Composition for controlling bacteria belonging to genus fusobacterium in intestinal flora, and use thereof

Abstract

The present invention addresses the problem of providing a composition for controlling bacteria belonging to the genus Fusobacterium in intestinal flora. Provided is a composition for controlling bacteria belonging to the genus Fusobacterium in intestinal flora, said composition containing bacteria belonging to the family Lactobacillaceae. The bacteria belonging to the genus Fusobacterium are preferably Fusobacterium nucleatum. The bacteria belonging to the family Lactobacillaceae are preferably bacteria belonging to any one selected from the group consisting of the genus Lactobacillus, the genus Levilactobacillus, the genus Limosilactobacillus, the genus Ligilactobacillus, the genus Lacticaseibacillus and the genus Lactiplantibacillus.

Description

Composition for controlling Fusobacterium genus bacteria in intestinal flora and use thereof

[0001] The present invention relates to a composition for controlling Fusobacterium bacteria in the intestinal flora and its use.

[0002] Fusobacterium is a bacterium present in the human oral cavity and intestinal tract and is known to be a causative agent of periodontal disease. Fusobacterium nucleatum is also known to cause opportunistic infections and has recently been implicated in colon cancer (e.g., Non-Patent Document 1). Furthermore, F. nucleatum has been isolated from gastrointestinal infections such as appendicitis (Non-Patent Document 2), and its association with inflammatory bowel disease has recently been suggested (Non-Patent Documents 3, 4, and 5).

[0003] On the other hand, lactic acid bacteria, sometimes in combination with other ingredients, are known to have the effect of inhibiting the growth of harmful bacteria. For example, Patent Document 1 describes a composition for preventing and / or treating tooth decay or periodontal disease, which contains at least one selected from the group consisting of live lactic acid bacteria, a substance containing the lactic acid bacteria, a culture filtrate of the lactic acid bacteria, and a processed product thereof, and at least one selected from the group consisting of xylitol, sorbitol, erythritol, trehalose, maltitol, mannitol, palatinose, reduced lactose, sucrose, fructose, glucose, fructooligosaccharide, aspartame, Eleuthero extract, Houttuynia cordata extract, red koji, turmeric pigment, Chinese quince extract, Ganoderma lucidum extract, hawthorn extract, shiitake mushroom extract, Alpinia zerumbet leaf extract, stevia extract, lotus germ extract, Luo Han Guo extract, green tea extract, Milk thistle extract, purple brown rice extract, enzymatically hydrolyzed licorice root, Phellodendron amurense leaf extract, ginkgo extract, rooibos tea extract, mugwort extract, glycyrrhizin, gymnema extract, and tsaraki pear extract. Patent Document 2 describes an oral composition containing lactic acid bacteria selected from Lactococcus lactis subsp. lactis FERM P-21436 strain, Lactobacillus rhamnosus FERM P-21437 strain, Lactobacillus rhamnosus FERM P-21438 strain, and Lactobacillus culbatus NITE P-568 strain. Patent Document 3 describes an antibacterial agent against Bacteroides fragilis, which contains as an active ingredient a bacterium selected from the group consisting of bacteria belonging to the genus Lactobacillus, bacteria belonging to the genus Lactococcus, and bacteria belonging to the genus Streptococcus.Patent Document 4 describes lactic acid bacteria selected from strains of Lactobacillus paracasei, Lactobacillus pentosus, Lactobacillus plantarum, Lactobacillus sakei, Enterococcus avium, and Enterococcus durans, which have the property of inhibiting the growth of oral bacteria that cause dental caries, periodontal disease, or bad breath and / or the formation of a biofilm formed by the oral bacteria when co-cultured in a sugar-free medium with the oral bacteria. Patent Document 5 describes a microorganism for use in the treatment and / or prevention of dental caries and / or periodontal disease, the microorganism being Lactobacillus paracasei LPc-G110 (CCTCC M 2013691). Non-Patent Document 6 describes that in an experiment using mice, the average abundance of F. nucleatum in a group administered a normal fat diet + Fusobacterium nucleatum + Lactiplantibacillus plantarum HNU082 suggests that Lp082 competes with F. nucleatum for nutrients and energy in the intestinal tract, inhibiting the proliferation and growth of F. nucleatum in the intestinal tract and promoting the proliferation of symbiotic bacteria.

[0004] Regarding bacteria other than lactic acid bacteria, Patent Document 6 describes a composition containing Bifidobacterium bacteria as an active ingredient for inhibiting the adsorption of Fusobacterium bacteria to mucosal cells. This document describes that the composition can be used for the prevention or treatment of diseases or symptoms caused by inflammation of mucosal cells, selected from the group consisting of ulcerative colitis, colon cancer, esophageal cancer, premature birth, and periodontal disease, and that the composition can be used to prepare fermented milk using lactic acid bacteria such as Lactobacillus bulgaricus as a starter. Regarding exopolysaccharides of lactic acid bacteria, Non-Patent Document 7 describes that two purified exopolysaccharide fractions derived from Lacticaseibacillus paracasei GL1 controlled the composition of the intestinal microbiota, increasing the relative amounts of Bacteroides and Phascolarctobacterium and decreasing Escherichia-Shigella, Klebsiella, and Fusobacterium.

[0005] The preventive effect of probiotics on colon cancer has been widely reported (Non-Patent Documents 8 and 9). For example, Patent Document 3, cited above, describes that an antibacterial agent against Bacteroides fragilis, which contains as an active ingredient a bacterium selected from bacteria belonging to the genus Lactobacillus, is useful for treating colon cancer or colorectal cancer caused by Bacteroides fragilis. Patent Document 7 describes a pharmaceutical composition for preventing or treating cancer, which contains Lactobacillus fermentum WiKim0102 (Deposit No. KCCM12356P) or a culture thereof as an active ingredient. Patent Document 8 describes a synbiotic composition comprising: (i) a probiotic composition comprising a Lactobacillus species; and (ii) a prebiotic mixture comprising at least one stabilized rice bran derivative, wherein the stabilized rice bran derivative comprises at least one natural antioxidant selected from the group consisting of tocol, phytosterol, γ-oryzanol, and inositol hexaphosphate (IP6), and describes that this composition can be used to treat or prevent irritable bowel syndrome (IBS) and related intestinal disorders.

[0006] WO2002 / 080946 (Patent No. 3921175) JP 2010-124772 A JP 2012-180289 A JP 2014-39 A WO2017 / 125453 (JP 2019-502397 A) WO2006 / 041930 (JP 2008-515809 A) WO2020 / 122497 (JP 2021-532432 A) WO2019 / 117212

[0007] C. A. Brennan et ai. Fusobacterium nucleatum - symbiont, opportunist and oncobacterium. Nat Rev Microbiol. 2019;17(3):156-166. doi: 10.1038 / s41579-018-0129-6.Metzger Z et al. Synergistic pathogenicity of Porphyromonas gingivalis and Fusobacterium nucleatum in the mouse subcutaneous chamber model. J. Endod 35, 86-94 (2009). [PubMed: 19084132]Strauss J et al. Invasive potential of gut mucosa-derived Fusobacterium nucleatum positively correlates with IBD status of the host. Inflamm. Bowel Dis 17, 1971-1978 (2011). [PubMed: 21830275]Gevers D et al. The treatment-naive microbiome in new-onset Crohn’s disease. Cell Host Microbe 15, 382-392 (2014). [PubMed: 24629344]Pascal V et al. A microbial signature for Crohn’s disease. Gut 66, 813-822 (2017). [PubMed: 28179361]Wang Y et al. Lactiplantibacillus plantarum HNU082 inhibited the growth of Fusobacterium nucleatum and alleviated the inflammatory response introduced by F. nucleatum invasionFood Funct. 2021 Nov 1;12(21):10728-10740. doi: 10.1039 / d1fo01388b.Wang X et al. In vitro simulated digestion and fecal fermentation of exopolysaccharides from Lacticaseibacillus paracasei GL1. Food Funct. 2023 Jun 6;14(11):5120-5137. doi: 10.1039 / d3fo00676j.Majid Eslami et al. Importance of probiotics in the prevention and treatment of colorectal cancer. J Cell Physiol. 2019 Aug;234(10):17127-17143. doi: 10.1002 / jcp.28473.Sara Ebrahimzadeh et al. Colorectal cancer treatment using bacteria: focus on molecular mechanisms. Biomedicine & PharmacotherapyVolume 127, July 2020, 110159Yuanchun Yue et al. Probiotic strain Lactobacillus plantarum YYC-3 prevents colon cancer in mice by regulating the tumour microenvironment. J Cell Physiol. 2019 Aug;234(10):17127-17143. doi: 10.1002 / jcp.28473.

[0008] Fusobacterium bacteria are thought to be difficult to control in the intestines because they live in a complex symbiotic relationship with other intestinal bacteria. For example, the administration of antibiotics is thought to reduce not only Fusobacterium bacteria but also beneficial bacteria. Therefore, control using probiotics and prebiotics, which do not affect beneficial bacteria, is desired.

[0009] No effective material has been found that can control Fusobacterium in the intestinal flora.

