Use of rice de novo gene DUD1 in control of drought resistance of plants

Abstract

Provided is a use of rice de novo gene DUD1 in control of drought resistance of plants. The rice de novo gene DUD1 (De Novo Gene Useful for Drought Resistance) capable of improving the drought resistance of rice is obtained by means of separation, cloning and functional verification of the rice. Genetic transformation materials for transforming multiple species by means of DUD1 are obtained by means of transgenesis. A drought experiment shows that DUD1 can enhance the drought resistance of the species, and the function and large use value of the gene are proved.

Description

Application of Orphan Gene DUD1 in Controlling Plant Drought Resistance Technical Field

[0001] The present invention relates to the field of rice genetic engineering. Specifically, it involves the isolation, cloning, and functional verification of a rice orphan gene, DUD1 (De Novo Gene Useful for Drought Resistance), which can enhance rice drought resistance. Through transgenic techniques, the present invention has generated genetically modified materials for DUD1 in multiple species. Drought experiments have demonstrated that DUD1 can enhance the drought tolerance of these species, confirming the gene's functionality and significant application value. Background Art

[0002] The conflict between water scarcity and crop production is becoming increasingly prominent with the intensification of global extreme climate change and a growing population. Discovering drought-resistant genes, improving crop tolerance, and developing new water-saving and drought-resistant crop varieties are effective solutions to this dilemma. Over the long course of crop evolution, crops have undergone significant changes in both genomics and plant morphology to adapt to extreme environmental changes. This diversity raises two important biological questions: What are de novo genes? And how do these de novo genes arise? First, the concept of de novo genes is defined as distinct from ancient genes. One type of de novo gene is derived rapidly from ancient genes, characterized by recent emergence and a short evolutionary history, while preserving their genetic structure or sequence information. Another type is orphan genes, which lack homologous genes in other species. They may have arisen from drastic changes in the coding sequence of ancient genes or from ancestral non-coding regions, also known as de novo genes. In recent years, increasing research has demonstrated that de novo genes are a major driving force of evolutionary innovation. Almost all species experience a certain number of orphan genes (species-specific novel genes) during their long evolutionary journey. Zhang et al. conducted a systematic study using high-quality genomes from 13 closely related rice varieties and discovered approximately 8,000 orphan genes in rice. Evolutionary patterns, transcription, and translation provided clear evidence for the existence of de novo genes. The study identified 175 de novo ORFs, and through mass spectrometry-targeted proteomics and ribosome profiling, translation signals were detected in over 50% of the de novo genes (Zhang et al. 2019). However, are there any orphan genes associated with drought resistance in this group? Do they drive phenotypic innovation? These questions await further investigation to guide the discovery of new drought-resistance genes and explore new strategies for genetic improvement of crop drought resistance.

[0003] Crucially, while the rice genome is predicted to harbor numerous novel genes specific to the genus Oryza, there are few reports on the evolution and specific functions of individual orphan genes in rice. Furthermore, there are also no reports on a single orphan gene enhancing the adaptability of multiple species to environmental (drought) conditions. Therefore, the present invention demonstrates that the orphan gene DUD1 in rice can enhance drought resistance in multiple species, which is of great value for the exploration of orphan genes related to drought resistance and the improvement of drought resistance in multiple species.

[0004] Summary of the Invention

[0005] The purpose of the present invention is to provide an application of the rice orphan gene DUD1 in controlling plant drought resistance. The protein encoded by the DUD1 gene is shown in SEQ ID NO.2, and its corresponding polynucleotide is shown in SEQ ID NO.1.

[0006] In order to achieve the above object, the present invention adopts the following technical measures:

[0007] Applicants have isolated, cloned, and functionally verified an orphan gene, DUD1 (De Novo Gene Useful for Drought Resistance), from rice, which can enhance rice drought resistance. Through genetic engineering, DUD1-transformed rice, maize, rapeseed, and Arabidopsis thaliana were obtained. Drought experiments demonstrated that DUD1 can enhance drought tolerance in these species. The protein encoded by the DUD1 gene is shown in SEQ ID NO. 2. The corresponding polynucleotide is shown in SEQ ID NO. 1.

