Gene expression regulation for gramineous plants

Abstract

The present invention addresses the problem of providing: a polynucleotide capable of increasing or decreasing the expression level of APO1 gene of a gramineous plant; and a gramineous plant in which at least one selected from the group consisting of the number of spikelets per spike, the number of primary rachis-branches per spike, and the number of secondary rachis-branches per primary rachis-branch is increased or decreased, by introducing the polynucleotide.　The polynucleotide comprises a nucleotide sequence having a structure such that a mutation is introduced into a part or the whole of a conservative non-coding sequence having a function of regulating the expression of APO1 gene of a gramineous plant.

Description

Gene expression regulation in grasses

[0001] The present invention relates to the regulation of gene expression in grasses.

[0002] Although genetic modification and smart breeding techniques using DNA markers have been used as disruptive innovations to create groundbreaking new varieties, genome editing is expected to be a new technology. Most current genome editing techniques for crops involve the creation of stop codons in the coding region of genes, resulting in the loss of gene function (e.g., Patent Documents 1 to 3).

[0003] Currently, the target of crop development using genome editing is limited to inducing loss of gene function by deleting or inserting bases into protein-coding regions, and the potential of the technology and the potential of crops has not been fully utilized.

[0004] On the other hand, the APO1 (Aberrant Panicle Organization 1) gene (Patent Document 4) is known to control the spikelet number in grasses, and it is known that knocking out the APO1 gene reduces the spikelet number.

[0005] Japanese Patent Publication No. 2020-130174 Japanese Patent Publication No. 2019-126339 Japanese Patent Publication No. 2015-192662 Japanese Patent Publication No. 2005-278499

[0006] The present invention aims to provide a polynucleotide that can increase or decrease the expression level of the APO1 gene in a grass plant, and to provide a grass plant in which, by introducing the polynucleotide, at least one characteristic selected from the group consisting of the number of spikelets per panicle, the number of primary rachis-branches per panicle, and the number of secondary rachis-branches per number of primary rachis-branches is increased or decreased.

[0007] In order to solve the above problems, the inventors conducted extensive research and discovered that the number of spikelets, primary rachis-branches, and secondary rachis-branches can be controlled by mutating a conserved non-coding sequence that has the function of regulating the expression of the APO1 gene in grasses.

[0008] The present invention was completed based on these findings and includes the following broad aspects. [Item 1] A polynucleotide comprising a nucleotide sequence in which a mutation has been introduced into all or part of a conserved non-coding sequence that functions to regulate the expression of the APO1 gene of a grass family plant. [Item 2] The polynucleotide of Item 1, wherein the conserved non-coding sequence is a sequence located 3.4 to 3.7 kbp upstream from the transcription start site of the APO1 gene of a grass family plant. [Item 3] The polynucleotide of Item 1 or 2, wherein the grass family plant is rice. [Item 4] The polynucleotide of any one of Items 1 to 3, which is any one of (1) to (4) below: (1) A polynucleotide comprising a nucleotide sequence represented by any of SEQ ID NOs: 2 to 28, 54 to 59. (2) A polynucleotide comprising a nucleotide sequence represented by any of SEQ ID NOs: 2 to 28, 54 to 59 in which one or more nucleotides have been substituted, added, or deleted. (3) A polynucleotide comprising a nucleotide sequence having 90% or more identity to a nucleotide sequence represented by any of SEQ ID NOs: 2 to 28, 54 to 59. (4) A polynucleotide comprising a nucleotide sequence that hybridizes under stringent conditions to a nucleotide sequence complementary to any one of SEQ ID NOs: 2 to 28 and 54 to 59. [Item 5] A grass plant comprising the polynucleotide of any one of Items 1 to 4, wherein at least one selected from the group consisting of the number of spikelets per panicle, the number of primary rachis-branches per panicle, and the number of secondary rachis-branches per number of primary rachis-branches is increased or decreased relative to a wild-type strain. [Item 6] The grass plant of Item 5, wherein the increase or decrease in the number of spikelets per panicle is 0.5 to 3 times relative to a wild-type strain. [Item 7] The grass plant of Item 5 or 6, wherein the increase or decrease in the number of primary rachis-branches per panicle is 0.7 to 2 times relative to a wild-type strain. [Item 8] The grass plant of any one of Items 5 to 7, wherein the increase or decrease in the number of secondary rachis-branches per number of primary rachis-branches is 0.5 to 5 times relative to a wild-type strain. [Item 9] A grass plant that is a progeny individual of the grass plant according to any one of Items 5 to 8. [Item 10] A seed of the grass plant according to any one of Items 5 to 9.[Item 11] A method for producing a grass plant in which at least one characteristic selected from the group consisting of the number of spikelets per panicle, the number of primary rachis-branches per panicle, and the number of secondary rachis-branches per number of primary rachis-branches is increased or decreased compared to a wild-type strain, the method comprising the step of introducing a mutation into part or all of a conserved non-coding sequence in a grass plant that has the function of regulating expression of the APO1 gene. [Item 12] The production method according to Item 11, wherein the conserved non-coding sequence is a sequence located in a region 3.4 to 3.7 kbp upstream from the transcription start site of the APO1 gene of the grass plant. [Item 13] The production method according to Item 11 or 12, wherein the conserved non-coding sequence is any of the following (i) to (iv): (i) a nucleotide sequence represented by SEQ ID NO: 1 or 53; (ii) a nucleotide sequence in which one or several bases are substituted, added, or deleted in the nucleotide sequence represented by SEQ ID NO: 1 or 53; or (iii) a nucleotide sequence having 90% or more identity to the nucleotide sequence represented by SEQ ID NO: 1 or 53. (iv) A nucleotide sequence that hybridizes under stringent conditions with a nucleotide sequence complementary to the nucleotide sequence represented by SEQ ID NO: 1 or 53.

[0009] According to the present invention, a polynucleotide capable of increasing or decreasing the expression level of the APO1 gene in a grass plant is provided, and by introducing a mutation into the polynucleotide, a grass plant can be provided in which at least one characteristic selected from the group consisting of the number of spikelets per panicle, the number of primary rachis-branches per panicle, and the number of secondary rachis-branches per number of primary rachis-branches is increased or decreased.

[0010] This shows an overview of the APO1 gene and its nearby conserved non-coding sequences. This shows an alignment of the CNS3 sequences of the APO1 genes of grasses. Note that "*" indicates a conserved sequence. Furthermore, "." indicates a quasi-conserved sequence, which is a locus consisting of only two types of pyrimidine bases (T / C) or only two types of purine bases (A / G). This shows an overview of the CNS3 genome-edited plants. This shows the results of analyzing the APO1 gene expression level in young panicles of the APO1 CNS3 genome-edited plants. This shows the results of analyzing the number of spikelets per panicle in the CNS3 genome-edited plants. This shows the results of analyzing the number of primary rachis-branches per panicle in the CNS3 genome-edited plants. This shows the results of analyzing the number of secondary rachis-branches per number of primary rachis-branches in the CNS3 genome-edited plants. This shows an overview of the CNS3 genome-edited plants of Kasalath. This shows the results of analyzing the number of spikelets per panicle, the number of primary rachis-branches per panicle, and the number of secondary rachis-branches per number of primary rachis-branches in the CNS3 genome-edited plants (Hetero -2 / -3). Since the mutant is in the T0 generation, the number of mutant individuals is 1.

[0011] As used herein, singular forms (e.g., a, an, the) include both the singular and the plural, unless otherwise specified herein or clearly contradictory in context. As used herein, "comprise" encompasses "consist essentially of" and "consist only of." As used herein, "conserved noncoding sequence (CNS)" refers to a nucleotide sequence that is detected as a highly conserved region by genome comparison between biological species and does not encode a protein. "Highly conserved" here means that the degree of conservation, as determined using, for example, phaastCons software, is at least 0.1, preferably 0.2 or more, more preferably 0.3 or more, even more preferably 0.4 or more, particularly preferably 0.5 or more, and most preferably 0.6 or more.

[0012] As used herein, "upstream" and "downstream" in relation to a gene refer to upstream and downstream in the transcription direction of the gene, where "upstream" refers to the 5' side of the gene, and "downstream" refers to the 3' side of the gene.

[0013] As used herein, the term "wild strain" refers to a plant that originally existed in nature, i.e., a plant whose genes have not been subjected to artificial mutation treatment.

[0014] The present invention provides a polynucleotide comprising a nucleotide sequence in which a mutation has been introduced into part or all of a conserved non-coding sequence that has the function of regulating the expression of the APO1 gene of a grass family plant.

