Method for detecting nucleic acid and use thereof

Abstract

A method, kit and system for detecting a nucleic acid, especially a method for detecting the presence, absence or content of one or more target nucleic acids in a nucleic acid sample.

Description

Nucleic acid detection methods and uses thereof Technical Field

[0001] The present application relates to a nucleic acid detection method, and specifically to a method, a kit, and a system for detecting nucleic acid samples. Background Art

[0002] The DNA of an organism carries information about the characteristics of an individual organism and diseases, and specific detection of its target nucleic acid is an important tool in diagnostic medicine and molecular biology research. The detection of target nucleic acids can be used, for example, to identify pathogens (e.g., bacteria or viruses) in a host object; to determine the expression of normal genes and to identify mutant genes (e.g., oncogenes); to type tissues for compatibility before tissue transplantation; to analyze the homology between genes of different substances; and / or to identify alleles and polymorphisms of gene variants. In these application scenarios, it is usually necessary to have the ability to detect and / or identify a small amount of target nucleic acid from a nucleic acid sample or mixture containing a large amount of non-target nucleic acid. However, due to the limitations of current technology, when the amount of nucleic acid in the sample is extremely small (less than 1 ng or even lower), it is difficult to obtain stable test results, or the results obtained are quite different from the original nucleic acid.

[0003] For example, PCR is currently the most commonly used method for amplifying nucleic acid fragments. However, according to the principle of PCR, amplification deviations in the initial stage of PCR are exponentially amplified in subsequent reactions. Furthermore, the smaller the amount of nucleic acid in the initial stage, the greater the randomness in the entire system during the initial PCR phase, leading to significant deviations in the final PCR results.

[0004] Linear amplification technology is a relatively mild nucleic acid fragment amplification technology. It does not cause large deviations in the final product due to deviations in the initial reaction. On the contrary, as the amplification multiples increase, the deviations in the initial reaction are evenly distributed throughout the entire process, and eventually approach an almost negligible deviation. The currently commonly used exemplary linear amplification scheme is based on T7 RNA polymerase technology. This scheme connects a linker containing a T7 promoter sequence to the end of the nucleic acid fragment to be amplified, and then uses T7 RNA polymerase to transcribe the nucleic acid fragment in vitro, amplifying the nucleic acid fragment while transcribing; then the transcribed RNA is reverse transcribed to obtain the amplified DNA fragment. However, this method has complicated steps, is time-consuming, and involves the manipulation of RNA, which has high environmental requirements.

[0005] For the above reasons, there is an urgent need in this field to develop nucleic acid detection methods that are easy to operate and highly accurate, especially for high-sensitivity detection of small or ultra-small amounts of target molecules in nucleic acid samples.

[0006] Summary of the Invention

[0007] The present application provides a nucleic acid detection method, which improves the original complex links in the unbiased amplification technology. The entire process does not require the RNA link, thereby avoiding the strict nuclease-free environment and specially treated test consumables required for RNA operation. The process is simple, the difficulty requirement is low, the linear amplification completion degree is high, and it can provide highly accurate and sensitive nucleic acid detection results in the subsequent analysis link.

[0008] On the one hand, the present application provides a method for detecting the presence, absence or amount of one or more target nucleic acids in a nucleic acid sample, the method comprising: a) treating the nucleic acid sample under conditions that allow linear amplification of target DNA derived from the nucleic acid sample to generate linear amplification products of the target DNA; b) exponentially amplifying the linear amplification products to generate exponential amplification products of the target DNA; c) contacting the exponential amplification products of the target DNA with an extension primer under extension conditions including a terminating nucleotide to generate extended oligonucleotides; and d) analyzing the extended oligonucleotides to identify the presence, absence or amount of the one or more target nucleic acids in the nucleic acid sample, wherein the treatment under conditions enabling linear amplification includes adding a recognition sequence to the end of the target DNA in the nucleic acid sample, and the recognition sequence can be recognized and cleaved by a nuclease.

[0009] In certain embodiments, the method comprises subjecting the nucleic acid sample to a treatment selected from the group consisting of: blunting the ends of the target DNA, adding deoxyadenosine dA to the ends of the target DNA, phosphorylating the 5' end of the target DNA, dephosphorylating the 5' end of the target DNA, and modifying the target DNA so that its nucleic acid sequence remains unchanged after bisulfite treatment.

[0010] In certain embodiments, the modification that does not change the nucleic acid sequence of the target DNA after bisulfite treatment is methylation of cytosine bases in the target DNA.

[0011] In certain embodiments, the recognition sequence is added by ligating the double-stranded ends of the target DNA to an adapter, wherein the adapter is a double-stranded oligonucleotide containing the recognition sequence.

[0012] In certain embodiments, the addition of the recognition sequence comprises contacting the target DNA with a primer so that the ends of the target DNA form a linker containing the recognition sequence, wherein the primer comprises a first segment and a second segment, the first segment comprises a recognition sequence, and the second segment comprises a sequence that is partially complementary to the target DNA.

[0013] In certain embodiments, the method comprises subjecting the linker to a protective modification.

[0014] In certain embodiments, the protective modification comprises modifying the linker so that its nucleic acid sequence is not changed after bisulfite treatment, and / or modifying the linker so that only one strand is cleaved by the nuclease.

[0015] In certain embodiments, the protective modification comprises methylating cytosine bases in the linker sequence.

[0016] In certain embodiments, the protective modification comprises replacing a non-bridging oxygen atom on the nucleotide phosphate backbone of the linker sequence with a sulfur atom, and the nucleotide where the substitution occurs is located near the recognition sequence.

[0017] In certain embodiments, the conditions enabling linear amplification include adding the nuclease.

[0018] In certain embodiments, the nuclease is selected from a restriction endonuclease and a nickase.

[0019] In certain embodiments, the restriction endonuclease comprises a Cas enzyme.

[0020] In certain embodiments, the conditions enabling linear amplification further comprise adding a DNA polymerase having strand displacement activity.

[0021] In certain embodiments, the DNA polymerase is selected from the group consisting of Bca, Bst, Bsu, Klenow large fragment, and Phi29.

[0022] In certain embodiments, the conditions enabling linear amplification further include adding a buffer, deoxyribonucleoside triphosphates (dNTPs) and / or single-stranded DNA binding proteins suitable for linear amplification of the target DNA.

[0023] In certain embodiments, the linear amplification is strand displacement amplification (SDA).

[0024] In certain embodiments, the linear amplification is non-target specific amplification that is not directed against a specific target.

[0025] In another aspect, the present application provides a method for identifying a biomarker associated with a disease, disease outcome, and / or treatment regimen outcome, the method comprising the following steps: i) identifying the presence, absence, or amount of one or more target nucleic acids derived from one or more nucleic acid samples according to the method described herein, wherein the one or more nucleic acid samples are derived from one or more subjects with a known disease, disease outcome, and / or treatment regimen outcome; ii) identifying the presence, absence, or amount of one or more target nucleic acids derived from one or more nucleic acid samples according to the method described herein, wherein the one or more nucleic acid samples are derived from normal subjects; and iii) identifying a difference between the presence, absence, or amount of the one or more target nucleic acids in step i) and the presence, absence, or amount of the one or more target nucleic acids in step ii), and accordingly, identifying the difference as a biomarker associated with the disease, disease outcome, and / or treatment regimen outcome.

[0026] In certain embodiments, the method includes modifying the target DNA in the nucleic acid sample so that the nucleic acid sequence of the target DNA is not altered after bisulfite treatment.

[0027] In certain embodiments, the method comprises methylating cytosine bases in the target DNA.

[0028] In certain embodiments, the conditions enabling linear amplification include adding the nuclease, and the nuclease is a methylation-sensitive enzyme.

[0029] In certain embodiments, the methylation-sensitive enzyme is a restriction endonuclease.

[0030] In certain embodiments, the method comprises ligating or forming an adapter at the end of the target DNA to add the recognition sequence, and the adapter comprises a protective modification so that only one strand is cleaved by the nuclease.

[0031] In certain embodiments, the protective modification comprises replacing a non-bridging oxygen atom on the nucleotide phosphate backbone of the linker sequence with a sulfur atom, and the nucleotide where the substitution occurs is located near the recognition sequence.

[0032] In another aspect, the present application provides a method for identifying methylation associated with a disease, disease outcome, and / or treatment regimen outcome, the method comprising the following steps: i) identifying methylated or unmethylated nucleotides in one or more target nucleic acids derived from one or more nucleic acid samples according to the method described herein, wherein the one or more nucleic acid samples are derived from one or more subjects with a known disease, disease outcome, and / or treatment regimen outcome; ii) identifying methylated or unmethylated nucleotides in one or more target nucleic acids derived from one or more nucleic acid samples according to the method described herein, wherein the one or more nucleic acid samples are derived from normal subjects; and iii) identifying a difference between the methylated or unmethylated nucleotides in the one or more target nucleic acids in step i) and the methylated or unmethylated nucleotides in the one or more target nucleic acids in step ii), and accordingly, identifying the differentially methylated or unmethylated nucleotides as methylation associated with the disease, disease outcome, and / or treatment regimen outcome.

[0033] In certain embodiments, the method includes ligating or forming an adapter at the end of the target DNA in the nucleic acid sample to add the recognition sequence, and the adapter comprises a protective modification so that the nucleic acid sequence of the adapter is not changed after bisulfite treatment.

[0034] In certain embodiments, the method comprises methylating a cytosine base in the linker sequence.

[0035] In certain embodiments, the method includes ligating or forming an adapter at the end of the target DNA in the nucleic acid sample to add the recognition sequence, and the unmethylated specific nucleotides in the target DNA are converted into other nucleotides through treatment.

[0036] In certain embodiments, the conditions enabling linear amplification include adding the nuclease, and the nuclease is a methylation-sensitive enzyme.

[0037] In certain embodiments, the methylation-sensitive enzyme is a restriction endonuclease.

[0038] In certain embodiments, the method comprises ligating or forming an adapter at the end of the target DNA to add the recognition sequence, and the adapter comprises a protective modification so that only one strand is cleaved by the nuclease.

[0039] In certain embodiments, the protective modification comprises replacing a non-bridging oxygen atom on the nucleotide phosphate backbone of the linker sequence with a sulfur atom, and the nucleotide where the substitution occurs is located near the recognition sequence.

[0040] On the other hand, the present application provides a kit for detecting a nucleic acid sample, the kit comprising: a linear amplification component, an exponential amplification component and an extension component, wherein the linear amplification component comprises a nuclease capable of nicking a single-stranded oligonucleotide, a DNA polymerase with strand displacement activity and deoxyribonucleoside triphosphates (dNTPs).

[0041] In certain embodiments, the linear amplification component further comprises one or more of an adapter, a primer, a buffer system suitable for linear amplification of the target DNA in the nucleic acid sample, and a single-stranded DNA binding protein.

[0042] In certain embodiments, the linker comprises a recognition sequence that can be recognized and cleaved by the nuclease.

[0043] In certain embodiments, the primer comprises a first segment and a second segment, the first segment comprises a recognition sequence, and the second segment comprises a sequence that is complementary to a portion of the target DNA.

[0044] In certain embodiments, the linear amplification component, the exponential amplification component, and the extension component do not mix with each other.

[0045] In certain embodiments, the linear amplification component, the exponential amplification component, and the extension component are each independently present in separate packages.

[0046] In certain embodiments, the kit further comprises one or more of the following components: a) a reagent that can modify specific unmethylated nucleotides to generate other nucleotides; b) one or more nucleic acid polymerases; c) one or more nucleic acid ligases; d) one or more primers; e) a reagent for modifying the one or more primers, wherein the modification comprises adding one or more of a restriction enzyme cleavage site, a biomarker, and a fluorescent substance; f) one or more adapters suitable for sequencing; g) one or more end modification reagents; h) one or more phosphokinases; i) a MALDI matrix compound; and j) a MALDI substrate.

[0047] In another aspect, the present application provides a system for detecting a nucleic acid sample, the system comprising the kit described herein, and optionally comprising one or more parts selected from the group consisting of instructions, reagents, and a device for using the kit.

[0048] In certain embodiments, the apparatus for using the kit comprises a thermal cycler and / or a mass spectrometer.

[0049] Those skilled in the art can easily discern other aspects and advantages of the present application from the detailed description below. In the detailed description below, only exemplary embodiments of the present application are shown and described. As will be appreciated by those skilled in the art, the content of this application enables those skilled in the art to modify the disclosed specific embodiments without departing from the spirit and scope of the invention to which this application relates. Accordingly, the descriptions in the drawings and specification of this application are merely exemplary and not restrictive. BRIEF DESCRIPTION OF THE DRAWINGS

[0050] The specific features of the inventions of this application are set forth in the appended claims. The features and advantages of the inventions of this application can be better understood by referring to the exemplary embodiments described in detail below and the accompanying drawings. A brief description of the drawings is as follows:

[0051] Figures 1A-1B show the qPCR amplification curves of the reference sample after unbiased amplification treatment according to the method of the present application, and the qPCR amplification curves of the reference sample without such treatment, respectively.

[0052] FIG2 shows the second generation sequencing results of the reference product after unbiased amplification treatment according to the method of the present application and the reference product not treated according to the method of the present application.

[0053] Figure 3 shows the library construction and sequencing workflow of the three schemes. DETAILED DESCRIPTION

[0054] The following describes the implementation of the present invention through specific embodiments. People familiar with this technology can easily understand other advantages and effects of the present invention from the contents disclosed in this specification.

[0055] Definition of terms

[0056] In this application, the term "sample" generally refers to a specimen containing a substance to be analyzed of interest, for example, a microorganism, a virus, a nucleic acid (such as a gene), or a component thereof, which may include a nucleic acid in or obtained from an analyte. The sample may be from any source, such as a biological specimen or an environmental source. A biological specimen includes any tissue or material obtained from a living or dead organism, which may include an analyte or a nucleic acid in or obtained from an analyte. Examples of biological specimens include respiratory tissue, exudate (e.g., bronchoalveolar lavage fluid), biopsy specimens, sputum, peripheral blood, plasma, serum, lymph nodes, gastrointestinal tissue, feces, urine, cerebrospinal fluid, tissue fluid (e.g., pleural effusion), lavage fluid (e.g., alveoli) or other fluids, tissues or materials. Examples of samples of environmental origin include water, ice, soil, suspensions, residues, biofilms, atmospheric dust particles and aerosols. The sample may be a processed specimen or material, such as obtained by treating the sample using filtration, centrifugation, precipitation, or adsorption to a medium (e.g., a matrix or carrier). Other treatments of the sample may include physical or mechanical disruption of tissue, cell aggregates, or cells to release intracellular components, including nucleic acids, into a solution that may contain other components, such as enzymes, buffers, salts, detergents, and the like. The sample may also include tissue, such as biopsied tissue (e.g., liquid biopsy tissue), formalin-fixed and paraffin-embedded (FFPE) tissue, and the like.

