Feed for eel using schizochytrium sp. microalgae and manufacturing method therefor

Abstract

The present invention relates to a feed composition for eels, the composition comprising Schizochytrium sp. microalgae-derived biomass, and a method for culturing eels using same. When the eel feed composition containing the Schizochytrium sp. microalgae-derived biomass is supplied to the eel, growth of the eel is promoted, and thus the biomass can be advantageously used as a feed composition or a feed additive for eels.

Description

Eel feed using microalgae of the genus Schizochytrium and its manufacturing method

[0001] Cross-citation with related application(s)

[0002] This disclosure claims the benefit of priority to Republic of Korea Patent Application No. 10-2023-0086717, dated July 4, 2023, the entire contents of which are incorporated herein by reference.

[0003] Numerous papers and patents are referenced and cited throughout this disclosure. The disclosures of these cited papers and patents are incorporated herein by reference in their entirety to provide a clearer understanding of the state of the art and the scope of the present invention.

[0004] The present application relates to a feed composition for eel using microalgae of the genus Schizochytrium and a method for producing the same.

[0005]

[0006] With global population growth and stagnant or even declining grain and fishery production, concerns about future food security persist, and many scientists believe that the aquaculture industry holds the unique potential to address these challenges. Global farmed fish production, which began at 2.4 million tons half a century ago, will reach 87.5 million tons in 2020, accounting for 49% of total aquaculture production. Feed consumption of marine fish and crustaceans is experiencing rapid growth (FAO 2022), and this growth is projected to continue. Today, aquaculture feed nutrition is one of the key factors in the success of the aquaculture industry. It is well known that the aquaculture industry must first select key aquaculture species, develop seed production technology, and then support their management with high-quality feed. The importance of feed nutrition is evident in the fact that feed costs, which vary by species, account for 30-60% of aquaculture production costs.

[0007] Feed utilization varies depending on the protein source. Fishmeal is made by drying and powdering fish waste or fish scraps left over after extracting fish oil from fish. It has long been used as the main protein source in aquaculture feed due to its high protein content, excellent amino acid composition, and high palatability. However, due to the recent rapid decline in production, supply is unstable and prices are skyrocketing, making it the largest portion of the cost of purchasing feed ingredients. The catch of various bycatch fish used to make fishmeal is rapidly decreasing due to overfishing and marine environmental problems, and its production is predicted to continue to decline until 2030. For this reason, much research is being conducted to find inexpensive, high-quality alternative protein sources that can replace fishmeal in aquaculture feed.

[0008]

[0009] [Prior Art Literature]

[0010] [Patent Document]

[0011] (Patent Document 01) Republic of Korea Publication Patent No. 10-2011-0026232

[0012]

[0013] The present inventors have conducted extensive research to develop a fish farming feed utilizing microalgae. As a result, they have discovered that a feed composition containing biomass derived from Schizochytrium sp. microalgae promotes eel growth, thereby completing the present invention.

[0014] Accordingly, the purpose of the present application is to provide a feed composition for eel comprising biomass derived from microalgae of the genus Schizochytrium sp.

[0015] Another object of the present application is to provide a method for cultivating eels, and / or a method for promoting the growth of eels, comprising a step of feeding eels a feed composition for eels containing biomass derived from the microalgae of the genus Schizochytrium described above.

[0016]

[0017] According to one aspect of the present application, the present application provides a feed composition for eel comprising a biomass derived from microalgae of the genus Schizochytrium sp.; and / or a use of the microalgae-derived biomass and / or the eel feed composition for promoting eel growth.

[0018]

[0019] Microalgae of the genus Schizochytrium (Schizochytrium sp.)

[0020] In this specification, the term “microalgae” refers to organisms that are not easily visible to the naked eye but can be seen through a microscope and live freely floating in water, and are also called phytoplankton. There are various types of microalgae, and even strains that are unable to photosynthesize and grow only through heterotrophy. The term “microalgae” may be used interchangeably with “strain” in this specification.

[0021] In this specification, the term “Schizochytrium sp.” is one of the genera belonging to the family Thraustochytriaceae of the order Thraustochytriales, and may be used interchangeably with the term “genus Schizochytrium.”

[0022] In the present specification, microalgae of the genus Schizochytrium refers to microorganisms belonging to the family of Thraustochytriaceae, and may be at least one species selected from the group consisting of Schizochytrium aggregatum, Schizochytrium limacinum, and Schizochytrium minutum, but is not limited thereto.

[0023] In one example, the microalgae in the genus Schizochytrium may be Schizochytrium limacinum.

[0024] In one example, the microalgae of the genus Schizochytrium may be Schizochytrium aggregatum.

[0025] In one example, the microalgae of the genus Schizochytrium may be Schizochytrium minutum.

[0026] In one embodiment of the present invention, the above-described Schizochytrium strain may be, but is not limited to, CD03-7004 strain (accession number KCTC15006BP).

[0027] The present inventors irradiated a wild-type Schizochytrium sp. CD01-5000 strain (accession number KCTC 14344BP) with gamma rays to induce a mutation, selected a strain among the mutant strains having antioxidant pigment production ability, and named it Schizochytrium sp. CD03-7004. The strain was deposited with the Korean Collection for Type Cultures (KCTC), an international depository under the Budapest Treaty, on June 20, 2022, and assigned the accession number KCTC15006BP.

[0028]

[0029] Biomass derived from microalgae of the genus Schizochytrium (Schizochytrium sp.)

[0030] As used herein, the term "biomass" refers to living organisms such as plants, animals, and microorganisms that can be used as chemical energy, i.e., the energy source of bioenergy. Ecologically, it also refers to the weight or energy content of a specific organism existing within a unit of time and space. Furthermore, the biomass may include, but is not limited to, compounds secreted by cells, and may contain cells and / or intracellular contents as well as extracellular substances.

[0031] In the present specification, the microalgae-derived biomass may include the microalgae itself, a culture thereof, a fermentation thereof, a dried product thereof, a crushed product thereof, or a product produced by culturing or fermenting the microalgae, or may include a concentrate or dried product of the biomass, but is not limited thereto. In one embodiment, the microalgae-derived biomass may include at least one selected from the group consisting of microalgae, a culture of the microalgae, a dried product of the culture, and a crushed product of the dried product. Drying may be performed by, but is not limited to, spray drying, hot air drying, freeze drying, natural drying, or vacuum drying.

[0032] The "culture" of the above microalgae refers to a product produced by culturing the microalgae, and may specifically be a culture solution containing microalgae or a culture filtrate from which the microalgae have been removed, but is not limited thereto. The "dry product" of the microalgae culture refers to the microalgae culture from which moisture has been removed, and may be, for example, in the form of dried microalgae cells, but is not limited thereto. In addition, the "crushed product" of the dried product refers to a general term for the result of crushing the dried product from which moisture has been removed from the microalgae culture, and may be, for example, in the form of dried microalgae cell powder, but is not limited thereto. The culture of the microalgae can be produced by inoculating the microalgae into a microalgae culture medium and according to a culturing method known in the art, and the dried product of the culture and the crushed product thereof can also be produced according to a method for treating or drying microalgae or a culture solution known in the art.

[0033] In one embodiment, the above-described microalgae-derived biomass may contain 40 wt% to 95 wt% of protein (crude protein), and more specifically, 40 wt% to 95 wt%, 40 wt% to 90 wt%, 40 wt% to 85 wt%, 40 wt% to 82.5 wt%, 40 wt% to 81.5 wt%, 40 wt% to 80.5 wt%, 50 wt% to 95 wt%, 50 wt% to 90 wt%, 50 wt% to 85 wt%, 50 wt% to 82.5 wt%, 50 wt% to 81.5 wt%, 50 wt% to 80.5 wt%, 60 wt% to 95 wt%, 60 wt% to 90 wt%, 60 wt% to 85 wt%, 60 wt% 82.5 wt%, 60 wt% to 81.5 wt%, 60 wt% to 80.5 wt%, 70 wt% to 95 wt%, 70 wt% to 90 wt%, 70 wt% to 85 wt%, 70 wt% to 82.5 wt%, 70 wt% to 81.5 wt%, 70 wt% to 80.5 wt%, 75 wt% to 95 wt%, 75 wt% to 90 wt%, 75 wt% to 85 wt%, 75 wt% to 82.5 wt%, 75 wt% to 81.5 wt%, 75 wt% to 80.5 wt%, 77.5 wt% to 95 wt%, 77.5 wt% to 90 wt%, 77.5 wt% to 85 wt%, 77.5 wt% to It may comprise, but is not limited to, 82.5 wt%, 77.5 wt% to 81.5 wt%, 77.5 wt% to 80.5 wt%, 79.5 wt% to 95 wt%, 79.5 wt% to 90 wt%, 79.5 wt% to 85 wt%, 79.5 wt% to 82.5 wt%, 79.5 wt% to 81.5 wt%, or 79.5 wt% to 80.5 wt%.

[0034] In one embodiment, the above-described microalgae-derived biomass may contain 3 wt% to 30 wt% of fat (crude lipids), and more specifically, 3 wt% to 30 wt%, 3 wt% to 20 wt%, 3 wt% to 15 wt%, 3 wt% to 13 wt%, 3 wt% to 12 wt%, 6 wt% to 30 wt%, 6 wt% to 20 wt%, 6 wt% to 15 wt%, 6 wt% to 16 wt%, 6 wt% to 12 wt%, 9 wt% to 30 wt%, 9 wt% to 20 wt%, 9 wt% to 15 wt%, 9 wt% to 16 wt%, 9 wt% to 12 wt%, 10 wt% to 30 wt%, 10 wt% to 20 wt%, 10 wt% to 15 It may include, but is not limited to, 10 wt% to 16 wt%, 10 wt% to 12 wt%, 11 wt% to 30 wt%, 11 wt% to 20 wt%, 11 wt% to 15 wt%, 11 wt% to 16 wt%, or 11 wt% to 12 wt%.

