Group of SNP markers related to assessment of the disease risk of nasopharyngeal carcinoma and uses thereof

Abstract

Disclosed are a group of SNP markers related to assessment of the disease risk of nasopharyngeal carcinoma, the SNP markers comprising: rs2276868, rs3917410 and / or strong-linkage sites thereof. Also provided is the use of SNP marker detecting regents in the preparation of reagents for assessing the disease risk of nasopharyngeal carcinoma, which can be used for accurate assessment of the disease risk of nasopharyngeal carcinoma. Also provided is the use of a group of reagents used for detecting the expression of RPL14, SELE, NOTCH3 and FGFR3 genes in preparing a kit used for assessing the disease risk of nasopharyngeal carcinoma. Also provided is the use of the reagent for detecting the RPL14 gene in preparing a drug used for assessment of EBV infection and replication, disease-related phenotypes and prognosis of nasopharyngeal carcinoma.

Description

A set of SNP markers for assessing the risk of nasopharyngeal carcinoma and their application Technical Field

[0001] The present invention relates to the field of gene mutation detection, and in particular, to a group of SNP markers associated with the assessment of nasopharyngeal carcinoma risk and applications thereof. Background Art

[0002] Nasopharyngeal carcinoma (NPC) is a relatively rare but locally prevalent malignant tumor, mainly occurring in East Asia and Southeast Asia. In China, the highest incidence rate is in the southeastern region, represented by Guangdong. The disease shows familial clustering characteristics, with 5.9% of patients having a family history, suggesting that the disease is affected by genetics or family shared environment. Studies have shown that the heritability of NPC is as high as 61.3%. Mapping the genetic susceptibility loci of NPC on the genome is of great significance for the early identification of high-risk groups for NPC, the identification of genetic subgroups in patients, the selection of treatment methods and the assessment of prognosis, and the development of therapeutic targets. Genome-wide association studies (GWAS) have reported multiple genomic regions associated with NPC, but these regions have limited explanations for the genetic pathogenic risk of NPC, suggesting that more NPC susceptibility loci need to be discovered.

[0003] In addition to genetic and environmental susceptibility factors, studies have found that Epstein-Barr Virus (EBV) infection is involved in the development and progression of nasopharyngeal carcinoma. The EBV DNA load in the plasma of nasopharyngeal carcinoma patients is significantly increased, and a large number of EBV-encoded molecules can also be found in tumor tissues through biopsy.

[0004] Further discovery of nasopharyngeal carcinoma susceptibility loci is limited by two major factors: insufficient sample size and limited coverage of genomic loci with varying frequencies. Due to the low incidence of nasopharyngeal carcinoma in the population, sample acquisition is relatively difficult, and the limited sample size of existing GWAS studies has limited the power of these studies. Furthermore, because the microarray data used in published GWAS studies only covers common mutation sites across the genome, such studies have struggled to identify rare nasopharyngeal carcinoma susceptibility loci.

[0005] Because nasopharyngeal carcinoma is a complex disease with multiple genes involved, even with the availability of more genetic susceptibility loci, single-locus risk estimates are still low. Therefore, genetic risk assessment for this disease requires integrating multi-locus information to construct risk prediction models, and their predictive efficacy should be evaluated in diverse populations. Currently, such models are based solely on existing GWAS loci, and their predictive efficacy for disease risk is limited. Furthermore, their predictive efficacy has not been systematically evaluated in multiple population samples.

[0006] Furthermore, elucidating the pathogenic mechanisms of susceptibility loci has always been a bottleneck in the application and translation of genetic factors, and nasopharyngeal carcinoma is no exception. To understand how susceptibility loci affect the expression or function of specific genes and disrupt specific cellular or physiological processes involved in disease, researchers need to collect and analyze multidimensional molecular data on nasopharyngeal carcinoma and conduct in vivo and in vitro experiments to detect mutations and the functions of related genes in nasopharyngeal carcinoma-related scenarios. This type of research is currently lacking in the field of nasopharyngeal carcinoma.