[0008] The protection scope of the present invention includes:

[0009] Use of DUD1 protein or a gene encoding DUD1 protein in regulating plant drought resistance, wherein the DUD1 protein is represented by SEQ ID NO. 2;

[0010] The applications described above are specifically:

[0011] Increasing the expression of DUD1 protein or a gene encoding DUD1 protein in a plant to improve the drought resistance of the plant, the application specifically comprising: introducing a substance that increases the expression of DUD1 protein or a gene encoding DUD1 protein into the plant;

[0012] Inhibit or reduce the expression of DUD1 protein in rice to weaken the drought resistance of rice;

[0013] Knockout, inhibition, or silencing of the expression of the gene encoding the DUD1 protein in rice can reduce the drought resistance of rice;

[0014] In the above applications, preferably, when applied to rice, the knockout adopts the CRISPR / Cas9 system, and the target site of the gRNA in the system is GAACAGAAGAGAAGAAGCATCGG.

[0015] In the above application, the rice with reduced drought resistance after editing by the CRISPR / Cas9 system has the polynucleotide shown by SEQ ID NO.3 or SEQ ID NO.4.

[0016] Use of DUD1 protein or a gene encoding DUD1 protein in preparing drought-resistant transgenic plants, wherein the use specifically comprises: introducing a substance that increases the expression level of DUD1 protein or the expression level of the gene encoding DUD1 protein into the plant;

[0017] In the above application, preferably, the substance is a nucleic acid molecule encoding DUD1 protein, or its expression cassette, recombinant vector, or recombinant microorganism;

[0018] In the above-mentioned applications, preferably, when it is necessary to increase the expression level of DUD1 protein in plants or to increase the expression level of the gene encoding DUD1 protein in plants, the expression vector carrying the DUD1 gene of the present invention is introduced into plant cells by conventional biotechnology methods such as Ti plasmid, plant virus vector, direct DNA transformation, microinjection, electroporation, etc. (Weissbach, 1998, Method for Plant Molecular Biology VIII, Academy Press, New York, pp. 411-463; Geiserson and Corey, 1998, Plant Molecular Biology (2nd Edition)).

[0019] The nucleic acid molecule encoding the DUD1 protein is shown in SEQ ID NO.1.

[0020] In the above application, preferably, the plant is rice, corn, rapeseed, poplar or Arabidopsis thaliana.

[0021] Compared with the prior art, the present invention has the following characteristics:

[0022] Through association analysis of rice drought resistance, the rice orphan gene DUD1 was identified. Using transgenic techniques, they demonstrated that DUD1 not only enhances drought resistance in rice but also in multiple foreign species. For example, expressing DUD1 in maize, Arabidopsis, rapeseed, and poplar trees has been shown to improve their drought tolerance. This discovery provides valuable experience and genetic resources for improving drought resistance in multiple species using a single gene. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 shows the gene editing of rice DUD1 CRISPR mutants;

[0024] CRI#6 and CRI#27 are two homozygous families for DUD1 CRISPR mutants.

[0025] Figure 2 shows the drought stress phenotype of the rice DUD1 CRISPR mutant at the booting stage;

[0026] C6 and C27 are two homozygous families for DUD1 CRISPR mutants (CRI#6 and CRI#27), and the wild-type Kongyu 131 (KY131) serves as a control;

[0027] (a) Phenotypes of wild-type KY131 and mutant DUD1 CRISPR (C6) materials before and after drought stress in potted plants; scale bar = 12 cm;

[0028] (b) Comparison of TBR_R (TBR: total area / boundary rectangle area (reflecting the degree of leaf curling), suffix “_R:” indicates drought value / value before drought stress) of wild-type KY131 and mutant DUD1 CRISPR (C6, C27) after potted drought stress;

[0029] (c) Comparison of GPAR_R (GPAR: green leaf area / total leaf area, suffix “_R:” indicates drought value / value before drought stress) of wild-type KY131 and mutant DUD1 CRISPR (C6, C27) after potted drought stress.