[0035] In one embodiment, the microalgae-derived biomass described above may contain moisture in an amount of 0.05 wt% to 5 wt%, and more specifically, 0.05 wt% to 5 wt%, 0.05 wt% to 3 wt%, 0.05 wt% to 1.75 wt%, 0.05 wt% to 1.5 wt%, 0.05 wt% to 1 wt%, 0.05 wt% to 0.7 wt%, 0.1 wt% to 5 wt%, 0.1 wt% to 3 wt%, 0.1 wt% to 1.75 wt%, 0.1 wt% to 1.5 wt%, 0.1 wt% to 1 wt%, 0.1 wt% to 0.7 wt%, 0.5 wt% to 5 wt%, 0.5 wt% to 3 wt%, 0.5 wt% to 1.75 It may include, but is not limited to, 0.5 wt% to 1.5 wt%, 0.5 wt% to 1 wt%, 0.5 wt% to 0.7 wt%, 0.6 wt% to 5 wt%, 0.6 wt% to 3 wt%, 0.6 wt% to 1.75 wt%, 0.6 wt% to 1.5 wt%, 0.6 wt% to 1 wt%, 0.6 wt% to 0.7 wt%.

[0036] In this specification, ash may refer to the ash produced by burning a sample or the total amount of inorganic substances contained in the sample. Ash may be used interchangeably with terms such as mineral, inorganic substance, inorganic salt, and mineral, and may include one or more inorganic elements selected from the group consisting of calcium, phosphorus, potassium, sulfur, sodium, chlorine, magnesium, iron, copper, manganese, iodine, cobalt, zinc, molybdenum, selenium, chromium, fluorine, boron, arsenic, tin, silicon, vanadium, and nickel.

[0037] In one embodiment, the microalgae-derived biomass described above may contain ash in an amount of 2.5 wt% to 20 wt%, and more specifically, 2.5 wt% to 20 wt%, 2.5 wt% to 15 wt%, 2.5 wt% to 13.5 wt%, 2.5 wt% to 12.5 wt%, 2.5 wt% to 10 wt%, 2.5 wt% to 8 wt%, 2.5 wt% to 7.5 wt%, 5 wt% to 20 wt%, 5 wt% to 15 wt%, 5 wt% to 13.5 wt%, 5 wt% to 12.5 wt%, 5 wt% to 10 wt%, 5 wt% to 8 wt%, 5 wt% to 7.5 wt%, 7 wt% to 20 wt%, 7 wt% to 15 wt%, 7 It may include, but is not limited to, from 7 wt% to 13.5 wt%, from 7 wt% to 12.5 wt%, from 7 wt% to 10 wt%, from 7 wt% to 8 wt%, or from 7 wt% to 7.5 wt%.

[0038] In one embodiment, the above-described microalgae-derived biomass may contain 30 to 70 parts by weight of glutamic acid based on 100 parts by weight of total amino acids, and more specifically, 30 to 70 parts by weight, 30 to 60 parts by weight, 30 to 57 parts by weight, 30 to 54 parts by weight, 45 to 70 parts by weight, 45 to 60 parts by weight, 45 to 57 parts by weight, 45 to 54 parts by weight, 50 to 70 parts by weight, 50 to 60 parts by weight, 50 to 57 parts by weight, 50 to 54 parts by weight, 53 to 70 parts by weight, 53 to 60 parts by weight, 53 to 57 parts by weight, or 53 parts by weight. It may contain, but is not limited to, 54 parts by weight.

[0039] In one embodiment, the microalgae-derived biomass described above may contain 7 to 25 parts by weight of arginine based on 100 parts by weight of total amino acids, and more specifically, may contain 7 to 25 parts by weight, 7 to 20 parts by weight, 7 to 15 parts by weight, 7 to 13 parts by weight, 10 to 25 parts by weight, 10 to 20 parts by weight, 10 to 15 parts by weight, 10 to 13 parts by weight, 12 to 25 parts by weight, 12 to 20 parts by weight, 12 to 15 parts by weight, or 12 to 13 parts by weight, but is not limited thereto.

[0040] In one embodiment, the microalgae-derived biomass described above may contain 20 parts by weight to 50 parts by weight of palmitic acid based on 100 parts by weight of total fatty acids, and more specifically, may contain 20 parts by weight to 50 parts by weight, 20 parts by weight to 40 parts by weight, 20 parts by weight to 37 parts by weight, 30 parts by weight to 50 parts by weight, 30 parts by weight to 40 parts by weight, 30 parts by weight to 37 parts by weight, 36 parts by weight to 50 parts by weight, 36 parts by weight to 40 parts by weight, or 36 parts by weight to 37 parts by weight, but is not limited thereto.

[0041] In this specification, the term “palmitic acid” refers to CH3(CH2) 14 One of the saturated fatty acids with the chemical formula COOH, it is also called hexadecanoic acid and can be abbreviated as C16:0.

[0042] In one embodiment, the microalgae-derived biomass described above may contain 30 parts by weight to 60 parts by weight of docosahexaenoic acid ((4Z,7Z,10Z,13Z,16Z,19Z)-Docosa-4,7,10,13,16,19-hexaenoic acid, DHA) based on 100 parts by weight of total fatty acids, and more specifically, may contain 30 parts by weight to 60 parts by weight, 30 parts by weight to 50 parts by weight, 30 parts by weight to 46 parts by weight, 40 parts by weight to 60 parts by weight, 40 parts by weight to 50 parts by weight, 40 parts by weight to 46 parts by weight, 45 parts by weight to 60 parts by weight, 45 parts by weight to 50 parts by weight, or 45 parts by weight to 46 parts by weight, but is not limited thereto.

[0043] In this specification, the term “docosahexaenoic acid ((4Z,7Z,10Z,13Z,16Z,19Z)-Docosa-4,7,10,13,16,19-hexaenoic acid, DHA)” refers to C 22 H 32 It is one of the polyunsaturated fatty acids with the chemical formula O2, and is an omega-3 fatty acid along with alpha-linolenic acid (ALA) and eicosapentaenoic acid (EPA). Its common name is cervonic acid, and it can also be abbreviated as C22:6n3. Since docosahexaenoic acid cannot be produced in fish, it must be consumed through food, and it is known as an essential fatty acid that plays an important role in the metabolism and cell function of fish.

[0044]

[0045] Feed composition

[0046] As used herein, the term "feed composition" may mean something that provides nutrition to animals (including unicellular or multicellular heterotrophic organisms such as zooplankton, livestock, and fish) or is necessary for maintaining their health or growth. The feed composition may be a single feed, a compound feed, or a supplementary feed. The single feed may mean a plant-based, animal-based, or mineral substance that is used directly as feed or as a raw material for a compound feed. The supplementary feed may mean something added to feed to prevent deterioration in the quality of the feed or to increase the utility of the feed. The compound feed may be a product obtained by mixing or processing single feed, supplementary feed, etc. in an appropriate ratio.

[0047] The above feed composition may refer to a substance that supplies organic or inorganic nutrients necessary for sustaining the life of an animal or producing meat, milk, etc. The feed composition may additionally contain nutrients necessary for sustaining the life of an animal or producing meat, milk, etc. The feed composition may be manufactured into various types of feed known in the art, and specifically may include concentrate feed, forage, and / or special feed. Alternatively, the feed composition may be manufactured in the form of compound feed (Extruded pellet, EP feed, dry feed), raw feed (Moist pellet, MP feed, wet feed), dough feed, etc.

[0048] In this specification, feed additives may include substances added to feed for various purposes such as nutrient supplementation and weight loss prevention, increasing the digestibility and availability of fiber in feed, improving milk quality, preventing reproductive disorders and improving conception rates, and preventing summer heat stress. The feed additives may refer to supplementary feeds under the Feed Management Act, and may further include mineral preparations such as sodium bicarbonate, bentonite, magnesium oxide, and complex minerals; mineral preparations that are trace minerals such as zinc, copper, cobalt, and selenium; vitamins such as carotene, vitamin E, vitamins A, D, E, nicotinic acid, and vitamin B complex; protected amino acids such as methionine and lysine; protected fatty acids such as fatty acid calcium salts; probiotics (lactic acid bacteria), yeast cultures, and mold fermentations; and yeast agents.

[0049] In this specification, the term “feed composition” may be interpreted to encompass “feed additive”.

[0050] The feed composition may further include grains, such as ground or shredded wheat, oats, barley, corn and rice; plant-based protein feeds, such as feeds mainly composed of soybeans and sunflower; animal-based protein feeds, such as fish meal, blood meal, meat meal and / or bone meal; dry ingredients composed of sugars and dairy products, such as various types of milk powder and whey powder, and may further include nutritional supplements, digestion and absorption enhancers, growth promoters and the like.

[0051] The feed composition may be administered to animals alone or in combination with other feed additives in an edible carrier. Furthermore, the feed composition may be readily administered to animals as a top dressing, by mixing it directly into feed, or in an oral formulation separate from the feed. When administered separately from feed, the composition may be prepared as an immediate-release or sustained-release formulation by combining it with an edible carrier acceptable in the feed industry, as is well known in the art. The edible carrier may be a solid or liquid, such as corn starch, lactose, sucrose, soybean flakes, peanut oil, olive oil, sesame oil, or propylene glycol. When a solid carrier is used, the feed composition may be in the form of a tablet, capsule, powder, troche, or saccharide tablet, or a top dressing in the form of a microdispersible. When a liquid carrier is used, the feed composition may be in the form of a gelatin soft capsule, or a syrup, suspension, emulsion, or solution.

[0052] The feed composition may include, for example, a preservative, a stabilizer, a wetting or emulsifying agent, a cryoprotectant, or an excipient. The cryoprotectant may be at least one selected from the group consisting of glycerol, trehalose, maltodextrin, skimmed milk powder, and starch. The preservative, stabilizer, or excipient may be included in the composition in an effective amount sufficient to reduce deterioration of the microalgae included in the feed composition. In addition, the cryoprotectant may be included in the composition in an effective amount sufficient to reduce deterioration of the microalgae included in the composition when the composition is in a dried state.

[0053] The above feed composition can be used by adding it to animal feed by immersion, spraying, or mixing.