[0010] The present invention provides the following: [1] A composition for controlling bacteria belonging to the genus Fusobacterium in intestinal flora, comprising bacteria belonging to the family Lactobacillaceae. [2] The composition according to 1, wherein the bacteria belonging to the genus Fusobacterium is Fusobacterium nucleatum. [3] The composition according to 1 or 2, wherein the bacteria belonging to the family Lactobacillaceae include bacteria belonging to any genus selected from the group consisting of the genera Lactobacillus, Levilactobacillus, Limosilactobacillus, Ligilactobacillus, Lacticaseibacillus, and Lactiplantibacillus.[4] Bacteria belonging to the Lactobacillaceae family include Lactobacillus acidophilus, Lactobacillus amylovorus, Levilactobacillus brevis, Lactobacillus crispatus, Lactobacillus delbrueckii subsp. lactis, Limosilactobacillus fermentum, Lactobacillus gasseri, Lactobacillus paragasseri, Ligilactobacillus murinus, and Ligilactobacillus animalis. 4. The composition according to any one of claims 1 to 3, comprising any one selected from the group consisting of Lacticaseibacillus paracasei, Lactiplantibacillus plantarum, Limosilactobacillus reuteri, Lacticaseibacillus rhamnosus, and Ligilactobacillus salivarius.[5] The composition according to 1, wherein the bacterium belonging to the family Lactobacillaceae comprises any one selected from the group consisting of the following strains and taxonomically equivalent strains thereof: Lactobacillus acidophilus JCM 1132T, Lactobacillus amylovorus JCM 1126T, Levilactobacillus brevis JCM 1059T, Lactobacillus crispatus JCM 1185T, Lactobacillus delbrueckii subsp. lactis NITE BP-02874 and JCM 1248T, Limosilactobacillus fermentum FERM BP-11433, Lactobacillus gasseri JCM 1131T, Lactobacillus paragasseri FERM BP-6999, NITE BP-72, NITE BP-224, and JCM 5343T, [6] The composition according to any one of [1] to [5], wherein the bacteria belonging to the family Lactobacillaceae include Lactobacillus delbrueckii subsp. bulgaricus.[7] The composition according to any one of 1 to 6, wherein the bacteria belonging to the Lactobacillaceae family include any one selected from the group consisting of the following strains and strains taxonomically equivalent thereto: Lactobacillus delbrueckii subsp. bulgaricus FERM BP-10741 and Lactobacillus delbrueckii subsp. bulgaricus 2038. [8] The composition according to any one of 1 to 7, wherein the control of bacteria belonging to the genus Fusobacterium is a reduction in the number of bacteria belonging to the genus Fusobacterium. [9] The composition according to any one of 1 to 8, for use as any one selected from the group consisting of probiotics, prebiotics, and synbiotics.

[10] The composition according to any one of 1 to 9, for treating at least one of inflammatory bowel disease and colorectal cancer via control of bacteria belonging to the genus Fusobacterium.

[11] The composition according to any one of 1 to 9, for treating at least one of inflammatory bowel disease and colorectal cancer in a subject in whom Fusobacterium genus bacteria have been detected in at least one of the intestinal tract and feces.

[12] A pharmaceutical composition comprising a bacterium belonging to the Lactobacillaceae family and a pharmaceutically acceptable additive.

[13] The pharmaceutical composition according to 12, for use in an intestinal disease.

[14] An enteric-coated formulation comprising a bacterium belonging to the Lactobacillaceae family.

[0011]

[15] A method for controlling bacteria belonging to the genus Fusobacterium in the intestinal tract of a subject, or a method for reducing the risk of at least one of inflammatory bowel disease and colorectal cancer in a subject, comprising the following steps: having the subject ingest a composition containing bacteria belonging to the family Lactobacillaceae, based on the presence or absence or amount of bacteria belonging to the genus Fusobacterium in the intestinal tract of the subject.

[16] A method for suggesting to a subject to take a composition, a method for supporting a subject's diet, or a method for supporting a subject's health, comprising the following steps: suggesting to a subject to take a composition containing bacteria belonging to the family Lactobacillaceae, based on the presence or absence or amount of bacteria belonging to the genus Fusobacterium in the intestinal tract of the subject.

[0012]

[21] A composition comprising a bacterium belonging to the Lactobacillaceae family for use in a method for controlling bacteria belonging to the genus Fusobacterium. Use of a bacterium belonging to the Lactobacillaceae family in the manufacture of a composition for controlling bacteria belonging to the genus Fusobacterium. A method or non-therapeutic method for controlling bacteria belonging to the genus Fusobacterium, comprising a step of administering a composition comprising a bacterium belonging to the Lactobacillaceae family to a subject. Use or non-therapeutic use of a composition comprising a bacterium belonging to the Lactobacillaceae family for controlling bacteria belonging to the genus Fusobacterium.

[22] The composition, use in manufacture, method or non-therapeutic method, or use or non-therapeutic use according to 21, wherein the bacterium belonging to the genus Fusobacterium is Fusobacterium nucleatum.

[23] The composition according to 21 or 22, wherein the bacteria belonging to the family Lactobacillaceae include bacteria belonging to any genus selected from the group consisting of the genera Lactobacillus, Levilactobacillus, Limosilactobacillus, Ligilactobacillus, Lacticaseibacillus, and Lactiplantibacillus.

[24] Bacteria belonging to the family Lactobacillaceae include Lactobacillus acidophilus, Lactobacillus amylovorus, Levilactobacillus brevis, Lactobacillus crispatus, Lactobacillus delbrueckii subsp. lactis, Limosilactobacillus fermentum, Lactobacillus gasseri, Lactobacillus paragasseri, Ligilactobacillus murinus, and Ligilactobacillus animalis. 24. The composition, use in manufacture, method or non-therapeutic method, or use or non-therapeutic use of any one of claims 21 to 23, comprising any selected from the group consisting of Lacticaseibacillus animalis, Lacticaseibacillus paracasei, Lactiplantibacillus plantarum, Limosilactobacillus reuteri, Lacticaseibacillus rhamnosus, and Ligilactobacillus salivarius.

[25] The composition, use in production, method or non-therapeutic method, or use or non-therapeutic use according to any one of items 21 to 24, wherein the bacterium belonging to the family Lactobacillaceae comprises any one selected from the group consisting of the following strains and taxonomically equivalent strains thereof: Lactobacillus acidophilus JCM 1132T, Lactobacillus amylovorus JCM 1126T, Levilactobacillus brevis JCM 1059T, Lactobacillus crispatus JCM 1185T, Lactobacillus delbrueckii subsp. lactis NITE BP-02874 and JCM 1248T, Limosilactobacillus fermentum FERM BP-11433, Lactobacillus gasseri JCM 1131T, Lactobacillus paragasseri FERM BP-6999, NITE BP-72, NITE BP-224, and JCM 5343T, Ligilactobacillus murinus JCM 1717T, Ligilactobacillus animalis JCM 5670T, Lacticaseibacillus paracasei NBRC 15889T, Lactiplantibacillus plantarum FERM BP-11262, Limosilactobacillus reuteri JCM 1112T, Lacticaseibacillus rhamnosus NITE P-313, and JCM 1136T, and Ligilactobacillus salivarius JCM 1231T.

[26] The composition, use in production, method or non-therapeutic method, or use or non-therapeutic use according to any one of claims 21 to 25, wherein the bacterium belonging to the family Lactobacillaceae includes Lactobacillus delbrueckii subsp. bulgaricus.

[27] The composition, use in production, method or non-therapeutic method, or use or non-therapeutic use according to any one of items 21 to 26, wherein the bacterium belonging to the family Lactobacillaceae includes any one selected from the group consisting of the following strains and strains taxonomically equivalent thereto: Lactobacillus delbrueckii subsp. bulgaricus FERM BP-10741 and Lactobacillus delbrueckii subsp. bulgaricus 2038.

[28] The composition, use in production, method or non-therapeutic method, or use or non-therapeutic use according to any one of items 21 to 27, wherein the control of bacteria belonging to the genus Fusobacterium is a reduction in the number of bacteria belonging to the genus Fusobacterium.

[29] The composition, use in production, method or non-therapeutic method, or use or non-therapeutic use according to any one of items 21 to 28, wherein the composition is for use as any one selected from the group consisting of probiotics, prebiotics, and synbiotics.

[30] The composition, use in manufacturing, method or non-therapeutic method, or use or non-therapeutic use according to any one of items 21 to 29, wherein the composition is for treating at least one of inflammatory bowel disease and colorectal cancer through control of bacteria belonging to the genus Fusobacterium. The composition, use in manufacturing, method or non-therapeutic method, or use or non-therapeutic use according to any one of items 21 to 29, wherein the composition is for treating at least one of inflammatory bowel disease and colorectal cancer in a subject in whom Fusobacterium bacteria have been detected in at least one of the intestinal tract and feces.

[0013] The use of bacteria belonging to the Lactobacillaceae family provides a means for controlling bacteria belonging to the genus Fusobacterium in the intestinal flora, which is expected to be useful in treating colon cancer and inflammatory bowel disease.

[0014] Number of Fusobacterium bacteria after inhibition circle cultivation of F. nucleatum using test bacteria (Lactobacillus delbrueckii subsp. lactis P2300434) Number of Fusobacterium bacteria after cultivation

[0015] [Active ingredient] (Bacteria belonging to the Lactobacillaceae family) The present invention relates to a composition for controlling Fusobacterium bacteria in intestinal flora, which contains bacteria belonging to the Lactobacillaceae family as an active ingredient. Bacteria belonging to the Lactobacillaceae family are sometimes called Lactobacillaceae lactic acid bacteria or Lactobacillaceae bacteria. According to the inventors' studies, Streptococcus thermophilus, a member of the Streptococcusae family in the Lactobacillales order, did not exhibit the desired function under the experimental conditions. "Containing as an active ingredient" refers to the composition being used in an amount effective to exert the desired function, or being specified in the label as a component contributing to the intended purpose. In functional food products, active ingredients are sometimes referred to as functional ingredients (ingredients that contribute to specific health purposes (excluding those related to reducing disease risk)).

[0016] In the present invention, when describing bacteria belonging to the family Lactobacillaceae, unless otherwise specified, the classification follows the reclassification according to Zheng J, Wittouck S, Salvetti E, Franz CMAP, Harris HMB, Mattarelli P, O'Toole PW, Pot B, Vandamme P, Walter J, Watanabe K, Wuyts S, Felis GE, Ganzle MG, Lebeer S.: A taxonomic note on the genus Lactobacillus: Description of 23 novel genera, emended description of the genus Lactobacillus Beijerinck 1901, and the union of Lactobacillaceae and Leuconostocaceae. Int J Syst Evol Microbiol. 2020 Apr; 70(4): 2782-2858.

[0017] After reclassification, the Lactobacillaceae family is now divided into 31 genera: Lactobacillus genus, Paralactobacillus genus, Holzapfelia genus, Amylolactobacillus genus, Bombilactobacillus genus, Companilactobacillus genus, Lapidilactobacillus genus, Agrilactobacillus genus, Schleiferilactobacillus genus, Loigolactobacilus genus, Lacticaseibacillus genus, Latilactobacillus genus, Dellaglioa genus, Liquorilactobacillus Liquorilactobacillus genus, Ligilactobacillus genus, Lactiplantibacillus genus, Furfurilactobacillus genus, Paucilactobacillus genus, Limosilactobacillus genus, Fructilactobacillus genus, Acetilactobacillus genus, Apilactobacillus genus, Levilactobacillus genus, Secundilactobacillus genus, Lentilactobacillus genus, Pediococcus The genera include the genera Convivina, Leuconostoc, Fructobacillus, Oenococcus, and Weissella.