[0030] Figure 3 shows the drought stress phenotype of rice DUD1 OE overexpressing materials in potted plants at the booting stage;

[0031] OE-1 and OE-4 are two DUD1 single-copy homozygous overexpression families, and the wild-type Kongyu 131 (KY131) was used as a control;

[0032] (a) Phenotypes of wild-type KY131 and overexpressing DUD1 OE (OE-1) materials before and after drought stress in potted plants; scale bar = 12 cm;

[0033] (b) Comparison of TBR_R between wild-type KY131 and overexpressing DUD1 OE (OE-1, OE-4) after drought stress in potted plants;

[0034] (c) Comparison of GPAR_R between wild-type KY131 and overexpressing DUD1 OE (OE-1, OE-4) after drought stress in potted plants;

[0035] (d) Comparison of the relative expression levels of DUD1 in wild-type KY131 and DUD1-overexpressing OE (OE-1, OE-4) materials.

[0036] Figure 4 shows the phenotype of DUD1 OE overexpressing maize materials in pots at the seedling stage after drought stress;

[0037] Among them: OE#53, OE#55 and #OE#57 are three independent transgenic maize lines, and OE-CK is an isolated wild-type line (i.e., wild-type KN5585) as a control;

[0038] (a) Phenotypes of wild-type maize OE-CK and DUD1 overexpressing OE (OE#53, OE#55, OE#57) before potting drought stress.

[0039] (b) Phenotypes of wild-type maize OE-CK and DUD1 overexpressing OE (OE#53, OE#55, OE#57) materials after drought stress in potted plants;

[0040] (c) Relative expression levels of the DUD1 gene in maize wild-type OE-CK and DUD1-overexpressing OE (OE#53, OE#55, OE#57);

[0041] (d) Comparison of GPAR_R between wild-type maize OE-CK and overexpressing DUD1 OE (OE#53, OE#55, OE#57) materials after potted drought stress.

[0042] Figure 5 shows the conditions of DUD1 OE-overexpressing Arabidopsis seedlings in potted plants before, after, and after rehydration;

[0043] OE23 and OE27 are two independent overexpression transgenic Arabidopsis lines, and Col is Columbia wild-type Arabidopsis as a control;

[0044] (a) Relative expression levels of the DUD1 gene in Arabidopsis wild-type Col and DUD1-overexpressing OE (OE23, OE27) materials;

[0045] (b) Phenotypes of Arabidopsis wild-type Col and overexpressing DUD1 OE (OE23, OE27) materials before, after, and after rehydration in potted plants;

[0046] (c) Survival rate of Arabidopsis wild-type Col and overexpressing DUD1 OE (OE23, OE27) materials after drought stress in potted plants.

[0047] Figure 6 shows the situation of DUD1 OE overexpressing rapeseed material in potted seedling stage after drought stress;

[0048] OE#11, OE#17, and OE#27 are three independent overexpression transgenic rapeseed lines, and Col is Westar wild-type rapeseed as a control;

[0049] Wherein: (a) is the relative expression level of DUD1 gene in wild-type rapeseed Westar and overexpression DUD1 OE (OE#11, OE#17 and OE#27);

[0050] (b) Phenotypes of wild-type rapeseed Westar and DUD1 overexpressing OE (OE#11, OE#17, and OE#27) materials after rehydration from drought stress.