[0054] The feed composition can be applied to a number of animal diets, including but not limited to mammals, birds, fish, crustaceans, cephalopods, reptiles, and amphibians. For example, the mammals can include pigs, cattle, sheep, goats, laboratory rodents, or pets, and the birds can include poultry, including but not limited to chickens, turkeys, ducks, geese, pheasants, or quail. The crustaceans can include but are not limited to shrimp, barnacles, and the like. In addition, the feed composition can also be applied to a diet of zooplankton, such as rotifers, artemia, daphnia pulex, and the like. In addition, the fish can include freshwater fish, saltwater fish, commercially farmed fish and their fry, ornamental fish, and the like.

[0055]

[0056] Feed composition for eel

[0057] One example of the present application provides a feed composition for eel, comprising biomass derived from the above-described microalgae of the genus Schizochytrium (Schizochytrium sp.).

[0058] The above Schizochytrium sp. microalgae, the microalgae-derived biomass and the feed composition are as described above.

[0059] In this specification, the term “eel” refers to a fish belonging to the genus Eel of the family Eelidae, and may be used interchangeably with “freshwater eel” or “eel”. In one embodiment, the eel may be at least one species selected from the group consisting of Japanese eel (Anguilla japonica), large eel (Anguilla marmorata), European eel (Anguilla anguilla), American eel (Anguilla rostrata), and bicolor eel (Anguilla bicolor), and more specifically, may be Japanese eel (Anguilla japonica), but is not limited thereto.

[0060] As demonstrated in the examples described below, the feed composition comprising the above-described microalgae biomass can promote the growth of eels.

[0061] In one embodiment, the eel feed composition of the present application may comprise 2.25 wt% to 45 wt% of the above-described microalgae-derived biomass, more specifically, 2.25 wt% to 45 wt%, 2.25 wt% to 30 wt%, 2.25 wt% to 25 wt%, 2.25 wt% to 22.5 wt%, 2.25 wt% to 20 wt%, 2.25 wt% to 17.5 wt%, 2.25 wt% to 15 wt%, 2.25 wt% to 13.3 wt%, 2.25 wt% to 12 wt%, 2.25 wt% to 10 wt%, 2.25 wt% to 8 wt%, 2.25 wt% to 7.5 wt%, 2.25 wt% to 7 wt%, 2.25 wt% to 6.6 wt%, 2.25 wt% to 6.5 wt%, 2.25 wt% to 6 wt%, 2.25 wt% to 5 wt%, 2.25 wt% to 4 wt%, 2.25 wt% to 3.3 wt%, 3 wt% to 45 wt%, 3 wt% to 30 wt%, 3 wt% to 25 wt%, 3 wt% to 22.5 wt%, 3 wt% to 20 wt%, 3 wt% to 17.5 wt%, 3 wt% to 15 wt%, 3 wt% to 13.3 wt%, 3 wt% to 12 wt%, 3 wt% to 10 wt%, 3 wt% to 8 wt%, 3 wt% to 7.5 wt%, 3 wt% to 7 wt%, 3 wt% to 6.6 wt%, 3 wt% to 6.5 % by weight, 3 wt% to 6 wt%, 3 wt% to 5 wt%, 3 wt% to 4 wt%, 3 wt% to 3.3 wt%, 4 wt% to 45 wt%, 4 wt% to 30 wt%, 4 wt% to 25 wt%, 4 wt% to 22.5 wt%, 4 wt% to 20 wt%, 4 wt% to 17.5 wt%, 4 wt% to 15 wt%, 4 wt% to 13.3 wt%, 4 wt% to 12 wt%, 4 wt% to 10 wt%, 4 wt% to 8 wt%, 4 wt% to 7.5 wt%, 4 wt% to 7 wt%, 4 wt% to 6.6 wt%, 4 wt% to 6.5 wt%, 4 wt% to 6 wt%, 4 wt% to 5 wt%, 5 wt% to 45 wt%, 5 wt% to 30 wt%, 5 wt% to 25 wt%, 5 wt% to 22.5 wt%, 5 wt% to 20 wt%, 5 wt% to 17.5 wt%, 5 wt% to 15 wt%, 5 wt% to 13.3 wt%, 5 wt% to 12 wt%, 5 wt% to 10 wt%, 5 wt% to 8 wt%, 5 wt% to 7.5 wt%, 5 % to 7 wt%, 5 wt% to 6.6 wt%, 5 wt% to 6.5 wt%, 5 wt% to 6 wt%, 6 wt% to 45 wt%, 6 wt% to 30 wt%, 6 wt% to 25 wt%, 6 wt% to 22.5 wt%, 6 wt% to 20 wt%, 6 wt% to 17.5 wt%, 6 wt% to 15 wt%, 6 wt% to 13.3 wt%, 6 wt% to 12 wt%, 6 wt% to 10 wt%, 6 wt% to 8 wt%, 6 wt% to 7.5 wt%, 6 wt% to 7 wt%, 6 wt% to 6.6 wt%, 6 wt% to 6.5 wt%, 6.5 wt% to 45 wt%, 6.5 wt% to 30 wt%, 6.5 wt% 25 wt%, 6.5 wt% to 22.5 wt%, 6.5 wt% to 20 wt%, 6.5 wt% to 17.5 wt%, 6.5 wt% to 15 wt%, 6.5 wt% to 13.3 wt%, 6.5 wt% to 12 wt%, 6.5 wt% to 10 wt%, 6.5 wt% to 8 wt%, 6.5 wt% to 7.5 wt%, 6.5 wt% to 7 wt%, 6.5 wt% to 6.6 wt%, 6.6 wt% to 45 wt%, 6.6 wt% to 30 wt%, 6.6 wt% to 25 wt%, 6.6 wt% to 22.5 wt%, 6.6 wt% to 20 wt%, 6.6 wt% to 17.5 wt%, 6.6 wt% to 15 wt%, 6.6 wt% to 13.3 wt%, 6.6 wt% to 12 wt%, 6.6 wt% to 10 wt%, 6.6 wt% to 8 wt%, 6.6 wt% to 7.5 wt%, 6.6 wt% to 7 wt%, 7 wt% to 45 wt%, 7 wt% to 30 wt%, 7 wt% to 25 wt%, 7 wt% to 22.5 wt%, 7 wt% to 20 wt%, 7 wt% to 17.5 wt%, 7 wt% to 15 wt%, 7 % to 13.3 wt%, 7 wt% to 12 wt%, 7 wt% to 10 wt%, 7 wt% to 8 wt%, 7 wt% to 7.5 wt%, 7.5 wt% to 45 wt%, 7.5 wt% to 30 wt%, 7.5 wt% to 25 wt%, 7.5 wt% to 22.5 wt%, 7.5 wt% to 20 wt%, 7.5 wt% to 17.5 wt%, 7.5 wt% to 15 wt%, 7.5 wt% to 13.3 wt%, 7.5 wt% to 12 wt%, 7.5 wt% to 10 wt%, 7.5 wt% to 8 wt%, 8 wt% to 45 wt%, 8 wt% to 30 wt%, 8 wt% to 25 wt%, 8 wt% to 22.5 % by weight, 8 wt% to 20 wt%, 8 wt% to 17.5 wt%, 8 wt% to 15 wt%, 8 wt% to 13.3 wt%, 8 wt% to 12 wt%, 8 wt% to 10 wt%, 10 wt% to 45 wt%, 10 wt% to 30 wt%, 10 wt% to 25 wt%, 10 wt% to 22.5 wt%, 10 wt% to 20 wt%, 10 wt% to 17.5 wt%, 10 wt% to 15 wt%, 10 wt% to 13.3 wt%, 10 wt% to 12 wt%, 12 wt% to 45 wt%, 12 wt% to 30 wt%, 12 wt% to 25 wt%, 12 wt% to 22.5 wt%, 12 wt% to 20 wt%, 12 wt% to 17.5 wt%, 12 wt% to 15 wt%, 12 wt% to 13.3 wt%, 13.3 wt% to 45 wt%, 13.3 wt% to 30 wt%, 13.3 wt% to 25 wt%, 13.3 wt% to 22.5 wt%, 13.3 wt% to 20 wt%, 13.3 wt% to 17.5 wt%, 13.3 wt% to 15 wt%, 15 wt% to 45 wt%, 15 wt% to 30 %, 15 wt% to 25 wt%, 15 wt% to 22.5 wt%, 15 wt% to 20 wt%, 15 wt% to 17.5 wt%, 17.5 wt% to 45 wt%, 17.5 wt% to 30 wt%, 17.5 wt% to 25 wt%, 17.5 wt% to 22.5 wt%, 17.5 wt% to 20 wt%, 20 wt% to 45 wt%, 20 wt% to 30 wt%, 20 wt% to 25 wt%, or 20 wt% to 22.5 wt%, but is not limited thereto.

[0062] In one embodiment, the feed composition for eel may contain 21 to 30 parts by weight of palmitic acid based on 100 parts by weight of total fatty acids, and more specifically, 21 to 30 parts by weight, 21 to 25 parts by weight, 21 to 23.75 parts by weight, 21 to 22.5 parts by weight, 21 to 21.25 parts by weight, 21.25 to 30 parts by weight, 21.25 to 25 parts by weight, 21.25 to 23.75 parts by weight, 21.25 to 22.5 parts by weight, 22.5 to 30 parts by weight, 22.5 to 25 parts by weight, 22.5 to 23.75 parts by weight, 23.75 to It may contain 30 parts by weight, 23.75 parts by weight to 25 parts by weight, or 25 parts by weight to 30 parts by weight.

[0063] In one embodiment, as the content of microalgae-derived biomass included in the eel feed composition increases, the content of palmitic acid included in the eel feed composition may increase.

[0064] In one embodiment, the feed composition for eel contains, based on 100 parts by weight of total fatty acids, 15 to 27 parts by weight of docosahexaenoic acid ((4Z,7Z,10Z,13Z,16Z,19Z)-Docosa-4,7,10,13,16,19-hexaenoic acid, DHA), more specifically, 15 to 27 parts by weight, 15 to 23 parts by weight, 15 to 20.25 parts by weight, 15 to 18 parts by weight, 15 to 16.25 parts by weight, 16.25 to 27 parts by weight, 16.25 to 23 parts by weight, 16.25 to 20.25 parts by weight, 16.25 to 18 parts by weight, 18 to It may include, but is not limited to, 27 parts by weight, 18 parts by weight to 23 parts by weight, 18 parts by weight to 20.25 parts by weight, 20.25 parts by weight to 27 parts by weight, 20.25 parts by weight to 23 parts by weight, or 23 parts by weight to 27 parts by weight.

