Nucleic acid encoding ATP7b, adeno-associated virus vector and use thereof in preparing drug for preventing and treating wilson's disease

Abstract

The present invention relates to a nucleic acid encoding ATP7B, an adeno-associated virus vector, and a use thereof in preparing a drug for preventing and treating Wilson's disease. Provided is an ATP7B GOI vector that can be packaged into an adeno-associated virus having cellular activity, relatively high yield and good integrity, which can be used in AAV gene therapy for WD. By means of using an engineered tissue-specific promoter and a truncated natural ATP7B gene having a unique sequence, the sequence length is suitable for packaging into an active adeno-associated virus particle, potential side effects caused by gene expression in tissues other than the liver are minimized, and it is expected to have better in vivo safety.

Description

Nucleic acid encoding ATP7B, adeno-associated virus vector and use thereof in preparing drugs for preventing and treating hepatolenticular degeneration

[0001] This application claims priority to the Chinese patent application filed with the China Patent Office on June 28, 2023, with application number 202310780255.3 and invention name “Nucleic acid encoding ATP7B, adeno-associated virus vector and its use in the preparation of drugs for preventing and treating hepatolenticular degeneration”, the entire contents of which are incorporated by reference into this application. Technical Field

[0002] The present invention relates to the field of biomedicine technology, and in particular to a nucleic acid encoding ATP7B, an adeno-associated virus vector and applications thereof in preparing a drug for preventing and treating hepatolenticular degeneration. Background Art

[0003] Wilson's disease (WD) is an autosomal recessive, single-gene inherited disorder characterized by impaired copper metabolism. It is caused by mutations in the ATP7B gene, which weaken or even abolish the function of the copper-transporting P-type ATPase (ATP7B). ATP7B is a membrane protein expressed in multiple organs that primarily facilitates copper excretion in the blood and bile. Mutations in the ATP7B gene alter ATP7B's intracellular localization, reducing its ability to transport copper. This leads to decreased serum ceruloplasmin synthesis and reduced copper excretion in the bile. This leads to varying degrees of excessive copper deposition in organs such as the liver, brain, kidneys, and cornea, causing progressively worsening neuropsychiatric symptoms, liver biochemical abnormalities, corneal KF rings, renal damage, hemolytic anemia, and skeletal muscle damage, severely impacting patients' quality of life and potentially causing liver failure and death. The ATP7B gene is located on the long arm of chromosome 13 (13q14.3–q21.1). It is approximately 85 kb long and contains 21 exons and 20 introns. It encodes a 1465-amino acid sequence encoding a copper-transporting P-type ATPase. ATP7B is a transmembrane protein composed of six N-terminal metal-binding domains (MBDs), eight transmembrane channels (TM-regions), one ATP-binding nucleotide-binding domain (N-region), one phosphorylation domain (P-region), and one phosphatase domain (A-region). The MBDs contain a conserved amino acid motif that binds copper ions with high affinity. Upon interaction with antioxidant protein-1 (Atox-1), the MBDs receive copper transported from the cytoplasm and release it into the transmembrane channel. ATP7B is synthesized in the endoplasmic reticulum and ultimately localized in the trans-Golgi network (TGN) of hepatocytes. Copper is an essential trace element for the human body, involved in many physiological processes, including the mitochondrial respiratory chain, neurotransmitter synthesis, and iron metabolism. ATP7B is crucial for regulating the distribution and transport of copper in hepatocytes. In the TGN, ATP7B supplies copper ions for the synthesis of new ceruloplasmin. When copper is excessive, ATP7B maintains cytoplasmic copper levels and transports excess copper to vesicles, where it enters the bile via exocytosis. Mutations in the ATP7B gene may disrupt the function of the expressed product, impairing copper excretion from hepatocytes, leading to the accumulation of copper toxicity in the liver, and inducing the clinical symptoms of Wilson's disease.

[0004] Hepatolenticular degeneration-associated ATP7B mutations reveal several hotspot mutations and numerous rare mutation sites, most of which are located in exons within the transmembrane region and functional domains of the ATP7B gene. Mutation types include missense, nonsense, deletions, insertions, splicing, and point mutations, with missense or nonsense mutations caused by single nucleotide sequences being the most common. Mutations affect copper binding, cyclic phosphorylation, trafficking, and post-translational modification of ATP7B, as well as its physiological interactions with other proteins, potentially interfering with ATP7B's role in excreting excess copper into bile and in the biosynthesis of ceruloplasmin, which is essential for normal iron metabolism.