[0007] Although the association between Epstein-Barr virus and nasopharyngeal carcinoma has been reported, how Epstein-Barr virus is involved in the pathogenicity of nasopharyngeal carcinoma susceptibility sites currently focuses on the HLA region, and whether Epstein-Barr virus is involved in the pathogenicity of non-HLA susceptibility regions remains to be explored.

[0008] Summary of the Invention

[0009] The purpose of the present invention is to provide a technical solution that can accurately and effectively assess the risk of nasopharyngeal carcinoma in response to the above technical problems.

[0010] To achieve the above objectives, the present invention provides a set of SNP markers for assessing the risk of nasopharyngeal carcinoma, wherein the SNP markers include: rs2276868, rs3917410 and / or strongly linked sites thereof. Preferably, the SNP markers also include rs2276868, rs3917410 and strongly linked sites thereof.

[0011] As used herein, a "strongly linked locus" is one in which the square of the allelic correlation coefficient R 2 Preferably, the strong linkage site can be rs5361, which is a complete linkage site of rs3917410 (i.e., the square of the inter-site allele correlation coefficient R 2 =1). rs2276868 is a C / T single nucleotide variant in the RPL14 gene on chromosome 3. rs3917410 is an A / G single nucleotide variant in the SELE gene on chromosome 1. rs5361 is a G / T single nucleotide variant in the SELE gene on chromosome 1.

[0012] On the other hand, the present invention also provides a group of genetic markers for assessing the risk of nasopharyngeal carcinoma, wherein the markers include: rs1572072, rs9510787, rs6498114, rs6774494, rs31489, rs1412829, rs3917410, rs2276868, rs186509115, HLA-DQB1*03:01:01, rs1131204, rs1050462, HLA amino acid HLA-A_62_Q, HLA amino acid HLA-DRB1_67_F and HLA amino acid HLA-B_66_I. Preferably, the markers also include their strong linkage sites (R 2 >0.8), such as the complete linkage locus of rs3917410 (R 2 =1)rs5361.

[0013] On the other hand, the present invention also provides a model for assessing the risk of nasopharyngeal carcinoma, wherein the model is constructed based on the following SNP markers: rs2276868, rs3917410, and / or strongly linked sites thereof. Preferably, the strongly linked site is rs5361, a strongly linked site of rs3917410.

[0014] On the other hand, the present invention also provides a model for assessing the risk of nasopharyngeal carcinoma, wherein the model is constructed based on the following SNP markers: rs1572072, rs9510787, rs6498114, rs6774494, rs31489, rs1412829, rs3917410, rs2276868, rs186509115, HLA-DQB1*03:01:01, rs1131204, rs1050462, HLA amino acid HLA-A_62_Q, HLA amino acid HLA-DRB1_67_F, HLA amino acid HLA-B_66_I, and / or their strong linkage sites.

[0015] On the other hand, the present invention also provides a method for constructing a risk assessment model for nasopharyngeal carcinoma, which comprises: incorporating SNP markers rs2276868 and rs3917410 or their strongly linked sites (R 2>0.8), combined with known GWAS loci (i.e., rs1572072, rs9510787, rs6498114, rs6774494, rs31489, rs1412829, rs186509115, HLA-DQB1*03:01:01, rs1131204, rs1050462, HLA amino acid HLA-A_62_Q, HLA amino acid HLA-DRB1_67_F, and HLA amino acid HLA-B_66_I), the scores were weighted summed using the correlation coefficient of the single locus as the weight and the number of alleles carried by the individual as the metric.

[0016] In another aspect, the present invention also provides the use of a reagent for detecting the SNP marker in preparing a kit for assessing the risk of nasopharyngeal carcinoma. Preferably, the reagent is a specific amplification primer. Preferably, the kit also includes a PCR buffer, dNTPs, magnesium chloride, DNA polymerase, and deionized water.