[0015] Examples of grass plants in the present invention include rice, corn bramble, wheat, barley, sorghum, corn, foxtail millet, panic grass, Aegilops sieboldii, wheat bramble, oats, rye, sugarcane, millet, barnyard millet, etc. Among these, rice, corn bramble, wheat bramble, wheat, barley, sorghum, corn, foxtail millet, and panic grass are preferred.

[0016] The grass plant of the present invention may be a wild species or a cultivated species, or may be a genetically modified or genome-edited version of these plants.

[0017] The APO1 (Aberrant Panicle Organization 1) gene is located in the region 27480082-27481453 of chromosome 6 in japonica rice (Oryza sativa) and controls grain number. The nucleotide sequence of the APO1 gene in japonica rice (Oryza sativa) has been registered with GenBank, provided by the National Center for Biotechnology Information (NCBI), under accession number AP014962. Note that if multiple revisions are registered, the most recent revision is understood to be the one being referred to.

[0018] As used herein, the term "APO1 gene" is not limited to rice APO1, but also includes homologs of APO1 from other species (e.g., barley, wheat, corn, oats, rye, sugarcane, millet, foxtail millet, barnyard millet, etc.). The nucleotide sequence of such a homolog is, for example, a nucleotide sequence having one or several (about 1 to several tens, preferably about 1 to 30, more preferably about 1 to 15, even more preferably about 1 to 10, and particularly preferably about 1 to 5) substitutions, additions, insertions, or deletions relative to the nucleotide sequence of rice APO1, or a nucleotide sequence having, for example, 85% or more, preferably 90% or more, more preferably 95% or more, and most preferably 99% or more sequence identity to the nucleotide sequence of rice APO1.

[0019] As used herein, "regulating the expression of the APO1 gene" means regulating the expression level of the APO1 gene and increasing or decreasing the expression level of the APO1 gene compared to the wild-type strain. "Having the function of regulating the expression of the APO1 gene" means having the function of increasing or decreasing the expression level of the APO1 gene compared to the wild-type strain. Whether a conserved non-coding sequence of the present invention "has the function of regulating the expression of the APO1 gene" can be determined by observing whether the expression level of the APO1 gene increases or decreases compared to the wild-type strain when a mutation is introduced into the conserved non-coding sequence.

[0020] The conserved non-coding sequence of the present invention preferably includes a sequence located in a region 3.4 to 3.7 kbp upstream from the transcription start site of the APO1 gene of a grass family plant (this sequence may be referred to as "APO1 CNS3" in this specification). Even if the position of the sequence is somewhat shifted from the region 3.4 to 3.7 kbp upstream from the transcription start site of the APO1 gene, the conserved non-coding sequence APO1 CNS3 of the present invention is encompassed as long as it is a nucleotide sequence homologous to any of the following (i) to (iv). Because this region is a region whose sequence is conserved among grass family plants, it is predicted to have the function of regulating the expression of the APO1 gene not only in rice but also in other grass family plants.

[0021] The conserved non-coding sequence of the present invention is preferably any one of the following (i) to (iv). The base length of the conserved non-coding sequence of the present invention is not particularly limited as long as it contains any one of the following base sequences (i) to (iv), and is, for example, 100 to 210 bp: (i) A base sequence represented by SEQ ID NO: 1 or 53. (ii) A base sequence in which one or several bases have been substituted, added, or deleted in the base sequence represented by SEQ ID NO: 1 or 53. (iii) A base sequence having 90% or more identity with the base sequence represented by SEQ ID NO: 1 or 53. (iv) A base sequence that hybridizes under stringent conditions with a base sequence complementary to the base sequence represented by SEQ ID NO: 1 or 53.

[0022] Here, the nucleotide sequence represented by SEQ ID NO: 1 represents a conserved non-coding sequence (APO1 CNS3) present in the region 27484894-27485103 of chromosome 6 in the japonica species of rice (Oryza sativa) (the region 3441 to 3650 bp upstream from the transcription start site of the APO1 gene). Note that even if the position of the sequence is slightly shifted from the region 27484894-27485103 of chromosome 6, the nucleotide sequence is still encompassed as a conserved non-coding sequence in the present invention as long as it is homologous to SEQ ID NO: 1. The sequence of CNS3 located in the region of 27484894-27485103 on chromosome 6 in japonica rice (Oryza sativa japonica IRGSP-1.0): GCATCATCCAGTTTGTCTCTTACCACTTCCACTCTCGTGTCACTGTCCCTTGTGCTAAGCTAGCCCTAGAAAGCAGGCAGAGATCCCTAGCTACTACTACTACTACGCGTCTACGCCCTAGCTCAGCTCATGCTCCCTGCATTTTCGCGTTTGCTCTGCTACTGCTACTCCACTTCCATTTTTGCACAGTGCTATCCCTTCCTGAAATGC (SEQ ID NO: 1)

[0023] The base sequence represented by SEQ ID NO: 53 represents a conserved non-coding sequence (APO1 CNS3) present in the upstream region of the APO1 gene of Kasalath (Oryza sativa L. variety, Kasalath), an indica variety of rice (Oryza sativa). The sequence of CNS3 of Kasalath (Oryza sativa L. variety, Kasalath), an indica variety of rice, is: GCATCATCCAGTTTGTCTCTTACCACTTCCACTCTCGTGTCACTGTCCCTTGCTAAGCTAGCCCTAGAAAGCAGGCAGAGATCCCCAGCTACTACTACTACTACGCCCTAGCTCAGCTCCCTGCATTTTCGCGTTTGATCTGCTACTGCTACTCCACTTCCATTTTTGCACAGTGTCATCCCTTTCTGAAATGC (SEQ ID NO: 53)

[0024] In the above (i), the base sequence represented by SEQ ID NO: 1 is included, which has the function of regulating the expression of the APO1 gene of grasses.

[0025] In (ii) above, the number of one or several bases to be substituted, deleted, added, or inserted is not particularly limited, as long as it is an integer of 1 or more. For example, it can be about 1 to several tens of bases, preferably about 1 to 20, more preferably about 1 to 15, even more preferably about 1 to 10, and particularly preferably about 1 to 5. This includes base sequences in which one or several bases have been substituted, added, or deleted in the base sequence represented by SEQ ID NO: 1, and which have the function of regulating the expression of the APO1 gene in grasses.

[0026] In one aspect, the number of one or more bases to be substituted, added, or deleted can be about 1 to 21 so that the base sequence has 90% or more identity with the base sequence of SEQ ID NO: 1, preferably about 1 to 10 so that the identity is 95% or more, more preferably about 1 to 6 so that the identity is 97% or more, even more preferably about 1 to 4 so that the identity is 98% or more, and particularly preferably about 1 to 2 so that the identity is 99% or more.

[0027] In the above (iii), the identity of the nucleotide sequence can be 90% or more, preferably 95% or more, more preferably 97% or more, even more preferably 98% or more, and particularly preferably 99% or more. The homology or identity of the nucleotide sequence can be less than 100%. The homology and identity between nucleotide sequences can be determined using known algorithms such as BLAST. The nucleotide sequence having 90% or more identity with the nucleotide sequence represented by SEQ ID NO: 1 and having the function of regulating the expression of the APO1 gene in grasses is also included.

[0028] In the above (iv), "stringent conditions" refers to conditions under which only specific hybridization occurs and nonspecific hybridization does not occur. Examples of stringent conditions include, but are not limited to, hybridization in 1x SSC (0.9 M NaCl, 0.09 M trisodium citrate) or 6x SSPE (3 M NaCl, 0.2 M NaH2PO4, 20 mM EDTA 2Na, pH 7.4) at 42°C, followed by washing with 0.5x SSC at 42°C. Such conditions are described, for example, in M.R. Green et al., Molecular Cloning: A Laboratory Manual, Fourth Edition, Cold Spring Harbor Laboratory Press (2012).