[0057] In this application, the term "target nucleic acid" generally refers to any nucleic acid that includes a sequence to be detected. The target nucleic acid can be DNA or RNA. The target nucleic acid can be of any origin, such as genomic DNA, mRNA, cDNA, cfDNA, ctDNA, etc. The target nucleic acid can be naturally occurring or synthetic (such as an amplification product, a vector, etc.). The target nucleic acid can be, but need not be, purified or isolated. Depending on the properties desired to be measured, the target nucleic acid can be derived from plant or animal tissue, or taken from a reaction mixture. The target nucleic acid is not limited in length, although the target nucleic acid can be exposed to a restriction endonuclease before being detected or identified by the method of the present application.

[0058] In this application, the term "nucleic acid" is used interchangeably with "nucleic acid molecule" or "polynucleotide" and generally refers to deoxyribonucleic acid (DNA), ribonucleic acid (RNA), or a combination of its DNA or RNA and polymers thereof in single-stranded or double-stranded form. The term "nucleic acid" also includes the sense or antisense strand of a gene, genomic DNA, and synthetic forms and mixed polymers of the two, cDNA and / or mRNA. For example, a nucleic acid molecule can be synthetic (e.g., chemically synthesized) or recombinant. Unless otherwise specified, the term may also include nucleic acids containing analogs or derivatives of natural nucleotides that have similar binding properties to a reference nucleic acid and are metabolized in a manner similar to naturally occurring nucleotides. Unless otherwise indicated, a specific nucleic acid sequence also implicitly includes conservatively modified variants thereof (e.g., degenerate codon substitutions), alleles, orthologs, SNPs, complementary sequences, and sequences explicitly indicated. Specifically, degenerate codon substitutions can be achieved by generating sequences in which the third position of one or more selected (or all) codons is substituted with mixed-base and / or deoxyinosine residues (Batzer et al., Nucleic Acid Res. 19:5081 (1991); Ohtsuka et al., J. Biol. Chem. 260:2605-2608 (1985); and Rossolini et al., Mol. Cell. Probes 8:91-98 (1994)). The term "nucleic acid" can also be chemically or biochemically modified, as will be readily apparent to those skilled in the art. Such modifications include, for example, labeling, methylation, substitution of one or more natural nucleotides with an analog, internucleotide modifications, such as uncharged linkages (e.g., methylphosphonates, phosphotriesters, phosphoramidates, carbamates, etc.), charged linkages (e.g., phosphorothioates, phosphorodithioates, etc.), side moieties (e.g., polypeptides), intercalators (e.g., acridine, psoralen, etc.), chelators, alkylating agents, and modified linkages (e.g., alpha mutameric nucleic acids, etc.). The above terms are also intended to include any topological conformation, including single-stranded conformation, double-stranded conformation, partial duplex conformation, triplex conformation, hairpin conformation, circular conformation, and padlock conformation.

[0059] In this application, the term "linear amplification" generally refers to an amplification process designed to increase the production of a target nucleic acid in a linear proportion to the amount of target nucleic acid in the reaction. For example, a transcription-related reaction can be used to prepare multiple RNA copies from a target DNA, where the increase in the number of copies can be described by a linear factor (e.g., starting copies of the template × 100). For example, in a multi-stage amplification procedure, the linear amplification in the first stage can increase the starting number of the target nucleic acid chain or the complementary chain of the target nucleic acid chain by at least 10 times, such as at least 100 times, such as 10 to 1000 times, before the start of the second stage amplification reaction. An example of a linear amplification system is T7-based DNA linear amplification. Other methods are described in this application. Therefore, the term "linear amplification" refers to an amplification reaction that does not result in exponential amplification of the target nucleic acid sequence. The term "linear amplification" does not refer to a method that only prepares a single copy of a nucleic acid chain. For example, linear amplification can be based on known reactions including nucleic acid transcription reactions, chain displacement amplification reactions, and / or rolling circle amplification reactions.

[0060] In this application, the term "exponential amplification" generally refers to an amplification process designed to increase the production of target nucleic acid in a reaction in geometric proportion to the amount of target nucleic acid. For example, PCR produces one DNA strand for each original target strand and for each synthesized strand present. Similarly, transcription-related amplification produces multiple RNA transcripts for each original target strand and for each subsequently synthesized strand. The amplification is exponential because the synthesized strands are used as templates in subsequent rounds of amplification. An amplification reaction does not need to actually produce an exponentially increasing amount of nucleic acid to be considered exponential amplification, as long as the amplification reaction is designed to produce such an increase.

[0061] In this application, the term "nucleotide" generally includes natural and non-natural nucleotides. Nucleotides include, but are not limited to, naturally occurring nucleoside monophosphates, nucleoside diphosphates, and nucleoside triphosphates; deoxyadenosine monophosphate, deoxyadenosine diphosphate, and deoxyadenosine triphosphate; deoxyguanosine monophosphate, deoxyguanosine diphosphate, and deoxyguanosine triphosphate; deoxythymidine monophosphate, deoxythymidine diphosphate, and deoxythymidine triphosphate; deoxycytidine monophosphate, deoxycytidine diphosphate, and deoxycytidine triphosphate; deoxyuridine monophosphate, deoxyuridine diphosphate, and deoxyuridine triphosphate; and deoxyinosine monophosphate, deoxyinosine diphosphate, and deoxyinosine triphosphate (referred to herein as dA, dG, dT, dC, dU, and dI, or A, G, T, C, U, and I, respectively). Nucleotides also include, but are not limited to, modified nucleotides and nucleotide analogs. Modified nucleotides and nucleotide analogs include, but are not limited to, dideoxynucleotides, acyclic nucleotides, deazapurine nucleotides, for example, 7-deaza-deoxyguanosine (7-deaza-dG) monophosphate, diphosphate and triphosphate and 7-deaza-deoxyadenosine (7-deaza-dA) monophosphate, diphosphate and triphosphate, deuterium-deoxythymidine (deuterium-dT) monophosphate, diphosphate and triphosphate, methylated nucleotides, for example, 5-methyldeoxycytidine triphosphate, 13C / 15N labeled nucleotides and deoxyinosine monophosphate, diphosphate and triphosphate. A variety of functional groups and attachment positions can be used to obtain modified nucleotides, isotopically enriched nucleotides, depleted nucleotides, tags and labeled nucleotides and nucleotide analogs.

[0062] In this application, the term "terminating nucleotide" is used interchangeably with "chain terminator reagent" or "chain terminator" and generally refers to a molecule that, when added to an extension reaction, stops the extension reaction. Chain terminators can include nucleotide analogs that, when present in a polynucleotide chain or oligonucleotide, prevent further extension of the chain or oligonucleotide. In certain embodiments, the terminating nucleotide is a nucleotide; in certain embodiments, the terminating nucleotide is a modified nucleotide that, when incorporated into the 3' end of a nucleic acid molecule (e.g., an oligonucleotide) in an extension reaction, will not allow further nucleotides to be incorporated into the oligonucleotide. In certain embodiments, the terminating nucleotide is not removed from the oligonucleotide or polynucleotide chain in the presence of an enzyme having 3'-5' exonuclease activity. In certain embodiments, the 3'-OH of the pentose of the nucleotide can be substituted with a moiety that produces a chain-terminating nucleotide and is also resistant to removal by an enzyme having 3'-5' exonuclease activity. In certain embodiments, the pentose 3' position of the terminator nucleotide is modified to replace the OH with another part, including but not limited to, a phosphoryl group, an acetyl group, a 3'-O-methyl group, a 3'-O-(2-nitrobenzyl group), a 3'-O-allyl group, a 3'-azido group, and a 3'-amino group. In certain embodiments, the 3'-OH group is replaced by hydrogen. In certain embodiments, the modified nucleotide is a dideoxynucleotide. In certain embodiments, the modified nucleotide is an acyclic nucleotide. The example of the terminator nucleotide includes: dideoxynucleotides, such as ddA (dideoxyadenine), ddT (dideoxythymine), ddC (dideoxycytosine), ddG (dideoxyguanine) and ddU (dideoxyuracil) and acyclic nucleotides, such as, acyATP, acyCTP, acyGTP, acyTTP, and acy-bromo-UTP.

[0063] In this application, the terms "oligonucleotide" and "oligomer" are used interchangeably and generally refer to nucleic acid polymers generally consisting of less than 1000 nucleotides (nt), including polymers having a length of about 2nt to about 900nt. For example, the oligonucleotide may comprise 5nt to 500nt, for example, 10nt to 150nt. For example, the oligonucleotide can be prepared by synthesis using any known in vitro chemical or enzymatic method, and can be purified after synthesis using standard methods, including, for example, high performance liquid chromatography (HPLC). In this application, representative oligonucleotides include, for example, primers, promoters, detection probe oligonucleotides, target capture oligonucleotides, etc.

[0064] In this application, the term "contacting" generally refers to causing two or more components to at least partially intermix. Contact can be achieved by mixing the components in a fluid or semi-fluid mixture. Contact can also be achieved when one or more components are in physical contact with one or more other components on a solid surface, such as a solid tissue section or matrix.

[0065] In this application, the terms "recognition sequence" and "recognition site" are used interchangeably, have their conventional scientific meanings, and in this application generally refer to a region or epitope on a molecule, such as a protein, DNA, or RNA, to which another molecule can bind. For example, a nucleic acid binding or recognition site for a particular protein (e.g., DNA polymerase) is understood to be a nucleic acid sequence that is capable of interacting with and / or interacting with that protein.

[0066] In this application, the term "nuclease" generally refers to an agent that can cut the phosphodiester bond of the nucleotide residues in the nucleic acid molecule, such as a protein or a small molecule. In some embodiments, a nuclease is a protein, such as an enzyme that can bind to a nucleic acid molecule and cut the phosphodiester bond of the nucleotide residues in the nucleic acid molecule. A nuclease can be an endonuclease (which cuts the phosphodiester bond in the polynucleotide chain) or an exonuclease (which cuts the phosphodiester bond at the end of the polynucleotide chain). In some embodiments, a nuclease is a site-specific nuclease that binds and / or cuts a specific phosphodiester bond in a specific nucleotide sequence, which is referred to as a "recognition sequence," "nuclease target site," or "target site" in this application. In some embodiments, a nuclease is an RNA-guided (i.e., RNA-programmable) nuclease that is compounded (e.g., bound) with an RNA (e.g., a guide RNA, "gRNA") having a sequence complementary to the target site, thereby providing the sequence identity of the nuclease. In some embodiments, a nuclease recognizes a single-stranded target site. In other embodiments, a nuclease recognizes a double-stranded target site, e.g., a double-stranded DNA target site. The target sites of many naturally occurring nucleases (e.g., many naturally occurring DNA restriction nucleases) are well known to those skilled in the art. In many cases, DNA nucleases (such as EcoRI, HindIII, or BamHI) recognize palindromic double-stranded DNA target sites of 4 to 10 base pairs in length and cut each of the two DNA chains at a specific position within the target site. Some endonucleases symmetrically cut double-stranded nucleic acid target sites, i.e., cut both chains at the same position, so that the ends contain base-paired nucleotides, also referred to as blunt ends in this application. Other endonucleases asymmetrically cut double-stranded nucleic acid target sites, i.e., cut each chain at different positions, so that the ends contain unpaired nucleotides. The unpaired nucleotides at the ends of double-stranded DNA molecules are also referred to as "overhangs," for example, as "5'-overhangs" or as "3'-overhangs," depending on whether the unpaired nucleotides form the 5' or 3' end of the corresponding DNA chain. The ends of double-stranded DNA molecules terminated with unpaired nucleotides are also referred to as sticky ends because they can "stick to" the ends of other double-stranded DNA molecules containing complementary unpaired nucleotides. Nuclease proteins typically comprise a "binding domain" (which mediates the interaction of proteins with nucleic acid substrates, and in some cases also specifically binds to target sites) and a "cleavage domain" (which catalyzes the cutting of phosphodiester bonds within the nucleic acid backbone). In some embodiments, nuclease proteins can bind and cut nucleic acid molecules in monomeric form, while in other embodiments, nuclease proteins must dimerize or multimerize to cut target nucleic acid molecules. The binding domain and cleavage domain of naturally occurring nucleases, and modular binding domains and cleavage domains that can be fused to create nuclease-binding specificity target sites are well known to those skilled in the art.For example, the binding domain of an RNA programmable nuclease (e.g., Cas9), or a Cas9 protein with an inactive DNA cleavage domain can be used as a binding domain (e.g., it binds to a gRNA to guide binding to a target site), thereby specifically binding to a desired target site, and fused or conjugated with a cleavage domain (e.g., the cleavage domain of FokI) to create an engineered nuclease that cleaves the target site.

[0067] In this application, the term "(DNA) end filling" generally refers to the process of adding nucleotides to the 5'-end protruding sticky ends of double-stranded DNA, which are formed by restriction endonuclease digestion, annealing of synthetic oligonucleotides, or other reasons, to convert them into blunt ends. For example, nucleotides can be added using the 5'-3' DNA polymerase activity of a DNA polymerase (such as Klenow enzyme or T4 DNA polymerase).

[0068] In this application, the term "bisulfite" generally refers to an agent that can distinguish between regions of DNA that have a modification state and regions that do not have a modification state. For example, bisulfite can include bisulfite, or an analog thereof, or a combination thereof. For example, bisulfite can deaminize the amino group of unmodified cytosine to distinguish it from modified cytosine. In this application, the term "analog" generally refers to a substance with a similar structure and / or function. For example, an analog of bisulfite can have a similar structure to bisulfite. For example, an analog of bisulfite can refer to an agent that can also distinguish between regions of DNA that have a modification state and regions that do not have a modification state.

[0069] In the present application, the term "primer" generally refers to an oligonucleotide, at least 3' of which is complementary to a nucleic acid template, and the oligonucleotide is compounded with the template (e.g., by hydrogen bonding or hybridization) to obtain a primer-template complex that is suitable for initiating synthesis by an RNA or DNA-dependent nucleic acid polymerase (e.g., DNA polymerase or RNA polymerase). A primer can be extended by adding a covalently bonded nucleotide base to the 3' end of the primer, the base being complementary to the template. What is obtained is a primer extension product. In the present application, the length of a primer can be at least 10 nucleotides, and can be extended to a length of about 15, 20, 25, 30, 35, 40, 45, 50 or more nucleotides.

