg / L ampicillin, and cultured at 32°C to obtain single colonies.

[0925] (3) Using the single colonies obtained in step (2) as templates, PCR amplification was performed using a primer pair consisting of primers P19 and P22 to obtain PCR amplification products. If the PCR amplification product obtained from a single colony contains a DNA fragment of 1253 bp, the colony is preliminarily identified as a positive transformant.

[0926] (4) The positive transformants obtained in step (3) were inoculated on 2-YT agar plates containing 100 mg / L spectinomycin and 0.2% (m / v) arabinose and cultured at 32°C (for eliminating the pGRB-mdh sgRNA plasmid); then, colonies that grew on 2-YT agar plates containing 100 mg / L spectinomycin but did not grow on 2-YT agar plates containing 100 mg / L ampicillin were selected, and these colonies were transferred to 2-YT agar plates and cultured at 42°C (for eliminating the plasmid pREDCas9); finally, colonies that did not grow on 2-YT agar plates containing 100 mg / L spectinomycin but grew on 2-YT agar plates without antibiotics were selected.

[0927] (5) Using the single colony obtained in step (4) as a template, PCR amplification is performed using a primer pair consisting of primers P19 and P22 to obtain a PCR amplification product. If the PCR amplification product obtained from a single colony contains a DNA fragment of 1253 bp, the colony is identified as a positive transformant lacking the mdh gene in the genome of the valine-producing bacterium CGMCC 22721. The positive transformant is named the engineered bacterium YPVal-mdh01.

[0928] 3. Obtaining the engineered bacteria YPVal-thiE02

[0929] The engineered bacteria YPVal-thiE01 obtained in step 1 was used as the starting bacteria. Based on the Escherichia coli W3110 genome sequence published by NCBI, the mdh gene in the genome of the engineered bacteria YPVal-thiE01 was knocked out using CRISPR / Cas9 gene editing technology.

[0930] The mdh gene encodes malate dehydrogenase, its Gene ID is 947854, and its amino acid sequence is shown in SEQ ID No.18.

[0931] The specific steps are as follows:

[0932] 1. Construction of pGRB-mdh sgRNA plasmid

[0933] Same as step 1 in step 2.

[0934] 2. Obtaining the Δmdh-Up-Down Fragment

[0935] Same as step 2.

[0936] 3. Acquisition of YPVal-thiE01-Cas9 strain

[0937] (1) The plasmid pREDCas9 was transformed into the competent cells of the engineered bacteria YPVal-thiE01, and then spread on 2-YT agar plates containing 100 mg / L spectinomycin and cultured at 32°C to obtain single colonies resistant to spectinomycin.

[0938] (2) Using the single colonies obtained in step (1) as templates, PCR amplification was performed using a primer pair consisting of primers pRedCas9-PF and primers pRedCas9-PR to obtain PCR amplification products. If the PCR amplification product obtained from a single colony contains a DNA fragment with a nucleotide sequence as shown in SEQ ID No. 3, then the colony contains the plasmid pREDCas9. The strain of the colony was named YPVal-thiE01-Cas9 strain.

[0939] 4. Obtaining the engineered bacteria YPVal-thiE02

[0940] (1) Cultivate the YPVal-thiE01-Cas9 strain; when the YPVal-thiE01-Cas9 strain grows to OD 600nm When the OD value was 0.1, IPTG was added to make the concentration of IPTG in the system 0.1 mM, and the culture was continued to induce λ-Red-mediated homologous recombination; when the YPVal-thiE01-Cas9 strain grew to OD 600nmWhen the pH value was 0.6, the bacteria were collected and competent cells of the YPVal-thiE01-Cas9 strain were prepared.

[0941] (2) The pGRB-mdh sgRNA plasmid obtained in step 1 and the Δmdh-Up-Down fragment obtained in step 2 were transformed into the competent cells of the YPVal-thiE01-Cas9 strain, spread on a 2-YT agar plate containing 100 mg / L spectinomycin and 100 mg / L ampicillin, and cultured at 32°C to obtain single colonies.