[0005] Current medications for Wilson disease include penicillamine, trientine, ammonium tetrathiomolybdate, and zinc supplements. While existing drugs are effective for most WD patients, some cannot tolerate the treatment or experience severe adverse reactions. Furthermore, drugs like penicillamine require multiple daily oral doses and lifelong adherence, leading to poor patient compliance. Consequently, there is a growing need for novel treatments for WD. As a monogenic genetic disorder, gene therapy is the ideal approach. The ATP7B gene responsible for Wilson disease has been cloned, laying the foundation for gene therapy research. Gene therapy involves the introduction of exogenous, normal genes into target cells to correct or compensate for diseases caused by defective or abnormal genes, thereby achieving therapeutic goals. To date, researchers have used adeno-associated virus (AAV) vectors in clinical studies for conditions such as α1 antitrypsin deficiency, Alzheimer's disease, hemophilia, Leber congenital amaurosis, muscular dystrophy, and Parkinson's disease. As the field matures, a large number of gene therapy products have been approved for clinical trials, making gene therapy a viable option for the clinical treatment of inherited genetic diseases, as well as diseases such as tumors and infectious diseases. However, the packaging capacity of AAV vectors is generally limited. Maximizing transduction efficiency while meeting AAV packaging capacity, while also improving product purity and solidity, remains a pressing challenge in this field.

[0006] Summary of the Invention

[0007] In view of this, the technical problem to be solved by the present invention is to provide a nucleic acid encoding ATP7B, an adeno-associated virus vector and their use in preparing a drug for preventing and treating Wilson's disease.

[0008] The present invention provides a nucleic acid encoding ATP7B, comprising at least one of I) to IV):

[0009] 1) a nucleic acid having a nucleotide sequence as shown in SEQ ID NO: 1 or 2;

[0010] II), a nucleic acid in which one or more nucleotides are substituted, deleted or added in the fragment described in I);

[0011] III), a nucleic acid having at least 90% homology to the sequence of the nucleic acid described in I), and encoding ATP7B;

[0012] IV) A nucleic acid that is partially complementary or completely complementary to any one of I) to III).

[0013] The nucleic acid sequence encoding ATP7B provided by the present invention is suitable for the packaging capacity of adeno-associated virus vectors. Therefore, functionally active adeno-associated virus particles can be packaged based on the nucleic acid fragment, and the packaged product has good purity, solid rate and particle integrity. In some embodiments, the nucleic acid sequence encoding ATP7B is shown in SEQ ID NO: 1 or 2. Among them, the nucleic acid sequence shown in SEQ ID NO: 1 is obtained by codon optimization of the full-length ATP7B, and the nucleic acid sequence shown in SEQ ID NO: 2 is obtained by codon optimization of the truncated subtype ATP7B isoC. Compared with other codon optimization schemes, the nucleic acid shown in SEQ ID NO: 1 or 2 of the present invention is more suitable for expression with an adeno-associated virus vector, and the length is more suitable for packaging into AAV8 particles and maintaining complete Iso C, and the purity, solid rate and integrity of the packaged product are higher.

[0014] The present invention also provides an expression unit comprising a promoter and the nucleic acid as described above.

[0015] The expression unit of the present invention comprises an upstream TR segment, a promoter, the aforementioned nucleic acid, an SPA segment, and a downstream TR segment, connected in sequence. More specifically, the expression unit comprises, from the 5' end to the 3' end, an upstream TR segment, a promoter, the aforementioned nucleic acid, an SPA segment, and a downstream TR segment. The promoter is an HLP promoter, an α1AT promoter, or an AAT promoter. The SPA segment is a small Sv40 polyA tail, and the upstream and downstream TR segments contain terminal repeats derived from AAV2.

[0016] Furthermore, the present invention also provides a recombinant vector comprising a backbone vector and the aforementioned nucleic acid, or the aforementioned expression unit.

[0017] In the present invention, a recombinant AAV vector of ATP7B nucleic acid is constructed, which comprises a TR-AAT promoter-ATP7B gene-SPA-TR sequence, etc., so as to be effectively packaged by AAV and mediate the transport of copper ions.