[0070] In this application, the term "strand displacement activity" generally refers to the ability of certain restriction enzymes to displace downstream DNA encountered during synthesis. Strand displacement activity is described in U.S. Patent Publication No. 20120115145 (which is incorporated herein by reference), as follows: "Strand displacement activity" refers to the phenomenon in which a biological, chemical, or physical agent (e.g., DNA polymerase) causes a paired nucleic acid to dissociate from its complementary strand in the 5' to 3' direction, bind to, and approach template-dependent nucleic acid synthesis. Strand displacement begins at the 5' end of the paired nucleic acid sequence, so the enzyme immediately performs nucleic acid synthesis in the 5' of the displacement site. The newly synthesized nucleic acid and the displaced nucleic acid typically have the same nucleotide sequence complementary to the template nucleic acid strand. Strand displacement activity can be located on the same molecule as the molecule that confers the activity of nucleic acid synthesis (particularly DNA synthesis), or it can be a separate and independent activity. DNA polymerases, such as Escherichia coli DNA polymerase I, the Klenow fragment of DNA polymerase I, T7 or T5 phage DNA polymerases, and HIV viral reverse transcriptase, are enzymes with both polymerase activity and strand displacement activity. Reagents such as helicases can be used in conjunction with inducing agents that do not have strand displacement activity to produce a strand displacement effect, that is, the displacement of nucleic acids is coupled to the synthesis of nucleic acids of the same sequence. Similarly, proteins (such as Rec A or single-stranded binding proteins from E. coli or from another organism) can be used to produce or promote strand displacement (Kornberg and Baker, 1992, DNA Replication, 2nd edition, pp 113-225, Freeman, NY) along with other inducing agents.

[0071] In this application, the term "non-target specific amplification" generally refers to a non-specific amplification method that is not directed to a specific target site or a specific target sequence. Specifically, this amplification method can increase the sequence of the target nucleic acid molecule in the sample essentially indiscriminately and in essentially the same or similar proportions.

[0072] In this application, the term "label" generally refers to a molecular part or compound that can be detected or produce a detectable response, and the molecular part or compound can be directly or indirectly attached to the labeled nucleic acid molecules. Direct labeling can use a key or interaction to connect the label and the nucleic acid molecules to be labeled, and the key or interaction include covalent bonds, non-covalent interactions (hydrogen bonds, hydrophobic and ionic interactions), or chelates or coordination complexes. Indirect labeling can use a bridging moiety or joint (such as an antibody, oligonucleotide or other compound) that is directly or indirectly labeled, and the bridging moiety or joint can amplify the signal. Label includes any detectable part. The example of available detectable part includes radionuclide, ligand (such as biotin or avidin), enzyme, enzyme substrate, reactive group, chromophore (detectable dye, particle or bead), fluorophore, or luminescent compound (such as bioluminescent label, phosphorescent label, or chemiluminescent label).

[0073] In the present application, the term "methylation-sensitive enzyme" generally refers to an enzyme that selectively digests nucleic acids based on the methylation state of its recognition site. For example, for a restriction enzyme that specifically shears when the recognition site is not methylated, shearing may not occur, or shearing may be performed with significantly reduced efficiency when the recognition site is methylated. For a restriction enzyme that specifically shears when the recognition site is methylated, shearing may not occur, or shearing may be performed with significantly reduced efficiency when the recognition site is not methylated. For example, a methylation-specific restriction enzyme can recognize a sequence containing a CG dinucleotide (e.g., cgcg or cccggg).

[0074] In this application, the term "matrix compound" generally refers to a matrix material used in some form of mass spectrometry (e.g., MALDI mass spectrometry) analysis, which functions to separate analyte (e.g., in this application, the analyte is a nucleic acid sample) molecules from each other and transfers energy absorbed from the mass spectrometer's ion source to the analyte molecules, thereby causing them to desorb and ionize. Once the analyte is ionized, the mass of the ions can be measured using a mass analysis device known in the art. The choice of matrix material for mass spectrometry analysis generally depends on the type of biomolecule being analyzed. For example, when analyzing nucleic acid samples by mass spectrometry, a commonly used matrix material can be a mixture of 3-hydroxypicolinic acid (3-HPA) and diammonium citrate (DAC). For example, another matrix material used to promote the ionization of sample analytes is 2,5-dihydroxybenzoic acid (DHB).

[0075] In this application, the term "substrate" generally refers to a substance that participates in biochemical activities such as reactions, experiments, and detection. For example, in this application, "MALDI substrate" may refer to a mixture of a nucleic acid sample and a matrix compound to be detected by MALDI nucleic acid mass spectrometry.

[0076] In this application, the terms "comprise" and "comprising" are used interchangeably and generally mean that the features specified are included, but other elements are not excluded.

[0077] In this application, the term "selected from" generally refers to the selected objects and all combinations thereof. For example, "selected from (:) A, B and C" means all combinations of A, B and C, for example, A, B, C, A+B, A+C, B+C or A+B+C.

[0078] Detailed Description of the Invention

[0079] On the one hand, the present application provides a method for detecting the presence, absence or amount of one or more target nucleic acids in a nucleic acid sample, the method comprising: a) treating the nucleic acid sample under conditions that allow linear amplification of target DNA derived from the nucleic acid sample to generate linear amplification products of the target DNA; b) exponentially amplifying the linear amplification products to generate exponential amplification products of the target DNA; c) contacting the exponential amplification products of the target DNA with an extension primer under extension conditions including a terminating nucleotide to generate extended oligonucleotides; and d) analyzing the extended oligonucleotides to identify the presence, absence or amount of the one or more target nucleic acids in the nucleic acid sample, wherein the treatment under conditions enabling linear amplification includes adding a recognition sequence to the end of the target DNA in the nucleic acid sample, and the recognition sequence can be recognized and cleaved by a nuclease.

[0080] In another aspect, the present application provides a method for identifying a biomarker associated with a disease, disease outcome, and / or treatment regimen outcome, the method comprising the following steps: i) identifying the presence, absence, or amount of one or more target nucleic acids derived from one or more nucleic acid samples according to the method described herein, wherein the one or more nucleic acid samples are derived from one or more subjects with a known disease, disease outcome, and / or treatment regimen outcome; ii) identifying the presence, absence, or amount of one or more target nucleic acids derived from one or more nucleic acid samples according to the method described herein, wherein the one or more nucleic acid samples are derived from normal subjects; and iii) identifying a difference between the presence, absence, or amount of the one or more target nucleic acids in step i) and the presence, absence, or amount of the one or more target nucleic acids in step ii), and accordingly, identifying the difference as a biomarker associated with the disease, disease outcome, and / or treatment regimen outcome.

[0081] In another aspect, the present application provides a method for identifying methylation associated with a disease, disease outcome, and / or treatment regimen outcome, the method comprising the following steps: i) identifying methylated or unmethylated nucleotides in one or more target nucleic acids derived from one or more nucleic acid samples according to the method described herein, wherein the one or more nucleic acid samples are derived from one or more subjects with a known disease, disease outcome, and / or treatment regimen outcome; ii) identifying methylated or unmethylated nucleotides in one or more target nucleic acids derived from one or more nucleic acid samples according to the method described herein, wherein the one or more nucleic acid samples are derived from normal subjects; and iii) identifying a difference between the methylated or unmethylated nucleotides in the one or more target nucleic acids in step i) and the methylated or unmethylated nucleotides in the one or more target nucleic acids in step ii), and accordingly, identifying the differentially methylated or unmethylated nucleotides as methylation associated with the disease, disease outcome, and / or treatment regimen outcome.

[0082] On the other hand, the present application provides a kit for detecting a nucleic acid sample, the kit comprising: a linear amplification component, an exponential amplification component and an extension component, wherein the linear amplification component comprises a nuclease capable of nicking a single-stranded oligonucleotide, a DNA polymerase with strand displacement activity and deoxyribonucleoside triphosphates (dNTPs).

[0083] In another aspect, the present application provides a system for detecting a nucleic acid sample, the system comprising the kit described herein, and optionally comprising one or more parts selected from the group consisting of instructions, reagents, and a device for using the kit.

[0084] Sample and target nucleic acid

[0085] The methods and products (eg, kits, systems, etc.) of the present application can be used to identify the presence, absence, or amount of one or more target nucleic acids in a nucleic acid sample.

[0086] In the present application, the nucleic acid identified can be an oligonucleotide or a polynucleotide, including but not limited to natural nucleic acids (such as deoxyribonucleic acid (DNA), ribonucleic acid (RNA)), synthetic nucleic acids, non-natural nucleic acids (such as peptide nucleic acid (PNA)), unmodified nucleic acids, modified nucleic acids (such as methylated DNA, labeled nucleic acids, nucleic acid molecules with one or more modified nucleotides), etc. In the present application, "polynucleotide" refers to two or more nucleotides or nucleotide analogs connected by a covalent bond. Nucleic acid can be any type of nucleic acid suitable for the method described in the present application. For example, the nucleic acid can be DNA (such as complementary DNA (cDNA), genomic DNA (gDNA), cfDNA, ctDNA, plasmid and vector DNA, etc.), or it can be a nucleic acid analog (for example, containing base analogs, sugar analogs and / or non-natural backbones, etc.). Nucleic acid can be in any form that can be used to perform the method described in the present application (for example, linear, circular, supercoiled, single-stranded, double-stranded, etc.). For example, the nucleic acid can be or can be derived from a plasmid, a phage, an autonomously replicating sequence (ARS), a centromere, an artificial chromosome, a chromosome, a cell, a nucleus or the cytoplasm of a cell. In some cases, the nucleic acid can be from a single chromosome (for example, a nucleic acid sample can be from a chromosome of a sample obtained from a diploid organism). In the case of fetal nucleic acid, the nucleic acid can be from paternal alleles, maternal alleles or maternal and paternal alleles. For example, the nucleic acid described herein can be cell-free DNA, such as cfDNA in a tissue or sample, such as ctDNA from a tumor or cancerous tissue / site.

[0087] In the present application, the target nucleic acid molecule to be detected or identified can be of any length. For example, it can comprise at least 1 (for example, it can comprise at least 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100 or more) nucleotides.

[0088] In the present application, the target nucleic acid molecule to be detected or identified can include one or more modifications, such as one or more methyl groups or methylation states, one or more phosphate groups, one or more acetyl groups and one or more nucleotides and one or more deletions, additions or replacements. The example of one or more deletions, additions or replacements of one or more nucleotides includes but is not limited to the presence or absence of specific mutations, nucleotide substitutions (e.g., single nucleotide polymorphisms (SNPs)), the presence or absence of repetitive sequences (e.g., dinucleotides, trinucleotides, tetranucleotides, pentanucleotide repeats), the presence or absence of markers (e.g., microsatellites) and the presence or absence of distinguishing sequences (e.g., distinguishing the sequence of a kind of organism from another kind of organism (e.g., distinguishing the sequence of a kind of virus strain from another kind of virus strain)). The different nucleic acids of target nucleic acids and different target nucleic acids can be distinguished by any known means, for example, as described in the present application, by quality, combination, distinguishable tags etc.

[0089] In some embodiments, the variant of target nucleic acid can be present in sample with roughly equal frequency or copy number (for example, SNP). In some embodiments, the variant of target nucleic acid can be present in sample with different frequency or copy number. In some embodiments, a variant can exist with greater abundance than other variants. In some embodiments, the variant with greater abundance is referred to as wild type, and the variant with less abundance is referred to as mutant. In some cases, target nucleic acid comprises the first and second variants, wherein the first or second variant shows greater abundance than other variants, i.e., high abundance variant and low abundance variant or a large amount of (major) variant and a small amount of (minor) variant. When compared with another variant, the variant showing greater abundance is usually present with higher concentration or represented by higher number of molecules (for example, copy) number. Higher concentration can be 2 times or more. In some embodiments, higher concentration is 10 times or more. In some embodiments, higher concentration is 100 times, 1000 times or 10000 times or more. In some embodiments, a variant represents wild-type sequence, and concentration is 100 times or more higher than another variant. In certain embodiments, the concentration of a variant (a low-abundance variant) is significantly lower than that of another variant (e.g., wild-type, a high-abundance variant).

[0090] In certain embodiments, the methods of the present application can be used to detect the presence or absence of low-abundance target nucleic acids (e.g., cfDNA or ctDNA) that are less than 30%, 20%, 15%, 10%, 8%, 5%, 4%, 3%, 2%, 1%, 0.8%, 0.75%, 0.5%, 0.1%, 0.05%, 0.01% or less of the total nucleic acid count in a sample. In certain embodiments, the methods of the present application can be used to detect the presence or absence of low-abundance target nucleic acids (e.g., cfDNA or ctDNA) that are about 1% to about 10% of the total nucleic acid count in a sample. In certain embodiments, the methods of the present application can be used to detect the presence or absence of low-abundance target nucleic acids (e.g., cfDNA or ctDNA) that are about 5% or less of the total nucleic acid count in a sample. In certain embodiments, the methods of the present application can be used to detect the presence or absence of low-abundance target nucleic acids (e.g., cfDNA or ctDNA) that are about 5% to 0.75% of the total nucleic acid count in a sample. In certain embodiments, the methods of the present application can be used to detect the presence or absence of low-abundance target nucleic acids (e.g., cfDNA or ctDNA) that account for about 5% to about 0.1% of the total nucleic acid count in a sample. In certain embodiments, the methods of the present application can be used to detect the presence or absence of low-abundance target nucleic acids (e.g., cfDNA or ctDNA) that account for about 1% or less of the total nucleic acid count in a sample. In certain embodiments, the methods of the present application can be used to detect the presence or absence of low-abundance target nucleic acids (e.g., cfDNA or ctDNA) that account for about 0.1% to about 0.001% of the total nucleic acid count in a sample.

[0091] For example, the content of target nucleic acid (e.g., DNA, such as cfDNA, ctDNA, etc.) in the sample can be less than about 100 ng (e.g., less than about 90 ng, less than about 80 ng, less than about 70 ng, less than about 60 ng, less than about 50 ng, less than about 40 ng, less than about 30 ng, less than about 20 ng, less than about 15 ng, less than about 10 ng, less than about 9 ng, less than about 8 ng, less than about 7 ng, less than about 6 ng, less than about 5 ng, less than about 4 ng, less than about 3 ng, less than about 2 ng, less than about 1 ng, less than about 0.9 ng, less than about 0.8 ng, less than about 0.7 ng, less than about 0.6 ng, less than about 0.5 ng, less than about 0.45 ng, less than about 0.4 ng, less than about 0.35 ng, less than about 0.3 ng, less than about 0.2 ng or less).