[0942] (3) Using the single colonies obtained in step (2) as templates, PCR amplification was performed using a primer pair consisting of primers P19 and P22 to obtain PCR amplification products. If the PCR amplification product obtained from a single colony contains a DNA fragment of 1253 bp, the colony is preliminarily identified as a positive transformant.

[0943] (4) The positive transformants obtained in step (3) were inoculated on 2-YT agar plates containing 100 mg / L spectinomycin and 0.2% (m / v) arabinose and cultured at 32°C (for eliminating the pGRB-mdh sgRNA plasmid); then, colonies that grew on 2-YT agar plates containing 100 mg / L spectinomycin but did not grow on 2-YT agar plates containing 100 mg / L ampicillin were selected, and these colonies were transferred to 2-YT agar plates and cultured at 42°C (for eliminating the plasmid pREDCas9); finally, colonies that did not grow on 2-YT agar plates containing 100 mg / L spectinomycin but grew on 2-YT agar plates without antibiotics were selected.

[0944] (5) Using the single colony obtained in step (4) as a template, PCR amplification was performed using a primer pair consisting of primers P19 and P22 to obtain a PCR amplification product. If the PCR amplification product obtained from a single colony contains a DNA fragment of 1253 bp, the colony is identified as a positive transformant lacking the mdh gene in the genome of the engineered strain YPVal-thiE01. The positive transformant is named engineered strain YPVal-thiE02.

[0945] Example 11: Transformation of an engineered bacterium based on Escherichia coli W3110

[0946] After extensive experiments, the inventors of the present invention modified E. coli W3110 to obtain engineered strains YPVal-thiE03, YPVal-thiE04, and YPVal-mdh02. The genotypes of the engineered strains YPVal-thiE03, YPVal-thiE04, and YPVal-mdh02 are shown in Table 16.

[0947] Table 16

[0948] 1. Acquisition of the engineered strain YPVal-thiE03

[0949] 1. Construction of pGRB-thiE sgRNA plasmid

[0950] Same as step 1 in Example 10.

[0951] 2. Obtaining the ΔthiE-Up-Down Fragment

[0952] Same as step 2 in Example 10.

[0953] 3. Acquisition of W3110-Cas9 strain

[0954] According to step 3 in step 1 of Example 10, the valine-producing bacteria CGMCC 22721 competent cells were replaced with Escherichia coli W3110 competent cells, and the other steps remained unchanged to obtain the W3110-Cas9 strain.

[0955] 4. Obtaining the engineered bacteria YPVal-thiE03

[0956] According to step 4 in step 1 of Example 10, the CGMCC 22721-Cas9 strain was replaced with the W3110-Cas9 strain, and the other steps remained unchanged to obtain the engineered bacteria YPVal-thiE03.

[0957] 2. Obtaining the engineered strain YPVal-mdh02

[0958] 1. Construction of pGRB-mdh sgRNA plasmid

[0959] Same as 1 in step 2 of Example 10.

[0960] 2. Obtaining the Δmdh-Up-Down Fragment

[0961] Same as 2 in step 2 of Example 10.

[0962] 3. Acquisition of W3110-Cas9 strain

[0963] According to step 3 in step 1 of Example 10, the valine-producing bacteria CGMCC 22721 competent cells were replaced with Escherichia coli W3110 competent cells, and the other steps remained unchanged to obtain the W3110-Cas9 strain.

[0964] 4. Acquisition of engineered bacteria YPVal-mdh02

[0965] According to step 4 in step 2 of Example 10, the CGMCC 22721-Cas9 strain was replaced with the W3110-Cas9 strain, and the other steps remained unchanged to obtain the engineered bacteria YPVal-mdh02.

[0966] 3. Obtaining the engineered bacteria YPVal-thiE04

[0967] 1. Construction of pGRB-mdh sgRNA plasmid

[0968] Same as 1 in step 2 of Example 10.