[0065] In one embodiment, as the content of microalgae-derived biomass included in the eel feed composition increases, the content of docosahexaenoic acid included in the eel feed composition may increase.

[0066] An eel feed composition according to an example of the present application may further include protein, carbohydrates, fat, etc. Yeast, starch, cellulose, vitamins, etc.

[0067] In one embodiment, the eel feed composition of the present application may additionally include fishmeal.

[0068] In one embodiment, the eel feed composition of the present application may additionally include at least one selected from the group consisting of yeast (e.g., live bacteria such as yeast culture or mold fermentation, yeast preparation), vitamins (e.g., vitamin preparations such as carotene, vitamin E, vitamins A, D, E, nicotinic acid, vitamin B complex, etc.), minerals (e.g., mineral preparations such as sodium bicarbonate, bentonite, magnesium oxide, and complex minerals, and mineral preparations such as trace minerals such as zinc, copper, cobalt, and selenium), and starch.

[0069] In one embodiment, the eel feed composition may promote the growth of eels. Promoting the growth of eels may mean increasing the weight gain rate (WGR), feed efficiency (FE), and / or specific growth rate (SGR) of the eels. For example, when the eel feed composition is fed to eels, the weight gain rate (WGR), feed efficiency (FE), and / or specific growth rate (SGR) of the eels may increase compared to when feeding a feed composition that does not include microalgae-derived biomass.

[0070] As demonstrated in the examples described below, in the case of eels that consumed the eel feed composition containing the microalgae-derived biomass, the weight gain rate (WGR), feed efficiency (FE), and / or specific growth rate (SGR) increased, confirming that the eel feed composition of the present application has an effect of promoting the growth of eels.

[0071] The feed composition of the present application described above promotes the growth of eels and can be usefully used as a feed composition for eels.

[0072]

[0073] Eel farming methods

[0074] According to another aspect of the present application, the present application provides a method for cultivating eels, comprising the step of feeding eels a feed composition for eels containing biomass derived from microalgae of the genus Schizochytrium described above.

[0075] In the above method, prior to the feeding step, a step of preparing an eel feed composition containing the biomass derived from the microalgae of the genus Schizochytrium described above may be additionally included.

[0076] In the above method, the feeding step can be performed by any method of providing food to an eel, and for example, it can include, but is not limited to, a step of supplying or adding an eel feed composition containing the biomass derived from the microalgae of the genus Schizochytrium described above to an eel (which can be interpreted as including an aquatic environment in which the eel is contained).

[0077] In the above method, the feeding amount of the eel feed composition containing the biomass derived from the microalgae of the genus Schizochytrium described above can be appropriately determined according to the type, size, condition, feeding purpose, etc. of the eel to be fed. In one specific example, the feeding amount of the eel feed composition containing the biomass derived from the microalgae of the genus Schizochytrium is 1% (w / w) to 15% (w / w), more specifically 1% (w / w) to 15% (w / w), 1% (w / w) to 10% (w / w), 1% (w / w) to 8% (w / w), 1% (w / w) to 7% (w / w), 2% (w / w) to 15% (w / w), 2% (w / w) to 10% (w / w), 2% (w / w) to 8% (w / w), 2% (w / w) to 7% (w / w), 3% (w / w) to 15% (w / w), 3% (w / w) to 10% (w / w), 3% (w / w) to It may be, but is not limited to, 8%(w / w), or 3%(w / w) to 7%(w / w).

[0078] The biomass derived from the above-mentioned microalgae of the genus Schizochytrium, the feed composition for eel, and the growth promotion of eel are as described above.

[0079]

[0080] According to another aspect of the present application, the present application provides a method for promoting the growth of an eel, comprising the step of feeding an eel a feed composition for an eel comprising biomass derived from the microalgae of the genus Schizochytrium described above.

[0081] According to another aspect of the present application, the present application provides a use of the biomass derived from the microalgae of the genus Schizochytrium described above and / or an eel feed composition comprising the biomass derived from the microalgae of the genus Schizochytrium for promoting eel growth.

[0082] The biomass derived from the above-mentioned microalgae of the genus Schizochytrium, the feed composition for eel, and the growth promotion of eel are as described above.

[0083]

[0084] The present invention relates to a feed composition for eels comprising a biomass derived from microalgae of the genus Schizochytrium sp., and a method for cultivating eels using the same. When the feed composition for eels comprising a biomass derived from microalgae of the genus Schizochytrium sp. of the present invention is fed to eels, the growth of eels is promoted, and thus the feed composition can be usefully utilized as an eel feed composition or feed additive.

[0085]

[0086] Figure 1 is a diagram showing the difference in color as a result of pure isolation culture of a mutant strain of Schizochytrium sp. CD03-7004 and a wild type strain of Schizochytrium sp. CD01-5000.

[0087] Figure 2 is a diagram showing the sizes of amplified DNA fragments of the wild-type CD01-5000 strain and the mutant CD03-7004 strain, after performing PCR using a primer set that amplifies a DNA fragment containing an additional 15 bp base sequence in the mutant CD03-7004 strain compared to the wild-type CD01-5000 strain.

[0088]

[0089] Hereinafter, the present application will be described in more detail through examples. These examples are intended solely to illustrate the present application more specifically, and it will be apparent to those skilled in the art that the scope of the present application is not limited by these examples, in accordance with the gist of the present application.

[0090]

[0091] Example

[0092]

[0093] (Throughout this specification, "%" used to indicate the concentration of a particular substance is (weight / weight) % for solid / solid, (weight / volume) % for solid / liquid, and (volume / volume) % for liquid / liquid, unless otherwise stated.)

[0094]

[0095] Example 1: Research materials and methods

[0096] 1-1. Test fish and breeding management

[0097] The tank was a 1-ton square tank (working vol 60 L), and was composed of 3 breeding tanks and 2 filtration tanks, forming one set. The test method involved transplanting 25 eels (freshwater eel, Anguilla Japonica) (approximately 20 g in size), currently being bred and managed at the Central Research Institute of Copacs Co., Ltd., into each test tank. After one week of acclimation, the manufactured test feed was supplied at 3-7% (w / w) of the body weight twice a day (07:30, 14:30), and the fish were bred for 8 weeks. 20-30 minutes after supplying the test feed, the remaining feed was collected, freeze-dried, weighed, and then excluded from the amount of feed supplied each time. The temperature of each test tank was maintained at 29℃, DO at 6.5, and pH at 5.8 ± 0.5. NH3, NO2 Collect water from each test tank filtration tank once a day. It was measured using a chemical analysis method.

[0098] After the breeding test was completed, the total weight of the eels in each tank was measured, and the growth performance was evaluated as follows.

[0099] Initial Weight (IW) (g), Initial Weight (g / fish)

[0100] Final Weight (FW) (g), Final Weight (g / fish)

[0101] Weight gain (WG) (g), Weight Gain = final weight - initial weight

[0102] Total Dry Feed Intake (DFI) (g)

[0103] Feed efficiency (FE) (%), Feed Efficiency = (wet weight gain / dry feed intake) x 100

[0104] Weight Gain Rate (WGR) (%), Weight Gain Rate = (final weight - initial weight) x 100 / initial weight

[0105] Daily Growth Rate (SGR) (%), Specific Growth Rate (% / day) = (log final weight - log initial weight) / days x 100

[0106] Survival Rate (SR) (%), Survival Rate = (No. of fish at end of experiment / No. of fish at start of experiment) x 100

[0107]

[0108] 1-2. Preparation of a new mutant strain of Schizochytrium sp. CD03-7004

[0109] 1-2-1. Development of a novel Schizochytrium sp. CD03-7004 mutant strain using gamma irradiation.

[0110] The pure isolated wild-type Schizochytrium sp. CD01-5000 strain (accession number KCTC 14344BP) was cultured in modified-GYEP (glucose 10 g / L, yeast extract 1 g / L, peptone 1 g / L, MgSO4·7H2O 2 g / L, H3BO3 5.0 mg / L, MnCl2 3.0 mg / L, CuSO4 0.2 mg / L, NaMo4·2H2O 0.05 mg / L, CoSO4 0.05 mg / L, ZnSO4·7H2O 0.7 mg / L) medium containing 30 g / L glucose for about 24 h to reach the early exponential phase, and then the culture solution sample was centrifuged to harvest the cells. The harvested cells had a cell count of about 10 9 The cells / mL were suspended in 0.1 M Phosphate Buffer Solution containing 1.0% NaCl and used for gamma irradiation.

[0111] Gamma-irradiation experiments were conducted at the Advanced Radiation Research Institute of the Korea Atomic Energy Research Institute, and gamma-ray doses of 2,000–5,000 GY were irradiated. After a recovery process for O / N in a darkroom, gamma-irradiated microalgae culture samples were spread on GYEP medium containing 20 g / L agar and cultured at 30°C for approximately 5 days. The number of growing colonies was counted to determine the mortality rate according to gamma-ray dose.

[0112] [Calculation Formula 1]

[0113] Mortality rate (%) = [{(number of colonies in untreated group) - (number of colonies in treated group)} / (number of colonies in untreated group)] X 100

[0114] Gamma ray dose (kGY) Number of growing colonies (EA) Mortality rate (%) 2.0 ≥ 250- 3.0 ≥ 2390.8 4.0 ≥ 798.2 4.50 100 5.00 100 Non-irradiated group ≥ 2500

[0115] As a result, as shown in Table 1, the appropriate dose was confirmed at which the number of growth colonies and the CFU value of viable cells were reduced by 95% or more according to the gamma-ray irradiation dose. Specifically, at gamma-ray irradiation doses of 2.0, 3.0, 4.0, 4.5, and 5.0 kGY, 0%, 90.8%, 98.2%, 100%, and 100% were killed, respectively. Under the gamma-ray irradiation condition of 4.5 GY or higher, all algae were killed, making it impossible to secure microalgae colonies, and the gamma-ray dose condition of 4.0 kGY, which showed a death rate of 98.2%, was selected.