[0092] For example, the content of target nucleic acid (e.g., DNA, such as cfDNA, ctDNA, etc.) in the sample can be less than about 20% of the total nucleic acid content, such as less than about 15%, less than about 10%, less than about 9%, less than about 8%, less than about 7%, less than about 6%, less than about 5%, less than about 4%, less than about 3%, less than about 2%, less than about 1%, less than about 0.9%, less than about 0.8%, less than about 0.7%, less than about 0.6%, less than about 0.5%, less than about 0.4%, less than about 0.3%, less than about 0.2%, less than about 0.1%, less than about 0.05%, less than about 0.04%, less than about 0.03%, less than about 0.02%, less than about 0.01%, or less. The percentage can be mass percentage, volume percentage, and / or molar percentage.

[0093] For example, the sample can comprise a mixture of one or more target nucleic acids (each target nucleic acid can have low abundance and high abundance variants), or a mixture can be formed by combining more than one sample comprising one or more target nucleic acids (each target nucleic acid can have low abundance and high abundance variants). Low abundance variants can be variants of high abundance variants and can include, but are not limited to, mutants of wild-type (high abundance variant) alleles (low abundance variants), variants of genes present in more than one host (e.g., viral oncogenes (low abundance genes) that are variants of normal healthy genes (high abundance variants)), polymorphisms, including single nucleotide polymorphisms (SNPs), insertions, deletions, or other mutational forms of high abundance variants.

[0094] The method of the present application can be used to simultaneously identify multiple target nucleic acids that may be present in a sample. The multiple target nucleic acids can refer to more than one target nucleic acid. For example, the multiple target nucleic acids can be about 2 to about 10,000 target nucleic acids, about 2 to about 1,000 nucleic acids, about 2 to about 500 nucleic acids, or about 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 80, 85, 90, 95, 100, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 950, 1000, 1100 In some embodiments, the present invention relates to a method for preparing the present invention for preparing the present invention. In some embodiments, the present invention relates to a method for preparing the present invention for preparing the present invention for preparing the present invention for preparing the present invention for preparing the present invention for preparing the present invention for preparing the present invention for preparing the present invention for preparing the present invention for preparing the present invention for preparing the present invention for preparing the present invention for preparing the present invention for preparing the present invention for preparing the present invention for preparing the present invention for preparing the present invention for preparing the present invention for preparing the present invention for preparing the present invention for preparing the present invention for preparing the present invention for preparing the present invention for preparing the present invention for preparing the present invention for preparing the present invention for preparing the present invention for preparing the present invention for preparing the present invention

[0095] For example, the nucleic acid detection or identification provided by the methods described herein can detect one or more sites (e.g., about 2 to about 10,000 sites, about 2 to about 1,000 sites, about 2 to about 500 sites, or about 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 100, 100, 100, 100, 100, 100, 100, 100, 100, 100 5, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000 or 10000 sites, which can include different sites on the same nucleic acid molecule or the same sites in different nucleic acid molecules, and whether methylation is present or the methylation status.

[0096] In the present application, a sample comprising a nucleic acid (e.g., a target nucleic acid) can be derived from one or more sources and can comprise a mixture of target nucleic acids, each of which can have one or more high-abundance variants and low-abundance variants having different copy numbers. Samples can also be combined to generate a mixture comprising different target nucleic acids, each of which can have different abundances and / or different copy numbers.

[0097] For example, the sample of the present application can be collected from organisms, minerals or geological sites (for example, soil, rock, mineral deposit, fossil) or forensic sites (for example, crime scenes, contraband or suspected contraband). Therefore, the source can be environmental, such as geological, agricultural, battlefield or soil sources. The source can also be any type of organism, such as any plant, fungus, protozoa, prokaryotes, viruses or animals, including but not limited to: humans, non-humans, mammals, reptiles, cattle, cats, dogs, goats, pigs, monkeys, apes, orangutans, bulls, cows, bears, horses, sheep, poultry, mice, rats, fish, dolphins, whales and sharks, or any animal or organism with detectable nucleic acid. The source can also refer to different parts of an organism, such as inside, outside, living or dead cells, tissues, liquids, etc. Therefore, a sample can be a "biological sample", which can be obtained from a living body or a source that was once a living body, such as any material of an animal such as a human or other mammal, plant, bacterium, fungus, protozoa or virus. The source can be in any form, including but not limited to solid materials such as tissues, cells, cell aggregates, cell extracts, or biopsy samples, or biological fluids such as urine, blood, saliva, amniotic fluid, exudates from infected or inflammatory areas, or mouthwash containing oral cells, hair, cerebrospinal fluid and joint fluid, and organs. For example, examples of samples (such as biological samples) may include respiratory tissue, exudates (e.g., bronchoalveolar lavage fluid), biopsy specimens, sputum, peripheral blood, plasma, serum, lymph nodes, gastrointestinal tissue, feces, urine, cerebrospinal fluid, tissue fluid (e.g., pleural effusion), lavage fluid (e.g., alveolar) or other fluids, tissues or materials. For example, the sample can be a processed specimen or material, such as obtained by processing the sample using filtration, centrifugation, precipitation or adsorption to a medium (e.g., a matrix or carrier). Other processing of the sample may include physical or mechanical disruption of tissue, cell aggregates, or cells to release intracellular components, including nucleic acids, into a solution that may contain other components, such as enzymes, buffers, salts, detergents, etc. The sample may also include tissue, such as biopsied tissue (e.g., liquid biopsy tissue), formalin-fixed and paraffin-embedded (FFPE) tissue, etc.

[0098] In some embodiments, the present invention provides the nucleic acid of the present invention.Sample can also be separated and obtained at a time point different from another sample, and wherein each sample can be from the same or different source.Nucleic acid can be from a nucleic acid library, such as a DNA library.Nucleic acid can be the product of nucleic acid purification or separation and / or amplification of nucleic acid molecules in the sample.The nucleic acid for sequencing analysis provided by the application can contain nucleic acid from one or from two or more samples (such as 1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,25,50,75,100,200,300,400,500,600,700,800,900 or 1000 or more samples).

[0099] Nucleic acids can be treated in a variety of ways during, before, or after the methods provided herein. For example, the length or mass of the nucleic acid can be reduced (e.g., by shearing, digestion with nucleases or restriction enzymes, dephosphorylation, demethylation), the size or mass of the nucleic acid can be increased (e.g., by phosphorylation, reaction with a methylation-specific reagent, attachment to a detectable label, etc.), or treatment with a nucleic acid cleavage inhibitor can be performed.

[0100] In some embodiments, untreated nucleic acid is provided for analysis according to the method described herein. In some embodiments, treated nucleic acid is provided for implementation of the method described herein. For example, nucleic acid can be extracted, separated, purified or amplified from a sample. For example, nucleic acid can be taken out from its original environment (for example, the natural environment of naturally occurring nucleic acid or the host cell of exogenous expression nucleic acid), so nucleic acid is changed from its original environment by "artificial" operation. Compared with the component content in the sample from which it is derived, the nucleic acid of separation generally carries less non-nucleic acid components (for example, protein, lipid etc.). The composition comprising the nucleic acid of separation can be substantially separated (for example, about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or greater than 99% without non-nucleic acid components). In the present application, purified nucleic acid refers to that the nucleic acid provided comprises less non-nucleic acid components compared with the sample source from which it is derived. A composition comprising nucleic acids can be substantially purified (e.g., about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or greater than 99% free from other nucleic acids).

[0101] Linear amplification

[0102] In the method of the present application, the nucleic acid sample can be treated under conditions that can cause linear amplification of the target DNA of the nucleic acid sample to generate a linear amplification product of the target DNA, and the conditions for linear amplification include adding a recognition sequence to the end of the target DNA, and the recognition sequence can be recognized and cut by a nuclease. The method of the present application provides a method for adding the recognition sequence. In certain embodiments, the addition of the recognition sequence is by connecting the double-stranded ends of the target DNA to a linker, and the linker is a double-stranded oligonucleotide containing the recognition sequence. In other embodiments, the addition of the recognition sequence includes contacting the target DNA with a primer so that the end of the target DNA forms a linker containing a recognition sequence, and the primer comprises a first segment and a second segment, the first segment comprises a recognition sequence, and the second segment comprises a sequence that can be partially complementary to the target DNA.

[0103] In some cases, the nucleic acid sample needs to be treated with one or more of the following: blunting the ends of the target DNA, adding deoxyadenosine dA to the ends of the target DNA, phosphorylating the 5' end of the target DNA, dephosphorylating the 5' end of the target DNA, and modifying the target DNA to maintain its nucleic acid sequence after bisulfite treatment. These treatments can be performed before ligating the target DNA ends or forming the adapter, or they can be performed on the target DNA that already contains or has formed the adapter at its end.

[0104] For example, the conditions for the linear amplification include the addition of a nuclease, for example, a restriction endonuclease. However, a restriction endonuclease typically contains a specific recognition sequence of 3-8 base pairs in length, and especially when the specific recognition sequence is only 3-4 base pairs in length, the target DNA chain needs to be protectively modified to avoid the nuclease that is supposed to only cut the recognition sequence on the linker sequence from being off-target, that is, to avoid additional cutting on the target DNA chain. In certain embodiments, the protective modification of the target DNA includes methylating the cytosine bases in the target DNA, because the restriction endonuclease is a nuclease that is sensitive to methylation and will only produce specific shearing when the recognition site is not methylated. When the recognition site is methylated, the restriction endonuclease may not cut, or cut with significantly reduced efficiency.

[0105] In some cases, it is necessary to perform one or more protective modifications on the linker sequence so that the nuclease can generate a nick in the recognition sequence region or in the vicinity thereof. For example, when the conditions for the linear amplification include adding a nuclease that recognizes and cuts double-stranded DNA, for example, adding a Cas enzyme, it is necessary to perform protective modification on a certain oligonucleotide chain of the linker to prevent it from being cut by the nuclease. In some embodiments, the protective modification of the linker may include replacing the non-bridging oxygen atom on the nucleotide phosphate backbone of the linker sequence with a sulfur atom, and the nucleotide in which the replacement occurs is located near the recognition sequence; the oligonucleotide single chain that has undergone the protective modification will not be recognized and / or cut by the nuclease. For another example, when the nucleic acid sample is expected to be used for methylation detection, it is necessary to perform one or more protective modifications on the linker sequence so that the nucleic acid sequence of the linker is not changed after bisulfite treatment; in some embodiments, the protective modification may include methylating the cytosine base in the linker sequence.

[0106] Exponential expansion

[0107] In the method of the present application, the linear amplification product can be subjected to exponential amplification to generate exponential amplification products of the nucleic acid (eg, the target DNA described in the present application).

[0108] In the exponential amplification, an amplification composition (e.g., an exponential amplification composition) can be used, the components of which may include, but are not limited to, nucleotides (e.g., nucleotide triphosphates), modified nucleotides, oligonucleotides (e.g., primer oligonucleotides for polymerase-based amplification and oligonucleotide building blocks for ligase-based amplification), one or more salts (e.g., magnesium salts), one or more buffers, one or more polymerizing agents (e.g., ligases, polymerases), one or more nicking enzymes (e.g., enzymes that cut one strand of a double-stranded nucleic acid), and one or more nucleases (e.g., exonucleases, endonucleases, RNAses). Any polymerase suitable for amplification can be used, such as polymerases with or without exonuclease activity, DNA polymerases, and RNA polymerases, mutant forms of these enzymes. Any suitable polymerase suitable for binding to an oligomer can be used.

[0109] In some embodiments, the amplification conditions can include a 5' end of a nucleotide and a 3' end of another oligonucleotide. Amplification conditions can also include some reaction conditions, such as isothermal or temperature cycling conditions. The method of cycling temperature in amplification methods is known, such as by thermal cycling equipment. The term "cycle" generally refers to the amplification (for example, amplification reaction or extension reaction) utilizing a single primer or multiple primers, wherein temperature cycling is used. In some embodiments, amplification conditions can also include an emulsifying agent (for example, oil), which is used to form a plurality of reaction compartments, in which a single nucleic acid molecule material can be increased.

[0110] For example, the exponential amplification reaction is a reaction that is carried out under conditions that allow the nucleic acid molecules in the sample or system to be exponentially amplified. For example, the linear amplification product can be contacted with an amplification composition (e.g., an exponential amplification composition) so that exponential amplification of the nucleic acid can occur under appropriate conditions. The exponential amplification composition typically contains a minimum amount of one or more components required for exponential amplification that are lacking in the linear amplification composition. For example, the exponential amplification composition may contain one or more of the following components or conditions: amplification oligonucleotides, reverse transcriptase, polymerase, nuclease, phosphorylase, enzyme cofactor, chelating agent, ribonucleoside triphosphate (rNTP), deoxynucleoside triphosphate (dNTP), MgCl2, ... 2+ , optimal pH, optimal temperature, salt, and combinations thereof. The polymerase is typically selected from RNA-dependent DNA polymerases, DNA-dependent DNA polymerases, DNA-dependent RNA polymerases, and combinations thereof. In certain embodiments, the exponential amplification composition comprises a reverse transcriptase and a DNA polymerase.

[0111] In certain instances, the exponential amplification comprises polymerase chain reaction (PCR).

[0112] In some cases, the exponential amplification reaction is an RT-PCR reaction, such as a one-step RT-PCR reaction, or a two-step RT-PCR reaction. For example, reverse transcription can provide a cDNA template for PCR amplification and downstream experiments, and the selected reverse transcriptase can have the highest efficiency for all samples, including RNA samples that are difficult to transcribe, such as RNA samples that are degraded, have inhibitor residues, or have a high degree of secondary structure. The one-step RT-PCR can include combining the first-strand cDNA synthesis (RT) and the subsequent PCR reaction in a single reaction (e.g., in a single reaction tube). The two-step RT-PCR can include two independent reactions, for example, first performing a first-strand cDNA synthesis (RT), and then amplifying the cDNA obtained in the first step by PCR.