[0969] 2. Obtaining the Δmdh-Up-Down Fragment

[0970] Same as 2 in step 2 of Example 10.

[0971] 3. Acquisition of YPVal-thiE03-Cas9 strain

[0972] According to step 3 in step 3 of Example 10, the competent cells of the engineered bacteria YPVal-thiE01 were replaced with the competent cells of the engineered bacteria YPVal-thiE03, and the other steps remained unchanged to obtain the YPVal-thiE03-Cas9 strain.

[0973] 4. Obtaining the engineered bacteria YPVal-thiE04

[0974] According to step 4 in step 3 of Example 10, the YPVal-thiE01-Cas9 strain was replaced with the YPVal-thiE03-Cas9 strain, and the other steps remained unchanged to obtain the engineered bacteria YPVal-thiE04.

[0975] Example 12: Fermentation production of L-valine using the engineered bacteria obtained from Examples 10 and 11

[0976] 1. The engineered bacteria YPVal-thiE01, YPVal-thiE02, YPVal-mdh01, YPVal-thiE03, YPVal-thiE04 and YPVal-mdh02 obtained by transformation in Example 10 and Example 11, as well as the starting bacteria valine-producing bacteria CGMCC 22721 and Escherichia coli W3110, were fermented in a fermenter (Shanghai Bailun Biotechnology Co., Ltd., model BLBIO-5GC-4-H) to obtain a fermentation broth.

[0977] Fermentation was repeated three times for each strain.

[0978] The composition of the fermentation medium used during fermentation is shown in Table 3.

[0979] The fermentation control process is shown in Table 4.

[0980] 2. Use high performance liquid chromatography to detect the L-valine production in the fermentation broth.

[0981] The test results of three fermentations of the valine-producing bacteria CGMCC 22721 and the engineered bacteria YPVal-thiE01, YPVal-thiE02, and YPVal-mdh01 obtained based on the valine-producing bacteria CGMCC 22721 are shown in Table 17 (P value < 0.01 indicates a very significant difference). The results show that compared with the valine-producing bacteria CGMCC 22721, YPVal-thiE01, YPVal-thiE02, and YPVal-mdh01 can significantly increase the production of L-valine. In other words, in the valine-producing bacteria CGMCC 22721, the production of L-valine can be increased by knocking out the thiE gene, knocking out the mdh gene, or knocking out the mdh gene while knocking out the thiE gene.

[0982] Table 17

[0983] The test results of the three fermentations of E. coli W3110 and the engineered bacteria YPVal-thiE03, YPVal-thiE04 and YPVal-mdh02 obtained with E. coli W3110 are shown in Table 18 (P value<0.01 represents that the difference is extremely significant). The result shows that, compared with E. coli W3110, YPVal-thiE03, YPVal-thiE04 and YPVal-mdh02 can all significantly improve the output of Valine. That is, in E. coli W3110, knocking out the mdh gene by knocking out the thiE gene or knocking out the mdh gene or knocking out the thiE gene can all improve the output of Valine.

[0984] Table 18

[0985] The present application has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present application, and without the need to carry out unnecessary experiments, the present application can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present application provides specific embodiments, it should be understood that further improvements can be made to the present application. In short, according to the principles of the present application, the present application is intended to include any changes, uses or improvements to the present application, including changes that depart from the disclosed scope in the present application and are made using conventional techniques known in the art. Industrial Applicability