[0018] In the present invention, the backbone vector of the recombinant vector of the present invention is selected from at least one of a DNA viral vector, a retroviral vector, a lentiviral vector, an adenoviral vector, and an adeno-associated viral vector. In some embodiments, the backbone vector is an adeno-associated viral vector, and the serotype of the adeno-associated viral vector is AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV2.7M8, or an AAV2-TYF mutant. In some specific embodiments, the serotype of the adeno-associated viral vector is AAV8. The backbone vector of the GOI plasmid is pUC57-GW-Kan.

[0019] Furthermore, the present invention also provides a plasmid combination, which includes the recombinant vector and the helper plasmid as described above.

[0020] Furthermore, the present invention also provides a host comprising the aforementioned recombinant vector or obtained by transfection of the aforementioned plasmid combination.

[0021] In the present invention, the host is used to store and / or amplify the recombinant vector as described above, and the host is a plant cell, an animal cell, a fungus, or a bacterium. For example, the host is a bacterium, specifically Escherichia coli. Alternatively, the host of the present invention is used to package and form viral particles, and the host is an animal cell. For example, the host is a mammalian cell selected from at least one of HEK-293, HEK293T, Hep G2, HELA, CHO-K1, COS-1, COS-7, NIH3T3, A204, A549, D-407, CHO, HCS-2, HT-29, U87, Sf9, or FD-CHOS. More specifically, in an embodiment of the present invention, the adeno-associated virus of the present invention is packaged in HepG2 cells.

[0022] Furthermore, the present invention also provides a method for constructing an adeno-associated virus expressing ATP7B, comprising: transfecting a host cell with the plasmid combination described above, and purifying the adeno-associated virus expressing ATP7B. In some embodiments, the host cell is a HepG2 cell.

[0023] Furthermore, the present invention also provides an adeno-associated virus expressing ATP7B prepared by the preparation method. The adeno-associated virus prepared by the present invention has high cell activity, high yield and good integrity.

[0024] Furthermore, the present invention also provides the use of the aforementioned recombinant vector, or the aforementioned plasmid combination, or the aforementioned adeno-associated virus in the preparation of a drug for preventing or treating a disease associated with ATP7B mutation. In the present invention, the disease associated with ATP7B mutation is hepatolenticular degeneration.

[0025] The prevention and treatment include increasing the transcription level of ATP7B, reducing the copper content in the liver and urine, restoring Cp activity and / or increasing the expression level of plasma Cp.

[0026] Furthermore, the present invention provides a drug comprising the aforementioned recombinant vector, or the aforementioned plasmid combination, or the aforementioned adeno-associated virus. The drug of the present invention exhibits good expression, high cell viability, and good integrity, while minimizing potential side effects of gene expression in tissues other than the liver, and is expected to have improved in vivo safety.

[0027] The drugs described herein also include other drugs that prevent and treat diseases associated with ATP7B mutations. The drugs described herein also include pharmaceutically acceptable excipients, and are in the form of oral preparations or injections. The injections are powders for injection and / or liquid injections.

[0028] The present invention also provides a method for preventing and treating diseases associated with ATP7B mutations, comprising administering the drug of the present invention. More specifically, administering an effective dose of the drug. The administration method includes, but is not limited to, injection.

[0029] The present invention provides an ATP7B GOI vector that can be packaged into AAV8 with cell activity, high yield, and good integrity, which can be used for AAV gene therapy of WD. By using an engineered liver tissue-specific promoter and a truncated natural ATP7B Iso C gene with a unique sequence, and by codon optimization to increase its expression in mammalian cells, the sequence length is made suitable for packaging into active AAV8 particles, which can effectively correct Cu in the liver of ATP7B KO mice. 2+ The method can reduce the defects of transfection transport and minimize the potential side effects caused by gene expression in tissues other than the liver, and is expected to have better in vivo safety. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 shows a schematic diagram of the composition of three ATP7B expression vectors;

[0031] Figure 2 shows the plasmid map of MW006;

[0032] FIG3 shows the mRNA expression capacity of three ATP7B expression vectors in vitro;

[0033] FIG4 shows the protein expression ability of three ATP7B expression vectors in vitro;

[0034] FIG5 shows the in vitro biological activities of three ATP7B expression vectors;

[0035] Figure 6 shows the integrity of the recombinant viral vector genome;

[0036] FIG7 shows the EC-HPLC profile of SAAV8-MW006 virus particles;

[0037] FIG8 shows the AEX-HPLC profile of AAV8-MW006 virus particles;