[0018] In one embodiment, the composition contains as an active ingredient any of bacteria belonging to the following 25 genera of lactic acid bacteria of the Lactobacillaceae family, which are the two existing genera (Lactobacillus and Paralactobacillus) plus 23 genera newly established through reorganization: Lactobacillus, Paralactobacillus, Holzapfelia, Amylolactobacillus, Bombilactobacillus, Companilactobacillus, Lapidilactobacillus, Agrilactobacillus, Schleiferilactobacillus, Loigolactobacilus, Lacticaseibacillus, Latilactobacillus, Dellaglioa, Lactic acid bacteria of the family Lactobacillaceae. Genus iquorilactobacillus, Genus Ligilactobacillus, Genus Lactiplantibacillus, Genus Furfurilactobacillus, Genus Paucilactobacillus, Genus Limosilactobacillus, Genus Fructilactobacillus, Genus Acetilactobacillus, Genus Apilactobacillus, Genus Levilactobacillus, Genus Secundilactobacillus, and Genus Lentilactobacillus.

[0019] In a preferred embodiment, the composition contains as an active ingredient a bacterium belonging to any one of the genera Lactobacillus, Levilactobacillus, Limosilactobacillus, Ligilactobacillus, Lacticaseibacillus, and Lactiplantibacillus, among lactic acid bacteria of the Lactobacillaceae family.

[0020] In another preferred embodiment, the composition contains as an active ingredient Lactobacillus acidophilus, Lactobacillus amylovorus, Levilactobacillus brevis, Lactobacillus crispatus, Lactobacillus delbrueckii, Lactobacillus delbrueckii subsp. lactis, Lactobacillus delbrueckii subsp. bulgaricus, Limosilactobacillus fermentum, Lactobacillus gasseri, or the like, among bacteria belonging to the family Lactobacillaceae. The present invention also includes any one selected from the group consisting of Lactobacillus gasseri, Lactobacillus paragasseri, Ligilactobacillus murinus, Ligilactobacillus animalis, Lacticaseibacillus paracasei, Lactiplantibacillus plantarum, Limosilactobacillus reuteri, Lacticaseibacillus rhamnosus, and Ligilactobacillus salivarius.

[0021] In a more specific embodiment, the composition contains as an active ingredient any one selected from the group consisting of the following strains of bacteria belonging to the family Lactobacillaceae and taxonomically equivalent strains thereof: Lactobacillus acidophilus JCM 1132T, Lactobacillus amylovorus JCM 1126T, Levilactobacillus brevis JCM 1059T, Lactobacillus crispatus JCM 1185T, Lactobacillus delbrueckii subsp. lactis NITE BP-02874 and JCM 1248T, Limosilactobacillus fermentum FERM BP-11433, Lactobacillus gasseri JCM 1131T, Lactobacillus paragasseri FERM BP-6999, NITE BP-72, NITE BP-224, and JCM 5343T, Ligilactobacillus murinus JCM 1717T, Ligilactobacillus animalis JCM 5670T, Lacticaseibacillus paracasei NBRC 15889T, Lactiplantibacillus plantarum FERM BP-11262, Limosilactobacillus reuteri JCM 1112T, Lacticaseibacillus rhamnosus NITE P-313, and JCM 1136T, as well as Ligilactobacillus salivarius JCM 1231T.

[0022] Strains with numbers beginning with "JCM" can be purchased from the Microbial Materials Development Division, BioResource Research Center, RIKEN (3-1-1 Takanodai, Tsukuba, Ibaraki 305-0074). Strains with numbers beginning with "NBRC" can be purchased from the Bioresources Utilization Promotion Division, Biotechnology Center (NBRC), National Institute of Technology and Evaluation (NITE) (2-5-8 Kazusa Kamatari, Kisarazu, Chiba 292-0818).

[0023] A strain taxonomically equivalent to a certain strain (hereinafter referred to as strain S) refers to, for example, any of the following: A strain belonging to the same genus as strain S, in which the entire sequence or a characteristic portion (such as the V1 region, the V2 region, or all or a portion of the V1 and V2 regions, or a portion including the V1 and V2 regions) of its 16S rRNA gene (hereinafter sometimes referred to as "16S" or "16S rRNA gene") has 90% or more, preferably 95% or more, more preferably 98% or more, even more preferably 98.5% or more, even more preferably more than 98.7%, even more preferably 99% or more, and even more preferably 100% sequence identity with the sequence of strain S; A strain that has the same mycological properties as strain S.

[0024] In the present invention, unless otherwise specified, sequence identity refers to the percentage of matching bases shared between two sequences when the two sequences are optimally aligned. Analysis of base sequence identity can be performed using algorithms or programs well known to those skilled in the art (e.g., BLASTN, BLASTP, BLASTX, ClustalW). When using a program, parameters can be appropriately set by those skilled in the art, or the default parameters of each program may be used. Specific techniques for these analysis methods are also well known to those skilled in the art. Commercially available genetic information processing software may be used to calculate identity.

[0025] Regarding criteria for determining species identity based on 16S rRNA gene sequences, those skilled in the art can refer to Stackebrandt E, Ebers J. Taxonomic parameters revisited: tarnished gold standards. Microbiol Today 2006;33:152-155.

[0026] (Lactobacillus delbrueckii OLL204989, NITE BP-02874) Lactobacillus delbrueckii OLL204989 is a strain belonging to Lactobacillus delbrueckii subsp. lactis and has been internationally deposited under the Budapest Treaty. Depositor: Meiji Co., Ltd. Depository institution: National Institute of Technology and Evaluation, Patent Microorganisms Depositary Center (2-5-8 Kazusa Kamatari, Kisarazu City, Chiba Prefecture, Japan, 292-0818) Accession number: NITE BP-02874 Date of deposit: February 5, 2019

[0027] The sequence of the 16S rRNA gene (a part of the sequence corresponding to the V1 to V3 regions of the 16S rRNA gene) is shown below and in SEQ ID NO: 1 in the sequence listing. GCTGGCGGCGTGCCTAATACATGCAAGTCGAGCGAGCTGAATTCAAAGATYCCTTCGGGRTGATTTGTTGGAYGCTAGCGGCGGATGGGTGAGTAACACGTGGGCAATCTGCCCTAAAGACTGGG ATACCACTTGGAAACAGGTGCTAATACCGGATAACAACATGAATCGCATGATTCAAGTTTGAAAGGCGGCGCAAGCTGTCACTTTAGGATGAGCCCGCGGCGCATTAGCTAGTTGGTGGGGTAAAG GCCTACCAAGGCAATGATGCGTAGCCGAGTTGAGAGACTGATCGGCCACATTGGGACTGAGACACGGCCCAAACTCCTACGGGAGGCAGCAGTAGGGAATCTTCCACAATGGACGCAAGTCTGAT GGAGCAACGCCGCGTGAGTGAAGAAGGTCTTCGGATCGTAAAGCTCTGTTGTTGGTGAAGAAGGATAGAGGCAGTAACTGGTCTTTATTTGACGGTAATCAACCAGAAAGTCACGGCTAACTACGT

[0028] The bacteriological characteristics are as follows: Morphology: Long rod-shaped bacterium Culture medium (Difco TMLactobacilli MRS Agar (BD) characteristics: round, medium size (φ2mm), smooth, white, convex round Gram staining: positive Catalase: negative

[0029] (Lactobacillus paragasseri OLL2716, FERM BP-6999) Lactobacillus paragasseri OLL2716 has been internationally deposited under the Budapest Treaty. Depositor: Meiji Co., Ltd. Depository: National Institute of Technology and Evaluation, Patent Organism Depositary Center Accession number: FERM BP-6999 Date of original deposit: May 24, 1999 Date of transfer to deposit under the Budapest Treaty: January 14, 2000

[0030]

[0031] The bacteriologic properties are as follows: Morphology: rod-shaped bacterium, does not produce gas from glucose, GC content 36.4%, gram-positive, catalase-negative, lactic acid optical rotation DL-type, does not grow at 15°C, and produces acid by assimilating glucose, mannose, fructose, galactose, sucrose, cellobiose, lactose, trehalose, starch, and dextrin.

[0032] (Lactobacillus paragasseri OLL2809, NITE BP-72) Lactobacillus paragasseri OLL2809 has been internationally deposited under the Budapest Treaty. Depositor: Meiji Co., Ltd. Depository: National Institute of Technology and Evaluation, Patent Microorganisms Depositary Center Accession number: NITE BP-72 Date of original deposit: February 1, 2005 Date of transfer to deposit under the Budapest Treaty: January 18, 2006

[0033] The sequence of the 16S rRNA gene of Lactobacillus paragasseri OLL2809 is highly identical to that of its homologous species, Lactobacillus paragasseri OLL2716.

[0034] The mycological characteristics are as follows. Colony appearance on medium (Lactobacilli MRS Agar, DIFCO): Straight sword 2-3 mm, pale yellow, round, flat, entire, smooth, opaque, viscous Bacterial morphology: rod-shaped Gram staining: positive Lactic acid fermentation type: homolactic fermentation Aerobic growth: + Growth temperature: 15°C -, 45°C + Sugar fermentation: arabinose -, xylose -, rhamnose -, ribose -, glucose +, mannose +, fructose +, galactose +, sucrose +, cellobiose +, lactose +, trehalose +, melibiose -, raffinose -, melitzose -, mannitol -, sorbitol

[0035] (Lactobacillus paragasseri OLL2959, NITE BP-224) Lactobacillus paragasseri OLL2959 has been internationally deposited under the Budapest Treaty. Depositor: Meiji Co., Ltd. Depository: National Institute of Technology and Evaluation, Patent Microorganisms Depositary Center Accession number: NITE BP-224 Date of deposit: March 31, 2006 Date of transfer to deposit under the Budapest Treaty: November 21, 2007

[0036] The sequence of the 16S rRNA gene of Lactobacillus paragasseri OLL2959 is highly identical to that of the homologous species Lactobacillus paragasseri OLL2716.