[0029] In the present invention, the expression of the APO1 gene can be controlled by introducing a mutation into part or all of a conserved non-coding sequence (preferably APO1 CNS3) that functions to control the expression of the APO1 gene in grasses. More specifically, by introducing a mutation into part or all of the conserved non-coding sequence, the expression level of the APO1 gene can be increased or decreased compared to that of a wild-type strain. Furthermore, by increasing or decreasing the expression level of the APO1 gene compared to that of a wild-type strain, it is possible to increase or decrease at least one characteristic selected from the group consisting of the number of spikelets per panicle, the number of primary rachis-branches per panicle, and the number of secondary rachis-branches per number of primary rachis-branches compared to that of a wild-type strain. By introducing a mutation into part or all of a conserved non-coding sequence that functions to control the expression of the APO1 gene in grasses, it is possible to produce grasses in which at least one characteristic selected from the group consisting of the number of spikelets per panicle, the number of primary rachis-branches per panicle, and the number of secondary rachis-branches per number of primary rachis-branches is increased or decreased compared to that of a wild-type strain. In one embodiment, the increase or decrease in the number of spikelets per panicle relative to the wild-type strain is preferably 0.5 to 3 times that of the wild-type strain. The increase or decrease in the number of primary rachis-branches per panicle relative to the wild-type strain is preferably 0.7 to 2 times that of the wild-type strain. The increase or decrease in the number of secondary rachis-branches per number of primary rachis-branches relative to the wild-type strain is preferably 0.5 to 5 times that of the wild-type strain.

[0030] The mutation introduced into the conserved non-coding sequence (preferably APO1 CNS3) is preferably a deletion, substitution, and / or insertion of one or more bases, more preferably a deletion of one or more bases. The term "multiple" is not particularly limited as long as increasing or decreasing the expression level of the APO1 gene compared to the wild-type strain can increase or decrease at least one of the following relative to the wild-type strain: the number of spikelets per panicle, the number of primary rachis-branches per panicle, and the number of secondary rachis-branches per number of primary rachis-branches. Examples of such mutations include: 2 to 210 bases, 2 to 205 bases, 2 to 200 bases, 2 to 195 bases, 2 to 190 bases, 2 to 185 bases, 2 to 180 bases, 2 to 175 bases, 2 to 170 bases, 2 to 165 bases, 2 to 160 bases, 2 to 155 bases, 2 to 150 bases, 2 to 145 bases, Examples include 2 to 140 bases, 2 to 135 bases, 2 to 130 bases, 2 to 125 bases, 2 to 120 bases, 2 to 115 bases, 2 to 110 bases, 2 to 105 bases, 2 to 100 bases, 2 to 95 bases, 2 to 90 bases, 2 to 85 bases, 2 to 80 bases, 2 to 75 bases, 2 to 70 bases, 2 to 65 bases, 2 to 60 bases, 2 to 55 bases, 2 to 50 bases, 2 to 45 bases, 2 to 40 bases, 2 to 35 bases, 2 to 30 bases, 2 to 25 bases, 2 to 20 bases, 2 to 15 bases, 2 to 10 bases, 2 to 9 bases, 2 to 8 bases, 2 to 7 bases, 2 to 6 bases, 2 to 5 bases, 2 to 4 bases, 2 or 3 bases, and 2 bases. Furthermore, the number of mutations introduced into the conserved non-coding sequence may be one or multiple (for example, two, three or less, five or less, ten or less, etc.).

[0031] The mutation introduced into the conserved non-coding sequence (preferably APO1 CNS3) is not particularly limited as long as it increases or decreases the expression level of the APO1 gene compared to the wild-type strain, thereby increasing or decreasing at least one of the following: the number of spikelets per panicle, the number of primary rachis-branches per panicle, and the number of secondary rachis-branches per number of primary rachis-branches, compared to the wild-type strain. Examples of the mutation include, for example, 2% or more, 5% or more, 10% or more, 15% or more, 20% or more, 25% or more, 30% or more, 35% or more, 40% or more, 45% or more, and 50% or more of the entire conserved non-coding sequence. Furthermore, the mutation is preferably a deletion, substitution, and / or insertion, and more preferably a deletion.

[0032] Furthermore, depending on the region into which the mutation is introduced, the degree of increase or decrease in at least one selected from the group consisting of the number of spikelets per panicle, the number of primary rachis-branches per panicle, and the number of secondary rachis-branches per number of primary rachis-branches can be adjusted in multiple stages.

[0033] APO1 CNS3 has two highly evolutionarily conserved regions at the 5' and 3' ends, with the central region being less conserved. Based on the degree of conservation, APO1 CNS3 from Oryza sativa japonica can be classified into the following three regions. APO1 CNS3 from other grasses can also be similarly classified based on sequences homologous to the sequences listed below. Note that the less conserved regions are specific to some grasses (such as the Oryza and Leersia genera), and not all grasses have homologous sequences. - 5'-side highly conserved region 6:27484894-27484966 GCATCATCCAGTTTGTCTCTTACCACTTCCACTCTCGTGTCACTGTCCCTTGTGCTAAGCTAGCCCTAGAAAG (SEQ ID NO: 49) - Lowly conserved region 6:27484967-27485017 CAGGCAGAGATCCCTAGCTACTACTACTACTACGCGTCTACGCCCTAGCT (SEQ ID NO: 50) - 3'-side highly conserved region 6:27485018-27485103 CAGCTCATGCTCCCTGCATTTTCGCGTTTGCTCTGCTACTGCTACTCCACTTCCATTTTTGCACAGTGCTATCCCTTCCTGAAATGC (SEQ ID NO: 51)

[0034] By introducing a mutation of 1 to 160 bases (1 to 150 bases, 1 to 140 bases, 1 to 130 bases, 1 to 120 bases, 1 to 110 bases, 1 to 100 bases, 1 to 90 bases, 1 to 80 bases, 1 to 70 bases, 1 to 60 bases, 1 to 50 bases, 1 to 40 bases, 1 to 30 bases, 1 to 20 bases, 1 to 10 bases, 1 to 9 bases, 1 to 8 bases, 1 to 7 bases, 1 to 6 bases, 1 to 5 bases, 1 to 4 bases, 1 to 3 bases, 1 to 2 bases, 1 base, etc.) into a highly conserved region, it is possible to reduce at least one characteristic selected from the group consisting of the number of spikelets per panicle, the number of primary rachis-branches per panicle, and the number of secondary rachis-branches per number of primary rachis-branches, compared to a wild-type strain. In particular, introduction of a mutation of 1 to 73 bases (e.g., 1 to 70 bases, 1 to 60 bases, 1 to 50 bases, 1 to 40 bases, 1 to 30 bases, 1 to 20 bases, 1 to 10 bases, 1 to 9 bases, 1 to 8 bases, 1 to 7 bases, 1 to 6 bases, 1 to 5 bases, 1 to 4 bases, 1 to 3 bases, 1 to 2 bases, 1 base, etc.) into the 5'-side highly conserved region significantly reduces at least one of the following: the number of spikelets per panicle, the number of primary rachis-branches per panicle, and the number of secondary rachis-branches per number of primary rachis-branches. Examples of reductions relative to the wild-type strain include a decrease in the number of spikelets per panicle of 0.5 to less than 1-fold that of the wild-type strain, a decrease in the number of primary rachis-branches per panicle of 0.7 to less than 1-fold that of the wild-type strain, and a decrease in the number of secondary rachis-branches per number of primary rachis-branches of 0.5 to less than 1-fold that of the wild-type strain. The mutation is preferably a deletion, substitution, and / or insertion, and more preferably a deletion.

[0035] On the other hand, by introducing a mutation of 1 to 9 bases (e.g., 1 to 8 bases, 1 to 7 bases, 1 to 6 bases, 1 to 5 bases, 1 to 4 bases, 1 to 3 bases, 1 to 2 bases, or 1 base) into the MADS box region of CNS3 (CCATTTTTG, including Oryza sativa japonica 6:27485069-27485077 and homologous sequences in grasses) located in the highly conserved 3' region, it is possible to increase at least one characteristic selected from the group consisting of the number of spikelets per panicle, the number of primary rachis-branches per panicle, and the number of secondary rachis-branches per number of primary rachis-branches to a high level compared to the wild-type strain. The tendency for an increase is not lost even if mutations are simultaneously introduced into regions other than the MADS box (e.g., highly conserved regions other than the MADS box). Here, "high level increase" means, for example, that the number of spikelets per panicle is increased by about 1.5 to 3 times compared to the wild-type strain, that the number of primary rachis-branches per panicle is increased by about 1.5 to 2 times compared to the wild-type strain, and that the number of secondary rachis-branches per number of primary rachis-branches is increased by about 2 to 5 times compared to the wild-type strain. Note that the mutation is preferably a deletion, substitution, and / or insertion, and more preferably a deletion.