[0051] Figure 7 shows the conditions of DUD1 OE overexpressing poplar potted plants before drought stress and after rehydration;

[0052] OE-3 and OE-19 are two independent overexpression transgenic poplar lines, and 717 is a wild-type poplar used as a control;

[0053] Among them: (a) The phenotypes of wild-type poplar 717 and DUD1 overexpressing OE (OE-3 and OE-19) before drought stress and after drought stress rewatering;

[0054] (b) Relative expression levels of the DUD1 gene in wild-type poplar 717 and DUD1-overexpressing OE (OE-3 and OE-19);

[0055] (c) Comparison of leaf survival rates of wild-type poplar and DUD1 overexpressing OE (OE-3 and OE-19) materials after rehydration under drought stress. DETAILED DESCRIPTION

[0056] The following examples define the present invention and describe methods for constructing DUD1 CRISPR mutants, cloning DNA fragments containing the complete coding region of the DUD1 gene, and verifying DUD1 gene function. Based on the following description and these examples, those skilled in the art will be able to ascertain the essential features of the present invention and, without departing from the spirit and scope of the present invention, may make various changes and modifications to adapt the present invention to various uses and conditions.

[0057] Example 1: Isolation and cloning of the DUD1 gene

[0058] Using cDNA from leaves of rice variety Nipponbare as a template, primers CDS-F: ATGGGAACAGAAGAGAAGAA and CDS-R: TTATCGCCGCTCATCAGCGG were used to PCR amplify the CDS sequence encoded by the DUD1 gene. The amplified sequence contained the CDS sequence shown in SEQ ID NO.1.

[0059] PCR reaction conditions were: 95°C denaturation for 3 minutes, 33 cycles of 94°C for 30 seconds, 55°C for 30 seconds, and 72°C for 1 minute, followed by extension at 72°C for 5 minutes. The amplified PCR product was ligated into the pGEM-T Easy vector (purchased from Promega), and positive clones were screened and confirmed by sequencing to obtain the DUD1 sequence.

[0060] The applicant named this clone pGEM-DUD1 plasmid.

[0061] Example 2: Construction of DUD1 gene overexpression vectors in rice, corn, Brassica napus, Arabidopsis thaliana and poplar

[0062] 1. Construction of rice overexpression vector The specific steps are as follows: First, the positive clone pGEM-DUD1 plasmid obtained in Example 1 was amplified using primers DUD1-OEF (TACGAACGATAGCCGGTACCATGGGAACAGAAGAGAAGAA) and DUD1-OER (TTGCGGACTCTAGAGGATCCTCAATTCCACCTTGGAGCAC) to amplify a cDNA fragment containing the full length of DUD1. The reaction conditions are: pre-denaturation at 94°C for 3 min; 30 cycles of 94°C for 30 sec, 55°C for 30 sec, and 72°C for 1 min; and extension at 72°C for 5 min.

[0063] The fragment was ligated with the pCAMBIA1301U vector digested with restriction endonucleases KpnI and BamHI using Gibson Assembly, and the vector was sequenced and confirmed for use in genetic transformation.

[0064] 2. The construction of corn overexpression vector was completed by Weimi Biotechnology (Jiangsu) Co., Ltd.

[0065] 3. Construction of a rapeseed overexpression vector: Design infusion primers pGWC-F1 / R1 and amplify a fragment containing the full-length CDS of DUD1 using pGEM-DUD1. PCR amplification using pGWC-F1-5'AGCAGGCTTTGACTTTAGGTC ATGGGAACAGAAGAGAAGAA-3' and pGWC-R1-5'-TGGGTCTAGAGACTTTAGGTCAATTCCACCTTGGAGCAC-3' was performed as follows: denaturation at 98°C for 2 min; denaturation at 98°C for 10 s, annealing at 60°C for 15 s, extension at 72°C for 30 s, 35 circles; and a total extension at 72°C for 5 min. The amplified product was ligated into the digested entry vector pGWC-T using a rapid seamless cloning reagent (Trelief™ SoSoo Cloning Kit Ver. 2, catalog number TSV-S2, purchased from Beijing Qingke Xinye Biotechnology Co., Ltd.). Then, three positive clones were selected for transformation and sent for sequencing. After sequencing was confirmed, the plasmid was extracted and constructed into the binary vector 35S: gene-C-terminal fusion GFP tag, and the vector was sequenced to confirm that it could be used for genetic transformation.