[0038] FIG9 shows electron micrographs of AAV8-MW006 virus particles (three different fields of view);

[0039] FIG10 shows the transcription level of ATP7B in mice of each group, wherein A shows the detection result of primer1, and B shows the detection result of primer2;

[0040] Figure 11 shows the liver copper and urine copper levels of KO mice in each group, where A shows the liver copper level and B shows the urine copper level;

[0041] FIG12 shows the changes in plasma ceruloplasmin (Cp) levels in each group of KO mice, wherein A shows the level changes and B shows the test results. DETAILED DESCRIPTION

[0042] The present invention provides nucleic acids encoding ATP7B, adeno-associated virus vectors and their use in the preparation of drugs for preventing and treating Wilson's disease. Those skilled in the art can refer to the contents of this article and appropriately improve the process parameters to achieve the desired results. It should be noted that all similar substitutions and modifications are obvious to those skilled in the art and are considered to be included in the present invention. The methods and applications of the present invention have been described through preferred embodiments, and relevant personnel can obviously modify or appropriately change and combine the methods and applications herein without departing from the content, spirit and scope of the present invention to implement and apply the technology of the present invention.

[0043] The test materials used in the present invention are all common commercial products and can be purchased in the market.

[0044] Herein, Wilson's disease is referred to as Wilson's disease, or WD. Copper-transporting P-type ATPase is referred to as ATP7B. The nucleic acid fragment encoding the full-length ATP7B in the present invention is:

[0045] The nucleic acid sequence encoding the truncated isoform ATP7B isoC is:

[0046] The codon optimization described in the present invention includes but is not limited to codon usage bias, elimination of secondary structures that are not conducive to expression (such as hairpin structures), changes in GC content, CpG dinucleotide content, secondary structure of mRNA, cryptic splicing sites, early polyadenylation sites, internal ribosome entry sites and binding sites, negative CpG islands, RNA unstable regions, repeat sequences (direct repeats, inverted repeats, etc.) and restriction sites that may affect cloning.

[0047] In the present invention, the expression unit refers to the DNA sequence starting from the promoter and ending at the terminator. The promoter and terminator may also include regulatory segments on both sides or between them. The regulatory segments may include promoters, enhancers, transcription termination signals, polyadenylation sequences, replication origins, nucleic acid restriction sites, and homologous recombination sites operably linked to the nucleic acid sequence, such as the promoter enhancer, poly (A) signal, etc. The expression unit of the present invention is composed of an upstream TR segment, a promoter, the nucleic acid, an SPA segment, and a downstream TR segment. Wherein,

[0048] The nucleic acid sequence of the upstream TR segment is: ttggccactccctctgcgcgctcgctcgctcactgaggc cgggcgaccaaaggtcgcccgacgcccgggctttgcccgggcggcctcagtgagcgagcgagcgcgcagagagggagtgg ccaactccatcactaggggttcct (SEQ ID NO: 3).

[0049] The nucleic acid sequence of the downstream TR segment is: aggaacccctagtgatggagttggccactccctctgcgc gctcgctcgctcactgaggccgggcgaccaaaggtcgcccgacgcccgggctttgcccgggcggcctcagtgagcgagcgag cgcgcagagagggagtggccaa (SEQ ID NO: 4).

[0050] The nucleic acid sequence of the SPA fragment is tcgcgaataaaagatctttattttcattagatctgtgtgttgg ttttttgtgtgatgcagc (SEQ ID NO: 5).

[0051] The promoter is the HLP promoter, and its nucleic acid sequence is tgtttgctgcttgcaatgtttgcccattttagggtggacacaggacgctgtggtttctgagccagggggcgactcagatcccagccagtggacttagcccctgtttgctcctccgataactggggtgaccttggttaatattcaccagcagcctcccccgttgcccctctggatccactgcttaaatacggacgaggacagggccctgtctcctcagcttcaggcaccaccactgacctgggacagtgaatc (SEQ ID NO:6).

[0052] Alternatively, the promoter is the α1AT promoter, and its nucleic acid sequence is ccaccccctccaccttggacacaggacgctgtggtttctgagccaggtacaatgactcctttcggtaagtgcagtggaagctgtacactgcccaggcaaagcgtccgggcagcgtaggcgggcgactcagatcccagccagtggacttagcccctgtttgctcctccgataactggggtgaccttggttaatattcaccagcagcctcccccgttgcccctctggatccactgcttaaatacggacgaggacagggccctgtctcctcagcttcaggcaccaccactgacctgggacagt (SEQ ID NO:7).