[0036] Furthermore, by introducing a mutation of 1 to 24 bases (1 to 22 bases, 1 to 20 bases, 1 to 18 bases, 1 to 16 bases, 1 to 14 bases, 1 to 12 bases, 1 to 10 bases, 1 to 9 bases, 1 to 8 bases, 1 to 7 bases, 1 to 6 bases, 1 to 5 bases, 1 to 4 bases, 1 to 3 bases, 1 to 2 bases, 1 base, etc.) into the C2H2 binding site of CNS3 present in the 5' highly conserved region and the surrounding region (TGTCTCTTACCACTTCCACTCTCG (SEQ ID NO: 52)), including Oryza sativa japonica 6:27484907-27484930 and homologous sequences in grasses), it is possible to increase at least one characteristic selected from the group consisting of the number of spikelets per panicle, the number of primary rachis-branches per panicle, and the number of secondary rachis-branches per number of primary rachis-branches compared to the wild-type strain. However, if mutations are simultaneously introduced into regions other than the C2H2 binding site and its surrounding region (e.g., highly conserved regions other than the C2H2 binding site), the tendency for an increase is reduced or lost. Here, an increase relative to the wild-type strain means, for example, an increase of more than 1- to 3-fold compared to the wild-type strain in the number of spikelets per panicle, an increase of more than 1- to 2-fold compared to the wild-type strain in the number of primary rachis-branches per panicle, and an increase of more than 1- to 5-fold compared to the wild-type strain in the number of secondary rachis-branches per number of primary rachis-branches. The mutations are preferably deletions, substitutions, and / or insertions, with deletions being more preferred.

[0037] By introducing a mutation of 1 to 50 bases (e.g., 1 to 40 bases, 1 to 30 bases, 1 to 20 bases, 1 to 10 bases, 1 to 9 bases, 1 to 8 bases, 1 to 7 bases, 1 to 6 bases, 1 to 5 bases, 1 to 4 bases, 1 to 3 bases, 1 to 2 bases, or 1 base) into a lowly conserved region, at least one selected from the group consisting of the number of spikelets per panicle, the number of primary rachis-branches per panicle, and the number of secondary rachis-branches per number of primary rachis-branches can be increased to a low level compared to the wild-type strain. However, if a mutation is simultaneously introduced into a highly conserved region, this tendency for an increase is lost. Here, "increased to a low level" includes, for example, an increase of more than 1- to 1.5-fold compared to the wild-type strain in the number of spikelets per panicle, an increase of more than 1- to 1.5-fold compared to the wild-type strain in the number of primary rachis-branches per panicle, and an increase of more than 1- to 2-fold compared to the wild-type strain in the number of secondary rachis-branches per number of primary rachis-branches. The mutation is preferably a deletion, substitution, and / or insertion, more preferably a deletion or insertion, and particularly preferably a deletion.

[0038] Methods for introducing mutations into conserved non-coding sequences include, but are not limited to, chemical mutagenesis, physical mutagenesis, methods for introducing transposons or the like into genomic DNA, and methods using proteins that act on DNA or RNA (genome editing enzymes).

[0039] An example of a chemical mutagenesis method is treating seeds with a chemical mutagen. There are no particular limitations on the chemical mutagen, but examples include ethyl methanesulfonate (EMS), N-ethyl-N-nitrosourea (ENU), N-methyl-N-nitrosourea (NNU), sodium azide, sodium bisulfite, hydroxylamine, N-methyl-N'-nitro-N-nitroguanidine (MNNG), N-methyl-N'-nitrosoguanidine (NTG), O-methylhydroxylamine, nitrous acid, formic acid, and nucleotide analogs.

[0040] Examples of physical mutagenesis methods include fast neutron irradiation, gamma ray irradiation, heavy ion beam (HIB) irradiation, and ultraviolet irradiation.

[0041] Methods for introducing transposons or the like into genomic DNA include, for example, methods for inserting transposons such as TOS17, T-DNA, or the like into genomic DNA.

[0042] Methods using proteins (genome editing enzymes) that act on DNA or RNA include, for example, Crispr-Cas enzymes (e.g., CRISPR-Cas9, etc.), PRR motifs, endonucleases, zinc finger nucleases (ZFNs), TALENs (transcription activator-like effector nucleases), transposases, and site-specific recombinases. Among these, CRISPR-Cas9 is preferred.

[0043] As mentioned above, various methods for introducing mutations are known, but the preferred method for introducing mutations into genes in the present invention is genome editing. By using genome editing, targeted genes can be disrupted with high efficiency. In the case of gene disruption by genome editing, only the targeted gene can be disrupted without leaving any trace of genetic modification, so some countries do not consider such plants to be genetically modified.

[0044] Furthermore, only desirable mutants can be selectively selected from plants into which mutations have been introduced. Furthermore, mutation introduction by the above methods can be confirmed by known methods (DNA sequencing, PCR, microarray analysis, Southern blotting, etc.). Whether or not a mutation has been introduced into the conserved non-coding sequence of the present invention can be determined by comparing the sequence before and after mutation introduction, for example.

[0045] Introduction of a mutation into a conserved non-coding sequence according to the present invention can be carried out, depending on the method of mutation introduction, on, for example, plant tissues such as plants, roots, stems, leaves, seeds, embryos, ovules, ovaries, shoot tips, pollen, etc., slices thereof, cells, callus, protoplasts, etc.

[0046] Alternatively, the DNA encoding the transposon, DNA encoding a protein that acts on DNA or RNA, DNA encoding double-stranded RNA, DNA encoding antisense RNA, DNA encoding RNA with ribozyme activity, etc. may be inserted into a vector and introduced into plant cells. The vector into which the DNA for introducing a mutation into the conserved non-coding sequence of the present invention is inserted is not particularly limited as long as it is capable of expressing the inserted gene in the cell, and may contain a promoter for constitutive or inducible expression of the DNA.

[0047] The DNA, the vector containing the inserted DNA, the protein, etc. can be introduced into cells by known methods, such as the in planta particle bombardment (iPB) method, the Agrobacterium method, the particle gun method, the polyethylene glycol method, the electroporation method, the liposome method, the calcium phosphate precipitation method, the lipofection method, and the microinjection method.

[0048] As described above, the present invention can increase or decrease at least one characteristic selected from the group consisting of the number of spikelets per panicle, the number of primary rachis-branches per panicle, and the number of secondary rachis-branches per number of primary rachis-branches in a grass plant by using the above-described DNA or a vector into which the DNA has been inserted. Therefore, the present invention provides a pharmaceutical agent for increasing or decreasing at least one characteristic selected from the group consisting of the number of spikelets per panicle, the number of primary rachis-branches per panicle, and the number of secondary rachis-branches per number of primary rachis-branches in a grass plant, comprising as an active ingredient at least one selected from the group consisting of the above-described DNA and a vector into which the DNA has been inserted. Such a pharmaceutical agent may comprise two or more active ingredients in a single composition, or may be in the form of a kit in which two or more active ingredients are contained in separate compositions. In addition to the above substances, the pharmaceutical agent may also contain a buffer, stabilizer, preservative, antiseptic, etc.

[0049] The polynucleotide of the present invention, which comprises a base sequence in which a mutation has been introduced into part or all of a conserved non-coding sequence that has the function of regulating the expression of the APO1 gene of a grass family plant, preferably comprises a base sequence in which a mutation has been introduced into part or all of the base sequence of the polynucleotides (i) to (iv) above.

[0050] The mutation is preferably a deletion, substitution, and / or insertion of one or more bases, more preferably a deletion of one or more bases. The term "multiple" is not particularly limited as long as it can increase or decrease, relative to the wild-type strain, at least one selected from the group consisting of the number of spikelets per panicle, the number of primary rachis-branches per panicle, and the number of secondary rachis-branches per number of primary rachis-branches, by increasing or decreasing the expression level of the APO1 gene compared to the wild-type strain. Examples of such mutations include: 2 to 210 bases, 2 to 205 bases, 2 to 200 bases, 2 to 195 bases, 2 to 190 bases, 2 to 185 bases, 2 to 180 bases, 2 to 175 bases, 2 to 170 bases, 2 to 165 bases, 2 to 160 bases, 2 to 155 bases, 2 to 150 bases, 2 to 145 bases, Examples include 2 to 140 bases, 2 to 135 bases, 2 to 130 bases, 2 to 125 bases, 2 to 120 bases, 2 to 115 bases, 2 to 110 bases, 2 to 105 bases, 2 to 100 bases, 2 to 95 bases, 2 to 90 bases, 2 to 85 bases, 2 to 80 bases, 2 to 75 bases, 2 to 70 bases, 2 to 65 bases, 2 to 60 bases, 2 to 55 bases, 2 to 50 bases, 2 to 45 bases, 2 to 40 bases, 2 to 35 bases, 2 to 30 bases, 2 to 25 bases, 2 to 20 bases, 2 to 15 bases, 2 to 10 bases, 2 to 9 bases, 2 to 8 bases, 2 to 7 bases, 2 to 6 bases, 2 to 5 bases, 2 to 4 bases, 2 or 3 bases, and 2 bases. Furthermore, the number of mutations introduced into the conserved non-coding sequence may be one or multiple (for example, two, three or less, five or less, ten or less, etc.).