[0037] The bacteriological characteristics are as follows: Colony appearance on medium (Lactobacilli MRS Agar, DIFCO): Round, pale yellow, smooth, fan-shaped Bacterial morphology: Rod-shaped Gram staining: Positive Lactic acid fermentation type: Homolactic fermentation Aerobic growth: + Growth temperature: 15°C -, 45°C + Gas production: - Sugar fermentation: Arabinose -, xylose -, rhamnose -, ribose -, glucose +, mannose +, fructose +, galactose +, sucrose +, cellobiose +, lactose -, trehalose -, melibiose -, raffinose -, melitzose -, mannitol -, sorbitol -

[0038] (Lactobacillus rhamnosus OLL2838, NITE P-313) Lactobacillus rhamnosus OLL2838 has been deposited at a depository designated by the Commissioner of the Japan Patent Office. Depositor: Meiji Co., Ltd. Depository: National Institute of Technology and Evaluation, Patent Microorganisms Depositary Center Accession number: NITE P-313 Date of deposit: February 14, 2007

[0039] The bacterial characteristics are as follows: Colony shape on medium (BL agar medium, Nissui Pharmaceutical): circular, white, smooth, cone-shaped (when cultured under construction conditions) Morphology: rod-shaped Gram staining: positive Lactic acid fermentation type: homolactic fermentation type Aerobic growth: + Growth temperature: 15°C +, 45°C - Sugar fermentation: arabinose -, xylose -, rhamnose +, ribose +, glucose +, mannose +, fructose +, galactose +, sucrose +, cellobiose +, lactose +, trehalose +, melibiose -, raffinose -, melitzose +, mannitol +, sorbitol +

[0040] (Lactobacillus fermentum OLL203697, FERM BP-11433) Lactobacillus fermentum OLL203697 has been internationally deposited under the Budapest Treaty. Depositor: Meiji Co., Ltd. Depository: National Institute of Advanced Industrial Science and Technology, International Patent Organism Depositary Center Accession number: FERM BP-11434 Date of deposit: October 5, 2011

[0041] The sequence of the 16S rRNA gene is shown below and in SEQ ID NO: 3 in the Sequence Listing: GGGCGGTGTGCCTAaTaCATGCAAGtCGAACGCGTTGGCCCAATTGATTGaTGGTGCTTGCACCTGATTGATTTTGGTCGCCAACGAGTGGCGGACGGGTGAGTAACACGTAGGTAACCTGCCCAGAAGCGGGGGACAACATTTGGAAACAGATGCTAATACCGCATAACAACGTTGTTCGCATGAACAACGCTTAAAAGATGGCTTCTCGCTATCACTTCTGGATGGACCTGCGGTGCATTAGCTTGTTGGTGGG GTAACGGCCTACCAAGGCGATGATGCATAGCCGAGTTGAGAGACTGATCGGCCACAATGGGACTGAGACACGGCCCATACTCCTACGGGAGGCAGCAGTAGGGAATCTTCCACAATGGGCGCAAGCCT GATGGAGCAACACCGCGTGAGTGAAGAAGGGTTTCGGCTCGTAAAGCTCTGTTGTTAAAGAAGAACACGTATGAGAGTAACTGTTCATACGTTGACGGTATTTAACCAGAAAGTCACGGCTAACTACGT

[0042] The bacterial characteristics are as follows: Oxygen requirement: Normally anaerobic. Colony shape when cultured in Lactobacilli MRS Broth (Difco, Ref. No. 288130): 2-3 mm in diameter, white, round, semi-lenticular, entire, smooth, opaque, butter-like.

[0043] (Lactiplantibacillus plantarum OLL2712, FERM BP-11262) Lactiplantibacillus plantarum OLL2712 has been internationally deposited under the Budapest Treaty. Lactiplantibacillus plantarum OLL2712 was deposited before the reclassification according to Zheng J, Wittouck S, Salvetti E, Franz CMAP, Harris HMB, Mattarelli P, O'Toole PW, Pot B, Vandamme P, Walter J, Watanabe K, Wuyts S, Felis GE, Ganzle MG, Lebeer S.: A taxonomic note on the genus Lactobacillus: Description of 23 novel genera, emended description of the genus Lactobacillus Beijerinck 1901, and the union of Lactobacillaceae and Leuconostocaceae. Int J Syst Evol Microbiol. 2020 Apr; 70(4): 2782-2858. Therefore, the deposit certificate refers to the basonym lactobacillus plantarum. Depositor: Meiji Co., Ltd. Depository institution: National Institute of Advanced Industrial Science and Technology, Patent Organism Depositary Center Accession number: FERM BP-11262 International deposit date: July 2, 2010

[0044] A partial sequence of the 16S rRNA gene is shown below and in SEQ ID NO: 4 in the sequence listing.

[0045] The bacteriological characteristics are as follows: Gram staining: positive Morphology: rod Lactic acid fermentation type: homolactic fermentation Aerobic growth: + Growth temperature: 15°C +, 45°C - Colony shape Diameter: 1-2 mm, Color: white, Shape: circular, Protrusion: hemispherical, Margin: entire, Surface shape: smooth, Transparency: opaque, Consistency: buttery.

[0046] (Lactobacillus delbrueckii subsp. bulgaricus OLL1073R-1, FERM BP-10741) OLL1073 R-1 has been internationally deposited under the Budapest Treaty. Depositor: Meiji Co., Ltd. Depository: National Institute of Technology and Evaluation, Patent Organism Depositary Center (Room 122, 2-5-8 Kazusa Kamatari, Kisarazu City, Chiba Prefecture, Japan) Accession number: FERM BP-10741 Deposit date: November 29, 2006

[0047] A partial sequence of the 16S rRNA gene is shown below and in SEQ ID NO: 5 in the sequence listing. GCTGGCGGCGTGCCTAATACATGCAAGTCGAGCGAGCTGAATTCAAAGATYCCTTCGGGRTGATTTGTTGGACGCTAGCG GCGGATGGGTGAGTAACACGTGGGCAATCTGCCCTAAAGACTGGGATACCACTTGGAAACAGGTGCTAATACCGGATAAC AACATGAATCGCATGATTCAAGTTTGAAAGGCGGCGYAAGCTGTCACTTTAGGATGAGCCCGCGGCGCATTAGCTAGTTG GTGGGTAAAGGCCTACCAAGGCAATGATGCGTAGCCGAGTTGAGAGACTGATCGGCCACATTGGGACTGAGACACGGCC CAAACTCCTACGGGAGGCAGCAGTAGGGAATCTTCCACAATGGACGCAAGTCTGATGGAGCAACGCCGCGTGAGTGAAGA AGGTTTTCGGATCGTAAAGCTCTGTTGTTGGTGAAGAAGGATAGAGGCAGTAACTGGTCTTTATTTGACGGTAATCAACC AGAAAGTCACGGCTAACTACGT

[0048] The bacteriological properties are as follows: Cell shape: rod Motility: none Presence or absence of spores: none Gram staining: positive The strain was spread on a BL agar medium (Eiken Chemical) plate and cultured at 37°C for 48 hours using the steel wool method, resulting in opaque, rough colonies. Nitrate reduction: negative Indole production: negative Gelatin liquefaction: negative Catalase activity: negative Attitude towards oxygen: facultative anaerobic Produces D(-) lactic acid from glucose by homolactic fermentation and does not produce gas In BL liquid medium, growth at 10°C is negative, growth at 45°C is positive Arginine decomposition: negative Gas production from malic acid: negative Decomposition of various carbohydrates (positive +, negative -): arabinose -, xylose -, rhamnose -, ribose -, glucose +, mannose +, fructose +, galactose -, sucrose -, maltose -, cellobiose -, lactose +, trehalose -, melibiose -, raffinose -, melezitose -, dextrin -, starch -, glycogen -, inulin - Mannitol -, sorbitol -, inositol -, esculin -, salicin - Polysaccharide production: This strain is capable of producing polysaccharides and is characterized by the extracellular production of phosphorus-containing polysaccharides composed of galactose and glucose.

[0049] (Lactobacillus delbrueckii ssp. bulgaricus 2038) This strain can be isolated from Meiji Bulgaria Yogurt LB81 (Meiji Co., Ltd.).

[0050] A partial sequence of the 16S rRNA gene is shown below and in SEQ ID NO: 6 in the sequence listing: gctggcggcgtgcctaatacatgcaagtcgagcgagctgaattcaaagatyccttcgggrtgatttgttggacgctagcggcggatgggtgagtaacacgtgggcaatctgccctaaagactgggataccacttggaaacaggtgctaataccggataacaacatgaatcgcatgattcaagtttgaaaggcggcgyaagctgtcactttaggatgagcccgcggcgcattagctagttggtggggtaaag gcctaccaaggcaatgatgcgtagccgagttgagagactgatcggccacattgggactgagacacggcccaaactcctacgggaggcagcagtagggaatcttccacaatggacgcaagtctgat ggagcaacgccgcgtgagtgaagaaggttttcggatcgtaaagctctgttgttggtgaagaaggatagaggcagtaactggtctttatttgacggtaatcaaccagaaagtcacggctaactacgt

[0051] The mycological properties of strain 2038 are as follows: Morphology: rod-shaped bacterium, does not produce gas from glucose, GC content 49.7%, gram-positive, catalase-negative, lactic acid optical rotation D type, does not grow at 15°C, produces acid by assimilating glucose, lactose, etc., does not form spores, non-motile.

[0052] (Production Method) The lactic acid bacteria of the Lactobacillaceae family contained in the composition can be produced by culturing. The culture conditions are not particularly limited as long as the desired effect is achieved.

[0053] The lactic acid bacteria of the Lactobacillaceae family may be contained in any form in the composition as long as the desired effect can be exhibited. For example, the lactic acid bacteria may be the lactic acid bacteria themselves or a culture of the lactic acid bacteria (consisting of the lactic acid bacteria cells and a culture supernatant).

[0054] Lactic acid bacteria cultures can be obtained according to standard methods for preparing lactic acid bacteria cultures. Various media can be used for the culture, including milk media or media containing milk components, semi-synthetic media that do not contain milk components, and synthetic media. Lactic acid bacteria cultures can be obtained by inoculating lactic acid bacteria of the family Lactobacillaceae into the above-mentioned sterilized medium and culturing them at approximately 20°C to 45°C for 5 hours to several days. The temperature and duration of the culture can be adjusted appropriately depending on the strain of lactic acid bacteria of the family Lactobacillaceae used and the desired number of bacteria. The culture may be used as is, or may be used after processing such as centrifugation, membrane concentration, drying, freeze-drying, or washing.

[0055] The bacterial cells may be in a living state (viable bacterial cells) or in a dead state (dead bacterial cells), as long as they can exert the desired effect.