[0113] In some cases, the exponential amplification is a non-target specific amplification that is not directed to a particular target. For example, the amplified product obtained or the amplified product can have different nucleic acid sequences (for example, because they are each amplified based on different template sequences) to each other. And in specific amplification, the product obtained by amplification is often identical with the template sequence. For example, by using universal primers, the exponential amplification can be amplified with similar ratio or multiple to substantially all nucleic acid molecules (for example, the nucleic acid molecules with different sequences) present in a sample or system. In some embodiments, the exponential amplification does not use the specific amplification primer for a particular target or for a particular target sequence, for example, it can not only specifically amplify some specific nucleic acid molecules or gene fragments present in a sample or reaction system, and does not amplify or with significantly lower other nucleic acid molecules or gene fragments present in amplified sample or reaction system.

[0114] However, the exponential amplification may be sequence-specific, ie, it may be an exponential amplification of a sequence that is common to a plurality of molecules or a variety of molecules in a sample.

[0115] Therefore, in some embodiments, by using universal primers to realize amplification based on polymerase.In such method, the hybridization region hybridized with one or more universal primers is introduced into template nucleic acid.For example, this type of hybridization reagent can be mixed with (i) and the primer that hybridizes with target nucleic acid and is extended, (ii) and the oligonucleotide of target nucleic acid or the product of (i) are engaged (for example, using ligase to connect), and / or (iii) there is the primer of the universal sequence manufactured at gene-specific sequence 5 ' end.The amplification method using universal primers can provide the advantage (also referred to as " not for the non-target specific amplification of specific target " in this application) of for example only using one or two amplification primers to amplify multiple target nucleic acids.

[0116] In some embodiments, the exponential amplification comprises repeating multiple temperature cycles to amplify the amount of the target nucleic acid. In some embodiments, the amplification reaction is cycled 2 times or more. In some embodiments, the amplification reaction is cycled 10 times or more. In some embodiments, the amplification reaction is cycled about 10, 15, 20, 50, 100, 200, 300 times or more. In some embodiments, the amplification reaction is cycled 20 to 50 times. In some embodiments, the amplification reaction is cycled 30 to 45 times.

[0117] In the methods of the present application, a strand of a single-stranded nucleic acid target can be amplified (for example, the exponential amplification can be performed using an RNA molecule as a template), and one or both strands of a double-stranded nucleic acid target can be amplified. In some embodiments, the amplification product (amplification product) is about 10 to about 10,000 nucleotides in length, such as about 10 to about 1,000 nucleotides in length, about 10 to about 500 nucleotides in length, about 10 to about 100 nucleotides in length, and sometimes about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 80, 85, 90, 95, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 600, 700, 800, 900, or 1,000 nucleotides in length.

[0118] Methylation testing

[0119] In certain embodiments, the methods of the present application can be used to identify the presence, absence, or amount of one or more methylated target nucleic acids in a nucleic acid sample. In certain cases, the methods of the present application can be used to identify the methylation status of nucleotide loci in one or more target nucleic acids in a nucleic acid sample.

[0120] For example, a process for linearly amplifying nucleic acids in a sample further includes treating the sample with a reagent capable of modifying unmethylated specific nucleotides to generate other nucleotides. For example, the reagent capable of modifying unmethylated specific nucleotides to generate other nucleotides may include a reagent capable of modifying unmethylated cytosine to generate uracil. For example, the reagent capable of modifying unmethylated specific nucleotides to generate other nucleotides may include bisulfite, β-glucosyltransferase, TET enzyme, pyridine borane, and / or A3A deaminase.

[0121] For example, a nucleic acid molecule (e.g., DNA) can be denatured and treated with bisulfite, wherein unmethylated C (cytosine) is converted to U (uracil), while methylated 5mC remains 5mC. Accordingly, after bisulfite treatment, a specific base position in the target region will be U or C, where U represents that the target region is unmethylated (and therefore converted to U), and C represents that the target region is methylated (and therefore not converted to U).

[0122] In some cases, the reagent that can modify unmethylated specific nucleotides to generate other nucleotides can include a reagent other than bisulfite. For example, during TAPS sequencing, 5hmC is protected with a sugar using β-glucosyltransferase (β-GT), 5mC is oxidized to 5caC using TET enzyme, 5caC is reduced to dihydrouracil (DHU) using pyridine borane, and is read as T during reading (e.g., sequencing). For example, during the TAB-Seq method, 5hmC is protected with a sugar using β-glucosyltransferase (β-GT), 5mC is oxidized to 5caC using TET enzyme, and bisulfite treatment can deaminate C and 5caC to U, which is read as T during reading (e.g., sequencing), while 5hmC is unaffected and is still read as C during reading (e.g., sequencing). For example, during the ACE-seq method, β-glucosyltransferase (β-GT) is used to protect 5hmC with sugar, which is read as C during reading (e.g., sequencing), and A3A deaminase is used to deaminize C and 5mC to generate U, which is read as T during reading (e.g., sequencing).

[0123] In certain embodiments of the method of the present application, step a) (e.g., a step for generating a linear amplification product of the target DNA) may include: ligating the target DNA derived from the nucleic acid sample to the adapter of the present application to form the adapter-containing nucleic acid, or contacting the target DNA with a primer to form the adapter-containing nucleic acid, wherein the adapter sequence contains one or more modifications (e.g., methylation modification, such as 5mC, 5hmC, 5ghmC, etc.), and the modification makes the nucleic acid sequence of the adapter sequence unchanged after bisulfite treatment; treating the adapter-containing nucleic acid with a reagent containing bisulfite to form a converted nucleic acid; and reacting the converted nucleic acid under conditions capable of linear amplification to generate a linear amplification product of the target DNA.

[0124] Changes in methylation patterns are often early events in the development and progression of cancer and other diseases. In many cancers, certain genes are inappropriately repressed or activated due to aberrant methylation. The ability of methylation patterns to repress or activate transcription can be inherited.

[0125] Therefore, the method of the present application can be used to detect sequence variations as epigenetic changes of target sequences, such as changes in methylation patterns in target sequences. The covalent addition of methyl to cytosine is mainly present on CpG dinucleotides (microsatellites). Although the function of the CpG island that is not located in the promoter region remains to be explored, the CpG island in the promoter region has received special attention because its methylation status regulates the transcription and expression of related genes. Methylation of the promoter region causes the silencing of gene expression. This silencing is permanent and continues through the mitotic process. Due to its important role in gene expression, DNA methylation has an impact on the developmental process, imprinting and X chromosome inactivation, as well as tumorigenesis, aging, and the suppression of parasitic DNA. Methylation is believed to be involved in the carcinogenesis of many widespread tumors such as lung, breast and colon cancer and leukemia. There is also an association between methylation and protein dysfunction (long QT syndrome) or metabolic diseases (transient neonatal diabetes, type 2 diabetes).

[0126] Bisulfite treatment of DNA (e.g., genomic DNA, cfDNA, or ctDNA) can be used to analyze the position of methylated cytosine residues in DNA. Treating nucleic acids with bisulfite deaminates cytosine residues into uracil residues, while methylated cytosine remains unchanged. Therefore, by comparing the sequence of a target nucleic acid that has not been treated with bisulfite with the sequence of a nucleic acid that has been treated with bisulfite according to the method of the present application, the degree of methylation in the methylated nucleic acid and the position at which the cytosine is methylated can be inferred. Similarly, TAPS sequencing, TAB-Seq, ACE-seq, etc. can also be used to analyze the position of methylated cytosine residues (e.g., 5mC, 5hmC, 5ghmC, etc.) in DNA.

[0127] Extension reaction

[0128] In the method of the present application, the exponential amplification product of the target DNA can be contacted with an extension primer under extension conditions including a terminator nucleotide to generate an extended oligonucleotide (i.e., perform an extension reaction). The extension reaction of the present application can be a single-base extension reaction. For example, after the extension primer is extended by only one base (e.g., a single-base extension using a terminator nucleotide), the extension reaction is terminated.

[0129] In the extension reaction of the present application, a nucleic acid polymerase can add one or more nucleotides to the 3' end of a primer (eg, an oligonucleotide) in a template-specific manner.

[0130] Conditions suitable for primer extension reaction are known in the art.Usually, primer is annealed (that is, hybridized) to target nucleic acid to form primer-template complex.Primer-template complex is contacted with archaeal dna polymerase and one or more free nucleotides under suitable conditions, to allow the addition of one or more nucleotides to the 3 ' end of primer.In some embodiments, primer and the nucleic acid site (for example, target site, as the methylation modification site that wishes to be differentiated) that hope to detect do not directly hybridize, but hybridize (for example, 5 ' end of this position) with the adjacent position of this position.In some embodiments, primer and the adjacent region of target site (for example, the methylation modification site that wishes to be differentiated) directly hybridize.In some embodiments, can use terminator nucleotide to terminate primer extension in primer extension reaction.

[0131] In the present application, " hybridization site " refers to the specific site on amplified product or target nucleic acid (for example, nucleic acid molecules to be measured in the sample).In some embodiments, the end of the oligonucleotide is adjacent to or substantially adjacent to amplified product or target nucleic acid and has a site different from another amplified product or target nucleic acid sequence.When there is no nucleotide between the site and the oligonucleotide end, the oligonucleotide end is "adjacent" to the site.In some embodiments, when there are 1,2,3,4,5,6,7,8,9 or 10 nucleotides between the site and the oligonucleotide end, the oligonucleotide end is "substantially adjacent" to the site.

[0132] The extension reaction is typically carried out under extension conditions. The extension conditions / reagents may include, but are not limited to, one or more oligonucleotides, extension nucleotides (e.g., nucleotide triphosphates (dNTPs)), terminating nucleotides (e.g., one or more dideoxynucleotide triphosphates (ddNTPs) or acyclic nucleotides), one or more salts (e.g., magnesium-containing salts), one or more buffers (e.g., containing β-NAD, Triton X-100), and one or more polymerizing agents (e.g., DNA polymerase, RNA polymerase).

[0133] Can select and use any suitable extension reaction.For example, can use extension reaction to distinguish SNP allele or specific methylation site, this is by being incorporated in the extension oligonucleotide of the regional hybridization adjacent with specific site in target nucleic acid by deoxynucleotide and / or terminator nucleotide (for example, dideoxynucleotide, acyclic nucleotide).Described primer is extended by polymerase conventionally.In some embodiments, oligonucleotide is extended by only one deoxynucleotide or terminator nucleotide (for example, dideoxynucleotide or acyclic nucleotide) complementary to site to be tested.In some embodiments, oligonucleotide is extended by mixing dNTP and stops by ddNTP or acyclic nucleotide, or in some embodiments, oligonucleotide stops by mixing ddNTP or acyclic nucleotide and does not have dNTP to extend.

[0134] In some embodiments, an oligonucleotide can be extended by any of the five terminating nucleotides (e.g., ddATP, ddUTP, ddTTP, ddGTP, ddCTP). The target nucleic acid or its corresponding amplification product can be used as a template and can partially determine which terminating nucleotide is added to the oligonucleotide during the extension reaction. In certain embodiments, other terminating nucleotides (e.g., acyclic nucleotides or terminators) can be utilized.

[0135] In certain embodiments, extension can be performed under isothermal conditions or under non-isothermal conditions (e.g., thermal cycling conditions). One or more target nucleic acids can be extended in the extension reaction, and one or more variants of each target nucleic acid can be extended. 75, 80, 80, 85, 90, 95, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 600, 700, 800, 900, or 1000 nucleotides in length. The incorporation of a terminating nucleotide (eg, ddNTP), the position of hybridization, or other factors can determine the length of the oligonucleotide extension. In certain embodiments, amplification and extension reactions are performed in the same detection process.

[0136] In some embodiments, the extension reaction comprises repeating multiple temperature cycles to amplify the amount of extension product in the reaction. In some embodiments, the extension reaction is cycled 2 or more times. In some embodiments, the extension reaction is cycled 10 or more times. In some embodiments, the extension reaction is cycled about 10, 15, 20, 50, 100, 200, 300, 400, 500, or 600 times or more. In some embodiments, the extension reaction is cycled 20 to 50 times. In some embodiments, the extension reaction is cycled 20 to 100 times. In some embodiments, the extension reaction is cycled 20 to 300 times. In some embodiments, the extension reaction is cycled 200 to 300 times. In some embodiments, the extension reaction is cycled at least 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 times.

[0137] In some embodiments, the oligonucleotide (e.g., extension primer of the present application) hybridized to the target nucleic acid (e.g., exponential amplification product of the present application) is extended by a nucleotide in the presence of an extension composition. The extension composition can include one or more buffers, salts, enzymes (e.g., polymerase, Klenow, etc.), water, templates (e.g., DNA, RNA, amplification products, etc.), primers (e.g., oligonucleotides), triphosphate nucleotides, glycerol, macromolecular exclusion molecules (macromolecular exclusion molecule) and any other additives used in the art. The extension composition can include a mixture of terminator nucleotides (e.g., dideoxynucleotides (e.g., ddNTPs) or pentacyclic nucleotides), non-terminator nucleotides (e.g., dNTPs) or terminator nucleotides and non-terminator nucleotides. The extension composition is essentially composed of one or more specific terminator nucleotides, can include any other components of the extension composition (e.g., buffer, salt, template, etc.), but except those specified, does not substantially include any other terminator nucleotides or triphosphate nucleotides (e.g., dNTPs). For example, the extension composition essentially composed of ddTTP and ddCTP does not contain ddATP, ddGTP or any other dNTPs. In some embodiments, the nucleotides in the extension composition are only terminator nucleotides and oligonucleotides that hybridize to the target nucleic acid, and the target nucleic acid or its amplified product is extended by one nucleotide. In some embodiments, the extension composition consists essentially of terminator nucleotides (e.g., ddNTPs, acyclic nucleotides).

[0138] In some embodiments, the terminator nucleotide present in the extension composition (or not present in some embodiments) determines which terminator nucleotide is added to the oligonucleotide. In some embodiments, the extension composition includes one or more terminator nucleotides (for example, ddNTP or acyclic nucleotides). In some embodiments with more than a terminator nucleotide, 2,3 or 4 kinds of chain terminator nucleotides are different terminators (that is, not identical substances, for example, ddA, ddT, ddC, ddG, ddU, acyATP, acyCTP, acyGTP, acyTTP and acy-bromo-UTP). In some embodiments, the extension composition includes one or more terminators and one or more non-terminator nucleotides (for example, dNTP). In some embodiments, the extension composition includes the terminator nucleotides of corresponding specific variants (for example, the first variant, low amount variant or low abundance variant), and therefore only specific variants can be extended. In some embodiments, the extension composition includes the terminator nucleotides that can allow the second variant (for example, wild type, high amount variant or high abundance variant) to be extended, thereby allowing the second variant to be extended. In some embodiments, the methods of the present application comprise contacting a hybridized oligonucleotide species with an extension composition comprising one or more stop nucleotides under extension conditions, thereby generating extended oligonucleotide species, wherein the oligonucleotide hybridized to the first variant (e.g., low abundance variant, less abundant variant, low amount variant) is extended by the stop nucleotide, and the oligonucleotide hybridized to the second variant (e.g., wild type, high abundance variant, high amount variant) is extended by the stop nucleotide.