[0017] In another aspect, the present invention also provides the use of a reagent for detecting the genetic marker in preparing a kit for assessing the risk of nasopharyngeal carcinoma. Preferably, the reagent is a specific amplification primer. Preferably, the kit also includes PCR buffer, dNTPs, magnesium chloride, DNA polymerase, and deionized water.

[0018] On the other hand, the present invention also provides a set of reagents for detecting gene expression in the preparation of a kit for assessing the risk of nasopharyngeal carcinoma, wherein the gene is at least one of RPL14, SELE, NOTCH3 and FGFR3.

[0019] In another aspect, the present invention also provides the use of a reagent for detecting gene expression in preparing a kit for assessing the risk of nasopharyngeal carcinoma. Preferably, the reagent is a specific amplification primer. Preferably, the kit also includes PCR buffer, dNTPs, magnesium chloride, DNA polymerase, and deionized water.

[0020] On the other hand, the present invention also provides the use of a reagent for detecting the RPL14 gene in the preparation of a drug for evaluating EBV infection and replication, disease-related phenotypes and prognosis of nasopharyngeal carcinoma.

[0021] The present invention confirms that the genotype frequencies of SNP sites rs2276868, rs3917410 and rs5361 (a strong linkage site of rs3917410) in nasopharyngeal carcinoma patients in the southern Chinese population are significantly different from those in the healthy population, and the frequency of carriers of rs2276868-T is higher in patients with a family history. The present invention also confirms that genes RPL14, SELE, NOTCH3 and FGFR3 are significantly enriched with more disease-related mutations in nasopharyngeal carcinoma patients in the southern Chinese population. The nasopharyngeal carcinoma risk prediction model proposed by the present invention based on the newly discovered sites (rs2276868 and rs3917410) and the reported GWAS sites has achieved an effect higher than the previous nasopharyngeal carcinoma risk model, and its effect is manifested in a higher area under the curve (AUC), and the identified high-risk group has a higher odds ratio (Odds Ratio, OR) than the low-risk group. The present invention, based on single-cell transcriptome and experimental data, confirmed that the susceptibility locus rs2276868 significantly regulates the RPL14 gene in nasopharyngeal carcinoma cells and tissues. Furthermore, combining transcriptome data with knockdown / overexpression experiments, the present invention identified the transcription factor NKRF, which regulates RPL14 expression and is influenced by rs2276868. Using Epstein-Barr virus infection and lysis models, the present invention, for the first time, confirmed the inhibitory effect of the RPL14 gene on Epstein-Barr virus infection and lysis, and also found that Epstein-Barr virus infection and lysis conversely inhibited RPL14 expression. The present invention, for the first time, utilized Epstein-Barr virus-positive nasopharyngeal carcinoma cell lines and mouse models to functionally confirm the inhibitory effect of RPL14 on nasopharyngeal carcinoma tumor growth and metastasis. Combining RPL14 expression information with nasopharyngeal carcinoma patient prognosis data, the present invention demonstrated for the first time that higher RPL14 expression is associated with better patient prognosis. These findings have significant implications for predicting the risk and prognosis of nasopharyngeal carcinoma and provide new molecular targets for its treatment. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 shows the 15 variant sites, target alleles, and OR value information involved in the model for assessing the risk of nasopharyngeal carcinoma.

[0023] FIG2 shows the results of the predictive efficacy evaluation (area under the curve and hazard ratio) of the model for estimating the risk of NPC.

[0024] Figure 3 shows the functional risk prediction information of the nasopharyngeal carcinoma risk locus rs5361.

[0025] FIG4 shows the effects of different rs2276868 genotypes on the expression of the susceptibility gene RPL14 in nasopharyngeal carcinoma tissues (A) and cells (B).

[0026] Figure 5 shows the use of luciferase reporter plasmids (AB) and chromatin immunoprecipitation experiments (CD) to prove that NKRF exerts different transcriptional regulatory effects on RPL14 by binding to different rs2276868 genotypes.