[0051] The mutation is not particularly limited as long as it increases or decreases the expression level of the APO1 gene compared to the wild-type strain, thereby increasing or decreasing at least one of the following relative to the wild-type strain: the number of spikelets per panicle, the number of primary rachis-branches per panicle, and the number of secondary rachis-branches per number of primary rachis-branches. Examples of such mutations include 2% or more, 5% or more, 10% or more, 15% or more, 20% or more, 25% or more, 30% or more, 35% or more, 40% or more, 45% or more, and 50% or more of the entire conserved non-coding sequence. The mutation is preferably a deletion, substitution, and / or insertion, and more preferably a deletion.

[0052] The method for introducing the mutation can be appropriately selected from the methods described above.

[0053] The position at which the mutation is introduced is not particularly limited as long as it is capable of controlling the expression of the APO1 gene of grasses, and may be any position in the conserved non-coding sequence. However, in order to increase the expression level of the APO1 gene relative to the wild-type strain and to increase at least one of the following values ​​selected from the group consisting of the number of spikelets per panicle, the number of primary rachis-branches per panicle, and the number of secondary rachis-branches per number of primary rachis-branches relative to the wild-type strain, as described above, it is preferable that the mutation be introduced into any of the following regions in the conserved non-coding sequence (CNS3): the low-conserved region (excluding those in which a mutation has been introduced into a highly conserved region), the MADS box, the C2H2 binding site and its surrounding region (excluding those in which a mutation has been introduced into a highly conserved region), and it is more preferable that the mutation be introduced into the MADS box region.

[0054] The polynucleotide of the present invention is preferably any one of the following (1) to (4): (1) A polynucleotide comprising a nucleotide sequence represented by any one of SEQ ID NOs: 2 to 28, 54 to 59. (2) A polynucleotide comprising a nucleotide sequence in which one or several nucleotides have been substituted, added, or deleted in the nucleotide sequence represented by any one of SEQ ID NOs: 2 to 28, 54 to 59. (3) A polynucleotide comprising a nucleotide sequence having 90% or more identity to the nucleotide sequence represented by any one of SEQ ID NOs: 2 to 28, 54 to 59. (4) A polynucleotide comprising a nucleotide sequence that hybridizes under stringent conditions to a nucleotide sequence complementary to the nucleotide sequence represented by any one of SEQ ID NOs: 2 to 28, 54 to 59.

[0055] Here, the nucleotide sequences represented by SEQ ID NOs: 2 to 28 are sequences in which a mutation (deletion, substitution, or insertion) has been introduced into a conserved non-coding sequence present in a region 3441 to 3650 bp upstream from the transcription start site of the APO1 gene on chromosome 6 in japonica rice (Oryza sativa japonica).Furthermore, the nucleotide sequences represented by SEQ ID NOs: 54 to 59 are sequences in which a mutation (deletion, substitution, or insertion) has been introduced into a conserved non-coding sequence present in a region upstream of the APO1 gene on chromosome 6 in indica rice (Oryza sativa indica).

[0056]

[0057]

[0058]

[0059]

[0060] In the above (1), polynucleotides containing the base sequences represented by SEQ ID NOs: 2 to 28 and 54 to 59 are included, and in a mutant strain into which the polynucleotide has been introduced, the expression level of the APO1 gene is increased or decreased compared to the wild-type strain.

[0061] In (2) above, the number of one or several bases to be substituted, deleted, added, or inserted is not particularly limited, as long as it is an integer of 1 or more. For example, it can be about 1 to several tens of bases, preferably about 1 to 20, more preferably about 1 to 15, even more preferably about 1 to 10, and particularly preferably about 1 to 5. Polynucleotides containing a base sequence in which one or several bases have been substituted, added, or deleted in the base sequence represented by SEQ ID NOs: 2 to 28 are encompassed, and in a mutant strain into which the polynucleotide has been introduced, the expression level of the APO1 gene is increased or decreased compared to the wild-type strain.

[0062] In the above (3), the identity of the nucleotide sequence can be 90% or more, preferably 95% or more, more preferably 97% or more, even more preferably 98% or more, and particularly preferably 99% or more. The homology or identity of the nucleotide sequence can be less than 100%. The homology and identity between nucleotide sequences can be determined using known algorithms such as BLAST. Polynucleotides containing a nucleotide sequence that is 90% or more identical to the nucleotide sequences represented by SEQ ID NOs: 2 to 28 are included, and in a mutant strain into which the polynucleotide has been introduced, the expression level of the APO1 gene is increased or decreased compared to the wild-type strain.

[0063] In (4) above, "stringent conditions" refers to conditions under which only specific hybridization occurs and nonspecific hybridization does not occur. Examples of stringent conditions include, but are not limited to, hybridization in 1x SSC (0.9 M NaCl, 0.09 M trisodium citrate) or 6x SSPE (3 M NaCl, 0.2 M NaH2PO4, 20 mM EDTA 2Na, pH 7.4) at 42°C, followed by washing with 0.5x SSC at 42°C. Such conditions are described, for example, in M.R. Green et al., Molecular Cloning: A Laboratory Manual, Fourth Edition, Cold Spring Harbor Laboratory Press (2012).

[0064] Among the polynucleotides (1) to (4) above, mutants containing the following polynucleotides are preferred because they increase the expression level of APO1 compared to the wild-type strain, and increase the number of spikelets per panicle, the number of primary rachis-branches per panicle, and the number of secondary rachis-branches per number of primary rachis-branches compared to the wild-type strain (for example, the number of spikelets per panicle is about 1 to 3 times that of the wild-type strain, the number of primary rachis-branches per panicle is about 1 to 2 times that of the wild-type strain, and the number of secondary rachis-branches per number of primary rachis-branches is about 1 to 5 times that of the wild-type strain). (1a) A polynucleotide containing a nucleotide sequence represented by any one of SEQ ID NOs: 2 to 19, 54 to 59. (2a) A polynucleotide containing a nucleotide sequence represented by any one of SEQ ID NOs: 2 to 19, 54 to 59 in which one or several bases have been substituted, added, or deleted. (3a) A polynucleotide containing a nucleotide sequence having 90% or more identity to the nucleotide sequence represented by any one of SEQ ID NOs: 2 to 19, 54 to 59. (4a) A polynucleotide comprising a base sequence that hybridizes under stringent conditions with a base sequence complementary to any of the base sequences represented by SEQ ID NOs: 2 to 19 and 54 to 59.

[0065] Among these, mutants comprising the following polynucleotides are more preferred, since they have a particularly increased APO1 expression level compared to the wild-type strain, and the number of spikelets per panicle, the number of primary rachis-branches per panicle, and the number of secondary rachis-branches per number of primary rachis-branches compared to the wild-type strain (for example, the number of spikelets per panicle is about 1.5 to 3 times that of the wild-type strain, the number of primary rachis-branches per panicle is about 1.5 to 2 times that of the wild-type strain, and the number of secondary rachis-branches per number of primary rachis-branches is about 2 to 5 times that of the wild-type strain). (1a') A polynucleotide comprising a nucleotide sequence represented by any one of SEQ ID NOS: 2 to 12 and 54 to 59. (2a') A polynucleotide comprising a nucleotide sequence represented by any one of SEQ ID NOS: 2 to 12 and 54 to 59 in which one or several bases have been substituted, added, or deleted. (3a') A polynucleotide comprising a nucleotide sequence having 90% or more identity to the nucleotide sequence represented by any one of SEQ ID NOS: 2 to 12 and 54 to 59. (4a') A polynucleotide comprising a nucleotide sequence that hybridizes under stringent conditions with a nucleotide sequence complementary to any one of the nucleotide sequences represented by SEQ ID NOs: 2 to 12 and 54 to 59.