[0056] Killed lactic acid bacteria can be obtained by sterilizing lactic acid bacteria. The sterilization method is not particularly limited as long as it can achieve the desired effect, and can involve heat, a germicidal lamp (UV), ozone, chemicals, high osmotic pressure, etc. The killed bacteria are preferably heat-killed bacteria obtained by heat-treating live bacteria. The heat treatment to obtain heat-killed bacteria is not particularly limited as long as it achieves the desired effect, and is carried out at a temperature and for a time sufficient to kill the lactic acid bacteria used. These conditions vary depending on the lactic acid bacteria used, but are, for example, 55°C or higher, preferably 60°C or higher, more preferably 65°C or higher, even more preferably 70°C or higher, or may be 80°C or higher, or even 90°C or higher. The upper limit of the heat treatment temperature can be appropriately set, for example, 121°C or lower, 100°C or lower, 90°C or lower, or 80°C or lower. Depending on the heat treatment temperature, the heat treatment time can be 1 minute or longer, 3 minutes or longer, 10 minutes or longer, 15 minutes or longer, 30 minutes or longer, or 45 minutes or longer. The upper limit of the heat treatment temperature can be, for example, 120 minutes or less, or may be 100 minutes or less, 90 minutes or less, or 80 minutes or less.

[0057] The lactic acid bacteria to be contained in the composition, regardless of whether they are live or dead cells, can be prepared in the form of washed cells, concentrate, dried product, suspension, paste, gel, etc.

[0058] [Uses] (Function / Action) The composition of the present invention can be used to control bacteria belonging to the genus Fusobacterium (sometimes simply referred to as Fusobacterium bacteria). In a preferred embodiment, the composition can be used to control Fusobacterium bacteria in intestinal flora. In a more preferred embodiment, the composition can be used to control Fusobacterium bacteria in human intestinal flora. Controlling Fusobacterium bacteria in intestinal flora refers to controlling bacteria belonging to the genus Fusobacterium in a state where various bacteria living in the intestine are present. Controlling bacteria refers to controlling the number of bacteria, regulating intestinal flora including Fusobacterium bacteria, or assisting in regulating intestinal flora including Fusobacterium bacteria. In a preferred embodiment, the composition is used to reduce the number of Fusobacterium bacteria or assist in reducing the number of Fusobacterium bacteria.

[0059] The intestine refers to the digestive organ in humans and animals where bacteria normally reside and where ingested food is digested and absorbed. The intestine includes the small intestine and the large intestine, and preferably the large intestine.

[0060] Examples of Fusobacterium genus bacteria include: Fusobacterium nucleatum subsp. nucleated, Fusobacterium nucleatum subsp. animal, Fusobacterium nucleatum subsp. vincentius (fusiform), Fusobacterium nucleatum subsp. polymorphic, Fusobacterium periodonticum, Fusobacterium russii, Fusobacterium canifelinum, Fusobacterium simiae, Fusobacterium necrophorum, Fusobacterium equinus, Fusobacterium gonidiaformans, Fusobacterium deadly, Fusobacterium necrogenes, Fusobacterium ulcerans, Fusobacterium varium, Fusobacterium perfoetens

[0061] In the present invention, the term "Fusobacterium" refers to bacteria identified as belonging to the genus Fusobacterium by molecular phylogenetic analysis based on the 16S rRNA gene. Criteria for determining genera based on molecular phylogenetic analysis based on the 16S rRNA gene are well known to those skilled in the art (Stackebrandt E, Ebers J. Taxonomic parameters revisited: tarnished gold standards. Microbiol Today 2006;33:152-155).

[0062] Whether a certain component controls Fusobacterium bacteria in the intestinal flora can be evaluated as follows: Feces provided by a healthy individual is added to an appropriate medium and, if necessary, incubated for a certain period of time. After that, the component to be evaluated is added and incubated under appropriate conditions (e.g., 16 hours of incubation at 37°C under anaerobic conditions, similar to those in the intestinal tract). If the feces do not contain Fusobacterium bacteria, any available Fusobacterium bacteria is added at the start of incubation and then cultured. An example of the Fusobacterium bacteria to be added is F. nucleatum JCM8532T. The amount added can be adjusted appropriately depending on the experimental conditions, but can be, for example, 0.1 to 10 × 10 4 The number of Fusobacterium bacteria in the bacterial flora of the culture is then measured. The results can then be compared with those of a culture grown under identical conditions except that a control (e.g., sterile water) was added instead of the component to be evaluated, and a judgment can be made.

[0063] The number of Fusobacterium bacteria contained in the bacterial flora can be determined by known methods. One preferred method is to perform 16S metagenomic analysis (sequence analysis of 16S rRNA gene amplicons) on DNA extracted from the culture. When performing 16S metagenomic analysis, DNA extraction can be performed using a commercially available kit. The genomic region to be analyzed is not particularly limited as long as it allows identification of the bacteria, but the V3-V4 region of the 16S rRNA gene can be used. Primers, amplification conditions, amplicon purification, and other methods for bacterial analysis are also well known to those skilled in the art. Sequence analysis is preferably performed using a next-generation sequencer with higher performance. QIIME 2 is used to analyze the obtained data. TMFor 16S metagenomic analysis, those skilled in the art can refer to information such as Sanschagrin S, Yergeau E. Next-generation sequencing of 16S ribosomal RNA gene amplicons. J Vis Exp. 2014;(90):51709. Published 2014 Aug 29. doi:10.3791 / 51709.

[0064] The Fusobacterium bacteria of the present invention are bacteria present in the human oral cavity and intestinal tract and are known to be the causative bacteria of periodontal disease. Fusobacterium nucleatum is also known to cause opportunistic infections and has recently been implicated in colon cancer (e.g., Non-Patent Document 1). Furthermore, F. nucleatum has been isolated from gastrointestinal infections such as appendicitis (Non-Patent Document 2), and its association with inflammatory bowel disease has recently been suggested (Non-Patent Documents 3, 4, and 5). In one aspect, the composition can be used for the treatment of any of inflammatory bowel disease and colon cancer via the control of Fusobacterium bacteria.

[0065] Inflammatory bowel diseases include ulcerative colitis and Crohn's disease.

[0066] The composition can also be used to treat a variety of diseases or conditions that can be improved by controlling the growth of Fusobacterium bacteria in the intestinal tract, including but not limited to inflammatory bowel disease and colon cancer.

[0067] In the present invention, the term "treatment" for a disease or condition includes reducing the risk of onset, delaying onset, prevention, cure, and halting or delaying progression. It also includes helping to improve from a disease or condition, alleviating a disease or condition, and reducing the risk of developing a disease or condition. Treatment includes radical treatment (treatment that eliminates the cause) and symptomatic treatment (treatment that improves symptoms). Treatment for improvement or treatment includes medical procedures performed by physicians and nurses and midwives under the direction of physicians, as well as non-therapeutic procedures performed by persons other than physicians, such as pharmacists, nutritionists (including registered dietitians and sports nutritionists), public health nurses, midwives, nurses, clinical laboratory technicians, sports instructors, pharmaceutical manufacturers, pharmaceutical distributors, food manufacturers, and food distributors. Prevention or reduction of the risk of onset also includes recommending the intake of specific foods and providing nutritional guidance (including nutritional guidance necessary for the recovery of injured or sick individuals, and nutritional guidance for maintaining and promoting health).

[0068] (Subject) The composition of the present invention is suitable for administration to subjects for whom it is desirable or necessary to control Fusobacterium bacteria in the intestinal flora, particularly to reduce the number of bacteria; subjects with any one selected from the group consisting of inflammatory bowel disease and colorectal cancer; and subjects with a disease or condition that can be improved by controlling the proliferation of Fusobacterium bacteria in the intestinal tract. In the present invention, the term "administer" is used not only to refer to administering a pharmaceutical product to a subject, but also to refer to having a subject ingest a non-pharmaceutical food or the like. "Administer" can be read as "intake" (or "ingestion"), and "administer" can be read as "administered".

[0069] Subjects for whom it is desirable or necessary to control Fusobacterium bacteria in the intestine include subjects in whom Fusobacterium bacteria are detected in at least one of their intestines and feces, and subjects in whom relatively high numbers of Fusobacterium bacteria are detected in at least one of their intestines and feces. Subjects for whom it is desirable or necessary to control Fusobacterium bacteria in the intestine also include subjects who have been found to have relatively high numbers of Fusobacterium bacteria through any test or analysis, such as an intestinal flora test, a test of substances in feces, or fecal metabolome analysis, subjects who have been found to be at high risk of inflammatory bowel disease, subjects who have been found to be at high risk of colorectal cancer, and subjects who have been recommended, based on the test or analysis results, by a doctor, nurse, pharmacist, nutritionist, etc., or by a computer program, to consume foods, beverages, or medicines capable of controlling Fusobacterium bacteria. Subjects for whom it is desirable or necessary to control Fusobacterium bacteria in at least one of their intestines and feces, subjects for whom it is desirable to reduce the number of Fusobacterium bacteria in at least one of their intestines and feces, subjects for whom it is desirable to reduce the risk of colorectal cancer, and subjects for whom it is desirable to reduce the risk of inflammatory bowel disease. In one embodiment, the subject is a subject in which Fusobacterium bacteria have been detected in at least one of the intestines and feces, or a subject in which the number of Fusobacterium bacteria has been found to be relatively high. According to studies by the present inventors, the number of Fusobacterium bacteria detected in at least one of the intestines and feces, or a relatively high number of Fusobacterium bacteria, means, for example, that when feces collected from a subject are cultured at 37°C under anaerobic conditions for 16 hours in a culture medium containing 0.1% (w / v) of stool, the number of Fusobacterium bacteria in the culture medium is 1 x 10 3 cells / mL or more, preferably 1 x 10 4 cells / mL or more, preferably 1×10 4 cells / mL or more, more preferably 5 x 10 5 cells / mL or more, or the number of Fusobacterium bacteria in the feces collected from the subject is 1 x 10 4 cells / g or more, preferably 5×10 4 cells / g or more, preferably 1×10 5 cells / g or more, more preferably 5×10 5cells / g or more, 1×10 6 cells / g or more, 1×10 7 This refers to the case where the number of bacteria is more than 10 ...

[0070] In one embodiment, the subject is healthy (not having a medically diagnosed illness). The subject may be a human or a non-human animal.