[0027] Figure 6 shows that EB virus infection and lysis can inhibit the expression of RPL14 (A and C). At the same time, RPL14 can negatively regulate EB virus infection and lysis (B and D).

[0028] Figure 7 shows that RPL14 overexpression can inhibit the proliferation (A), migration (B) and in vivo tumorigenicity (C, D) of EB virus-positive nasopharyngeal carcinoma cells.

[0029] FIG8 shows that RPL14 is lowly expressed in nasopharyngeal carcinoma (A) and patients with low expression have a worse prognosis (B). DETAILED DESCRIPTION

[0030] To more clearly understand the above-mentioned objects, features, and advantages of the present invention, the present invention is further described in detail below with reference to the accompanying drawings and specific examples. Those skilled in the art should understand that the examples are merely helpful for understanding the present invention and should not be construed as limiting the present invention. Unless otherwise specified, the sequencing and analysis methods used in the following examples are conventional methods.

[0031] The present invention locates NPC risk loci and genes based on a large sample of NPC patients and healthy controls using full-exome association analysis. The specific steps are as follows:

[0032] 1. Blood or DNA samples were collected from 2023 nasopharyngeal carcinoma patients with genetic characteristics consistent with the southern Chinese population and 1068 healthy controls through the Sun Yat-sen University Cancer Center.

[0033] 2. Perform whole exome sequencing and variant calling. Use the Agilent SureSelect Human All Exon V6+UTR Kit, the Agilent SureSelect Human All Exon V5+UTR Kit, or the Roche SeqCap EZ Exome+UTR Target Enrichment Kit for library construction and exon region capture. Sequencing was performed using an Illumina HiSeq sequencer using a paired-end 2 x 150bp standard. Alignment and genotype identification were performed using Sentieon software (Sentieon, USA). All procedures were performed according to the manufacturer's instructions.

[0034] 3. Taking the occurrence of nasopharyngeal carcinoma as the target phenotype, the following multi-level molecular correlation analysis was performed:

[0035] (1) Single nucleotide variation (SNV) level: Multivariate regression analysis was used to perform association analysis on all SNVs with a minor allele frequency > 0.001 on the genome, while correcting for confounding factors such as sex and population genetic structure.

[0036] (2) Multiple SNV-gene level: Four regression analysis and statistical methods are used to detect the cumulative effect of multiple SNVs per gene on the study trait and select the optimal solution. When applying each method, confounding factors such as sex and population genetic structure are corrected. The four methods are:

[0037] (A) SNP-set (Sequence) Kernel Association Test (SKAT) based on linear regression equation;

[0038] (B) Burden test based on variation loading;

[0039] (C) SKAT for the combined effect of common and rare variants based on linear equations;

[0040] (D) Burden test for the combined effect of common and rare variants based on variant loading.

[0041] The statistical results of the analysis are shown in Figure 1 and Table 1. Figure 1 shows the 15 variant sites, target alleles, and OR values ​​involved in the model for assessing NPC risk. Table 1 shows the genes significantly associated with NPC development identified through multi-SNV association analysis.

[0042] Table 1: Genes significantly associated with nasopharyngeal carcinoma

[0043] The model designed by the present invention for calculating the polygenetic risk score (PRS) for nasopharyngeal carcinoma is composed of 15 germline variant sites (rs1572072, rs9510787, rs6498114, rs6774494, rs31489, rs1412829, rs3917410, rs2276868, rs186509115, HLA-DQB1*03:01:01, rs1131204, rs1050462, HLA amino acid HLA-A_62_Q, HLA amino acid HLA-DRB1_67_F and HLA amino acid HLA-B_66_I) shown in Figure 1 or their strongly linked sites (R 2 The weight is calculated by adding the target allele copy number (>0.8) x the weight. The weight is derived from association analysis based on a single locus and is the logarithm of the disease risk odds ratio (OR). The specific formula is:

[0044] Among them, dosage ij is the number of copies of the target allele (A1, see Figure 1) at variant site j for a given individual i (value range: 0 / 1 / 2). Information on the germline variant site, target allele (A1), and OR is shown in Figure 1.