[0986] The present application provides the use of the pflB gene, adhE gene, ilvE(E) gene, ilvE(B) gene, thiE gene and mdh gene in improving the L-amino acid production of Escherichia coli. Experiments show that in Escherichia coli that can produce valine, by inserting the ilvE(B) gene from Bacillus subtilis driven by ptrc and / or knocking out or weakening at least one of the pflB gene, adhE gene, thiE gene, mdh gene and ilvE(E) gene (for example, "knock out the pflB gene", "knock out the pflB gene and adhE gene", "knock out the pflB gene and adhE gene and knock out the ilvE(E) gene and inserting the ilvE(B) gene from Bacillus subtilis driven by ptrc) vE(B) gene", "knockout of the pflB gene, adhE gene and thiE gene and knockout of the ilvE(E) gene, while inserting the ptrc-promoted ilvE(B) gene from Bacillus subtilis", "knockout of the pflB gene, adhE gene, thiE gene and mdh gene and knockout of the ilvE(E) gene, while inserting the ptrc-promoted ilvE(B) gene from Bacillus subtilis", "knockout of the adhE gene", "knockout of the adhE gene and knockout of the ilvE(E) gene "knock out the adhE gene and thiE gene and knock out the ilvE(E) gene and insert the ptrc-driven ilvE(B) gene from Bacillus subtilis" "knock out the adhE gene, thiE gene and mdh gene and knock out the ilvE(E) gene and insert the ptrc-driven ilvE(B) gene from Bacillus subtilis" "knock out the ilvE(E) gene and insert the ptrc-driven ilvE(B) gene from Bacillus subtilis" The following examples demonstrate that knocking out the pflB gene, adhE gene, ilvE(E) gene, ilvE(B) gene from Bacillus subtilis, and simultaneously inserting the ptrc-promoted ilvE(B) gene from Bacillus subtilis, knocking out the thiE gene and the mdh gene, and simultaneously inserting the ptrc-promoted ilvE(B) gene from Bacillus subtilis, and knocking out the thiE gene, the mdh gene, or both knocking out the thiE gene and the mdh gene simultaneously facilitates the accumulation of L-amino acids. Consequently, genetically engineered strains for L-amino acid production can be constructed using the pflB gene, adhE gene, ilvE(E) gene, ilvE(B) gene, thiE gene, and mdh gene, significantly increasing L-amino acid production and reducing costs, which is of great significance for accelerating the industrialization of L-amino acids.

Claims

1. The use of a protein combination, which is at least one of A1) to A5): A1) constructing a genetically engineered bacterium that produces L-amino acids; A2) production of L-amino acids; A3) regulating the production of L-amino acids; A4) preparing products for the production of L-amino acids; A5) preparing food, feed or medicine containing L-amino acid; The protein combination includes at least one of pyruvate formate lyase, alcohol dehydrogenase, branched chain amino acid transaminase derived from Escherichia coli, branched chain amino acid transaminase derived from Bacillus subtilis, thiamine phosphate synthase and malate dehydrogenase; The pyruvate formate lyase is B1) or B2) or B3): B1) a protein with an amino acid sequence as shown in SEQ ID No. 13; B2) a protein having more than 90% identity with the protein shown in B1) and having the same function as the protein shown in B1) obtained by replacing and / or deleting and / or adding amino acid residues of the amino acid sequence shown in SEQ ID No. 13; B3) A fusion protein having the same function obtained by connecting a tag to the N-terminus and / or C-terminus of B1) or B2); The alcohol dehydrogenase is C1) or C2) or C3): C1) a protein whose amino acid sequence is shown in SEQ ID No.14; C2) a protein having more than 90% identity with the protein shown in C1) and having the same function as the protein shown in C1) obtained by substitution and / or deletion and / or addition of amino acid residues of the amino acid sequence shown in SEQ ID No. 14; C3) A fusion protein having the same function obtained by connecting a tag to the N-terminus and / or C-terminus of C1) or C2); The branched-chain amino acid transaminase derived from Escherichia coli is D1) or D2) or D3): D1) a protein with an amino acid sequence as shown in SEQ ID No. 15; D2) a protein having more than 90% identity with the protein shown in D1) and having the same function as the protein shown in D1) obtained by replacing and / or deleting and / or adding amino acid residues of the amino acid sequence shown in SEQ ID No. 15; D3) A fusion protein having the same function obtained by connecting a tag to the N-terminus and / or C-terminus of D1) or D2); The branched chain amino acid transaminase derived from Bacillus subtilis is E1) or E2) or E3): E1) a protein with an amino acid sequence as shown in SEQ ID No. 16; E2) a protein having 90% or more identity with the protein shown in E1) and having the same function as the protein shown in E1) obtained by substitution and / or deletion and / or addition of amino acid residues of the amino acid sequence shown in SEQ ID No. 16; E3) A fusion product with the same function obtained by connecting a tag to the N-terminus and / or C-terminus of E1) or E2) protein; The thiamine phosphate synthase is F1) or F2) or F3): F1) a protein with an amino acid sequence as shown in SEQ ID No. 17; F2) a protein having more than 90% identity with the protein shown in F1) and having the same function as the protein shown in F1) obtained by substitution and / or deletion and / or addition of amino acid residues of the amino acid sequence shown in SEQ ID No. 17; F3) A fusion protein having the same function obtained by connecting a tag to the N-terminus and / or C-terminus of F1) or F2); The malate dehydrogenase is G1) or G2) or G3): G1) a protein whose amino acid sequence is shown in SEQ ID No. 18; G2) a protein having more than 90% identity with the protein shown in G1) and having the same function as the protein shown in G1) obtained by replacing and / or deleting and / or adding amino acid residues of the amino acid sequence shown in SEQ ID No. 18; G3) A fusion protein having the same function is obtained by connecting a tag to the N-terminus and / or C-terminus of G1) or G2).