[0066] Furthermore, among the polynucleotides (1) to (4) above, mutants containing the following polynucleotides have a reduced expression level of APO1 compared to the wild-type strain, and a reduced number of spikelets per panicle, the number of primary rachis-branches per panicle, and the number of secondary rachis-branches per number of primary rachis-branches compared to the wild-type strain (for example, the number of spikelets per panicle is 0.5 to less than 1 times that of the wild-type strain, the number of primary rachis-branches per panicle is 0.7 to less than 1 times that of the wild-type strain, and the number of secondary rachis-branches per number of primary rachis-branches is 0.5 to less than 1 times that of the wild-type strain). (1b) A polynucleotide containing a nucleotide sequence represented by any of SEQ ID NOs: 20 to 28. (2b) A polynucleotide containing a nucleotide sequence represented by any of SEQ ID NOs: 20 to 28 in which one or more bases have been substituted, added, or deleted. (3b) A polynucleotide containing a nucleotide sequence having 90% or more identity to the nucleotide sequence represented by any of SEQ ID NOs: 20 to 28. (4b) A polynucleotide comprising a base sequence that hybridizes under stringent conditions with a base sequence complementary to any of the base sequences represented by SEQ ID NOs: 20 to 28.

[0067] In another aspect, the present invention provides a grass plant in which at least one of the following is increased or decreased relative to a wild-type strain: the number of spikelets per panicle, the number of primary rachis-branches per panicle, and the number of secondary rachis-branches per number of primary rachis-branches. The grass plant comprises a polynucleotide comprising a nucleotide sequence in which a mutation has been introduced into part or all of a conserved non-coding sequence that functions to regulate the expression of the APO1 gene of the grass plant.

[0068] In the grass plant, the increase or decrease in the number of spikelets per panicle relative to the wild-type strain is preferably 0.5 to 3 times that of the wild-type strain. The increase or decrease in the number of primary rachis-branches per panicle relative to the wild-type strain is preferably 0.7 to 2 times that of the wild-type strain. The increase or decrease in the number of secondary rachis-branches per number of primary rachis-branches relative to the wild-type strain is preferably 0.5 to 5 times that of the wild-type strain.

[0069] The grasses of the present invention, in which at least one characteristic selected from the group consisting of the number of spikelets per panicle, the number of primary rachis-branches per panicle, and the number of secondary rachis-branches per number of primary rachis-branches is increased or decreased relative to the wild-type strain, can be obtained by the above-mentioned method. Furthermore, once the grasses are obtained, progeny (progeny individuals) can be obtained from the plants by sexual or asexual reproduction. Preferably, the progeny individuals maintain the increase or decrease in the number of spikelets per panicle and / or the number of primary rachis-branches per panicle and / or the number of secondary rachis-branches per number of primary rachis-branches relative to the wild-type strain. "Maintaining the increase or decrease relative to the wild-type strain" means that the increase or decrease between the grasses and their progeny individuals relative to the wild-type strain is approximately the same. For example, the increase or decrease in the progeny individuals relative to the increase or decrease in the grasses is within a range of 0.8 to 1.2 times. Furthermore, plants can be mass-produced from propagation materials such as seeds, cuttings, stems, callus, and protoplasts of the plants, their progeny, or clones. The grasses of the present invention include progeny plants such as the "T0 generation," which is the regenerated generation that has been subjected to transformation treatment, the "T1 generation," which is the self-pollinated seeds of the T0 generation plants, hybrid plants obtained by crossbreeding these plants using them as a single parent, and their progeny plants.

[0070] The present invention will be described in more detail using examples, but is not limited to these examples. <Example 1> The nucleotide sequences of the APO1 genes of 11 monocotyledonous plant species (white yam, Taiwan banana, panic grass, foxtail millet, maize, sorghum, barley, Aegilops sieboldii, wheatgrass, snowdrop, and japonica rice) were obtained from EnsemblPlants (http: / / plants.ensembl.org). We then performed comparative genome analysis on these 11 species, nine grass species (panic grass, foxtail millet, maize, sorghum, barley, Aegilops sieboldii, Brachypodium nigricans, Brachypodium japonica, and Oryza sativa), and five species of the BEP clade (barley, Aegilops sieboldii, Brachypodium nigricans, Brachypodium japonica, and Oryza sativa), and identified conserved non-coding sequences located between 5,000 bp upstream and 5,000 bp downstream of the transcription start site of the APO1 gene (chromosome 6, 27480082-27481453) in Oryza sativa.

[0071] Specifically, pairwise alignments were performed using LASRZ (https: / / www.bx.psu.edu / miller_lab / ) for nine grass species retrieved from the EnsemblPlants database. Furthermore, multiple alignments were performed by combining the pairwise aligned sequences using MULTIZ (https: / / www.bx.psu.edu / miller_lab / ). Furthermore, the degree of conservation of the aligned sequences was quantified using phastCons (https: / / conpgen.cshl.edu / phast / ). Regions with a conservation degree greater than 0 (≥ 15 bp) were defined as conserved regions, and protein-coding regions were excluded from these conserved regions to identify conserved non-coding sequences.

[0072] As a result, three conserved non-coding sequences (CNS1: chromosome 6, 27478213-27478295; CNS2: chromosome 6, 27483827-27483993; CNS3: chromosome 6, 27484894-27485103) were identified near the APO1 gene (Figure 1).

[0073] The DNA sequences of CNS3 from each grass family plant are as follows: An alignment of the CNS3 sequences from grass families is shown in Figure 2 . Panicum hallii (4:3497695-3498014) CATCATGCGATCTGTCTGTTGCCACTCCTGCTCTCGCGTCCCTGTCGCGGCGACGGGCGTGGCGTTGCGTCCCCCTGCTGCTTGTCCCGGCGACACCCCGTTTCCATTTCTGCGCAGTGCCAAGCCCTTTCTGAAACGCCCGCC (Setaria italica) (IV:30339733-30339857) CGCCATGCGTTTTGTCTGTTGCCATTCCCACTCTCGCGTCCCCGTCTGCGTCCCGGTGCTTGCCCCCCGACACCCCGTTTCCATTTTTGCACAGTACCAAAGAGCCCTTTCTGAAATGCCACTTC (SEQ ID NO: 42) Maize (Zea mays) (9:114248455-114248600) GCATCATGCGATTTGTCTGTTACCATTCCCATTCTCGCGTCGCTGTCGAGGAGTTGCGTCCCTGTGCTTCCCTGTTTCTATTTTTGTACAGTGCTGCCGGCTGCGCCCTTGCTGAAATTAATGCCGCTGCGC (SEQ ID NO: 43) Sorghum bicolor (10:56260315-56260437) GCATCATGCGATTTGTCTGTTACCATTCCCATTCTCGCGTCGCTGTCGCGGCGTTGCGTCCCTGTGCTGCCCTGTTTCTATTTTTGTACAGTCATGCTCCCTTTCTGAAATGCCGCTTGCACA (SEQ ID NO: 44) Barley (Hordeum vulgare) (7H:599516570-599516691) CACCAACCGGTTTGCCTGTTACCACTTGCGCTCTATTGTCGCTGTCCCTCCCGTCTTCTCCCGGCATTTTCGTGTTACTCCATTTCCATTTTTGCACAGTGATTCTCCCTTTCTAAAATACCCCCAAGTC (SEQ ID NO: 45) AegilopsTauschii (7D:587082546:587083265) CACCAACCGGTTTGCCTGTTACCACTTGCGCTCTATTGTCGCTGTCCCTCCCGTCTTCTCCCGGCATTTTCGTGTTACTCCATTTCCATTTTTGCACAGTGATTCTCCCTTTCTAAAATACCCCCAAGTC (SEQ ID NO: 46) Brachypodium distachyon (1:27413678-27413813) GCAAGCATCATCCGGTTTGCCTGTTACCACTTCCTCTCTCGTGTCGCTGTCCCCCACATCAACTCCCGGCATTTTCGTGCCACTCCATTTCCATTTTTGCACAGTGATAGCTAGCTTCTCCCTTTCTGAAATTCCT (SEQ ID NO: 47) Leersia perrieri (6:18194671-18195166) GAAAGCATGCATCATCCAGTTTGTCTCTTACCACTTCCACTCTCGTGTCACTGTCCCTAGCAGATGGACAGATCCCCAGCTATACATGCAGTAGCTGTAGCTTAGCTCCCTGCATTTTATTCCCGTTTGTTACTCCACTTCCATTTTTGCACAGTGACTCTCGATCCGTTTCTGAAATGCCTCACTCGT (SEQ ID NO: 48) Oryza sativa japonica (6:27484894-27485103) GCATCATCCAGTTTGTCTCTTACCACTTCCACTCTCGTGTCACTGTCCCTTGTGCTAAGCTAGCCCTAGAAAGCAGGCAGAGATCCCTAGCTACTACTACTACTACGCGTCTACGCCCTAGCTCAGCTCATGCTCCCTGCATTTTCGCGTTTGCTCTGCTACTGCTACTCCACTTCCATTTTTGCACAGTGCTATCCCTTCCTGAAATGC (SEQ ID NO: 1)