[0116] In the same way, the novel microalgae strain CD01-5000 was irradiated with 4.0 kGY gamma rays and cultured in GYEP medium. Colonies that could grow during the culture were selected, and passages were performed under the same medium and culture environment conditions. Colonies with a red color morphologically between passages were selected, and the single cell line was isolated and cultured purely, and the results of the photographing are shown in Fig. 1. The above Schizochytrium strain was named Schizochytrium sp. CD03-7004 strain and deposited with the Korean Collection for Type Cultures (KCTC) of the Korea Research Institute of Bioscience and Biotechnology on June 20, 2022, and assigned the accession number KCTC15006BP.

[0117]

[0118] 1-2-2. Derivation of markers to differentiate between the CD03-7004 mutant strain and the wild-type CD01-5000 strain.

[0119] The whole genome sequences of the wild type Schizochytrium sp. CD01-5000 strain and the mutant Schizochytrium sp. CD03-7004 strain were compared to identify the mutated sequence in CD03-7004 and construct a PCR marker.

[0120] Specifically, the mutant CD03-7004 strain was confirmed to have an additional portion of 15 base pairs (the portion in bold in the sequence of SEQ ID NO. 1 below, SEQ ID NO. 5) when compared to the genome of the wild-type CD01-5000 strain.

[0121]

[0122] [DNA fragment sequence for amplification of mutant CD03-7004 strain (SEQ ID NO: 1)]

[0123] tttcagactgctttttgcttttttgcttgcttgcttttttgcttgcttgcttttggcttgcttttctttttgcttcttcctgcttgatccggtgaagaagaacggagcgaactaaaagaaaagagtcaatccgaagagag

[0124]

[0125] [DNA fragment sequence to be amplified from the wild-type CD01-5000 strain (SEQ ID NO: 2)]

[0126] tttcagactgctttttgcttttttgcttgcttgcttttggcttgctttctttttgcttcttcctgcttgatccggtgaagaagaacggagcgaactaaaagaaaagagtcaatccgaagagag

[0127]

[0128] Primer A: 5'-TTTCAGACTGCTTTTTGCTTTTTG-3' (SEQ ID NO: 3) and primer B: 5'-CTCTCTTCGGATTGACTCTTTTCT-3' (SEQ ID NO: 4) were selected to amplify this part, and PCR amplification was performed using them. The PCR reaction was performed using a reaction solution containing taq polymerase, denaturing at 95°C for 5 minutes, followed by 35 cycles of denaturation at 95°C for 10 seconds, annealing at 50°C for 10 seconds, and polymerization at 72°C for 15 seconds, and then polymerization at 72°C for 5 minutes. The reaction solution amplified through the PCR process was electrophoresed on a 1.7% agarose gel to confirm the amplified DNA size, which is shown in Figure 2.

[0129] As a result, as shown in Fig. 2, the DNA fragment amplified in the mutant CD03-7004 strain was found to be about 140 bp in size, confirming that it was different from the wild-type CD01-5000 strain in which a DNA fragment of about 120 bp in size was amplified.

[0130] Therefore, the above results show that primer A: 5'-TTTCAGACTGCTTTTTGCTTTTTG-3' (SEQ ID NO: 3) and primer B: 5'-CTCTCTTCGGATTGACTCTTTTCT-3' (SEQ ID NO: 4) can be utilized to select the mutant CD03-7004 strain.

[0131]

[0132] 1-2-3. Production of dried microalgae biomass powder (Schizochytrium sp. powder)

[0133] The microalgae biomass dry powder to be used in the experiment was prepared using the Schizochytrium sp. CD03-7004 strain (KCTC15006BP) using the following method.

[0134] For the preliminary culture prior to the main culture at 30 L scale, each strain was inoculated into GYEP medium containing 50 ml of working volume and 30 g / L of glucose in a 500 ml flask, and cultured in a shaking incubator at 30°C and 180 rpm for approximately 20 hours. The preliminary culture was inoculated into a 30 L fermenter containing medium under the same conditions and fermented in a total working volume of 20 L. Glucose corresponding to 20% of the working volume was continuously added for cell culture under the conditions of 30°C, 500 rpm, 0.5-1 vvm, and pH 5-7, and the glucose concentration at this time was maintained at the level of 20 g / L. The culture was terminated when all of the supplied carbon source, glucose, was consumed. The cultured solution was dried using a dryer so that the moisture content became approximately 5-8%.

[0135]

[0136] 1-3. Preparation of test feed

[0137] The test feed was manufactured using fishmeal manufactured by Copax Feed Manufacturing (Glumar Co., Chille) as a protein source and Schizochytrium sp. powder (CJ Co., Korea) manufactured in Example 1-2-3 above, yeast (Biolife Co., Brazil), vitamins (Seoul vet Pharm Co., Korea), minerals (Seoul vet Pharm Co., Korea), and starch (Asai Co., Thailand). A control feed (CTL) consisting of 100% fishmeal as a protein source, and test feeds (alternative feeds) T1, T2, T3, T4, and T5 in which 5%, 10%, 15%, 20%, and 30% of the fishmeal were replaced with Schizochytrium sp. powder, respectively, were manufactured. Meanwhile, all protein sources were ground to approximately 100 mesh size using a grinder owned by Copax Research Institute. The composition of the control and test feeds is described in Table 8 below.

[0138]

[0139] 1-4. Evaluation of biological (liver weight) index

[0140] After the experiment, 10 mice were randomly selected from each test group, and the hepatosomatic index (HSI) and intestinosomatic index (ISI) were measured. The body weight and the weight of the liver and intestines removed after dissection were measured using an electronic scale, and the liver weight index [(liver weight / body weight) × 100] and the intestinosomatic index [(liver weight / body weight) × 100] were calculated.

[0141]

[0142] 1-5. Analysis of basic components of research materials and fish

[0143] Analysis of moisture, fat, protein, and ash content of research materials and fish bodies was performed. Research materials used fish meal (Glumar Co., Chille) and the above Schizochytrium sp. meal. For fish bodies, five eels of similar weight were randomly collected for each test group, finely ground in a grinder, and then analyzed for moisture, fat, protein, and ash. The analysis method was performed according to the food code method, and crude fat analysis was performed by acid digestion method considering the characteristics of Schizochytrium sp. meal.

[0144]

[0145] 1-6. Amino acid, fatty acid analysis, and Ca, P analysis

[0146] The amino acid, fatty acid, and Ca. P contents of the fish meal and Schizochytrium sp. meal, which were the research materials, and the fish body were evaluated. In the case of the fish body, the amino acid, fatty acid, and Ca. P contents were evaluated using the freeze-dried meal of the ground meat of five fish randomly selected from each experimental group. The analysis was requested to the Feed Testing and Certification Center of the Chungnam National University Agricultural Science Research Institute (https: / agro.cnu.ac.kr / agro / index.do).

[0147]

[0148] 1-6-1. Amino acid analysis method

[0149] Analysis of the amino acid composition was performed using the ninhydrin post-column reaction method using ion exchange chromatography, modified from the AOAC method (2005). For the 16 amino acids, 0.2 g of the sample was placed in a digestion tube, 10 ml of 6 N HCl was added, nitrogen gas was injected, and hydrolysis was performed at 110 °C for 24 hours. The filtrate was concentrated using a vacuum evaporator, diluted to 50 ml with 0.2 M sodium citrate buffer, and the filtrate filtered through a 0.20 μm cellulose acetate syringe filter was used as the analysis sample. Sulfur-containing amino acids such as methionine and cysteine ​​were analyzed using the performic acid oxidation method, and tryptophan was analyzed using the alkaline hydrolysis method. The analysis conditions are shown in Tables 2 and 3.

[0150] Analysis conditions of amino acid automatic analyzer for total amino acids Items Conditions Instrument Hitachi, L-8900 Column Ion exchange column (#2622PH column) 4.6 × 60 ㎜ Mobile phase Buffer set (PH-SET KANTO) Detector UV / Vis (440, 570 ㎚) Flow rate Ninhydrin ; 0.30 ㎖ / min Buffer ; 0.35 ㎖ / min Injection volume 20 μL

[0151] HPLC analysis conditions for tryptophan Items Conditions Instrument Waters Isocratic 600 pump, 486 UV / VIS detector Column CAPCELL PAK C18 (4.6 x 250 ㎜) Mobile phase 0.0085M Sodium acetate : methanol = 95 : 5 Detector UV 280 ㎚ Flow rate 1.0 ㎖ / min Injection volume 20 ㎕

[0152]

[0153] 1-6-2. Fatty acid composition analysis method

[0154] Fatty acid composition was prepared by adding about 100 ml of a mixture of chloroform and methanol (2:1) to about 10 g of the crushed sample according to the method of Folch et al. (1957), extracting at room temperature for 24 hours, and then concentrating under reduced pressure to prepare an extract. After methyl esterification with a 14% BF3-MeOH (Sigma, St Louis, Mo, USA) solution, the result was analyzed using a Gas Chromatograph (HP 6890, Heslett Packard Ltd., USA). The column used was HP-88 (100 m×0.25 mm id, film thickness 0.20 μm, Agilent, USA), and the temperature of the column oven was maintained at 140°C for 5 minutes, then increased by 4°C per minute to 240°C and maintained for 20 minutes. The temperature of the inlet was 260℃, the temperature of the detector FID was 270℃, N2 was used as the carrier gas at 1㎖ / min, and the split ratio was adjusted to 1 / 50. The analysis conditions of gas chromatography were as shown in Table 4 below, and the peaks of each fatty acid were identified by comparing them with the retention time of the methyl ester of the standard fatty acid. The fatty acid composition was determined by calculating the area of ​​each identified peak and expressing each area ratio as a percentage.

[0155] Gas chromatography analysis conditions for fatty acids Items Conditions Instrument HEWLETT PACKARD 6890 Column HP-88 (100 m × 0.25 mm, 0.2 μm) Injection port 260℃ Detection port 270℃ Column oven 140℃ (5 min), 4℃ / min, 240℃ (20 min) Detector FID Carrier gas N2 Injection volume 1㎕ Split ratio 50:1

[0156]

[0157] 1-6-3. Mineral Analysis Method

[0158] The mineral content was measured by dissolving the residue after dry charring in a hydrochloric acid solution (1:1, v / v) to prepare a sample solution. Calcium (Ca) was measured using an atomic absorption spectrophotometer (GBC Scientific Equipment, SavantAA, Australia), and phosphorus (P) was measured at 470 nm using a spectrophotometer (UV-2450, Shimadzu Co., Japan) according to the molybdenum blue colorimetric method. All reagents and distilled water were for mineral analysis.