2. Use of a nucleic acid molecule encoding the protein combination of claim 1, which is at least one of A1) to A5): A1) constructing a genetically engineered bacterium that produces L-amino acids; A2) production of L-amino acids; A3) regulating the production of L-amino acids; A4) preparing products for the production of L-amino acids; A5) Preparation of food, feed or medicine containing L-amino acid.

3. Use of a substance that inhibits or down-regulates the expression and / or activity of pyruvate formate lyase according to claim 1, and / or a substance that inhibits or down-regulates the expression and / or activity of alcohol dehydrogenase according to claim 1, and / or a substance that inhibits or down-regulates the expression and / or activity of Escherichia coli-derived branched-chain amino acid transaminase according to claim 1, and / or a substance that inhibits or down-regulates the expression and / or activity of thiamine phosphate synthase according to claim 1, and / or a substance that inhibits or down-regulates the expression and / or activity of malate dehydrogenase according to claim 1, and / or a substance that increases or increases the expression and / or activity of branched-chain amino acid transaminase derived from Bacillus subtilis according to claim 1, which is at least one of A1) to A5): A1) constructing a genetically engineered bacterium that produces L-amino acids; A2) production of L-amino acids; A3) regulating the production of L-amino acids; A4) preparing products for the production of L-amino acids; A5) Preparation of food, feed or medicine containing L-amino acid.

4. Use of an expression cassette, a recombinant vector, a recombinant bacterium or a recombinant host cell comprising the nucleic acid molecule of claim 2, the substance for inhibiting or down-regulating the expression and / or activity of pyruvate formate lyase of claim 1 of claim 3, the substance for inhibiting or down-regulating the expression and / or activity of alcohol dehydrogenase of claim 1, the substance for inhibiting or down-regulating the expression and / or activity of branched-chain amino acid transaminase derived from Escherichia coli of claim 1, the substance for inhibiting or down-regulating the expression and / or activity of thiamine phosphate synthase of claim 1, the substance for inhibiting or down-regulating the expression and / or activity of malate dehydrogenase of claim 1 and / or the substance for increasing or increasing the expression and / or activity of branched-chain amino acid transaminase derived from Bacillus subtilis of claim 1, which is at least one of A1) to A5): A1) constructing a genetically engineered bacterium that produces L-amino acids; A2) production of L-amino acids; A3) regulating the production of L-amino acids; A4) preparing products for the production of L-amino acids; A5) Preparation of food, feed or medicine containing L-amino acid.