[0139] For example, the extension primer can specifically bind to the target nucleic acid (e.g., a specific site or target nucleic acid that one wishes to identify). In the present application, the extension primer can comprise a nucleic acid molecule (e.g., a single-stranded nucleic acid molecule, such as a single-stranded DNA molecule) of at least about 1 nucleotide, e.g., at least about 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or more nucleotides. The extension primer can be substantially fully complementary (e.g., at least 80% complementary, such as at least 85% complementary, at least 90% complementary, at least 91% complementary, at least 92% complementary, at least 93% complementary, at least 94% complementary, at least 95% complementary, at least 96% complementary, at least 97% complementary, at least 98% complementary, or at least 99% or more complementary, such as 100% complementary) to its target sequence (e.g., a specific site or target nucleic acid that one wishes to identify).

[0140] In certain embodiments, the extension reaction (eg, single base extension reaction) may use a DNA polymerase, such as the Therminator DNA polymerase from NEB.TM DNA polymerase, Therminator DNA polymerase is 9°N TM A mutant DNA polymerase, engineered to recognize and incorporate modified bases such as ddNTPs. Due to the enzyme's thermostability, repeated denaturation, annealing, and extension cycles can significantly improve primer utilization and yield.

[0141] Other T7 DNA polymerases can also be used, for example, genetically engineered T7 DNA polymerases can also be used for single base extension reactions. For example, the DNA polymerase can be a genetically engineered form of T7 DNA polymerase (e.g., Sequenase). Unlike the wild-type enzyme, it can have essentially no 3'→5' exonuclease activity. The DNA polymerase can comprise two subunits, one of which can be Escherichia coli thioredoxin and the other can be a genetically engineered version of the bacteriophage T7 gene 5 protein. Genetic alterations to the subunit (e.g., deletion of 28 amino acids by in vitro mutation) can eliminate all measurable exonuclease activity but will not alter the activity of the DNA polymerase.

[0142] For example, the terminator nucleotide may be modified at the 3' carbon of its pentose moiety. For example, at least one of the terminator nucleotides may be a dideoxynucleotide. For example, the dideoxynucleotide may be selected from the group consisting of ddATP, ddGTP, ddCTP, ddTTP, and ddUTP. In certain embodiments, the terminator nucleotide is an acyclic nucleotide. For example, the acyclic nucleotide may be selected from the group consisting of acyATP, acyCTP, acyGTP, acyTTP, and acy-bromo-UTP.

[0143] For example, the terminator nucleotides include: 1) a terminator nucleotide specific for the other nucleotides generated by modification of the unmethylated specific nucleotides after the treatment; and 2) a terminator nucleotide specific for the methylated specific nucleotide.

[0144] Detection

[0145] In the present application, the extended oligonucleotide comprises a detectable label. For example, the detectable label can be a mass marker. For example, the mass marker can be a mass distinguishable tag. In some cases, the terminating nucleotide can comprise the mass distinguishable tag.

[0146] For example, in the method of the present application, the mass marker can be detected by mass spectrometry. The mass spectrometry can be, for example, matrix-assisted laser desorption ionization (MALDI) mass spectrometry.

[0147] The detectable marker generally refers to a label that can be distinguished from each other and used to identify the nucleic acid to which the marker is connected. Various types of markers can be selected and used for the method of the present application. For example, oligonucleotides, amino acids, small organic molecules, light emitting molecules, light absorbing molecules, light scattering molecules, luminescent molecules, isotopes, enzymes, etc. can be used as detectable markers. In some embodiments, oligonucleotides, amino acids and / or small organic molecules of various lengths, various charge-to-mass ratios, various electrophoretic mobilities (capillary electrophoretic mobility) and / or various qualities can also be used as detectable markers. Therefore, fluorophores, radioisotopes, chromogenic agents, luminescent agents, chemiluminescent agents, light scattering agents, etc. can be used as markers. The selection of markers depends on the required sensitivity, the difficulty, stability requirements, and available equipment of the nucleic acid coupling.

[0148] In some embodiments, the detectable marker is connected with terminator nucleotide.In some embodiments, can select and / or design suitable detectable marker, to realize optimal flight performance in mass spectrum and allow marker to distinguish on higher multiple level.In some embodiments, marker is fluorescent marker or the dyestuff that detects by electrophoresis or implementation PCR.

[0149] Any suitable detection device can be used to distinguish the detectable marker in the sample. Detection equipment suitable for detecting mass distinguishable labels includes but is not limited to some mass spectrometry and gel electrophoresis equipment. The example of mass spectrometry includes but is not limited to: matrix-assisted laser desorption / ionization time of flight (MALDI-TOF) mass spectrometry (MS), MALDI orthogonal TOF mass spectrometry (OTOF MS; two-dimensional), laser desorption mass spectrometry (LDMS), electrospray (ES) mass spectrometry, ion cyclotron resonance (ICR) mass spectrometry and Fourier transform mass spectrometry. The method described herein is easily applicable to mass spectrometry, wherein analyte is volatilized and ionized (" ionization MS ", for example, MALDI-TOF MS, LDMS, ESMS, linear TOF, OTOF). Orthogonal ion extraction MALDI-TOF and axial MALDI-TOF can produce relatively high resolution, and therefore, relatively high-level multiplexing. Detection equipment suitable for detecting light emission, light absorption and / or light scattering labels includes but is not limited to some light detectors and photodetectors (for example, detecting fluorescence, chemiluminescence, absorption and / or light scattering labels).

[0150] The extension products obtained by the methods of the present application (e.g., extended oligonucleotides of the present application) can be detected by a variety of methods. For example, the extension primer (UEP) and / or the terminating nucleotide can be labeled with any type of chemical group or moiety that allows detection and / or quantification of the signal, including but not limited to, mass markers, radioactive molecules, fluorescent molecules, antibodies, antibody fragments, haptens, carbohydrates, biotin, biotin derivatives, phosphorescent moieties, luminescent moieties, electrochemiluminescent moieties, moieties that generate electrochemical signals upon oxidation or reduction, such as iron, ruthenium or osmium complexes, colorimetric moieties, moieties with detectable electron spin resonance, capacitance, dielectric constant or conductivity, or any combination of their labels.

[0151] In the present application, "mass distinguishable label" refers to a marker with mass as a distinguishing feature. In some embodiments, the detectable label is composed of nucleotides, and sometimes the label is about 5 nucleotides to about 50 nucleotides long. In certain embodiments, the detectable label is a nucleotide complex, which is sometimes about 5 nucleotides to about 35 nucleotides long. In some embodiments, the detectable label is a peptide, which is sometimes about 5 amino acids to about 100 amino acids long. In certain embodiments, the detectable label is a concatemer of organic molecular units. In some embodiments, the label is a trityl molecule concatemer. In certain embodiments, the mass distinguishable label is a chain termination nucleotide.

[0152] A variety of mass-distinguishing tags can be selected and used, such as complexes, amino acids and / or concatemers. Different lengths and / or compositions of nucleotide strings (e.g., nucleic acids; complexes), amino acid strings (e.g., peptides; polypeptides; complexes) and / or concatemers can be distinguished by mass and used as markers. Any number of units can be used in mass-distinguishing tags, and the upper and lower limits of such units depend in part on the mass window and the resolution of the system for detecting and distinguishing such labels. Therefore, the length and composition of the mass-distinguishing tag can be selected in part based on the mass window and the resolution of the detector for detecting and distinguishing the marker.

[0153] In some embodiments, detectable label can be released from nucleic acid product (for example, extended oligonucleotide). The connection between detectable label and nucleic acid can be any type that can be transcribed and cut, cut and allow to detect one or more labels of release. In some embodiments, label can be separated from other parts of the molecule connected by label. For example, the connection that can be cut by nuclease (for example, ribonuclease, endonuclease);The connection that can be cut by chemical method;The connection that can be cut by physical treatment;With the light cleavable joint (for example, o-nitrobenzyl, 6-nitroveratryloxycarbonyl (6-nitroveratryloxycarbonyl), 2-nitrobenzyl group) that can be cut by light. When using the detection system of emission light (for example, matrix-assisted laser desorption ionization (MALDI) mass spectrometry of the excitation emission of light), light cleavable joint has advantages because cutting and detection are combined and carried out in one step.

[0154] For example, when detecting the methylation status of nucleic acid molecules using mass spectrometry (e.g., MALDI mass spectrometry) according to the methods described herein, unmethylated nucleic acid molecules will show a peak at the position corresponding to dA, methylated nucleic acid molecules will show a peak at the position corresponding to dG, and excess extended primers will appear as another peak. Therefore, the value of dG / (dA+dG) can represent the proportion or content of the nucleic acid molecules containing methylation modifications.

[0155] Multiplex detection

[0156] The method of the present application allows the presence, absence or content of multiple target nucleic acids in high-throughput detection or quantitative nucleic acid samples. Multiplexing refers to detecting more than a target nucleic acid (or more than a specific site, such as a methylation site) simultaneously. The conventional method of carrying out multiple reactions in conjunction with mass spectrometry is known (see, for example, WO1997037041A2). Compared to having to carry out independent mass spectrometry analysis to each target nucleic acid, the advantage that multiplexing provides is that multiple target nucleic acids and variants thereof (for example, variants with different sequence variations) can be identified in a single mass spectrum. In some embodiments, the method of the present application can be used for high-throughput, highly automated processes for rapid and accurate analysis of target sequences (for example, DNA methylation, particularly the methylation of a small amount of DNA). In some embodiments, the method of the present application can be highly multiplexed in a single reaction. When the genotype positioned at the locus is unknown, multiplexing is applicable, and in some embodiments, the genotype positioned at the locus is known.

[0157] In certain embodiments, the number of multiplexed target nucleic acids includes, but is not limited to, about 2 to about 1000, about 2 to about 500, about 2 to about 100, for example, about 1-5, 5-9, 9-11, 11-13, 13-15, 15-17, 17-19, 19-21, 21-23, 23-25, 25-27, 27-29, 29-31, 31-33, 33-35, 35-3 7, 37-39, 39-41, 41-43, 43-45, 45-47, 47-49, 49-51, 51-53, 53-55, 55-57, 57-59, 59-61, 61-63, 63-65, 65-67, 67-69, 69-71, 71-73, 73-75, 75-77, 77-79, 79-81, 81-83, 83-85, 8 5-87, 87-89, 89-91, 91-93, 93-95, 95-97, 97-101, 101-103, 103-105, 105-107, 107-109, 109-111, 111-113, 113-115, 115-117, 117-119, 121-123, 123-125, 125-127, 127-129, 1 29-131, 131-133, 133-135, 135-137, 137-139, 139-141, 141-143, 143-145, 145-147, 147-149, 149-150, 150-200, 200-250, 250-300, 300-350, 350-400, 400-450, 450-500 or more.

[0158] The design method of obtaining the analytical mass spectrum with multiple analysis can include primer and oligonucleotide design method and reaction design method. With regard to the primer and oligonucleotide design in multiple analysis, the same overall primer design principle is adopted as in the single reaction, such as avoiding false priming and primer dimers, except that the multiple reaction involves more primers. In addition, the analyte peak in the mass spectrum of an experiment can be fully resolved from the product of any experiment of the experiment multiplexed with it, including pausing peak (pausingpeak) and any other byproduct peak. In addition, the analyte peak preferably falls within the mass window specified by the user, for example, within the range of 5000-8500Da. In some embodiments, relative to a specific target sequence, an extended oligonucleotide can be designed. In this type of embodiment, for example, the length is typically between the range of (for example, 17-24 bases or 17-26 bases) that can be specified by the user, and does not usually include uncertain bases in the target sequence. Hybridization intensity is sometimes measured by calculating sequence-dependent melting (or hybridization / dissociation) temperature Tm. Methods and software for designing extension primers are known and include, for example, SpectroDESIGNER (Sequenom).

[0159] In some embodiments, the multiplex assays provided herein are designed for single-base extension. For example, an oligonucleotide (e.g., an oligonucleotide extended herein) can be first hybridized to an amplification product derived from a target nucleic acid (e.g., an amplification product herein, such as an exponential amplification product) at a 5' position relative to a single base position that differs between target nucleic acid variants (e.g., target nucleic acids with and without methylation modifications).

[0160] Disease, disease outcomes, and / or treatment options

[0161] The methods and products of the present application can be used for diagnosis of a disease or condition (including prognosis of a disease or condition), for example, by non-invasive methods.

[0162] For example, the disease or condition can be a disease or condition associated with (e.g., determined based on) changes in genetic material (e.g., nucleic acid, such as DNA) (e.g., methylation modification or SNP), such as a tumor or cancer. The genetic material can be cfDNA, such as ctDNA, from a sample (e.g., tissue or body fluid) of a subject.

[0163] In certain embodiments, the methods and products of the present application can be used to improve, adjust, or determine a treatment regimen that is appropriate for a particular subject.

[0164] Kits and Systems

[0165] In another aspect, the present application provides a kit and / or system that can be used to implement the method described in the present application.

[0166] The kit may include: the linear amplification component described in the present application, the exponential amplification component described in the present application, and the extension component described in the present application; wherein the linear amplification component comprises a nuclease capable of nicking a single-stranded oligonucleotide, a DNA polymerase with strand displacement activity, and deoxyribonucleoside triphosphates (dNTPs). In certain embodiments, the linear amplification component further comprises an adapter, a primer, a buffer system suitable for linear amplification of the target DNA of the nucleic acid sample, and / or a single-stranded DNA binding protein. For example, the adapter comprises a recognition sequence that can be recognized and cleaved by the nuclease. For example, the primer comprises a first segment and a second segment, the first segment comprises a recognition sequence, and the second segment comprises a sequence that can be partially complementary to the target DNA.

[0167] In some cases, the linear amplification component, the exponential amplification component, and the extension component are not mixed with each other in the kit. For example, in the kit, the linear amplification component, the exponential amplification component, and the extension component can each be independently present in a separate package (or device).