[0045] As shown in Figure 2, it shows the predictive efficacy evaluation results (area under the curve and risk comparison) of the model for assessing the risk of nasopharyngeal carcinoma. As shown in Figure 2A, the horizontal axis of the figure is the percentile of PRS, and the vertical axis is the odds ratio of individuals with each percentile score of PRS to individuals with the lowest 5% percentile of nasopharyngeal carcinoma. It can be seen from the figure that with the increase of PRS, the risk of nasopharyngeal carcinoma increases significantly. As shown in Figure 2B, the horizontal axis of the figure is the false positive rate, and the vertical axis is the true positive rate. It can be seen from the figure that the PRS of the present invention has a higher AUC than the published PRS that only contains GWAS sites.

[0046] Since there are multiple SNP sites in the exon region of the significant gene SELE that are significantly associated with the incidence of nasopharyngeal carcinoma, functional prediction of these sites was performed. The results showed that the rs5361 mutation has a greater possibility of affecting the normal function of SELE (Figure 3).

[0047] The present invention constructs 15 SNP sites for the model for assessing the risk of nasopharyngeal carcinoma at rs2276868, rs5361, and rs3917410, as well as their strongly linked sites. The method for capturing the RPL14, SELE, NOTCH3, and FGFR3 genes in the target genomic region is as follows:

[0048] Synthetic probes were designed and customized for the target region (Nanodigmbio probes: each 120 bp in length. See Tables 2 and 3).

[0049] Table 2: Probe sequences designed for target sites

[0050] Table 3: Probe sequences designed for target gene regions

[0051] Library construction and capture hybridization were performed using the NadPrep DNA Library Preparation Kit. Experimental procedures were performed using the automated MGISP-960 / 100 automated workstation MGI sequencing platform (Shenzhen MGI Intelligent Manufacturing Technology Co., Ltd.). Sequencing was performed using the MGI DNBSEQ-T7 (Shenzhen MGI Intelligent Manufacturing Technology Co., Ltd.) (pair-end of 150 bp). Alignment and genotyping were performed using Sentieon software (Sentieon, USA). Procedures were performed according to the manufacturer's instructions.

[0052] The present invention uses single-cell transcriptome data from nasopharyngeal carcinoma to analyze the correlation between carriers of different rs2276868 genotypes and the expression of the susceptibility gene RPL14. Promoter reporter plasmids containing different rs2276868 genotypes were constructed (cloning primers: forward CGGGGTACCGAGAGGATCGTCTTCACTCAG, reverse CTAGCTAGCACCCTCACCATGCGCTTCC, constructed into the pGL3 plasmid). Luciferase assays were performed, and the results are shown in Figure 4. Figure 4A shows the changes in the standardized average expression of RPL14 in nasopharyngeal carcinoma tissues with different rs2276868 genotypes (CC, CT, TT); Figure 4B shows the effect of different genotypes on the expression of the susceptibility gene RPL14 at the cellular level. As shown in FIG4 , it was confirmed that the expression of RPL14 in nasopharyngeal carcinoma patients carrying the rs2276868-T type (RPL14-T, same as the TT type) was lower than that in nasopharyngeal carcinoma patients carrying the rs2276868-C type (RPL14-C, same as the CC type).