[0053] Or the promoter is AAT promoter, and its nucleic acid sequence is ggatcttgctaccagtggaacagcca ctaaggattctgcagtgagagcagagggccagctaagtggtactctcccagagactgtctgactcacgccaccccctccaccttggacacaggacgctg tggtttctgagccaggtacaatgactcctttcggtaagtgcagtggaagctgtacactgcccaggcaaagcgtccgggcagcgtaggcgggcgactcag atcccagccagtggacttagcccctgtttgctcctccgataactggggtgaccttggttaatattcaccagcagcctcccccgttgcccctctggatccactgcttaaatacggacgaggacagggccctgtctcctcagcttcaggcaccacccactgacctgggacagtgaatgatccccctgatctgcggcc(SEQ ID NO:8).

[0054] As used herein, a recombinant vector refers to a nucleic acid molecule capable of amplifying another nucleic acid to which it is linked. This term encompasses vectors that are self-replicating nucleic acid structures as well as vectors that integrate into the genome of a host cell into which the vector has been introduced. Certain vectors are capable of directing the expression of nucleic acids to which they are operably linked. As used herein, the terms recombinant vector, expression vector, plasmid vector, and plasmid are used interchangeably.

[0055] In the present invention, the host cell refers to a cell into which an exogenous nucleic acid has been introduced, including the progeny of such a cell. Host cells include "transformants" and "transformed cells," which include the original transformed cell and its progeny, regardless of the number of passages. Progeny may not be completely identical to the parent cell in nucleic acid content, but may contain mutations. Mutant progeny having the same function or biological activity as that screened or selected in the initially transformed cell are included herein.

[0056] In the present invention, the "adeno-associated virus vector" or "AAV" generally refers to the adenovirus itself or its derivatives. Adeno-associated virus (AAV) generally refers to a class of single-stranded DNA viruses belonging to the family Parvoviridae and the genus Dependovirus. The AAV genome may contain inverted terminal repeats (ITRs) at both ends of the DNA chain and two open reading frames (ORFs). The open reading frames may include rep and cap. rep is composed of multiple overlapping genes encoding the Rep protein required for the AAV life cycle, and cap contains overlapping nucleotide sequences encoding capsid proteins, which may include VP1, VP2 and VP3. The capsid proteins interact to form a capsid. AAV has multiple common serotypes and more than 100 viral variants. In the present application, the AAV capsid, ITRs and other selected AAV components are selected from any AAV, including but not limited to AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV8bp, AAV7M8 and AAVAnc80, any known or mentioned AAV variants or AAVs yet to be discovered or their variants or mixtures.

[0057] In the present invention, the "serotype" generally refers to the detection of epitopes on the surface of the adeno-associated virus capsid by serological methods and the typing of the adeno-associated virus. Adeno-associated virus has a variety of common serotypes and more than 100 virus variants. In this application, AAV capsid, ITR and other selected AAV components are selected from any AAV, including but not limited to AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV8bp, AAV7M8 and AAVAnc80, any known or mentioned AAV variants or AAVs yet to be discovered or their variants or mixtures.

[0058] In the present invention, the drug comprises the virus particles of the present invention and a pharmaceutically acceptable excipient or carrier. The excipient or carrier is suitable for human use and must have sufficient purity and sufficiently low toxicity.

[0059] In the present invention, the "treatment" refers to surgical or therapeutic treatment, the purpose of which is to prevent, slow down (reduce) undesirable physiological changes or lesions in the treatment subject, such as ATP7B mutation-related diseases. Beneficial or desired clinical results include, but are not limited to, alleviation of symptoms, weakening of disease severity, stabilization of the disease state (i.e., no worsening), delay or slowing of disease progression, improvement or alleviation of the disease state, and relief (whether partial relief or complete relief), whether detectable or undetectable. Subjects in need of treatment include subjects who already have a condition or disease, as well as subjects who are susceptible to a condition or disease or subjects who intend to prevent a condition or disease. When terms such as slowing down, alleviating, weakening, alleviating, and alleviating are mentioned, their meanings also include situations such as elimination, disappearance, and non-occurrence. The subject of the treatment refers to an organism receiving treatment for a specific disease or condition as described in the present invention. Exemplarily, "subjects" include mammals such as humans, primates (e.g., monkeys), or non-primate mammals receiving treatment for a disease or condition.