[0159]

[0160] 1-7. Blood chemistry analysis

[0161] After the experiment, 10 mice were randomly selected from each test group, and plasma for blood analysis was collected from the caudal vein using a disposable syringe in a heparin tube and centrifuged (2000 rpm, 15 min, 4 ℃). A blood analyzer (NX500i, FUJI FILM, JAPAN) was used to measure glutamate oxaloacetate transaminase (GOT), cholesterol (cholesterol, CHO), triglyceride (TG), alkaline phosphatase (ALP), and total protein (TP).

[0162]

[0163] 1-8. Nonspecific immunoassay

[0164] To measure lysozyme activity, 50 μl of serum isolated from the tail veins of 10 eels for each test group after the end of the experiment was mixed with 1 ml of a solution containing Micrococcus lysodeikticus (0.2 mg / ml) suspended in 0.05 M sodium phosphate buffer (Sigma, USA, pH 6.2) in a 96-well plate. The reaction was measured at 0.5 and 5 min at 530 nm using a spectrophotometer (Molecular Device, USA) at 20°C. A unit of lysozyme activity was defined as the amount of enzyme that exhibited a decrease in absorbance of 0.001 per minute.

[0165] To measure the phagocyte activity of neutrophils, 50 μL of serum isolated from the tail veins of 10 eels for each test group was mixed with NBT solution (Sigma, USA) at a 1:1 ratio after the experiment was over, and 50 μL of the reaction mixture was transferred to a glass tube after reacting for 30 minutes at 25 °C, and 1 mL of dimethyl formamide (Sigma, USA) was added to reduce formazan production. After centrifugation at 2,000 ×g for 5 minutes, the supernatant was collected, and the reduction range of NBT was measured at 540 nm using a spectrophotometer (Molecular Device, USA). Dimethyl formamide (Sigma, USA) was used as the blank.

[0166]

[0167] 1-9. Cholecystokinin and superoxide dismutase analysis

[0168] To analyze the activity of the digestive enzyme cholecystokinin and the antioxidant enzyme superoxide dismutase (SOD), blood was collected from 10 eels per test group, and the serum was separated by centrifugation at 2,000×g for 10 minutes at 4°C and stored at -70°C. ELISA analysis using the serum was performed using a kit that can measure fish cholecystokinin (CUSABIO, USA) and SOD (CUSABIO, USA), and 50 μL of plasma per well was used in triplicate according to the manufacturer's protocol. The activity was measured at the absorbance at 450 nm using a spectrophotometer (Molecular Device, USA), and the results were calculated in units of ng / mL (SOD) or pg / mL (Cholecystokinin) based on a standard curve.

[0169]

[0170] Example 2: Analysis of research materials (fish meal and Schizochytrium microalgae powder)

[0171] 2-1. Proximate components

[0172] The general components of fishmeal powder and Schizochytrium sp. microalgae powder, which were used as protein sources in this study, were evaluated and are shown in Table 5 below.

[0173] Proximate components (%) Fishmeal powder (FP) Schizochytrium sp. powder (SP) Moisture (Moisture) 1.76 0.63 Crude protein (Crude protein) 74.25 80.31 Crude lipids (Crude lipids) 9.9 1 1.36 Ash (Ash) 13.6 5 7.25 Crude fiber (Crude fiber) 0.4 0.45 Calorie (Calorie) (cal / 100g) 447.25 49 3.08

[0174] As shown in Table 5, Schizochytrium sp. meal had lower moisture and ash contents than fish meal, and higher crude protein and crude fat contents than fish meal.

[0175]

[0176] 2-2. Amino acids

[0177] The amino acid composition of the two protein powders used in this study, fish meal and Schyzochytrium sp. meal, was evaluated and expressed as g / 100 g of total amino acid, as shown in Table 6.

[0178] Amino acids (g / 100g total amino acids) Fishmeal powder (FP) Schizochytrium sp. powder (SP) Aspartic acid 9.9 9 4.65 Threonine* 4.62 2.14 Serine 4.3 9 2.23 Glutamic acid acid14.4153.56Proline4.621.40Glycine6.732.53Alanine6.773.00Cysteine0.210.11Valine*5.223.01Methionine*3.241.51Isoleuc ine*4.291.96Leucine*7.853.45Tyrosine3.321.49Phenylalanine*4.081.93Histidine*4.671.18Lysine*8.833.65Arginine*6.7612.18

[0179] * Essential amino acids

[0180]

[0181] As shown in Table 6, most amino acid contents were higher in fish meal, but the glutamic acid content was about four times higher in Schyzochytrium sp. than in fish meal, and arginine, an essential amino acid, was also higher in Schyzochytrium sp. than in fish meal.

[0182]

[0183] 2-3. Fatty acids

[0184] The fatty acid composition of the fat contained in the two proteins used in this study was evaluated and expressed as g / 100g of total fatty acid, as shown in Table 7.

[0185] 지방산 (g / 총 지방산100g)약칭어분 분말 (Fishmeal powder; FP)Schizochytrium sp.powder (SP)포화지방산Caproic acidC6:00.040.04Caprylic acidC8:00.020.02Capric acidC10:00.030.03Lauric acidC12:00.060.05Myristic acidC14:05.601.70Pentadecanoic acidC15:00.520.12Palmitic acidC16:019.9636.70Magaric acidC17:00.680.07Stearic acidC18:06.681.51Arachidic acidC20:00.070.21Heneicosylic acidC21:00.900.00Behenic acidC22:00.240.00Lignoceric acidC24:01.581.67불포화지방산Myristoleic acidC14:10.170.11Pentadecenoic acidC15:10.250.00Palmitoleic acidC16:15.990.11Magaoleic acidC7:10.830.04Oleic acidC18:1n918.870.51Linoleic acidC18:2n62.370.37γ-linoleic acidC18:3n60.260.23Linolenic acidC18:3n30.640.25Eicosenoic acidC20:1n91.890.01Eicosadienoic acidC20:2n60.160.00Dihomo-δ-LinoleicacidC20:3n60.070.00Eicosatrienoic acidC20:3n30.310.00Arachidonic acidC20:4n62.840.12EPA (eicosapentaenoic acid)C20:5n39.630.72Erucic aicdC22:1n90.290.24Docosadienoic acidC22:2n60.680.66Nervonic acidC24:1n93.250.40DHA (docosahexaenoic acid)C22:6n315.0945.12

[0186] The content ratios of some fatty acids between the two protein sources showed very large differences. The fatty acids showing major differences are myristic acid (C14:0, FP, 5.60; SP, 1.70), palmitic acid (C16:0, FP, 19.96; SP, 36.70), stearic acid (C18:0, FP, 6.68; SP, 1.51), palmitoleic acid (C16:1, FP, 5.99; SP, 0.11), oleic acid (C18:1n9, FP, 18.87; SP, 0.51), linoleic acid (C18:2n6, FP, 2.37; SP, 0.37), linolenic acid (C18:3n3, FP, 0.64; SP, 0.25), eicosadienoic acid (C20:1n9, FP, 1.89; SP, 0.01), arachidonic acid (C20:4n6, FP, 2.84; SP, 0.12), EPA (eicosapentaenoic acid) (C16:0, FP, 9.63; SP, 0.72), nervonic acid (C24:1n9, FP, 3.25; SP, 0.40), and DHA (docosahexanoic acid) (C22:6n3), FP, 15.09; SP, 45.12). Many fatty acids tended to be lower in Schizochytrium sp. than in fish meal, but on the other hand, the composition ratio of palmitic acid and DHA was very high in Schizochytrium sp. compared to fish meal.

[0187]

[0188] 2-4. Preparation of control feed and test feed

[0189] A control feed (CTL) containing 100% fish meal as a protein source, and test feeds (replacement feeds) T1, T2, T3, T4, and T5, in which 5%, 10%, 15%, 20%, and 30% of the fish meal were replaced with Schizochytrium sp. meal, were prepared with the compositions shown in Table 8 below.

[0190] Components (%)CTLT1T2T3T4T5Brown Fish meal(Jack mackerel) a 7268.464.861.257.650.4Schizochytriumsp.powder b 03.36.61013.320Brewer's Yeast c 333333Starch d 232323232323Cellulose e 00.30.60.81.11.6Vitamin f 111111Mineral f 111111Total100100100100100100

[0191] a, Glumar Co., Chille

[0192] b, CJ Co., Korea

[0193] c, Biolife Co., Brazil

[0194] d, Asai Co., Thailand

[0195] e, Nelson-Jameson, Inc., USA

[0196] f, Seoul vet Pharma Co., Korea

[0197]

[0198] 2-5. General ingredients of test feed

[0199] The basic components of the control feed (CTL) and test feeds (alternative feeds) T1 to T5 used in this experiment were evaluated and are shown in Table 9.

[0200] Proximate components (%) CTLT 1 T2 T3 T4 T5 Moisture 3.36 3.84 3.84 3.36 3.68 3.49 Crude protein 43.66 43.5 245.20 44.86 44.93 45.45 Crude lipids 6.9 37.24 6.79 6.83 6.39 6.11 Crude carbohydrates 24.00 24.00 24.00 24.00 24.00 24.00 Ash 22.05 ± 1.65 21.4 ± 1.8 3 20.17 ± 0.56 20.95 ± 0.70 21.0 ± 0.38 20.95 ± 1.65 Calories (cal / 100g)353.80356.96358.28357.40352.40351.12

[0201] As shown in Table 9, there was no difference in moisture, crude protein content, crude fat content, and ash, and the crude carbohydrate content was also evaluated equally, and it was confirmed that there was little difference in calories between the feeds.

[0202]

[0203] 2-6. Fatty acid analysis of test feed

[0204] The fatty acid composition ratio (profile) of the control feed (CTL) and test feeds (alternative feeds) T1 to T5 used in this experiment was evaluated and expressed as g / 100g of total fatty acid, as shown in Table 10.