[0066] 4. Arabidopsis overexpression vector construction steps are as follows: The vector was constructed using the Gateway method: using rice cDNA as a template, primers DUD1-ATTB-FP (GGGGACAAGTTTGTACAAAAAAGCAGGCTTC ATGGGAACAGAAGAGAAGAA) and DUD1-ATTB-RP (GGGGACCACTTTGTACAAGAAAGCTGGGTCTCAATTCCACCTTGGAGCAC) were used, respectively, to amplify the target fragment using a high-fidelity enzyme (Phusion). PCR products were purified using NaAc. The purified target fragments were ligated into the entry vector pDONR223 via BP reaction and then into the final vector pGreen0179-35S-GWB-YFP via LR reaction to obtain the positive plasmid pGreen0179-35S-DUD1-YFP. The vector was sequenced to confirm suitability for genetic transformation.

[0067] 5. The steps for constructing a poplar overexpression vector are as follows: The vector was constructed using the Gateway method: using rice cDNA as a template, DUD 1-3*FLAG(C)-BP-F (acaagtttgtacaaaaaagcaggctTA atgggaacagaagagaa) and DUD1-3*FLAG(C)-BP-R (accact ttgtacaagaaagctgggtA TCATTTATCATCATCATC) as primers, respectively, and using a high-fidelity enzyme (KOD) to amplify the target fragment. The PCR product was purified using the Tiangen Gum Recovery Kit (DP214). The purified target fragment was ligated into the entry vector pDONR 207 via BP reaction and then into the final vector PK2GW7 via LR reaction, resulting in the positive plasmid PK2GW7-35S-DUD1-3*FLAG. The vector was sequenced to confirm its suitability for genetic transformation.

[0068] Example 3: Construction of dud1 rice CRISPR vector

[0069] The gene sequence of the DUD1 gene was obtained from the Rice Data database (http: / / www.ricedata.cn / gene / ). The target site was selected according to CRISPR-P v2.0 (http: / / crispr.hzau.edu.cn / CRISPR2 / ), and the target site sequence was: Target site sequence: GAACAGAA GAGAAGAAGCATCGG.

[0070] The vector construction of CRISPR mutant strains can refer to the relevant literature (Xie Kabin et al. Boosting CRISPR / Cas9 multiplex editing capability with the endogenous tRNA-processing system. PNAS. 2015, 112: 3570-3575.), which will not be described in detail in this manual due to space limitations.

[0071] Example 4:

[0072] Genetic transformation of plasmid vectors and positive detection of transgenic plants

[0073] 1. Rice genetic transformation:

[0074] Rice genetic transformation was performed using Agrobacterium-mediated transformation (the specific steps are described below). The constructed overexpression and CRISPR genes were introduced into the rice variety "KY131." Transgenic plants were obtained through pre-cultivation, infection, co-cultivation, selection of hygromycin-resistant calli, differentiation, rooting, seedling training, and transplanting. This Agrobacterium-mediated rice genetic transformation method (system) is based on the method reported by Hiei et al. (Hiei et al., Efficient transformation of rice, Oryza sativa L., mediated by Agrobacterium and sequence analysis of the boundaries of the T-DNA, Plant J, 6:271-282, 1994).

[0075] (1) Electrotransformation: The final genetic transformation vector was electrotransformed into the Agrobacterium EHA105 strain using a voltage of 1800 V, and the culture medium was spread on LA medium with corresponding resistance selection. Positive clones were screened and used for the following transformation callus.