[0071] The age of the subject is not particularly limited, and the subject may be, for example, a newborn (within 28 days of birth); an infant (less than 1 year of age); a toddler (1 to 6 years of age); a child (7 years of age or older, but less than 15 years of age); an adult (15 years of age or older); or a person 65 years of age or older. In a preferred embodiment, the subject is a relatively elderly person, for example, a person 60 years of age or older, a person 65 years of age or older, a person 70 years of age or older, or a person 75 years of age or older. It has often been reported that the number of Fusobacterium bacteria in the intestinal tract increases with age (e.g., Odamaki et al. BMC Microbiology (2016) 16:90 DOI 10.1186 / s12866-016-0708-5).

[0072] [Composition] (Food composition, etc.) The composition of the present invention can be a food composition or a pharmaceutical composition. Foods and pharmaceuticals include not only those for humans but also those for non-human animals, unless otherwise specified. Foods include general foods, functional foods, nutritional compositions, and also therapeutic foods (those that serve the purpose of treatment; prepared based on a menu prepared by a nutritionist or the like in accordance with a doctor's dietary prescription), dietary therapy foods, ingredient-modified foods, nursing care foods, and foods for medical support, unless otherwise specified. Foods include not only solid foods but also liquid foods, such as beverages, energy drinks, liquid foods, and soups, unless otherwise specified. Functional foods refer to foods that can impart a specific functionality to the body, and include, for example, foods for specified health uses (including conditional FOSHUs [foods for specified health uses]), foods with functional claims, health functional foods including foods with nutrient function claims, foods for special dietary uses, dietary supplements, health supplements, supplements (e.g., tablets, coated tablets, sugar-coated tablets, enteric-coated preparations, enteric-coated preparation capsules (e.g., enteric-coated soft capsules, enteric-coated hard capsules, colon delivery capsules), liquid preparations, and various other dosage forms), dietary supplements, food supplements, medical foods (as defined by the U.S. Food and Drug Administration (FDA)), beauty foods (e.g., diet foods), and other health foods in general. Furthermore, in the present invention, "functional foods" also includes health foods to which a health claim based on the Codex Alimentarius (Joint FAO / WHO Food Standards Commission) is applied. A food supplement is a concentrated form of nutrients or other substances, either alone or in combination, that supplements the normal diet and has a nutritional or physiological effect, and is labeled as a food supplement. A dietary supplement is a product (other than tobacco) intended to supplement the diet, contains one or more of the ingredients in question, and is labeled as a dietary supplement.

[0073] (Route of Administration, etc.) The composition of the present invention may be administered orally, parenterally, for example, via a tube (gastrostomy, enterostomy), or nasally, but is preferably administered orally.

[0074] The composition can be administered to a subject repeatedly or continuously for a long period of time. The period is not particularly limited, but to ensure sufficient efficacy, it is preferable to administer the composition continuously for a relatively long period of time, for example, 3 days or more, 1 week or more, 2 weeks or more, 1 month or more, 3 months or more, 6 months or more, or 1 year or more.

[0075] The compositions may be administered routinely, proactively, such as when at high risk, or when the need arises. The compositions may be administered with a meal, before a meal, after a meal, between meals, or at the onset of the disease or condition that the composition is intended to ameliorate.

[0076] (Content and dosage of active ingredient) The content of lactic acid bacteria of the family Lactobacillaceae in the composition of the present invention may be any amount that achieves the desired effect. The content of lactic acid bacteria of the family Lactobacillaceae in the composition can be appropriately determined taking into account various factors such as the age, weight, and symptoms of the subject to be ingested or administered. One unit of the composition can be the amount ingested or administered per day or per administration (which may be administered or administered once a day, or multiple times a day, for example, three times a day).

[0077] In one embodiment, the content of lactic acid bacteria of the Lactobacillaceae family per unit of the composition is, for example, 1 x 10 ５ It can be 1×10 or more. ６ It can be 1×10 or more. ７ It can be 1×10 or more. ８ pcs or more, 5×10 ８ 5.7 x 10 pieces or more ８ pcs or more, 6×10 ８ 7×10 pieces or more ８ 8×10 pieces or more ８ 9×10 pieces or more ８ pcs or more, 1×10 ９ pcs or more, 5×10９ It may be 1×10 or more. １０ It is preferable that the number of particles is 1×10 or more. １１ More preferably, it is 2×10 １１ The upper limit can be set appropriately, and whatever the lower limit, for example, 1 × 10 １４ It may be 1×10 or less. １３ It may be 1×10 or less. １２ It may be less than one.

[0078] In one embodiment, the intake amount of lactic acid bacteria of the Lactobacillaceae family is 1×10 ５ It can be more than 1 x 10 ６ It can be more than 1 x 10 ７ It can be more than 1 x 10 ８ pcs / day or more, 5×10 ８ pcs / day or more, 5.7×10 ８ pcs / day or more, 6×10 ８ pcs / day or more, 7×10 ８ pcs / day or more, 8×10 ８ pcs / day or more, 9×10 ８ pcs / day or more, 1×10 ９ pcs / day or more, 5×10 ９ It may be 1 x 10 １０ It is preferable to have more than 1.3 × 10 １０ More preferably, it is 2 x 10 １０ pcs / day or more, 1×10 １１ pcs / day or more, 2×10 １１ The upper limit can be set appropriately, and whatever the lower limit, for example, 1 × 10 １４ It may be 1 x 10 １３ It may be 1 x 10 １２ It may be less than one per day.

[0079] In addition, commercially available yogurt contains 1 x 10 7 It may contain approximately 1 x 10 Lactobacillaceae bacteria per gram. 9It is estimated that it contains lactic acid bacteria of the Lactobacillaceae family.

[0080] Furthermore, when the content of Lactobacillaceae lactic acid bacteria is as described above, in any case, one unit can be, for example, 0.5 g or more, 1 g or more, 5 g or more, 10 g or more, 20 g or more, or 30 g or more. When the composition is in the form of a food such as fermented milk, one unit can be an amount that is easy to ingest as a food in one sitting, for example, 50 g or more, 60 g or more, 70 g or more, 80 g or more, 90 g or more, or 100 g or more. The upper limit can be set as appropriate, and in either case, the lower limit can be set to 500 g or less, 400 g or less, 300 g or less, 200 g or less, 150 g or less, or 125 g or less.

[0081] The composition contains lactic acid bacteria of the Lactobacillaceae family, which have a long history of consumption, as an active ingredient. Therefore, the composition of the present invention may be taken repeatedly or over a long period of time, for example, for 3 days or more, preferably 1 week or more, more preferably 15 days or more, and even more preferably 3 weeks or more, 4 weeks or more, or 1 month or more.

[0082] (Other Ingredients, Additives) In the present invention, the composition may contain other active ingredients or nutritional ingredients that are acceptable as foods or pharmaceuticals. Examples of such ingredients include lipids (e.g., milk fat, vegetable oil, medium-chain fatty acid-containing oil), proteins (e.g., milk protein, milk protein concentrate (MPC), whey protein concentrate (WPC), whey protein isolate (WPI), α-lactalbumin (α-La), β-lactoglobulin (β-Lg), heat-denatured whey protein, and enzyme-treated whey protein), amino acids (e.g., lysine, arginine, glycine, alanine, glutamic acid, leucine, isoleucine, valine), carbohydrates (glucose, lactic acid, niacin ... sugar, sucrose, fructose, maltose, trehalose, erythritol, maltitol, palatinose, xylitol, dextrin), electrolytes (e.g., sodium, potassium, calcium, magnesium), vitamins (e.g., vitamin A, vitamin B1, vitamin B2, vitamin B6, vitamin B12, vitamin C, vitamin D, vitamin E, vitamin K, biotin, folic acid, pantothenic acid, and nicotinic acids), minerals (e.g., copper, zinc, iron, cobalt, manganese), antibiotics, dietary fiber, etc.

[0083] In accordance with the present invention, the composition may or may not contain probiotics other than the active ingredient. In one embodiment, the composition does not contain Bifidobacterium bacteria.

[0084] In the present invention, the composition may contain a prebiotic other than the active ingredient. Prebiotics can be defined as indigestible food ingredients that have a beneficial effect on the host and improve the host's health by selectively altering the growth and activity of specific bacteria in the large intestine. The composition may contain one or more prebiotics other than the active ingredient.

[0085] The prebiotics other than the active ingredient are not particularly limited as long as they do not interfere with the effects of the active ingredient contained in the composition. Examples of prebiotics other than the active ingredient include galactooligosaccharides, fructooligosaccharides, xylooligosaccharides, isomaltooligosaccharides, raffinose, lactulose, lactosucrose, soybean oligosaccharides, coffee oligosaccharides, dietary fiber, and gluconic acid.

[0086] The composition may further contain additives acceptable for food or pharmaceutical use, such as inert carriers (solid or liquid carriers), excipients, surfactants, binders, disintegrants, lubricants, solubilizers, suspending agents, coating agents, colorants, preservatives, buffers, pH adjusters, emulsifiers, stabilizers, sweeteners, antioxidants, flavors, acidulants, and natural products. More specifically, examples of the additives include water, other aqueous solvents, pharmaceutically acceptable organic solvents, collagen, polyvinyl alcohol, polyvinylpyrrolidone, carboxyvinyl polymers, sodium alginate, dextrin, water-soluble dextran, water-soluble dextrin, corn starch, sodium carboxymethyl starch, pectin, xanthan gum, gum arabic, casein, gelatin, agar, glycerin, propylene glycol, polyethylene glycol, petrolatum, paraffin, stearyl alcohol, stearic acid, magnesium stearate, precipitated calcium carbonate, talc, human serum albumin, mannitol, sorbitol, lactose, sucralose, lactose hydrate, candy powder, white sugar, stevia, aspartame, acesulfame potassium, citric acid, lactic acid, malic acid, tartaric acid, phosphoric acid, acetic acid, fruit juice, and vegetable juice.

[0087] (Dosage Form / Form) The food composition of the present invention may be prepared in any form, such as a solid, liquid, mixture, suspension, powder, granules, paste, jelly, gel, or capsule. The food composition of the present invention may also be prepared in any form, such as a dairy product, supplement, confectionery, beverage, drink, seasoning, processed food, prepared dish, or soup. More specifically, the composition of the present invention may be in the form of a liquid diet, semi-liquid diet, jelly, gel, powder, infant formula, infant formula, liquid milk, powder or liquid milk for pregnant or nursing women, fermented milk, bar, mousse, chocolate, biscuit, ice cream, fermented milk, lactic acid bacteria drink, dairy drink, soft drink, tablet, cheese, bread, biscuit, cracker, pizza crust, food for the sick, nutritional food, frozen food, or processed food. It may also be in the form of a granule, powder, paste, or concentrated liquid for administration by mixing with beverages or foods. The granules and powder may be in the form of cubes or sticks (single-serving amounts packaged). In the present invention, modified powdered milk refers to raw milk, cow's milk, special cow's milk, or raw buffalo milk, or foods made from these as raw ingredients, processed or used as the main ingredient, to which nutrients necessary for infants have been added, and made into a powder, as defined in the Ministerial Ordinance on Milk, etc. In the present invention, modified liquid milk refers to raw milk, cow's milk, special cow's milk, or raw buffalo milk, or foods made from these as raw ingredients, processed or used as the main ingredient, to which nutrients necessary for infants have been added, and made into a liquid, as defined in the Ministerial Ordinance on Milk, etc.