[0060] The present invention will be further described below in conjunction with the embodiments:

[0061] Example 1

[0062] 1. Construction and screening of functional truncated ATP7B protein expression plasmid

[0063] The expression plasmid for ATP7B expression uses pUC50 as the backbone. After searching for transcriptional or splicing isoforms of human ATP7B (NCBI Gene ID: 540), full-length ATP7B (denoted as WT-ATP7B-co) and truncated isoform ATP7BisoC (denoted as ATP7B-isoC-co) were selected for AAV vector packaging. Considering the packaging capacity of AAV vectors, three different ATP7B expression vectors (GOI plasmids) were designed using smaller liver-specific promoters (HLP promoter and α1AT promoter, AAT promoter) and a small Sv40 polyA tail (Figure 1, Figure 2), which are denoted as follows:

[0064] MW004: From the 5' end to the 3' end, upstream TR, HLP promoter, WT-ATP7B-co, SPA fragment, and downstream TR (full length as shown in SEQ ID NO: 9) are connected in sequence.

[0065] MW005: From the 5' end to the 3' end, upstream TR, α1AT promoter, WT-ATP7B-co, SPA fragment, and downstream TR (full length is shown in SEQ ID NO: 10) are connected in sequence.

[0066] MW006: From the 5' end to the 3' end, the upstream TR, AAT promoter, ATP7B-isoC-co, SPA fragment, and downstream TR (the full length is shown in SEQ ID NO: 11) are connected in sequence.

[0067] 2. Preparation of AAV8-ATP7B Viral Particles

[0068] 2.1 Cell culture

[0069] The 293 cells were revived and cultured in a 37°C carbon dioxide incubator (RADOBIO, model: Herocell Cl). After about 2 weeks, the cell density was greater than 10 6 pieces / mL.

[0070] 2.2 Virus packaging

[0071] The three constructed GOI plasmids, AAV8 RC plasmid, and helper plasmids were mixed in a ratio of 1:1:2.5 and transfected into 293 cells using polyethyleneimine (PEI, Yeasen, 40816ES02). Culture was carried out in a 37°C CO2 incubator (RADOBIO, model: Herocell Cl). After 6 days, the fermentation broth containing the packaged virus was removed. Tween 20 (GENERAL-REAGENT, Catalog No.: G89190B) was added to the fermentation broth and allowed to stand for 1 hour to lyse the cells and release the virus inside the cells. Nuclease (ArcticZymes, Catalog No.: 70921-202) was added and allowed to stand for 1 hour to enzymatically degrade long-chain DNA. Cell debris was then removed by vacuum filtration.

[0072] 2.3 AAV8-ATP7B Virus Particle Purification

[0073] A hollow fiber column (Repligen, Catalog No. S02-E100-05-N) was connected to a tangential flow filtration system (Cytiva, Model: AKTA flux 6) to concentrate the sample and remove some impurities such as DNA and proteins. An affinity column (Thermo Scientific, Catalog No. A36742) was connected to a chromatography instrument (Cytiva, Model: AKTA avant 150) for further impurity removal. Empty virus shells and residual impurities were then removed using an ion exchange column (BIA, Catalog No. 411.5113-2). Finally, the sample was concentrated and exchanged using an ultrafiltration tube (BIOFIL, Catalog No. FTT-200-500) to obtain viral particles.

[0074] Effect verification

[0075] 1. Detection and evaluation of three AAV8 plasmid samples (AAV8-MW004, AAV8-MW005, AAV8-MW006)

[0076] 1. RT-PCR evaluation of the mRNA expression capacity of three ATP7B expression vectors in vitro

[0077] HepG2 cells were transfected with the control vector, MW004, MW005, and MW006 vectors using PEI reagent (Yeasen, 40816ES02). Twenty-four hours after transfection, total cellular RNA was extracted (Promega, LS1040) and reverse transcribed to generate cDNA (Vazyme, R323-01). Real-time fluorescence quantitative PCR was used to measure the mRNA expression levels of the different vectors in the cells using three primers. The results are shown in Figure 3. The results showed that all three vectors increased the mRNA expression level of ATP7B in hepatocytes, with the MW006 vector having the highest expression capacity.