[0053] The present invention designed siRNA of the NKRF gene (NKRF-siRNA sequence: CCAAGAGACATCTACCAAGAT; control sequence si-NC: CCTGGAACAATTGCTTTTA) and an overexpression plasmid (forward primer: AAGCTTGCCACCATGGACTACAAAGAC; reverse primer: GAATTCTCAATTTGCTTGAGGCATAAC, constructed into the pCDNA3.1 plasmid), and performed luciferase experiments and chromatin immunoprecipitation experiments. The results are shown in Figure 5. Figure 5A shows that after knocking down NKRF, the luciferase transcriptional activities of the above-mentioned RPL14-C and RPL14-T were inhibited (left figure), but after correction with the control group (si-NC), NKRF knockdown had a stronger inhibitory effect on RPL14-C than on RPL14-C (right figure); Figure 5B (left figure) shows the relative luciferase activity results of RPL14-C and -T after overexpressing NKRF, and the right figure shows that after correction with the control group (Vector), overexpression of NKRF can further promote the transcriptional activity of RPL14-C; Figure 5C is a primer design pattern diagram of the RPL14 promoter region, and D is the result of the chromatin immunoprecipitation experiment (where PRL14-P1 corresponds to primer1, PRL14-P2 corresponds to primer2, and PRL14-P3 corresponds to primer3), showing that NKRF does bind to the region near the mutation site and exerts a transcriptional regulatory effect. In summary, as shown in Figure 5 , the transcription factor NKRF binds to the region near rs2276868 and has a stronger transcriptional regulatory effect on the rs2276868-C type.

[0054] The present invention designed siRNA of the RPL14 gene (two siRNAs targeting different regions of mRNA, including siRPL14-1: CTGCTAAAGTTCCAGCAAA; siRPL14-2: CACTGATTTCATCCTCAAG; control sequence si-NC: CCTGGAACAATTGCTTTTA) and an overexpression plasmid (forward primer: CCGGAATTCATGGTGTTCAGGCGCTTCGT; reverse primer: CGCGGATCCTTATGCTTTCTTGCCAGATGCC, constructed into the pCDH plasmid). The present invention uses Epstein-Barr virus to infect Epstein-Barr virus-negative nasopharyngeal carcinoma cells (S26 and HK-1, provided by Qian Chaonan Laboratory of Sun Yat-sen University Cancer Center and Kwok Wai Lo Laboratory of The Chinese University of Hong Kong, respectively), and in Epstein-Barr virus-positive nasopharyngeal carcinoma cells (CNE2-EBV and HONE1-EBV, provided by Zeng Musheng Laboratory of Sun Yat-sen University Cancer Center) by treating them with phorbol ester TPA (20 ng / ml) and sodium butyrate NaB (3 mM) at different time points to establish an Epstein-Barr virus lysis-inducing model. Figure 6A shows that the expression of RPL14 is downregulated during EB virus infection, and Figure 6B shows that knocking down RPL14 (left) can promote the infection efficiency of EB virus and increase the GFP positive rate. Compared with the control group (Vector), overexpression (RPL14 group, right) inhibits the infection efficiency of EB virus. Figure 6C shows that the expression of RPL14 is also downregulated during the induction of EB virus lysis. Figure 6D shows that RPL14 knockdown (left) or overexpression (right) significantly promotes and inhibits the expression of EB virus lysis-related genes, respectively. The above experiments reveal that EB virus infection and lysis can inhibit the expression of RPL14 (A and C), and RPL14 can negatively regulate EB virus infection and lysis (B and D).