[0074] Example 2: Genome editing was performed on japonica rice using the genome editing vector targeting the CNS3 gene. The following sequences were designed as guide RNAs, and two of these guide RNAs were inserted into the pZNH2GTE-U6 vector. A Cas9 expression cassette and expression cassettes for streptomycin resistance and hygromycin resistance genes were also constructed in the vector, resulting in a genome editing vector (Biosci Biotechnol Biochem (2010) 74:2348-2351). APO1_CNS3_Left: CATGCTTTCTGAATTCTGAT (SEQ ID NO: 29) APO1_CNS3_Right: TAGCTACTACTACTACTACG (SEQ ID NO: 30) APO1_CNS3_L2: CGTAGTAGTAGTAGTAGCTA (SEQ ID NO: 31) APO1_CNS3_L3: AAGGGACAGTGACACGAGAG (SEQ ID NO: 32) APO1_CNS3_L4: CTAGGGCTAGCTTAGCACAA (SEQ ID NO: 33) APO1_CNS3_L5: GCACTGTGCAAAAATGGAAG (SEQ ID NO: 34) APO1_CNS3_R3: CTCTCGTGTCACTGTCCCTT (SEQ ID NO: 35) APO1_CNS3_R4: TTGTGCTAAGCTAGCCCTAG (SEQ ID NO: 36) APO1_CNS3_R5: CTTCCATTTTTGCACAGTGC (SEQ ID NO: 37) APO1_CNS3_R6: GAAATGCTTCTTCGTACATT (SEQ ID NO: 38) Escherichia coli DH5alpha was cultured at 37°C in 2xYT medium supplemented with streptomycin, and the vector was cloned.

[0075] The vector was introduced into callus derived from seeds of Nipponbare (rice cultivar, Japonica species) by Agrobacterium-mediated transformation.

[0076] Specifically, Agrobacterium EHA105 was transformed with the vector and cultured in 2xYT medium supplemented with streptomycin at 28°C, followed by culture in AB medium supplemented with streptomycin at 23°C for 3 days in the dark.

[0077] Nipponbare seeds were also dehusked and the surfaces sterilized with 70% ethanol, followed by 1% sodium hypochlorite for 30 minutes, and then washed three times with sterile distilled water. They were then cultured in 2N6 medium at 32°C in the dark for four weeks to form calli. The 2N6 medium was replaced every two weeks. The calli were then cultured in fresh 2N6 medium at 32°C in the dark for three days before infection with Agrobacterium.

[0078] The Agrobacterium EHA105 strain was suspended in liquid MSL medium supplemented with acetosyringone and added to calli cultured in N6CO medium at 23°C in the dark. The calli were then washed with sterile distilled water and meropenem trihydrate and cultured in N6SE medium supplemented with meropenem trihydrate and hygromycin at 32°C in the dark for 4 weeks. The calli were then cultured in ReIII medium supplemented with meropenem trihydrate and hygromycin at 28°C in the light for 6 weeks. Transformed plants (10 mm long) were cultured in MSF medium at 28°C in the light. At 15 mm in length, they were transplanted into potting soil and grown in a biohazard room at 28°C under a 14-hour light-10-hour dark cycle.

[0079] As described above, genome editing was performed using one or two of the 10 designed guide RNAs, resulting in a total of 27 strains with various lengths of substitutions, insertions, and deletions in the CNS3 region (Figure 3). The sequences of the 27 strains are SEQ ID NOs: 2 to 28, as listed in Tables 1 to 3.

[0080] PCR was performed on the resulting transformed plants to confirm whether genome editing had occurred. The primer sequences used were as follows: APO1_CNS3_F: 5'-AGAGTTTGGCCTTCACACCA-3' (SEQ ID NO: 39) APO1_CNS3_R: 5'-ATCCCGTCACCAATCGATCG-3' (SEQ ID NO: 40)

[0081] RNA was extracted from 1-2 mm-long young panicles, and TPM (Transcripts Per Kilobase Million) values ​​were calculated via RNA-seq analysis to compare APO1 gene expression levels (Fig. 4). Expression levels of CNS3_6(-2,-1) and CNS3_5(+1,-21) were increased, while expression levels of CNS3_1(+226) and CNS3_1(-28) were comparable to or increased compared to the wild-type. Expression levels of CNS3_2(-33,-2), CNS3_5(-85), and CNS3_3(-5,-1) were comparable to or decreased compared to the wild-type.

[0082] The 27 transgenic rice lines in which genome editing was confirmed and the wild-type line were grown until the seed harvest stage, and the number of spikelets per panicle, the number of primary rachis-branches per panicle, and the number of secondary rachis-branches per number of primary rachis-branches were compared (Figures 5 to 7).

[0083] As a result, lines lacking part or all of the MADS box region in CNS3 (6:27485069-27485077) showed a phenotype in which the number of spikelets per panicle, the number of primary rachis-branches per panicle, and the number of secondary rachis-branches per number of primary rachis-branches were all significantly increased (number of spikelets: 1.5-3 times, number of primary rachis-branches: 1.5-2 times, number of secondary rachis-branches per number of primary rachis-branches: 2-5 times) (CNS3_5 (-3,-26), CNS3_5(+1,-2), CNS3_5 (+1,-21), CNS3_6(-1,-1), CNS3_6 (-2,-1), CNS3_1(-122), CNS3_1(-150), CNS3_6(-3,-1), CNS3_1(-116), CNS3_5(-51,-3)). Some of these strains had mutations in parts other than the MADS box, but all showed an increasing trend.

[0084] Furthermore, lines lacking the C2H2 binding site in CNS3 (6:27484907-27484930) or part of its neighboring region (CNS3_2(+1,-24) and CNS3_2(-2,-2)) exhibited increased spikelet numbers per panicle, primary rachis-branches per panicle, and secondary rachis-branches per primary rachis-branches (spikelet numbers: approximately 1-3 times, primary rachis-branches: approximately 1-2 times, secondary rachis-branches per primary rachis-branches: approximately 1-5 times) (CNS3_2(+1,-24), CNS3_2(-2,-2)). On the other hand, in strains in which mutations were introduced into highly conserved regions (6:27484894-27484966, 6:27485017-27485103) in addition to the region in question, the increasing trend was reduced or disappeared (CNS3_2(-33,-2), CNS3_2(-2,+1,1s), CNS3_4(-107), CNS3_2(-49), CNS3_2(+1,-2,1s), CNS3_3(-5,-1), CNS3_0(-106), CNS3_3(+1,-2)).

[0085] In lines harboring mutations in part or all of the low-conserved region of CNS3 (6:27484967-27485016), the number of spikelets per panicle, the number of primary rachis-branches per panicle, and the number of secondary rachis-branches per number of primary rachis-branches were all increased to a small level (number of spikelets: approximately 1-1.5 times, number of primary rachis-branches: approximately 1-1.5 times, number of secondary rachis-branches per number of primary rachis-branches: approximately 1-2 times) (CNS3_1(+226), CNS3_5(-16|+11,+1), CNS3_0(-5,-50), CNS3_1(-28)). On the other hand, in strains in which mutations were introduced into highly conserved regions (6:27484894-27484966, 6:27485017-27485103) in addition to the region in question, the increasing trend disappeared (CNS3_5(-85), CNS3_4(-107), CNS3_4(-36), CNS3_0(-106), CNS3_0(+1,-67)).

[0086] In lines in which a part or all of the highly conserved region in CNS3 (6:27484894-27484966, 6:27485017-27485103) was mutated, the number of spikelets per panicle, the number of primary rachis-branches per panicle, and the number of secondary rachis-branches per number of primary rachis-branches were all reduced (number of spikelets: approximately 0.5-1 times, number of primary rachis-branches: approximately 0.7-1 times, number of secondary rachis-branches per number of primary rachis-branches: approximately 0.5-1 times). ) phenotypes were observed (CNS3_2(-33,-2), CNS3_2(-2,+1,1s), CNS3_5(-85), CNS3_4(-107), CNS3_4(-36), CNS3_2(-49), CNS3_2(+1,-2,1s), CNS3_3(-5,-1), CNS3_0(-106), CNS3_3(+1,-2), CNS3_0(+1,-67)).