[0088] Formulated powdered milk or formulated liquid milk (these are sometimes collectively referred to as formulae. In addition, formulae are sometimes explained using formulae as an example, but the explanation also applies to formulae liquid milk) can be for infants, follow-up (to supplement weaning food), low birth weight infants, children, adults, pregnant women, nursing women, the elderly, those with allergies, those with lactose intolerance, and those with inborn errors of metabolism. Preferred examples of formulae are those for infants, follow-up, low birth weight infants, and children.

[0089] The enteric coated formulation and pharmaceutical composition of the present invention can be made into any dosage form suitable for oral administration, such as solid formulations such as tablets, granules, powders, pills, and capsules; liquid formulations such as solutions, suspensions, and syrups; gels; and aerosols.

[0090] (Others) In producing the composition of the present invention, the stage at which the lactic acid bacteria of the Lactobacillaceae family are blended can be appropriately selected. The stage at which the lactic acid bacteria of the Lactobacillaceae family are blended is not particularly limited as long as the properties of the lactic acid bacteria of the Lactobacillaceae family are not significantly impaired.

[0091] For example, a composition can be produced as fermented milk containing a sufficient amount of Lactobacillaceae lactic acid bacteria by mixing milk, a dairy product, and water, homogenizing and sterilizing as necessary, inoculating with Lactobacillaceae lactic acid bacteria, and fermenting. The milk and dairy product used as raw materials can be appropriately selected depending on the Lactobacillaceae lactic acid bacteria used for fermentation. Alternatively, a composition can be produced by mixing milk, a dairy product, and water, homogenizing and sterilizing as necessary, inoculating with lactic acid bacteria necessary for fermentation (e.g., Lactobacillus delbrueckii ssp. bulgaricus and S. thermophilus), and adding Lactobacillaceae lactic acid bacteria capable of controlling bacteria belonging to the genus Fusobacterium simultaneously with or after fermentation.

[0092] In a preferred embodiment, the milk and dairy products include those derived from animals, and may exclude plant-based milks such as soy milk, almond milk, oat milk, coconut milk, rice milk, and hemp milk.

[0093] The compositions of the present invention may be labeled with the intended use (application) and may also be labeled to recommend administration to a particular subject.

[0094] The composition of the present invention may be labeled with its intended use (application), and in one embodiment, it may be labeled with a recommendation that the composition be administered to a specific subject. Examples of subjects to be labeled are as described above. In one embodiment, the composition of the present invention may be labeled with the function of the composition or active ingredient or a usage method based on that function. For example, it may be labeled with the following: the ability to control the growth of Fusobacterium bacteria in the intestinal tract; the ability to inhibit the growth of Fusobacterium bacteria in the intestinal tract; the ability to treat diseases or conditions that are improved by controlling (preferably inhibiting) the growth of Fusobacterium bacteria in the intestinal tract; the ability to use the composition as a probiotic; the ability to use the composition as a prebiotic; the ability to use the composition as a synbiotic (a combination of probiotics and prebiotics); or the ability to treat inflammatory bowel disease or colon cancer. Note that a term such as "temporary" or "long-term" may be added to the beginning of each statement, as appropriate.

[0095] Representation can be explicit or implicit. Examples of explicit representations are direct descriptions on tangible objects such as the product itself, packaging, containers, labels, tags, etc., while examples of implicit representations (which can also be called implied) include advertising and promotional activities by place or means such as websites, stores, pamphlets, exhibitions, seminars such as media seminars, books, newspapers, magazines, television, radio, mail, email, and audio.

[0096] In one embodiment, the recommendation to consume the composition is displayed personally. Such a display can be provided via a document (whether written or electronic) addressed to the subject, the subject's tablet, smartphone, personal computer, or social networking site. Furthermore, such a display can be provided together with the results of any test or analysis, such as a gut flora test, a fecal substance test, or a fecal metabolome analysis, for the subject. This can also be utilized in precision nutrition (individualized nutrition, which refers to proposing an appropriate diet (nutrition) tailored to an individual's constitution).

[0097] In one aspect, there is provided a method for controlling bacteria belonging to the genus Fusobacterium in the intestinal tract of a subject, or a method for reducing the risk of at least one of inflammatory bowel disease and colorectal cancer in a subject, the method comprising a step of having the subject ingest a composition containing bacteria belonging to the Lactobacillaceae family based on the presence or absence or amount of bacteria belonging to the genus Fusobacterium in the intestinal tract of the subject.In another aspect, there is provided a method for suggesting to a subject to ingest a composition containing bacteria belonging to the Lactobacillaceae family, a method for supporting a subject's dietary habits, or a method for supporting a subject's health, the method comprising a step of suggesting to a subject to ingest a composition containing bacteria belonging to the Lactobacillaceae family based on the presence or absence or amount of bacteria belonging to the genus Fusobacterium in the intestinal tract of the subject. These methods may include other steps, such as any of the following: collecting a fecal sample from a subject or having the subject collect a fecal sample; analyzing the fecal sample for the presence or amount of Fusobacterium bacteria; displaying the analysis results; determining whether it is desirable or necessary for the subject to reduce the number of Fusobacterium bacteria based on the analysis results; displaying the determination results; and displaying a product that is a composition containing bacteria belonging to the Lactobacillaceae family.

[0098] The present invention will be described in more detail below using examples, although the technical scope of the present invention is not limited to these examples.

[0099] Example 1: Test bacteria belonging to the genus Fusobacterium were cultured on an agar medium, and the formation of an inhibition circle was confirmed around a drop of culture solution of the test bacteria, a lactic acid bacterium of the family Lactobacillaceae. Specifically, a 0.1% culture solution of the test bacteria, Fusobacterium nucleatum JCM8532T, was poured onto GAM agar medium. After solidification, a circle of medium approximately 0.5 cm in diameter was removed, and 20 μL of the culture solution of the test bacteria was dropped onto the culture solution.

[0100] The test strain, Fusobacterium nucleatum JCM8532T, was prepared as follows: Frozen Fusobacterium nucleatum JCM8532T was suspended in GAM medium and cultured overnight at 37°C under anaerobic conditions. The culture was then suspended in fresh GAM medium to a final concentration of 1% and cultured overnight at 37°C under anaerobic conditions.

[0101] The test strains were prepared as follows: the frozen strains were suspended in MRS medium and cultured overnight at 37°C under anaerobic conditions. The culture was then suspended in fresh MRS medium to a final concentration of 1% and cultured overnight at 37°C under anaerobic conditions.

[0102] As a result, the strains in the table below formed an inhibition zone as shown in Figure 1. These results suggest that lactic acid bacteria of the Lactobacillaceae family may inhibit the growth of Fusobacterium. Three strains of Streptococcus thermophilus were similarly evaluated, but no inhibition zone was observed in any of them.

[0103] The genera and species listed in the table below are names based on the classification of the 16S rRNA gene. The genera and species in parentheses are the names of the genus before reclassification according to Zheng J, Wittouck S, Salvetti E, Franz CMAP, Harris HMB, Mattarelli P, O'Toole PW, Pot B, Vandamme P, Walter J, Watanabe K, Wuyts S, Felis GE, Ganzle MG, Lebeer S.: A taxonomic note on the genus Lactobacillus: Description of 23 novel genera, emended description of the genus Lactobacillus Beijerinck 1901, and union of Lactobacillaceae and Leuconostocaceae. Int J Syst Evol Microbiol. 2020 Apr; 70(4): 2782-2858. In addition, the genus / species column lists two species side by side (e.g., Lactobacillus gasseri / paragasseri) to indicate that they are closely related species and cannot be distinguished by conventional 16S rRNA gene classification (i.e., they have not been distinguished by other classification methods) (Adriana Ene et al. Genomic insights into Lactobacillus gasseri and Lactobacillus paragasseri. PeerJ. 2022 10: e13479. doi: 10.7717 / peerj.13479).

[0104]

[0105] [Example 2] Next, feces were cultured in a medium containing the test bacteria, lactic acid bacteria of the Lactobacillaceae family, and the number of Fusobacterium bacteria was quantified to confirm that the number of Fusobacterium bacteria was reduced by the lactic acid bacteria of the Lactobacillaceae family. Specifically, the fecal suspension was added to GAM medium containing 0.2% culture solution of the test bacteria, lactic acid bacteria of the Lactobacillaceae family, and cultured at 37°C under anaerobic conditions for 24 hours. DNA was then extracted from each culture solution using a Maxwell® RSC Instrument (Promega Corporation).

[0106] The bacterial count was measured as follows. Quantitative PCR was performed on DNA extracted from the culture medium in which the number of Fusobacterium bacteria had been measured in advance, and a standard curve was created. Quantitative PCR was performed on the DNA obtained above, and the number of Fusobacterium bacteria was calculated based on the standard curve. The results were then corrected to the number of bacteria per mL of culture medium. The primer sequences used for quantitative PCR are shown in the table below. DNA extracted from Fusobacterium nucleatum subsp. nucleatum JCM 8532T (type species of Fusobacterium bacteria) was used as the standard.

[0107]

[0108] The test strains were prepared as follows: the frozen strains were suspended in MRS medium and cultured overnight at 37°C under anaerobic conditions. The culture was then suspended in fresh MRS medium to a final concentration of 1% and cultured overnight at 37°C under anaerobic conditions.

[0109] As a result, the number of Fusobacterium bacteria was reduced in the cultures containing the strains shown in the table below compared to the control (MRS medium containing no lactic acid bacteria) (Figure 2). These results suggest that lactic acid bacteria of the Lactobacillaceae family may reduce the number of Fusobacterium bacteria.