[0205] Fatty acids (g / 100g total fatty acids) Abbreviation CTLT1T2T3T4T5 Saturated fatty acids Caproic acid C6: 00.040.050.050.070.130.05 Caprylic acid C8: 00.030.030.020.030.070.08 Capric acid C10: 00.100.120.100.030.120.07 Lauric acid C12: 00.100.090.100.110.100.10 Myristic acid C14: 05.775.505.405.115.054.66 Pentadecanoic acid C15: 00.820.770.620.510.540.43 Palmitic acid acidC16:020.6721.1221.3623.4724.1026.16Magaric acidC17:00.840.540.500.520.480.51Stearic acidC18:06.866.296.356.546.115.79Arachidic acidC20:00.080.040.060.050.050.05Heneicosylic acidC21:00.920.860.830.800.760.70Behenic acidC22:00.230.200.190.170.170.15Lignoceric acidC24:01.471.411.371.341.251.08Unsaturated fatty acidMyristoleic acidC14:10.160.160.150.140.140.11Pentadecenoic acidC15:10.210.210.200.200.210.13Palmitoleic acidC16:16.115.895.645.195.204.54Magaoleic acidC7:10.751.010.730.690.630.61Oleic acidC18:1n918.3618.8917.8916.1215.7013.23Linoleic acidC18:2n62.272.222.122.021.991.76γ-linoleicacidC18:3n60.270.290.280.280.260.27Linolenic acidC18:3n30.660.630.620.630.600.60Eicosenoic acidC20:1n92.081.771.691.701.471.29Eicosadienoic acidC20:2n60.180.140.140.160.120.11Dihomo-δ-Linoleic acidC20:3n60.050.030.030.050.060.03Eicosatrienoic acidC20:3n30.320.350.330.300.300.25Arachidonic acidC20:4n62.642.362.272.362.021.75EPAC20:5n39.408.898.548.087.717.01Erucic aicdC22:1n90.290.280.290.320.290.28Docosadienoic acidC22:2n60.670.630.670.680.640.65Nervonic acidC24:1n93.183.082.982.802.722.44DHAC22:6n314.4716.1416.5719.5321.0125.11.

[0206] As shown in Table 10 above, in the test feed mixed with fish meal and Schizochytrium sp. meal at a certain ratio, a difference in fatty acid composition was confirmed in proportion to the mixing ratio. It was confirmed that as the mixing ratio of Schizochytrium sp. meal increased, the content of palmitic acid and DHA increased.

[0207]

[0208] Example 3: Growth performance evaluation

[0209] The growth performance was evaluated by feeding the control feed and test feeds T1 to T5 twice a day for 8 weeks to freshwater eels (A. japonica, approximately 20 g in size) in the growth stage, and is shown in Table 11 below.

[0210] CTLT1T2T3T4T5IW a (g)255.00±0.00225.67±0.58255.5±0.71255.33±0.58225.00±0.50225.33±0.58FW b(g)649.33±10.89638.33±10.77668.00±28.28635.59±8.53622.17±18.11621.87±14.18WG c (g)424.33±10.89412.67±10.75422.5±28.99410.25±9.08397.17±18.32396.53±14.76DFI d (g)487.22±0.42482.34±4.87487.01±0.26485.31±0.75487.04±1.37486.81±0.36FE e (%)87.09±2.1685.55±1.5290.86±5.084.53±1.8981.54±3.5481.45±2.97WGR f (%)188.59±4.84182.87±4.77196.25±13.47182.07±4.47176.52±8.32175.99±6.99SGR g (% / day)1.89±0.031.86±0.031.94±0.081.85±0.031.82±0.051.81±0.05SR h (%)100±0.00100±0.00100±0.0097.78±3.85100±0.0097.78±3.85

[0211] a IW (g), 초기무게, Initial Weight (g / fish)

[0212] b FW (g), 최종무게, Final Weight (g / fish)

[0213] c WG (g), 증체량, Weight Gain = final weight - initial weight

[0214] d DFI (g), 총사료섭이량, Total Dry Feed Intake

[0215] e FE (%), 사료효율, Feed Efficiency = (wet weight gain / dry feed intake) x 100

[0216] f WGR (%), Weight Gain Rate = (final weight - initial weight) x 100 / initial weight

[0217] g SGR (%), daily growth rate, Specific Growth Rate (% / day) = (log final weight - log initial weight) / days x 100

[0218] h SR (%), survival rate, Survival Rate = (No. of fish at end of experiment / No. of fish at start of experiment) x 100

[0219]

[0220] As shown in Table 11 above, the weight gain rate (WGR) was in the order of T2 (196.25±13.47) > control feed (188.59±4.84) ​​> T1 (182.87±4.77) > T3 (182.07±4.47) > T4 (176.52±8.32 > T5 (175.99±6.99), and the feed efficiency (FE) was in the order of T2 (90.86±5.0) > control feed (87.09±2.16) > T1 (85.55±1.52) > T3 (84.53±1.89) > T4 (81.54±3.54) > T5 (81.45±2.97), and the daily growth rate (SGR) was also in the order of T2 (1.94±0.08) > control feed (1.89±0.03 n ) > T1 (1.86±0.03) > T3 (1.85±0.03) > T4 (1.82±0.05) > T5 (1.81±0.05), and it was confirmed that the best weight gain rate, feed efficiency, and daily growth rate were shown in the test feed T2. The survival rate (SR) did not show a significant difference between 97.72% and 100% in the test sections.

[0221] In this way, it was confirmed that when fish meal was replaced with Schizochytrium sp. meal in the mixing ratio of test feed T2, the growth of eels was promoted, and it could be usefully used as a feed composition for eels.

[0222]

[0223] Example 4: Bioindex Evaluation

[0224] Biological characteristics such as liver weight index (HSI) and intestine weight index (ISI) are generally known to vary depending on the fish's nutritional status, habitat conditions, and stress. The results of evaluating the liver weight index and intestine weight index of eel groups fed the control diet and test diets T1 to T5 are shown in Table 12 below.

[0225] CTLT1T2T3T4T5 liver weight index a (HSI)1.86±0.372.02±0.591.91±0.221.86±0.242.15±0.451.99±0.22Heat Weight Index b (VSI)5.34±1.035.34±1.435.11±0.595.52±0.735.97±1.255.40±0.61

[0226] a Liver weight(g) / Body weight(g) x 100 b Intestine weight(g) / Body weight(g) x 100

[0227]

[0228] As shown in Table 12, there was no significant difference in the liver weight index and intestine weight index between the eel groups fed the control feed and the test feed (T1 to T5), and thus it was confirmed that fish meal could be safely replaced with Schizochytrium sp. meal within the content ratio range of the test feed.

[0229]

[0230] Example 5: Blood chemistry analysis

[0231] Chemical tests of fish blood can diagnose various diseases or physiological changes such as organ damage and stress levels, and have long been used as indicators of health diagnosis. Ten test fish each were randomly selected after being fed a control diet and a test diet for eight weeks, and plasma glutamate oxaloacetate transaminase (GOT), triglyceride (TG), cholesterol (CHO), alkaline phosphatase (ALP), and total protein (TP) were measured, and the results are presented in Table 13.

[0232] CTLT1T2T3T4T5GOT107.2±37.1118.2±34.2103.4±27.593.8±19.6111.6±33.5181.8±126.9TG1324 .0±721.51192±360.71048.8±574.41023.2±260.5980.8±381.9746.4±274.7CHO363.8±59.0356.8± 128.8346.8±59.0345.3±38.2354±68.2311.4±57.5ALP1326.4±585.4888.2±375.21061.2±459.31 166.6±380.81168.4±459.21155.6±394.0TP4.5±0.34.62±0.64.36±0.44.2±0.14.34±0.54.86±1.3

[0233] As shown in Table 13, both the control feed-fed eel group and the test feed (T1-T5) groups showed similar values ​​in blood concentrations of GOT (also known as aspartate aminotransferase (AST)), a blood liver damage index, cholesterol (CHO), alkaline phosphatase (ALP), a major liver enzyme, and total protein (TP). Blood triglyceride (TG) tended to decrease in test feeds T1-T5 as the fish meal replacement ratio increased compared to the control feed-fed eel group, but no significant difference was observed.

[0234] Accordingly, it was confirmed that fish meal could be safely replaced with Schizochytrium sp. meal within the content ratio range of the test feed.

[0235]

[0236] Example 6: Nonspecific Immunity, Cholecystokinin, and Superoxide Dismutase Assays

[0237] Fish, as vertebrates, also have a defense system based on nonspecific and specific immunity, and it is known that immune activity reacts sensitively to changes in feeding environment and water quality. By evaluating the activity of lysozyme, a humoral immune factor, and the phagocytic activity of neutrophils, a cellular immune factor, the effect on nonspecific immunity between the eel group fed the control diet (CTL) and the eel groups fed the test diets T1 to T5 was evaluated (Table 14).

[0238] In addition, digestive function was evaluated by assessing cholecystokinin, a hormone that promotes gallbladder contraction and pancreatic enzyme secretion, and blood antioxidant activity was compared by assessing the activity of superoxide dismutase (SOD), an antioxidant enzyme in the blood (Table 14).

[0239] CTLT1T2T3T4T5Lysozyme activity23.27±3.90 ns 22.69±5.0724.52±4.9622.77±3.2122.89±4.1022.74±3.40Phagocytic activity140.99±65.35 ns 108.04±53.14166.45±10.328124.25±47.28128.61±81.61122.32±36.48Cholecystokinin activity1827.00±1266.53 ns727.40±682.682645.5±1141.551494.20±596.292601.40±990.342189.70±1132.49Superoxide dismutaseactivity21.21±0.83 ns 21.17±1.2920.33±3.1021.68±0.2121.74±0.3521.03±1.12

[0240] As shown in Table 14, lysozyme activity, phagocytic activity, cholecystokinin activity, and superoxide dismutase activity all showed similar levels between the eel groups fed the alternative feed and the test feed, confirming that fish meal can be safely replaced with Schizochytrium sp. meal within the content ratio range of the test feed.