[0087] Therefore, genome editing of CNS3 according to the purpose makes it possible to control the number of spikelets per panicle, the number of primary rachis-branches per panicle, and the number of secondary rachis-branches per number of primary rachis-branches. Furthermore, in other grasses in which the CNS3 sequence is conserved, it is thought that the number of spikelets per panicle, the number of primary rachis-branches per panicle, and the number of secondary rachis-branches per number of primary rachis-branches can be similarly controlled by introducing mutations into sequences homologous to the above sequence.

[0088] Example 3 Genome editing was performed on rice indica using a genome editing vector targeting CNS3. The DNA sequence of CNS3 in Kasalath (Oryza sativa L. variety, Kasalath), an indica rice variety, is as follows: GCATCATCCAGTTTGTCTCTTACCACTTCCACTCTCGTGTCACTGTCCCTTGCTAAGCTAGCCCTAGAAAGCAGGCAGAGATCCCCAGCTACTACTACTACTACGCCCTAGCTCAGCTCCCTGCATTTTCGCGTTTGATCTGCTACTGCTACTCCACTTCCATTTTTGCACAGTGTCATCCCTTTCTGAAATGC (SEQ ID NO: 53) The following sequences were designed as guide RNAs, and two of these guide RNAs were inserted into the pZNH2GTE-U6 vector. Furthermore, a Cas9 expression cassette and expression cassettes for streptomycin resistance and hygromycin resistance genes were constructed in the vector to create a genome editing vector (Biosci Biotechnol Biochem (2010) 74:2348-2351.). APO1_CNS3_L5: GCACTGTGCAAAAATGGAAG (SEQ ID NO: 34) APO1_CNS3_R6: GAAATGCTTCTTCGTACATT (SEQ ID NO: 38) Escherichia coli DH5alpha was cultured at 37°C in 2xYT medium supplemented with streptomycin, and the vector was cloned.

[0089] The vector was introduced into callus derived from Kasalath seeds by Agrobacterium-mediated transformation.

[0090] Specifically, Agrobacterium EHA105 was transformed with the vector and cultured in 2xYT medium supplemented with streptomycin at 28°C, followed by culture in AB medium supplemented with streptomycin at 23°C for 3 days in the dark.

[0091] Additionally, Kasalath seeds were peeled, and the surface was sterilized with 70% ethanol, followed by 1% sodium hypochlorite for 30 minutes, and then washed three times with sterile distilled water. They were then cultured in 2N6 medium in the dark at 32°C for four weeks to form calli. The 2N6 medium was replaced every two weeks. The calli were then cultured in fresh 2N6 medium in the dark at 32°C for three days before infection with Agrobacterium.

[0092] The Agrobacterium EHA105 strain was suspended in liquid MSL medium supplemented with acetosyringone and added to calli cultured in N6CO medium at 23°C in the dark. The calli were then washed with sterile distilled water and meropenem trihydrate and cultured in N6SE medium supplemented with meropenem trihydrate and hygromycin at 32°C in the dark for 4 weeks. The calli were then cultured in ReIII medium supplemented with meropenem trihydrate and hygromycin at 28°C in the light for 6 weeks. Transformed plants (10 mm long) were cultured in MSF medium at 28°C in the light. At 15 mm in length, they were transplanted into potting soil and grown in a biohazard room at 28°C under a 14-hour light-10-hour dark cycle.

[0093] As described above, four strains with insertions or deletions at the MADS box site in CNS3 were generated (Figure 8). The sequences of the four strains are SEQ ID NOs: 54 to 59 in Table 4. The CNS3 sequence of Hetero(-2 / -3) is SEQ ID NOs: 54 and 55. The CNS3 sequence of Homo(+1) is SEQ ID NO: 56. The CNS3 sequence of Homo(-1) is SEQ ID NO: 57. The CNS3 sequence of Hetero(-1 / -5) is SEQ ID NOs: 58 and 59.

[0094] PCR was performed on the resulting transformed plants to confirm the presence or absence of genome editing. The primer sequences used are as follows: Kasalath_APO1_CNS3_seq_F: 5'-TGATGGCAAAACCATGTCTG-3' (SEQ ID NO: 60) Kasalath_APO1_CNS3_seq_R: 5'-GCCTGCTATCGTGTCACTCA-3' (SEQ ID NO: 61)

[0095] One transgenic rice line (Hetero -2 / -3) and the wild-type were grown until the seed harvest stage, and the number of spikelets per panicle, the number of primary rachis-branches per panicle, and the number of secondary rachis-branches per number of primary rachis-branches were compared (Fig. 9).

[0096] As a result, a line (Hetero -2 / -3) in which a portion of the MADS box in CNS3 was deleted showed a phenotype in which the number of spikelets per panicle, the number of primary rachis-branches per panicle, and the number of secondary rachis-branches per primary rachis-branches were all significantly increased in the TO generation. The remaining three lines (Hetero +1, Hetero -1, and Hetero -1 / -5) are expected to show similar results to those of (Hetero -2 / -3).

Claims

1. A polynucleotide comprising a base sequence in which a mutation has been introduced into all or part of a conserved non-coding sequence that has the function of regulating the expression of the APO1 gene of a grass family plant.

2. The polynucleotide according to claim 1, wherein the conserved non-coding sequence is a sequence located in a region 3.4 to 3.7 kbp upstream from the transcription start site of the APO1 gene of a grass family plant.

3. The polynucleotide of claim 1, wherein the grass plant is rice.

4. The polynucleotide according to claim 1, which is any one of the following (1) to (4): (1) A polynucleotide comprising a base sequence represented by any one of SEQ ID NOs: 2 to 28, 54 to 59. (2) A polynucleotide comprising a base sequence in which one or several bases have been substituted, added, or deleted from the base sequence represented by any one of SEQ ID NOs: 2 to 28, 54 to 59. (3) A polynucleotide comprising a base sequence having 90% or more identity with the base sequence represented by any one of SEQ ID NOs: 2 to 28, 54 to 59. (4) A polynucleotide comprising a base sequence which hybridizes under stringent conditions with a base sequence complementary to the base sequence represented by any one of SEQ ID NOs: 2 to 28, 54 to 59.

5. A grass family plant comprising the polynucleotide described in claim 1, in which at least one selected from the group consisting of the number of spikelets per panicle, the number of primary rachis branches per panicle, and the number of secondary rachis branches per number of primary rachis branches is increased or decreased compared to the wild-type strain.

6. The gramineous plant according to claim 5, wherein the increase or decrease in the number of spikelets per panicle is 0.5 to 3 times that of the wild type.

7. The gramineous plant according to claim 5, wherein the increase or decrease in the number of primary rachis-branches per panicle is 0.7 to 2 times that of the wild type.

8. The gramineous plant according to claim 5, wherein the increase or decrease in the number of secondary rachis branches per number of primary rachis branches is 0.5 to 5 times that of the wild type.

9. A grass plant which is a progeny of the grass plant according to claim 5.

10. A seed of the grass family plant according to claim 5.

11. A method for producing a grass family plant in which at least one selected from the group consisting of the number of spikelets per panicle, the number of primary rachis branches per panicle, and the number of secondary rachis branches per number of primary rachis branches is increased or decreased compared to a wild-type strain, the method comprising the step of introducing a mutation into part or all of a conserved non-coding sequence in a grass family plant that has the function of regulating expression of the APO1 gene.

12. The method according to claim 11, wherein the conserved non-coding sequence is a sequence located in a region 3.4 to 3.7 kbp upstream from the transcription start site of the APO1 gene of a grass family plant.

13. The method of claim 11, wherein the conserved non-coding sequence is any one of (i) to (iv) below: (i) A base sequence represented by SEQ ID NO: 1 or 53. (ii) A base sequence in which one or several bases have been substituted, added or deleted in the base sequence represented by SEQ ID NO: 1 or 53. (iii) A base sequence having 90% or more identity with the base sequence represented by SEQ ID NO: 1 or 53. (iv) A base sequence which hybridizes under stringent conditions with a base sequence complementary to the base sequence represented by SEQ ID NO: 1 or 53.

Images