[0168] For example, the kit may include one or more of the following components: a) a reagent that can modify unmethylated specific nucleotides to generate other nucleotides; b) one or more nucleic acid polymerases; c) one or more nucleic acid ligases; d) one or more primers; e) a reagent for modifying the one or more primers, wherein the modification comprises adding one or more of a restriction enzyme cleavage site, a biomarker, and a fluorescent substance; f) one or more adapters suitable for sequencing; g) one or more terminal modification reagents; h) one or more phosphokinases; i) a MALDI matrix compound; and j) a MALDI substrate.

[0169] In some cases, in the systems described herein, the apparatus for using the kit may include a thermal cycler and / or a mass spectrometer.

[0170] The kits described herein generally comprise one or more containers containing one or more components described herein. The kits may comprise one or more components in any number of separate containers, bags, tubes, vials, multiwell plates, and the like, or the components may be combined in various combinations within these containers. The kits may comprise, for example, one or more of the following components: (i) one or more nucleotides (e.g., terminating nucleotides and / or non-terminating nucleotides); one or more of which may comprise a detection label; (ii) one or more oligonucleotides, one or more of which may comprise a detection label (e.g., an amplification primer, one or more extension primers, an oligonucleotide comprising a label); (iii) one or more enzymes (e.g., a polymerase, an endonuclease, a restriction enzyme, an exonuclease, and the like); (v) control components (e.g., control DNA, primers, synthesis templates, target nucleic acids, and the like); (vi) one or more buffers; and (vii) printed matter (e.g., instructions, labels, and the like).

[0171] Kits are sometimes used in conjunction with certain methods and may include instructions for performing one or more methods and / or descriptions of one or more compositions. Kits can be used to perform the methods described herein. The instructions and / or descriptions may be in tangible form (e.g., paper, etc.) or electronic form (e.g., a computer-readable file on a tangible medium (e.g., a compact disc)) and may be included in a kit insert. The kit may also include a written description of an internet location providing such instructions or descriptions.

[0172] In certain embodiments, the kit of the present application includes one or more terminator nucleotides that inhibit the activity of the enzyme on the oligonucleotide when the terminator nucleotide is at the 3' end of the oligonucleotide. In certain embodiments, the terminator nucleotide is a dideoxynucleotide. In certain embodiments, the dideoxynucleotide is selected from: ddATP, ddGTP, ddCTP, ddTTP and ddUTP. In certain embodiments, the terminator nucleotide is an acyclic nucleotide. In certain embodiments, the acyclic nucleotide is selected from: acyATP, acyCTP, acyGTP, acyTTP and acy-bromo-UTP. In certain embodiments, the terminator nucleotide includes a mass distinguishable tag.

[0173] In certain embodiments, the kit includes one or more of the following: oligonucleotides, a polymerase, a reverse transcriptase, one or more buffers, and one or more reaction controls.

[0174] Without intending to be bound by any theory, the following embodiments are merely intended to illustrate the methods, products, and uses of the present application, and are not intended to limit the scope of the invention of the present application.

[0175] Example

[0176] Example 1

[0177] Preparation of linear amplification products

[0178] 1. Reference Material Preparation

[0179] The experimental materials in this example were derived from the genome of the colorectal cancer cell line RKO. The genome of the RKO cells was extracted using the Tiangen genome extraction kit (DP304) according to the instructions. The RKO cell genome was fragmented into fragments of approximately 150 bp using a Covaris M220 ultrasonic DNA shearer. 1% agarose was used for electrophoresis to recover DNA fragments between 1 and 200 bp. Finally, the recovered nucleic acid fragments were quantified using Qbit and then diluted to a concentration of 1 ng / uL to complete the preparation of the reference product.

[0180] 2. Connect the connector

[0181] 2.1. Linear amplification of the DNA fragment to be amplified

[0182] 1) Dilute the reference sample to 100 pg / uL and perform genome-wide CpG cytosine methylation modification using M.SssI methyltransferase (NEB, Cat. No. M0226V). The reaction system is set up as follows:

[0183] 2) End treatment:

[0184] Use Klenow exo-enzyme (NEB, Cat. No. M0212V) with 3' exonuclease activity deficiency and T4 DNA polymerase (M0203S) to fill in the ends of the treated product in step 1 and add an adenine (A) tail. The reaction system is set up as follows:

[0185] 3) 5' end dephosphorylation treatment:

[0186] The product in 2) was added with shrimp alkaline phosphatase SAP (Thermo Fisher Scientific, Cat. No. 783901000UN) for treatment. The reaction system was set up as follows:

[0187] 4) Preparation and connection of connectors:

[0188] Synthesized oligonucleotide 1 (5'CTCACCAACTCTCGAGTCACTATAGGt3') and oligonucleotide 2 (5'pCCTATAGTGAC*T*C*GAGAGTTGGTGAG3', where p represents 5'-terminal phosphorylation and * indicates that the non-bridging oxygen atom in the phosphate backbone of the nucleotide has been replaced with a sulfur atom) were annealed by heating at 95°C for 5 minutes and then gradually cooling to 20°C. The annealing step was then diluted to a 1 μM concentration. The adapter was ligated to the reference sample prepared in step 3) using T4 polymerase (NEB, Cat. No. M0202V). The reaction system was set up as follows:

[0189] After the linker is connected, the product is purified using 1×AMPure purification magnetic beads with an elution volume of 14uL.

[0190] 5) Linear amplification:

[0191] Add the purified ligation product from step 4) to a linear amplification reaction system for linear amplification. Linear amplification requires the restriction endonuclease XhoI (NEB, Catalog No. R0146V); DNA polymerase Bsu polymerase (NEB, Catalog No. M0330S); and single-strand binding protein T4 Gene 32 Protein (NEB, Catalog No. M0300S). The reaction system settings are as follows:

[0192] After the reaction is complete, linear amplification is complete. The linear amplification product can be diluted and used directly or purified before use. The linear amplification product can be used for PCR re-amplification or targeted amplification, and can also be used for direct sequencing or targeted sequencing.

[0193] 2.2. Bisulfite treatment of the DNA fragment to be amplified followed by linear amplification

[0194] 1) End treatment:

[0195] Dilute the reference sample to 100 pg / uL. Use Klenow exo-enzyme (NEB, Catalog No.: M0212V) with 3' exonuclease activity deficiency and T4 DNA polymerase (M0203S) to blunt the ends of the reference sample fragments and add adenine A tails. Then use T4 PNK (NEB, Catalog No.: M0201V) to phosphorylate the 5' ends of the DNA fragments. Prepare the reaction system according to the following table for the above treatment process:

[0196] 2) Preparation and connection of connectors:

[0197] Synthesized oligonucleotide 3 (5'CTCACCAACTGCTCTTCTCACTATAGGt3') and oligonucleotide 4 (5'pCmCTATAGTGAmCGAGAAGAGTTGGTGAG3', where p represents 5'-terminal phosphorylation and m represents cytosine methylation) were annealed by heating at 95°C for 5 minutes and then gradually cooling to 20°C. The annealing step was then diluted to a 1 μM concentration. The adapters were ligated to the end-repaired reference using T4 polymerase (NEB, Cat. No. M0202V). The reaction system was set up as follows:

[0198] After connecting the adapter, the product was purified using 1X AMPure purification magnetic beads with an elution volume of 20uL.

[0199] 3) Bisulfite treatment to convert cytosine:

[0200] The ligation and purification product was converted to cytosine using the EZ DNA methylation-Gold kit (Cat. No.: D5006) from ZYMO Research according to the instructions, and then purified with an elution volume of 13 uL.

[0201] 4) Linear amplification:

[0202] Mix 13 μL of the purified cytosine conversion product with 1 μL of 10 μM oligonucleotide 3 and anneal by heating at 95°C for 5 minutes and gradually cooling to 20°C. Linear amplification of the annealed product requires the following: nicking enzyme Nt.BspQI (NEB, Catalog No. R0644S), DNA polymerase: Bst (NEB, Catalog No. M0275V), and single-strand binding protein: T4 Gene 32 Protein (NEB, Catalog No. M0300S). The reaction system is set up as follows:

[0203] Once the reaction is complete, linear amplification is complete, and the product can be diluted and used directly or purified. The linear amplification product can be used for PCR reamplification or targeted amplification, as well as for direct sequencing or targeted sequencing.

[0204] Example 2

[0205] Detection of linear amplification products

[0206] 1. qPCR detection

[0207] In this example, the linear amplification and purification product of Example 1 and the product after cytosine conversion of the same 100 pg reference material were used as templates, and then qPCR was used to detect the abundance of nucleic acid fragments on the ACTB gene. The degree of amplification was determined by comparing the abundance results of the nucleic acid detection.

[0208] The qPCR reaction protocol was prepared according to the following table, where 2X PCR mix was from Abiotech (Cat. No. RK21208), primers were ACTB-F (SEQ ID NO: 1) and ACTB-R (SEQ ID NO: 2), and the probe was ACTB-P (SEQ ID NO: 3):

[0209] The qPCR reaction was performed according to the procedure in the table below, using the Roche light cycler 480II:

[0210] The qPCR amplification curves in Figures 1A and 1B show that the ACTB gene can be clearly detected by qPCR in samples that have undergone linear amplification, while the ACTB gene cannot be detected by qPCR in the 100 pg control sample that has not undergone the linear amplification process due to the small amount of nucleic acid sample.

[0211] 2. Sequencing results

[0212] 100 ng of the reference sample was treated for cytosine conversion and then used with the DNA methylation library construction kit (Cat. No. NE103) from Novezan, according to the instructions for next-generation sequencing. Simultaneously, an equal amount of the linear amplification and purification product from Example 1 was also used with the DNA methylation library construction kit (Cat. No. NE103) from Novezan, according to the instructions for next-generation sequencing. After library construction, both libraries were sequenced by NGS, yielding 60 GB and 61 GB of sequencing data, respectively.

[0213] After the sequencing is completed, the data obtained by sequencing are aligned to the human methylation genome reference sequence, and then the proportion of methylated cytosine at each methylation site on the genome is counted. Statistics are performed on all CG sites with coverage ≥ 5, and the results are shown in Figure 2 (the NCcfDNA on the left side of Figure 2 is the distribution of methylated cytosine of the directly constructed sample, and the LASDA on the right side is the distribution of methylated cytosine of the linear amplification sample processed by the method of this application). There is no significant difference between the samples using linear amplification and the samples directly constructed, which shows that the SDA-based linear amplification method provided by this application has high fidelity, and the amplified samples are basically equivalent to the original samples.

[0214] 3. Nucleic Acid Mass Spectrometry Analysis

[0215] Based on the methylation sites in the Sept9 gene promoter region, we designed and synthesized primers for cytosine conversion (S9F and S9R, SEQ IDs: 8 and 9), as well as an extension primer (S9E, SEQ ID: 10) for detecting the methylation rate of the methylation sites. PCR amplification was performed using S9F and S9R on 100pg of the reference product after cytosine conversion, as well as on the linearly amplified nucleic acid sample, to increase the abundance of nucleic acid fragments in the Sept9 target region.

[0216] After the PCR amplification is completed, heat-sensitive alkaline phosphatase is added to the reaction system to digest the PCR amplification product and remove dNTPs in the PCR reaction product.

[0217] After digestion is complete, the extension primer S9E, single-base extension polymerase, buffer, and reaction substrates such as ddNTPs are added to perform a single-base extension reaction. After the single-base extension reaction is complete, a cation exchange resin is added to the reaction system, mixed, and allowed to settle for 5 minutes.

[0218] The supernatant from the previous step was transferred to a nucleic acid mass spectrometry sample plate, and nucleic acid mass spectrometry detection was performed according to the instructions of a nucleic acid mass spectrometer (GeneTOF3100).

[0219] The test results showed that after 100 pg of the reference material completed cytosine conversion and then was directly amplified, no extension peak was detected by nucleic acid mass spectrometry, indicating that the methylation status of this site in the sept9 gene could not be detected. However, the test result of the sample after linear amplification was 100%, which was consistent with the result of direct library construction and sequencing after 100 ng of the reference material completed cytosine conversion.

[0220] Example 3 Comparison of the effects of different amplification schemes

[0221] This example compares the effects of direct library construction, linear amplification based on T7 RNA polymerase in vitro transcription, and the method of the present application. The three library construction processes are shown in Figure 3: on the left is the process of direct single-stranded library construction after bisulfite treatment of cfDNA; in the middle is the process of library construction based on linear amplification of T7 RNA polymerase in vitro transcription; on the far right is the library construction process of this case based on linear amplification of SDA.

[0222] A) Build the database directly:

[0223] Take 10ng, 1ng and 100pg cfDNA respectively, dilute to 20uL, and then use ZYMO research company's EZ DNA methylation-Gold kit (catalog number: D5006) according to the instructions to convert cytosine to the purified product and purify it. The elution volume is 13uL.

[0224] Then, the DNA methylation library construction kit (catalog number: NE103) from Novezan was used to construct the second-generation sequencing library according to the instructions. After the library construction was completed, the two libraries were sequenced by NGS, and the sequencing data output was 60G, 60G, and 59G, respectively. After the sequencing was completed, the sequencing data was aligned to the human methylation genome reference sequence.

[0225] B) Library construction based on T7 in vitro transcription linear amplification:

[0226] (1) The synthesized oligonucleotide 5 (5'TAATACGACTCACTATAGGATCCCTCAATAACGt3', SEQ ID NO.11) and oligonucleotide 6 (5'pmCGTTATTGAGGGATmCmCTATAGTGAGTmCGTATTA3', SEQ ID NO.12, where p represents 5' end phosphorylation modification and m represents cytosine methylation modification) were subjected to annealing treatment by heating at 95°C for 5 minutes and gradually cooling to 20°C, and then diluted to a concentration of 1 uM for use.

[0227] (2) Take 10 ng, 1 ng and 100 pg of cfDNA respectively, dilute to 19 uL, use Klenow exo-enzyme (NEB, catalog number: M0212V) with 3' exonuclease activity deficiency and T4 DNA polymerase (M0203S) to fill the ends of the reference fragment and add adenine A tail, and then use T4 PNK (NEB, catalog number: M0201V) to phosphorylate the 5' end of the DNA fragment; the above treatment process is prepared according to the following table:

[0228] (3) Use T4 polymerase (NEB, Catalog No.: M0202V) to connect the adapter to the end-repaired reference. The reaction system is set up as follows:

[0229] After connecting the adapter, the product was purified using 1X AMPure purification magnetic beads with an elution volume of 20uL.