[0055] The present invention utilizes the above-mentioned RPL14 overexpression plasmid (PRL14) in combination with a lentiviral packaging system to stably overexpress RPL14 in Epstein-Barr virus-positive nasopharyngeal carcinoma cells (CNE2-EBV and HONE1-EBV). Colony formation experiments and Transwell migration experiments are used to clarify the inhibitory effect of RPL14 overexpression on the proliferation and migration of nasopharyngeal carcinoma cells. At the same time, a nude mouse tumor formation experiment is performed. Six-week-old male BALB / c nude mice are subcutaneously inoculated with CNE2-EBV cells (5x10 cells) mixed with matrigel and expressing or not RPL14. 6 The tumor size of the mice was measured with a caliper every week and the calculation formula was LxW 2x0.5 (where L is the longest diameter of the tumor and W is the shortest diameter). Figure 7A shows that RPL14 overexpression can inhibit the proliferation of EB virus-positive nasopharyngeal carcinoma cells, and the right figure shows statistics; Figure 7B shows that overexpression of RPL14 inhibits the migration of EB virus-positive nasopharyngeal carcinoma cells, and the right figure shows statistics; Figure 7CD in vivo tumor formation experiments show that after overexpressing RPL14, the in vivo tumor growth rate of CNE2-EBV cells is reduced (C) and the tumor weight is reduced (D). These experiments reveal that RPL14 plays a tumor suppressor function in nasopharyngeal carcinoma.

[0056] The present invention analyzed transcriptome sequencing data from 87 NPC tissues and 10 rhinitis control tissues (nasopharyngeal tissues from patients without NPC) and revealed that RPL14 expression was significantly decreased in NPC tumor tissues compared to control tissues (Figure 8, A). Simultaneously, survival analysis using another transcriptome dataset of 88 NPC tissues revealed that NPC patients with low RPL14 expression had a worse prognosis (Figure 8, B).

[0057] It is worth noting that the above description is not a limitation of the present invention, and the present invention is not limited to the above examples. Changes, modifications, additions or substitutions made by technicians in this technical field within the essential scope of the present invention should also fall within the scope of protection of the present invention.

Claims

1. A group of SNP markers associated with the risk of nasopharyngeal carcinoma, characterized in that: The SNP markers include: rs2276868, rs3917410, and / or their strongly linked sites.

2. The SNP marker according to claim 1, characterized in that: The SNP markers also include the completely linked site rs5361 of rs3917410.

3. A set of genetic markers associated with the risk of nasopharyngeal carcinoma, including: The markers include: rs1572072, rs9510787, rs6498114, rs6774494, rs31489, rs1412829, rs3917410, rs2276868, rs186509115, HLA-DQB1*03:01:01, rs1131204, rs1050462, HLA amino acid HLA-A_62_Q, HLA amino acid HLA-DRB1_67_F and HLA amino acid HLA-B_66_I, and / or their strong linkage sites.

4. A model for assessing the risk of nasopharyngeal carcinoma, characterized in that: The model was constructed based on the following SNP markers: rs2276868, rs391741, and / or their strongly linked sites.

5. A model for assessing the risk of nasopharyngeal carcinoma, characterized in that: The model was constructed based on the following genetic markers: rs1572072, rs9510787, rs6498114, rs6774494, rs31489, rs1412829, rs3917410, rs2276868, rs186509115, HLA-DQB1*03:01:01, rs1131204, rs1050462, HLA amino acid HLA-A_62_Q, HLA amino acid HLA-DRB1_67_F, HLA amino acid HLA-B_66_I, and / or their strongly linked sites.

6. A method for constructing a risk assessment model for nasopharyngeal carcinoma, characterized in that include: The SNP markers rs2276868, rs3917410 and / or their strongly linked loci were included, combined with known GWAS loci, and the scores were weighted summed using the correlation coefficient of the single locus as the weight and the number of alleles carried by the individual as the metric.

7. Use of a reagent for detecting the SNP marker according to claim 1 or 2 in the preparation of a kit for assessing the risk of nasopharyngeal carcinoma.

8. Use of a reagent for detecting the genetic marker according to claim 3 in preparing a kit for assessing the risk of nasopharyngeal carcinoma.

9. Use of a set of reagents for detecting gene expression in the preparation of a kit for assessing the risk of nasopharyngeal carcinoma, wherein the gene is at least one of RPL14, SELE, NOTCH3 and FGFR3.

10. Use of a reagent for detecting the RPL14 gene in the preparation of a drug for evaluating EBV infection and replication, disease-related phenotypes and prognosis of nasopharyngeal carcinoma.

Images