[0241]

[0242] Example 7: Whole fish analysis

[0243] 7-1. Basic ingredients

[0244] After grinding and mixing five whole fish, the moisture content was measured, and the basic components (crude protein, crude fat, and ash) and Ca and P contents of the dried grinding powder were measured, and the results are shown in Table 15.

[0245] Proximate components (%) CTLT 1 T2 T3 T4 T5 Moisture 66.16 65.7 368.13 66.6 167.35 68.64 Crude protein 14.79 14.69 13.43 14.06 13.57 14.16 Crude lipids 13.09 14.15 12.52 13.33 13.27 12.10 Ash 5.9 6 5.4 3 5.9 2 6.00 5.8 15.10 Ca 1.05 1.00 1.10 1.14 1.08 1.00 P 1.17 1.05 1.14 1.12 1.13 1.07

[0246] As shown in Table 15, the moisture content, crude protein, crude fat, ash, Ca, and P contents of the whole fish body were similar between the eel group fed the control feed (CTL) and the eel group fed the test feed (T1-T5), confirming that fish meal can be safely replaced with Schizochytrium sp. meal within the content ratio range of the test feed.

[0247]

[0248] 7-2. Composition amino acids

[0249] The results of evaluating the amino acid composition of the eel group fed the control feed (CTL) and the eel group fed the test feed (T1 to T5) are shown in Table 16 below.

[0250] Amino acids (g / 총 아미노산100g)CTL (%)T1 (%)T2 (%)T3 (%)T4 (%)T5 (%)Aspartic acid4.24(9.3)4.07(9.4)4.29(9.3)4.29(9.3)4.49(9.3)4.53(9.3)Threonine*2.03(4.5)1.94(4.5)2.07(4.5)2.04(4.4)2.14(4.5)2.16(4.4)Serine2.02(4.4)1.89(4.4)2.07(4.5)2.02(4.4)2.12(4.4)2.12(4.4)Glutamic acid6.02(13.2)5.77(13.4)6.17(13.3)6.17(13.3)6.52(13.6)6.53(13.4)Proline2.72(6.0)2.38(5.5)2.81(6.1)2.79(6.0)2.86(6.0)2.84(5.8)Glycine4.51(9.9)3.82(8.9)4.67(10.1)4.56(9.9)4.69(9.8)4.59(9.4)Alanine3.34(7.3)3.04(7.0)3.41(7.4)3.37(7.3)3.49(7.3)3.50(7.2)Valine*2.01(4.4)1.98(4.6)2.00(4.3)2.00(4.3)2.10(4.4)2.17(4.5)Isoleucine*1.70(3.7)1.70(3.9)1.68(3.6)1.71(3.7)1.81(3.8)1.87(3.8)Leucine*3.27(7.2)3.20(7.4)3.27(7.1)3.30(7.1)3.46(7.2)3.53(7.3)Tyrosine1.26(2.8)1.28(3.0)1.29(2.8)1.32(2.9)1.38(2.9)1.36(2.8)Phenylalanine*1.75(3.8)1.69(3.9)1.76(3.8)1.76(3.8)1.84(3.8)1.88(3.9)Histidine*1.75(3.8)1.73(4.0)1.78(3.8)1.80(3.9)1.86(3.9)1.97(4.1)Lysine*3.74(8.2)3.69(8.5)3.76(8.1)3.80(8.2)3.96(8.2)4.04(8.3)Arginine*3.08(6.8)2.89(6.7)3.14(6.8)3.19(6.9)3.28(6.9)3.29(6.8)Cysteine0.48(1.1)0.51(1.2)0.53(1.1)0.52(1.1)0.51(1.1)0.55(1.1)Methionine*1.47(3.2)1.54(3.6)1.56(3.4)1.53(3) .3)1.49(3.1)1.64(3.4)Tryptophan*0.15(0.3)0.08(0.2)0.13(0.3)0.11(0.2)0.11(0.2)0.12(0.3)Total45.5443.2046.3946.2848.1148.69.

[0251] * Essential amino acids

[0252]

[0253] As shown in Table 16, the amino acid composition of the whole eel body was similar between the eel group fed the control diet (CTL) and the eel group fed the test diets (T1-T5). As such, although there was a large difference in the amino acid composition ratio, including essential amino acids, between fish meal and Schizochytrium sp. meal (Table 6), as shown in Table 16, it was determined that there was almost no effect on the protein composition of the whole eel body fed the test diet in which fish meal was replaced with Schizochytrium sp. meal, confirming that fish meal can be safely replaced with Schizochytrium sp. meal within the content ratio range of the test diet.

[0254]

[0255] 7-3. Fatty acids

[0256] The results of evaluating the fatty acid composition of the eel group fed the control feed (CTL) and the eel group fed the test feed (T1 to T5) are shown in Table 17 below.

[0257] Fatty acids (g / 100g total fatty acids) Abbreviation CTLT1T2T3T4T5Saturated fatty acidsCaproic acidC6:00.020.010.020.020.020.02Caprylic acidC8:00.020.010.020.020.020.02Capric acidC10:00.020.020.020.040.060.01Lauric acidC12:00.070.060.070.080.080.07Myristic acidC14:04.143.774.043.803.783.59Pentadecanoic acidC15:00.250.230.270.230.230.22Palmitic acidC16:022.6220.8921.1321.6721.5321.70Magaric acidC17:00.320.330.340.280.290.29Stearic acidC18:03.563.603.283.773.573.57Arachidic acidC20:00.150.130.150.150.140.14Heneicosylic acidC21:00.150.140.090.090.140.13Behenic acidC22:00.110.110.100.120.120.12Lignoceric acidC24:00.390.370.400.370.360.34Unsaturated fatty acidMyristoleic acidC14:10.170.140.190.190.180.16Pentadecenoic acidC15:10.040.040.040.040.040.03Palmitoleic acidC16:18.879.029.348.618.558.68Magaoleic acidC7:10.460.430.480.440.440.39Oleic acidC18:1n943.8845.7944.5344.6243.8443.92Linoleic acidC18:2n61.121.161.050.910.960.92γ-linoleicacidC18:3n60.170.150.140.150.140.14Linolenic acidC18:3n30.230.210.230.230.220.22Eicosenoic acidC20:1n91.561.421.471.401.391.48Eicosadienoic acidC20:2n60.430.410.440.370.40.4Dihomo-δ-LinoleicacidC20:3n60.210.20.210.190.240.21Eicosatrienoic acidC20:3n30.020.030.0200.020.02Arachidonic acidC20:4n60.730.650.660.630.640.63EPA (eicosapentaenoic acid)C20:5n32.052.0121.821.761.55Erucic aicdC22:1n90.110.120.110.110.110.11Docosadienoic acidC22:2n60.490.540.570.520.550.52Nervonic acidC24:1n92.292.272.272.282.232.11DHA (docosahexaenoic acid)C22:6n35.365.756.336.827.958.27.

[0258] As shown in Table 17, it was confirmed that some polyunsaturated fatty acids, such as linoleic acid (CTL, 1.12 > T1, 1.16 > T2, 1.05 > T3, 0.91 > T4, 0.96 > T5, 0.92), EPA (CTL, 2.05 > T1, 2.01 > T2, 2.00 > T3, 1.82 > T4, 1.76 > T5, 1.55), and DHA (CTL, 5.36 < T1, 5.75 < T2, 6.33 < T3, 6.82 < T4, 7.95 < T5, 8.27), showed differences in content proportional to the replacement ratio of Schizochytrium sp. This is consistent with the results showing that some fatty acids in the fatty acid composition ratios of the fish meal and Schizochytrium sp. meal used in the test evaluation showed large differences between the two raw materials (Table 7), and that differences were also shown according to the mixing ratio of Schizochytrium sp. meal in the control feed (CTL) and test feeds T1 to T5 (Table 10). In this way, the fatty acid compositions of fish meal and Schizochytrium sp. meal showed large differences, and it was confirmed that the differences in the composition of some essential polyunsaturated fatty acids also affected the differences in the fatty acid composition of fish after feeding.

[0259]

[0260] [Accession number]

[0261] Name of depositor: Korea Research Institute of Bioscience and Biotechnology, Biological Resource Center (KCTC)

[0262] Accession number: KCTC15006BP

[0263] Date of acceptance: 20220620

[0264]

Claims

1. A feed composition for eel comprising 2.25 to 45 wt% of biomass derived from microalgae of the genus Schizochytrium sp.

2. An eel feed composition in paragraph 1, wherein the microalgae-derived biomass comprises at least one selected from the group consisting of microalgae, a culture of the microalgae, a dried product of the culture, and a crushed product of the dried product.

3. A feed composition for eel, comprising 4 to 8 wt% of the microalgae-derived biomass according to claim 1.

4. A feed composition for eel, wherein the microalgae-derived biomass of paragraph 1 contains 40 to 95 wt% of protein.

5. A feed composition for eel, wherein the microalgae-derived biomass of paragraph 1 contains 3 to 30 wt% of fat.

6. In the first paragraph, the microalgae of the genus Schizochytrium is at least one selected from the group consisting of Schizochytrium aggregatum, Schizochytrium limacinum, and Schizochytrium minutum, a feed composition for eel.

7. An eel feed composition according to claim 1, wherein the eel is at least one selected from the group consisting of Japanese eel (Anguilla japonica), large eel (Anguilla marmorata), European eel (Anguilla anguilla), American eel (Anguilla rostrata), and bicolor eel (Anguilla bicolor).

8. A feed composition for eel, which promotes the growth of eel according to paragraph 1.

9. In the 8th paragraph, an eel feed composition that promotes the growth of the eel by increasing the weight gain rate (WGR) of the eel.

10. In the 8th paragraph, an eel feed composition that promotes the growth of the eel by increasing the feed efficiency (FE) of the eel.

11. In the 8th paragraph, an eel feed composition that promotes the growth of the eel by increasing the specific growth rate (SGR) of the eel.

12. A method for cultivating eels, comprising a step of feeding eels with an eel feed composition according to any one of claims 1 to 11.

13. A method for promoting the growth of an eel, comprising the step of feeding an eel feed composition according to any one of claims 1 to 11.

14. Use of the eel feed composition of any one of claims 1 to 11 for promoting eel growth.

Images