[0078] 2. Western Blot method to evaluate the protein expression ability of three ATP7B expression vectors in vitro

[0079] The control vector, MW004, MW005, and MW006 vectors were transfected into HepG2 cells using PEI reagent (Yeasen, 40816ES02). Proteins were extracted 48 hours after transfection using RIPA lysis buffer (Biyuntian, P0013B). The expression level of ATP7B protein in cells was detected by western blot using ATP7B antibody (Genetex, GTX30639). The results are shown in Figure 4. The results showed that all three vectors increased the expression level of ATP7B protein in hepatocytes, among which the MW006 vector had the strongest expression ability.

[0080] 3. Dual luciferase reporter gene assay to evaluate the in vitro biological activity of three ATP7B expression vectors

[0081] HepG2 cells were transfected with the control vector, MW004 vector, MW005 vector, MW006 vector, internal reference plasmid (Renilla), and pGL4.40[luc2P / MRE / Hygro] vector (Promega, E413A) using PEI reagent (Yeasen, 40816ES02). Eight hours after transfection, the medium was replaced with 200 μM copper sulfate (Sigma, 451657) and incubated for 24 hours. Fluorescence intensity of each sample was measured using a microplate reader according to the instructions for the Progema Dual-Luciferase Reporter Gene Assay System (Progema, E1960). The results are shown in Figure 5. The results demonstrate that all three vectors can reduce copper levels in hepatocytes in vitro, demonstrating comparable copper excretion capabilities.

[0082] 4. Detection of the genome integrity of recombinant viral vectors

[0083] AAV8 particles packaged from the three plasmid vectors were tested for viral genome integrity using alkaline gel electrophoresis. The results are shown in Figure 6. Comparing the three plasmid vectors packaged into AAV, the recombinant viral vector MW006, which encapsulates ATP7B isoC, showed the highest genome integrity.

[0084] In summary, the biologically active truncated ATP7B recombinant viral vector MW006 (AAV8-MW006) has excellent potential for AAV product development.

[0085] II. Evaluation of AAV8-MW006 Virus

[0086] 1. Size Exclusion Chromatography (SEC-HPLC) to Detect AAV Purity

[0087] The AAV8-MW006 virions prepared in Example 1 were tested by Shanghai Microspectra Technology Co., Ltd. A liquid chromatograph (Waters, model: ACQUITY UPLC H-Class Bio) was installed with a chromatographic column (Waters, catalog number: 186007643) and equilibrated for 90 minutes. A 100 μL sample was injected, and elution was performed at a UV wavelength of 280 nm. The resulting chromatograms are shown in Figure 7 and Table 1.

[0088] Table 1: SEC-HPLC test results

[0089] SEC-HPLC results showed that the purity of AAV8-MW006 was 97.27%, meeting the industry standard of SEC-HPLC ≥ 95%, and was higher in purity than the other two viral ions prepared in Example 1.

[0090] 2. Ion exchange chromatography (AEX-HPLC) to detect AAV purity,

[0091] The AAV8-MW006 virions prepared in Example 1 were tested by Shanghai Microspectra Technology Co., Ltd. A chromatographic column (Waters, Catalog No. 186004931) was connected to a liquid chromatograph (ThemoFisher, Model: U3000HPLC). After equilibration of the column for 90 minutes, 50 μL of sample was injected, and elution was performed using an excitation wavelength of 280 nm and an emission wavelength of 350 nm. The resulting chromatograms are shown in Figure 8 and Table 2.

[0092] The area normalization method is used to calculate the proportion of the main peak as shown in Table 2:

[0093] Table 2: AEX-HPLC test results

[0094] AEX-HPLC results showed that the empty shell ratio of AAV8-MW006 was 9.87% and the non-empty shell ratio was 90.13%, indicating that most of the empty shells had been removed. The empty shell ratio was lower than that of the other two viral ions prepared in Example 1.

[0095] 3. Electron microscopy to detect AAV purity

[0096] The AAV8-MW006 virus particles prepared in Example 1 were commissioned to Zhejiang Hengyu Biological Company for testing. Take 10 μL of sample and drop it on a copper mesh, let it stand for 5 minutes, and absorb the liquid with filter paper. 5 μL of 3% uranyl acetate (Rui Xin, product number: GZ02625) was dripped onto the copper mesh for staining. After standing for 3 minutes, the liquid was absorbed with filter paper. A transmission electron microscope (Thermo Scientific, model: Talos L120C) was used to take pictures at 120KV (Figure 9). Three regions were selected to count the proportion of empty shell viruses, as shown in Table 3:

[0097] Table 3: Electron microscopy results

[0098] The electron microscopy results showed that empty shell viruses and solid viruses were visible, with an average empty shell ratio of 5.61%.