5. A recombinant bacterium, characterized in that: A recombinant bacterium is obtained by weakly expressing or not expressing at least one of the pyruvate formate lyase, the ethanol dehydrogenase, the branched-chain amino acid transaminase derived from Escherichia coli, the thiamine phosphate synthase and the malate dehydrogenase in claim 1 in the starting bacterium; and / or expressing or overexpressing the branched-chain amino acid transaminase derived from Bacillus subtilis in claim 1.

6. The recombinant bacterium according to claim 5, characterized in that: The weak expression or no expression is achieved by reducing the expression amount and / or activity of the pyruvate formate lyase, the ethanol dehydrogenase, the Escherichia coli-derived branched chain amino acid transaminase, the thiamine phosphate synthase and / or the malate dehydrogenase in the starting bacteria; The expression or overexpression is achieved by introducing the gene encoding the branched chain amino acid transaminase derived from Bacillus subtilis into the starting bacteria.

7. The recombinant bacterium according to claim 6, characterized in that: The method of reducing the expression amount and / or activity of the pyruvate formate lyase, the ethanol dehydrogenase, the branched-chain amino acid transaminase derived from Escherichia coli, the thiamine phosphate synthase and / or the malate dehydrogenase in the starting bacteria is to reduce the expression amount, reduce the activity or inactivate the pyruvate formate lyase, the ethanol dehydrogenase, the branched-chain amino acid transaminase derived from Escherichia coli, the thiamine phosphate synthase and / or the malate dehydrogenase in the starting bacteria through gene editing, gene knockout, gene mutation or gene attenuation technology.

8. A method for increasing the yield of L-amino acids, comprising the following steps: reducing the expression level and / or activity of at least one of the pyruvate formate lyase, the ethanol dehydrogenase, the Escherichia coli-derived branched-chain amino acid transaminase, the thiamine phosphate synthase and the malate dehydrogenase in the starting bacteria according to claim 1, and / or increasing the expression level and / or activity of the Bacillus subtilis-derived branched-chain amino acid transaminase according to claim 1, to obtain a recombinant bacterium; The L-amino acid production of the recombinant bacteria was higher than that of the original bacteria.

9. The method according to claim 8, characterized in that: The method for reducing the pyruvate formate lyase, the ethanol dehydrogenase, the Escherichia coli derived branched chain amino acid transaminase, the thiamine phosphate synthase and the malate dehydrogenase in claim 1 in the starting bacteria The expression level and / or activity of at least one of the enzymes is reduced, the activity is reduced or inactivated by gene editing, gene knockout, gene mutation or gene attenuation technology to reduce the expression level, activity or inactivate the pyruvate formate lyase, the ethanol dehydrogenase, the Escherichia coli-derived branched chain amino acid transaminase, the thiamine phosphate synthase and / or the malate dehydrogenase in the starting bacteria; The increasing of the expression level and / or activity of the branched-chain amino acid transaminase derived from Bacillus subtilis in claim 1 is achieved by introducing a gene encoding the branched-chain amino acid transaminase derived from Bacillus subtilis into the starting bacteria.

10. A method for producing L-amino acids, comprising the following steps: fermenting and culturing the recombinant bacteria according to any one of claims 5 to 7, collecting the fermentation product, and obtaining L-amino acids therefrom.

11. The use according to any one of claims 1 to 4 or the method according to claim 8 or 10, characterized in that: The L-amino acid is L-valine.

12. The recombinant bacterium according to any one of claims 5 to 7 or the method according to claim 8 or 9, characterized in that: The starting bacteria is Escherichia coli.

13. The use of the recombinant bacteria according to any one of claims 5 to 7, which is at least one of A2) to A5): A2) production of L-amino acids; A3) regulating the production of L-amino acids; A4) preparing products for the production of L-amino acids; A5) Preparation of food, feed or medicine containing L-amino acid.

Images