[0110] The genera and species listed in the table below are names based on the classification of the 16S rRNA gene. The genera and species in parentheses are the names of the genus before reclassification according to Zheng J, Wittouck S, Salvetti E, Franz CMAP, Harris HMB, Mattarelli P, O'Toole PW, Pot B, Vandamme P, Walter J, Watanabe K, Wuyts S, Felis GE, Ganzle MG, Lebeer S.: A taxonomic note on the genus Lactobacillus: Description of 23 novel genera, emended description of the genus Lactobacillus Beijerinck 1901, and union of Lactobacillaceae and Leuconostocaceae. Int J Syst Evol Microbiol. 2020 Apr; 70(4): 2782-2858. In addition, the genus / species column listing two species side by side (for example, Lactobacillus gasseri / paragasseri) indicates that they are closely related species and cannot be distinguished by the standard classification method of the 16S rRNA gene (they have not been distinguished by other classification methods).

[0111]

[0112] [Example 3] Feces were cultured in a medium containing the test bacteria, lactic acid bacteria of the Lactobacillaceae family, and the number of Fusobacterium bacteria was quantified to confirm that the number of Fusobacterium bacteria was reduced by the lactic acid bacteria of the Lactobacillaceae family. Specifically, a fecal suspension was added to GAM medium containing 0.2% culture solution of the test bacteria, lactic acid bacteria of the Lactobacillaceae family, and cultured at 37°C under anaerobic conditions for 24 hours. DNA extraction and qPCR were then performed as described above.

[0113] The test strains were prepared as follows: the frozen strains were suspended in MRS medium and cultured overnight at 37°C under anaerobic conditions. The culture was then suspended in fresh MRS medium to a final concentration of 1% and cultured overnight at 37°C under anaerobic conditions.

[0114] As a result, the number of Fusobacterium bacteria was reduced in the cultures containing the strains shown in the table below compared to the control (Figure 3). These results suggest that Lactobacillaceae lactic acid bacteria may reduce the number of Fusobacterium bacteria.

[0115]

[0116] [Discussion] Thus, it can be said that lactic acid bacteria of the Lactobacillaceae family can be used to control Fusobacterium bacteria, particularly to reduce the number of Fusobacterium bacteria in the intestinal flora. Fusobacterium bacteria have recently been suggested to be involved in colorectal cancer (e.g., Non-Patent Document 1), and F. nucleatum has been isolated from gastrointestinal infections such as appendicitis (Non-Patent Document 2), and recently has also been suggested to be associated with inflammatory bowel disease (Non-Patent Documents 3, 4, 5). Therefore, it can be said that lactic acid bacteria of the Lactobacillaceae family can be used to treat these diseases, particularly as a preventative measure for those at high risk of these diseases.

[0117] [Production Example 1: Fermented Milk] A yogurt base mix is ​​prepared by mixing milk, a dairy product (derived from milk), and water so that the final product has a non-fat milk solids content of 9.5% and a milk fat content of 3.0%. The prepared yogurt base mix is ​​homogenized, sterilized by heating at 95°C for 5 minutes, and then cooled to approximately 40°C. This sterilized yogurt base mix is ​​inoculated with lactic acid bacteria of the Lactobacillaceae family (one or more strains can be selected from the strains listed in the table of Example 3) to obtain a fermented milk product containing 5 x 10 lactic acid bacteria of the Lactobacillaceae family per 100g. 9 The yogurt is fermented until the number of Fusobacterium species reaches 100 or more, thereby producing yogurt for controlling Fusobacterium species in the intestinal flora.

[0118] [Production Example 2: Health Food] Lactobacillaceae lactic acid bacteria are cultured in a skim milk powder medium until the late logarithmic growth phase, and the culture solution is concentrated 25 times and heated at 60°C for 10 minutes. The resulting concentrated heated bacterial solution is spray-dried to form a powder, and then blended with dextrin at a 3.9% addition rate and mixed until completely uniform. This mixture is packed into sticks at 1g per packet to produce a health food for controlling Fusobacterium bacteria in the intestinal flora. The number of Lactobacillaceae lactic acid bacteria per 1g is 2 x 10 10 There are more than one.

[0119] [Production Example 3: Capsules] Lactobacillaceae lactic acid bacteria are cultured in a skim milk powder medium until the late logarithmic growth phase, and the culture solution is concentrated 25-fold and heated at 60°C for 10 minutes. The resulting concentrated, heated bacterial solution is spray-dried to powder, and then blended with dextrin at a 3.9% addition rate and mixed until completely uniform. This mixture is filled into 200 mg enteric-coated soft capsules to produce a health food for controlling Fusobacterium bacteria in the intestinal flora, or a pharmaceutical for intestinal disorders, intestinal regulation (regulating bowel movements), or for the treatment of loose stools, constipation, and abdominal bloating. The number of Lactobacillaceae lactic acid bacteria in 200 mg is 5 x 10 9 There are more than one.

[0120] [Production Example 4: Enteric-coated supplement (tablets)] A powder mixture of raw materials containing Lactobacillaceae lactic acid bacteria cells is tableted and coated to obtain tablets containing 100 to 400 mg of Lactobacillaceae lactic acid bacteria per tablet. The additives other than the Lactobacillaceae lactic acid bacteria are corn starch, dextrin, lactose hydrate, precipitated calcium carbonate, candy powder, white sugar, talc, and magnesium stearate.

[0121] [Manufacturing Example 5: Enteric-Release Supplement (Capsule)] Pulsincaps (registered trademark, Scherer DDS, Ltd.), which are designed to release their contents approximately 8 hours after contact with the contents of the gastrointestinal tract, are filled with 100 to 400 mg of lactic acid bacteria of the Lactobacillaceae family per capsule.

[0122] The present invention supports the maintenance and improvement of people's health by providing a composition for controlling Fusobacterium bacteria. The present invention also provides a food composition and a method for producing food that support the maintenance and improvement of people's health. Furthermore, the present invention can improve the nutrition of various people, ensure healthy lifestyles, and promote welfare.

[0123] [Sequences listed in the sequence listing] SEQ ID NO: 1 Lactobacillus delbrueckii OLL204989, NITE BP-028741 16S rRNA gene SEQ ID NO: 2 Lactobacillus paragasseri OLL2716, FERM BP-6999 16S rRNA gene SEQ ID NO: 3 Lactobacillus fermentum OLL203697, FERM BP-11433 16S rRNA gene SEQ ID NO: 4 Lactiplantibacillus plantarum OLL2712, FERM BP-11262 16S rRNA gene SEQ ID NO: 5 Lactobacillus delbrueckii subsp. bulgaricus OLL1073R-1, FERM BP-1074116S rRNA gene SEQ ID NO: 6 Lactobacillus delbrueckii ssp. bulgaricus 2038 16S rRNA gene SEQ ID NO: 7 PCR Forward primer SEQ ID NO: 8 PCR Reverse primer

Claims

1. A composition for controlling bacteria belonging to the genus Fusobacterium in the intestinal flora, including bacteria belonging to the family Lactobacillaceae.

2. The composition according to claim 1, wherein the bacterium belonging to the genus Fusobacterium is Fusobacterium nucleatum.

3. The composition according to claim 1, wherein the bacteria belonging to the Lactobacillaceae family include bacteria belonging to any genus selected from the group consisting of the genera Lactobacillus, Levilactobacillus, Limosilactobacillus, Ligilactobacillus, Lacticaseibacillus, and Lactiplantibacillus.

4. Bacteria belonging to the Lactobacillaceae family include Lactobacillus acidophilus, Lactobacillus amylovorus, Levilactobacillus brevis, Lactobacillus crispatus, Lactobacillus delbrueckii subsp. lactis, Limosilactobacillus fermentum, Lactobacillus gasseri, Lactobacillus paragasseri, Ligilactobacillus murinus, and Ligilactobacillus animalis.

2. The composition of claim 1, comprising any one selected from the group consisting of Lacticaseibacillus paracasei, Lactiplantibacillus plantarum, Limosilactobacillus reuteri, Lacticaseibacillus rhamnosus, and Ligilactobacillus salivarius.

5. The composition according to claim 1, wherein the bacterium belonging to the family Lactobacillaceae comprises any one selected from the group consisting of the following strains and strains taxonomically equivalent thereto: Lactobacillus acidophilus JCM 1132T, Lactobacillus amylovorus JCM 1126T, Levilactobacillus brevis JCM 1059T, Lactobacillus crispatus JCM 1185T, Lactobacillus delbrueckii NITE BP-02874, Lactobacillus delbrueckii subsp. lactis JCM 1248T, Limosilactobacillus fermentum FERM BP-11433, Lactobacillus gasseri JCM 1131T, Lactobacillus paragasseri FERM BP-6999, NITE BP-72, NITE BP-224, and JCM 5343T, Ligilactobacillus murinus JCM 1717T, Ligilactobacillus animalis JCM 5670T, Lacticaseibacillus paracasei NBRC 15889T, Lactiplantibacillus plantarum FERM BP-11262, Limosilactobacillus reuteri JCM 1112T, Lacticaseibacillus rhamnosus NITE P-313, and JCM 1136T, and Ligilactobacillus salivarius JCM 1231T.

6. The composition according to claim 1, wherein the bacterium belonging to the Lactobacillaceae family includes Lactobacillus delbrueckii subsp. bulgaricus.

7. The composition according to claim 1, wherein the bacterium belonging to the family Lactobacillaceae includes any one selected from the group consisting of the following strains and taxonomically equivalent strains thereto: Lactobacillus delbrueckii subsp. bulgaricus FERM BP-10741 and Lactobacillus delbrueckii subsp. bulgaricus 2038.

8. The composition according to claim 1, wherein the control of bacteria belonging to the genus Fusobacterium is a reduction in the number of bacteria belonging to the genus Fusobacterium.

9. A composition according to any one of claims 1 to 8 for use as any one selected from the group consisting of probiotics, prebiotics and synbiotics.

10. A composition according to any one of claims 1 to 8 for treating at least one of inflammatory bowel disease and colon cancer via control of bacteria belonging to the genus Fusobacterium.

11. A composition described in any one of claims 1 to 8 for treating at least one of inflammatory bowel disease and colon cancer in a subject in which Fusobacterium genus has been detected in the intestinal tract and / or feces.

12. A pharmaceutical composition comprising a bacterium belonging to the family Lactobacillaceae.

13. A pharmaceutical composition according to claim 12 for use in treating intestinal diseases.

14. An enteric preparation containing bacteria belonging to the family Lactobacillaceae.

Images