[0099] 4. Evaluation of AAV8-MW006 Virus Activity in Mice

[0100] In the ATP7B KO mice constructed by the Southern Model Animal Center, AAV8-MW006 solution or PBS solution was injected into the tail vein to evaluate the in vivo pharmacodynamic activity of the preparation. The preparation was set up in two dose groups, 1E12 / mouse (low dose) and 5E12 / mouse (high dose). After 30 days of tail vein administration, the urine, serum, and liver tissue of the mice were collected to detect the ATP7B mRNA expression level in the mice (Figure 10) and the copper metabolism indicators liver copper (Figure 11), urine copper (Figure 11), and blood ceruloplasmin (Figure 12). The experimental results showed that:

[0101] Figure 10: Compared with wild-type mice (WT), the transcription level of ATP7B in KO mice after administration of different doses of AAV8-MW006 indicates that AAV8-MW006 significantly increases the transcription level of ATP7B in mice in a dose-dependent manner.

[0102] The primers involved are:

[0103] The sequences of the two primers of primer1 are: tccacctgagcaagagaacc; accaggttgtagatcagggc;

[0104] The sequences of the two primers of primer2 are: agcatccacctgagcaagag; aggttgtagatcagggccag.

[0105] Figure 11: Liver copper and urine copper levels in KO mice after administration of different doses of AAV8-MW006 compared to wild-type mice (WT), indicating that AAV-ATP7B significantly reduced the copper content in the liver and urine of mice in a dose-dependent manner.

[0106] Figure 12: Changes in plasma ceruloplasmin (Cp) levels in KO mice after administration of different doses of AAV8-MW006 relative to wild-type mice (WT), demonstrating that AAV8-MW006 can significantly restore Cp activity. Western blot results showed that AAV8-MW006 also significantly increased plasma Cp expression.

[0107] The above are only preferred embodiments of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A nucleic acid encoding ATP7B, comprising at least one of I) to IV): 1), a nucleic acid having a nucleotide sequence as shown in SEQ ID NO: 1 or 2; II), a nucleic acid in which one or more nucleotides are substituted, deleted or added in the fragment described in I); III), a nucleic acid having at least 90% homology with the sequence of the nucleic acid described in I), and encoding ATP7B; IV), a nucleic acid that is partially complementary or completely complementary to any one of I) to III).

2. The nucleic acid according to claim 1, characterized in that Its sequence is shown in SEQ ID NO: 1 or 2.

3. An expression unit comprising a promoter and the nucleic acid according to claim 1 or 2.

4. The expression unit according to claim 3, characterized in that It comprises an upstream TR segment, a promoter, the nucleic acid according to claim 1 or 2, a SPA segment and a downstream TR segment connected in sequence; The promoter is HLP promoter, α1AT promoter or AAT promoter.

5. A recombinant vector comprising a backbone vector and the nucleic acid according to claim 1 or 2, or the expression unit according to claim 3 or 4.

6. The recombinant vector according to claim 5, characterized in that The backbone vector is an adeno-associated virus vector, and the serotype of the adeno-associated virus vector is AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV2.7M8 or AAV2-TYF mutant.

7. A plasmid combination, characterized in that: It comprises the recombinant vector and the auxiliary plasmid described in claim 5 or 6.

8. A host comprising the recombinant vector according to claim 5 or 6, or obtained by transfection of the plasmid combination according to claim 7.

9. A method for constructing an adeno-associated virus expressing ATP7B, comprising: The plasmid combination according to claim 7 is transfected into host cells, and the adeno-associated virus of ATP7B is obtained through purification.

10. Adeno-associated virus expressing ATP7B obtained by the preparation method of claim 9.

11. Use of the recombinant vector according to claim 5 or 6, or the plasmid combination according to claim 7, or the adeno-associated virus according to claim 10 in the preparation of a drug for preventing and treating ATP7B mutation-related diseases.

12. The use according to claim 11, characterized in that: The ATP7B mutation-related disease is Wilson's disease.

13. A drug, characterized in that It comprises the recombinant vector according to claim 5 or 6, or the plasmid combination according to claim 7, or the adeno-associated virus according to claim 10.

Images