[0230] (4) Bisulfite treatment to convert cytosine:

[0231] The ligation and purification product was converted to cytosine using the EZ DNA methylation-Gold kit (Cat. No.: D5006) from ZYMO Research according to the instructions, and then purified with an elution volume of 13 uL.

[0232] (5) In vitro transcription primer annealing:

[0233] 1 uL of 10 mM oligonucleotide 7 (5'TAATACGACTCACTATAGGATCCCTCAATAA CGt3', SEQ ID NO. 13) was added to the purified product, mixed, and then annealed by heating at 95°C for 5 minutes and then gradually cooling to 20°C.

[0234] (6) In vitro transcription:

[0235] Use the in vitro transcription kit (Cat. No. 10623ES50) from Yisheng Biotechnology and prepare the reaction system according to the following table:

[0236] The RNA was purified using 0.9X AMPure magnetic beads with an elution volume of 15 uL.

[0237] (7) Reverse transcription:

[0238] The RNA product was reverse transcribed using the reverse transcription kit (Cat. No. RK20432) from Ibotek Biotech. The reaction system is as follows:

[0239] (8) Single-chain library construction

[0240] Then, the DNA methylation library construction kit (catalog number: NE103) from Novezan was used to construct the second-generation sequencing library according to the instructions. After the library construction was completed, the two libraries were sequenced by NGS, and the sequencing data output was 61G, 62G, and 60G, respectively. After the sequencing was completed, the sequencing data was aligned to the human methylation genome reference sequence.

[0241] C) Library construction based on SDA linear amplification:

[0242] (1) Joint preparation

[0243] The synthesized oligonucleotide 8 (5'TGTGTTATATGGATCCGCTGTGTGTCTGAAt3', SEQ ID NO.14) and oligonucleotide 9 (5'pTTmCAGAmCAmCAmCAGmC*G*G*A*TmCmCATATAAmCAmCA3', SEQ ID NO.15, wherein p represents 5' end phosphorylation modification, * indicates the use of thiolated modified nucleotides, and m indicates methylation modification of cytosine) were subjected to an annealing treatment by heating at 95°C for 5 minutes and gradually cooling to 20°C, and then diluted to a concentration of 1 uM for use.

[0244] (2) End repair

[0245] Take 10ng, 1ng, and 100pg of cfDNA, respectively, dilute to 19uL, use Klenow exo-enzyme (NEB, Cat. No.: M0212V) with 3' exonuclease activity deficiency and T4 DNA polymerase (M0203S) to fill in the ends of the reference fragments and add adenine A tails, and then use T4 PNK (NEB, Cat. No.: M0201V) to phosphorylate the 5' ends of the DNA fragments. The above treatment process is prepared according to the following table:

[0246] (3) Connector connection:

[0247] Use T4 polymerase (NEB, Cat. No. M0202V) to ligate the adapter to the end-repaired reference. The reaction system is set up as follows:

[0248] (4) Bisulfite treatment to convert cytosine:

[0249] The ligation and purification product was converted to cytosine using the EZ DNA methylation-Gold kit (Cat. No. D5006) from ZYMO Research according to the instructions, and then purified with an elution volume of 16 uL.

[0250] (5) In vitro transcription primer annealing:

[0251] 1 uL of 10 mM oligonucleotide 8 (5'TGTGTTATATGGATCCGCTGTGTGTCTGAAt3', SEQ ID NO. 16) was added to the purified product, mixed, and then annealed by heating at 95°C for 5 minutes and then gradually cooling to 20°C.

[0252] (6) SDA linear amplification

[0253] Prepare the reaction system according to the following table:

[0254] After the reaction, the product was purified using 2.5XAMPure magnetic beads with an elution volume of 15uL.

[0255] (7) Single-chain library construction

[0256] Then, the DNA methylation library construction kit (catalog number: NE103) from Novezan was used to construct the second-generation sequencing library according to the instructions. After the library construction was completed, the two libraries were sequenced by NGS, and the sequencing data output was 61G, 60G, and 60G, respectively. After the sequencing was completed, the sequencing data was aligned to the human methylation genome reference sequence.

[0257] Sequencing analysis results:

[0258] The ratios of sequencing results from the three methods aligned to the genome are shown in the following table:

[0259] The repeatability of sequencing data is shown in the following table:

[0260] The coverage of the genome by sequencing results is shown in the following table:

[0261] From the overall results, the lower the sample volume, the worse the sequencing results, the lower the alignment rate and genome coverage, and the higher the repeatability. However, although the results of the samples after linear amplification showed the above trends, the changes were not significant. However, the direct library construction method changed greatly with the reduction of sample volume. When the sample volume was 100pg, the sequencing results could hardly obtain valuable information.

[0262] Both linear amplification methods, whether based on T7 RNA polymerase in vitro transcription or SDA-based chain displacement, do not show a significant decrease in sequencing data quality when the sample volume is reduced. The sequencing data quality of the two methods is very similar, with the SDA-based chain displacement linear amplification method having higher data quality. However, in terms of the number of steps and time required for the operation, the SDA-based chain displacement linear amplification method of the present application has fewer steps; the operation of the present application does not require an RNase-free environment, and the conditions required are lower. At the same time, the method of the present application is more time-saving than the T7 RNA polymerase in vitro transcription linear amplification method, shortening the time by more than ten hours.

Claims

1. A method for detecting the presence, absence or content of one or more target nucleic acids in a nucleic acid sample, the method comprising: a) treating the nucleic acid sample under conditions that allow linear amplification of a target DNA derived from the nucleic acid sample, so as to generate a linear amplification product of the target DNA; b) performing exponential amplification on the linear amplification product to generate an exponential amplification product of the target DNA; c) contacting the exponentially amplified products of the target DNA with an extension primer under extension conditions including a terminator nucleotide, thereby generating an extended oligonucleotide; as well as d) analyzing the extended oligonucleotides to identify the presence, absence or amount of the one or more target nucleic acids in the nucleic acid sample, Wherein, the treatment under conditions enabling linear amplification includes adding a recognition sequence to the end of the target DNA of the nucleic acid sample, and the recognition sequence can be recognized and cut by a nuclease.

2. The method according to claim 1, comprising subjecting the nucleic acid sample to a treatment selected from the following: blunting the ends of the target DNA, adding deoxyadenosine dA to the ends of the target DNA, phosphorylating the 5' end of the target DNA, dephosphorylating the 5' end of the target DNA, and modifying the target DNA so that its nucleic acid sequence does not change after bisulfite treatment.

3. The method according to claim 2, wherein the modification that does not change the nucleic acid sequence of the target DNA after bisulfite treatment is methylation of the cytosine bases in the target DNA.

4. The method according to any one of claims 1 to 3, wherein the recognition sequence is added by ligating a linker to the double-stranded ends of the target DNA, wherein the linker is a double-stranded oligonucleotide containing the recognition sequence.

5. According to the method according to any one of claims 1 to 3, the addition of the recognition sequence comprises contacting the target DNA with a primer so that the end of the target DNA forms a linker containing the recognition sequence, the primer comprises a first segment and a second segment, the first segment comprises the recognition sequence, and the second segment comprises a sequence that can be complementary to the target DNA portion.

6. The method according to any one of claims 4-5, comprising subjecting the linker to protective modification.

7. The method according to claim 6, wherein the protective modification comprises modifying the linker so that its nucleic acid sequence is not changed after bisulfite treatment, and / or modifying the linker so that only one chain is cleaved by the nuclease.

8. The method according to any one of claims 6-7, wherein the protective modification comprises methylating the cytosine bases in the linker sequence.

9. The method according to any one of claims 6-7, wherein the protective modification comprises replacing a non-bridging oxygen atom on the nucleotide phosphate backbone of the linker sequence with a sulfur atom, and the nucleotide where the substitution occurs is located near the recognition sequence.

10. The method according to any one of claims 1 to 9, wherein the conditions enabling linear amplification comprise adding the nuclease.

11. The method according to any one of claims 1 to 10, wherein the nuclease is selected from a restriction endonuclease and a nickase.

12. The method of claim 11, wherein the restriction endonuclease comprises a Cas enzyme.

13. The method according to any one of claims 1 to 12, wherein the conditions enabling linear amplification further comprise adding a DNA polymerase having strand displacement activity.

14. The method of claim 13, wherein the DNA polymerase is selected from the group consisting of Bca, Bst, Bsu, Klenow large fragment and Phi29.

15. The method according to any one of claims 1 to 14, wherein the conditions enabling linear amplification further comprise adding a buffer, deoxyribonucleoside triphosphates (dNTPs) and / or a single-stranded DNA binding protein suitable for linear amplification of the target DNA.

16. The method according to any one of claims 1 to 15, wherein the linear amplification is strand displacement amplification (SDA).

17. The method according to any one of claims 1 to 16, wherein the linear amplification is a non-target specific amplification not directed against a specific target.

18. A method for identifying biomarkers associated with a disease, disease outcome, and / or treatment regimen outcome, the method comprising the steps of: i) the method of any one of claims 1 to 17, identifying the presence, absence or amount of one or more target nucleic acids derived from one or more nucleic acid samples derived from one or more subjects with a known disease, disease outcome and / or outcome of a treatment regimen; ii) identifying the presence, absence or amount of one or more target nucleic acids derived from one or more nucleic acid samples derived from normal subjects according to the method of any one of claims 1 to 17; as well as iii) identifying a difference between the presence, absence or amount of the one or more target nucleic acids in step i) and the presence, absence or amount of the one or more target nucleic acids in step ii), and based on this, identifying the difference as a biomarker associated with the disease, disease outcome and / or treatment regimen outcome.

19. The method according to claim 18, comprising modifying the target DNA in the nucleic acid sample so that the nucleic acid sequence of the target DNA is not changed after being treated with bisulfite.

20. The method of claim 19, comprising methylating cytosine bases in the target DNA.

21. The method according to any one of claims 18 to 20, wherein the conditions enabling linear amplification include adding the nuclease, and the nuclease is an enzyme sensitive to methylation.

22. The method according to claim 21, wherein the enzyme sensitive to methylation is a restriction endonuclease.

23. The method according to any one of claims 18 to 22, comprising ligating or forming an adapter at the end of the target DNA to add the recognition sequence, and the adapter comprises a protective modification so that only one strand is cleaved by the nuclease.

24. The method according to claim 23, wherein the protective modification comprises replacing a non-bridging oxygen atom on the nucleotide phosphate backbone of the linker sequence with a sulfur atom, and the nucleotide where the substitution occurs is located near the recognition sequence.

25. A method for identifying methylation associated with a disease, disease outcome, and / or treatment regimen outcome, the method comprising the steps of: i) the method according to any one of claims 1 to 17, identifying methylated or unmethylated nucleotides in one or more target nucleic acids derived from one or more nucleic acid samples derived from one or more subjects with a known disease, disease outcome and / or outcome of a treatment regimen; ii) identifying methylated or unmethylated nucleotides in one or more target nucleic acids derived from one or more nucleic acid samples derived from normal subjects according to the method of any one of claims 1 to 17; as well as iii) identifying differences between the methylated or unmethylated nucleotides in the one or more target nucleic acids in step i) and the methylated or unmethylated nucleotides in the one or more target nucleic acids in step ii), and accordingly, identifying the differential methylated or unmethylated nucleotides as methylation associated with the disease, disease outcome and / or treatment regimen outcome.

26. The method according to claim 25, comprising connecting or forming an adapter at the target DNA end of the nucleic acid sample to add the recognition sequence, and the adapter comprises a protective modification so that the nucleic acid sequence of the adapter is not changed after being treated with bisulfite.

27. The method of claim 26, comprising methylating cytosine bases in the linker sequence.

28. The method according to any one of claims 25 to 27, comprising ligating or forming a linker at the end of the target DNA of the nucleic acid sample to add the recognition sequence, and the unmethylated specific nucleotides in the target DNA are converted into other nucleotides through treatment.

29. The method according to any one of claims 25 to 28, wherein the conditions enabling linear amplification include adding the nuclease, and the nuclease is an enzyme sensitive to methylation.

30. The method according to claim 29, wherein the enzyme sensitive to methylation is a restriction endonuclease.

31. The method according to any one of claims 25 to 30, comprising ligating or forming an adapter at the end of the target DNA to add the recognition sequence, and the adapter comprises a protective modification so that only one strand is cleaved by the nuclease.

32. The method according to claim 31, wherein the protective modification comprises replacing a non-bridging oxygen atom on the nucleotide phosphate backbone of the linker sequence with a sulfur atom, and the nucleotide where the substitution occurs is located near the recognition sequence.

33. A kit for detecting a nucleic acid sample, the kit comprising: a linear amplification component, an exponential amplification component and an extension component, wherein the linear amplification component comprises a nuclease capable of nicking a single-stranded oligonucleotide, a DNA polymerase with strand displacement activity and deoxyribonucleoside triphosphates (dNTPs).

34. The kit according to claim 33, wherein the linear amplification component further comprises one or more of an adapter, a primer, a buffer system suitable for linear amplification of the target DNA of the nucleic acid sample, and a single-stranded DNA binding protein. The kit according to claim 34 , wherein the linker comprises a recognition sequence capable of being recognized and cleaved by the nuclease.

36. The kit according to claim 34, wherein the primer comprises a first segment and a second segment, the first segment comprises a recognition sequence, and the second segment comprises a sequence that is complementary to the target DNA portion.

37. The kit according to any one of claims 33-36, wherein the linear amplification component, the exponential amplification component, and the extension component do not mix with each other.

38. The kit according to any one of claims 33-37, wherein the linear amplification component, the exponential amplification component, and the extension component are each independently present in separate packages.

39. The kit according to any one of claims 33-38, further comprising one or more of the following components: a) reagents that can modify specific unmethylated nucleotides to generate other nucleotides; b) one or more nucleic acid polymerases; c) one or more nucleic acid ligases; d) one or more primers; e) a reagent for modifying the one or more primers, wherein the modification comprises adding one or more of a restriction site, a biomarker, and a fluorescent substance; f) one or more adapters suitable for sequencing; g) one or more terminal modification reagents; h) one or more phosphokinases; i) a MALDI matrix compound; and j) MALDI substrate.

40. A system for detecting a nucleic acid sample, the system comprising the kit of any one of claims 33-39, and optionally comprising one or more parts selected from the group consisting of instructions, reagents, and a device for using the kit.

41. The system of claim 40, wherein the apparatus for using the kit comprises a thermal cycler and / or a mass spectrometer.

Images