[0076] (2) Callus induction: Mature rice Kongyu 131 was shelled and then treated with 70% ethanol for 1 minute and 0.15% mercuric chloride (HgCl2) for 15 minutes for surface disinfection; the seeds were washed 4-5 times with sterile water; the sterilized seeds were placed on the induction medium; the inoculated callus induction medium was placed in the dark and cultured for 4 weeks at a temperature of 25±1°C.

[0077] (3) Callus subculture: Select bright yellow, compact and relatively dry embryogenic calli and culture them on subculture medium in the dark at 25±1℃ for 2 weeks.

[0078] (4) Pre-culture: Select compact and relatively dry embryogenic calli and culture them on pre-culture medium in the dark at 25±1°C for 2 weeks.

[0079] (5) Agrobacterium culture: Agrobacterium EHA105 (derived from CAMBIA, a commercial strain carrying the vector of the present invention) was pre-cultured on LA medium with corresponding resistance selection for two days at a culture temperature of 28°C; the Agrobacterium was transferred to a suspension culture medium and cultured on a shaker at 28°C for 2-3 hours.

[0080] (6) Agrobacterium infection: transfer the pre-cultured callus into a sterilized bottle; adjust the Agrobacterium suspension to OD 600 0.8-1.0; soak the callus in the Agrobacterium suspension for 30 minutes; transfer the callus to a sterilized filter paper and dry it; then place it on the co-culture medium and culture it for 3 days at a culture temperature of 19-20°C.

[0081] (7) Callus washing and selective culture: Wash the callus with sterile water until Agrobacterium is no longer visible; soak in sterile water containing 400 ppm carbenicillin (CN) for 30 minutes; transfer the callus to sterilized filter paper and blot dry; transfer the callus to selective culture medium for selection 2-3 times, each time for 2 weeks (the carbenicillin concentration for the first screening is 400 ppm, the second and subsequent screenings are 250 ppm, and the hygromycin concentration is 250 ppm).

[0082] (8) Differentiation: Transfer the resistant calli to the pre-differentiation culture medium and culture in the dark for 5-7 weeks; transfer the pre-differentiation culture calli to the differentiation medium and culture under light at 26°C.

[0083] (9) Rooting: Cut off the roots produced during differentiation; then transfer them to rooting medium and culture them under light at 26°C for 2-3 weeks.

[0084] (10) Transplantation: Wash off the residual culture medium on the roots and transfer the seedlings with good root systems into the greenhouse while keeping them moist for the first few days.

[0085] 2. The genetic transformation of maize overexpression materials was completed by Weimi Biotechnology (Jiangsu) Co., Ltd.

[0086] 3. Genetic transformation of rapeseed:

[0087] Genetic transformation of rapeseed was carried out using Agrobacterium-mediated genetic transformation (De Block et al. 1989). In this experiment, the recipient strain used for rapeseed transformation was Brassica napus Westar. The transformation process was as follows:

[0088] De Block M,De Brouwer D,Tenning P.Transformation of Brassica napus and Brassica oleracea Us ing Agrobacterium tumefaciens and the Expression of the bar and neo Genes in the Transgenic Plants.Plant Physiol,1989,91:694-701

[0089] (1) Seed disinfection and sowing: First, soak mature and plump Brassica napus seeds 'Westar' in 75% alcohol for 1 min, disinfect with 0.15% mercuric chloride solution for 12 min, and wash with sterile ddH2O 4-5 times; sow the sterilized seeds in medium numbered M0 and culture in a dark room at 22°C for 6-7 days.

[0090] (2) Agrobacterium activation: Pick the target Agrobacterium and inoculate it into 50 mL of liquid LB. Cultivate at 28°C and 180 rpm until OD600 = 0.3-0.5 (about 12-14 h). Collect the cells by centrifugation at 4000 rpm / min, suspend them in DM suspension (containing acetosyringone, with a final concentration of 0.05 mM), and cultivate them at 28°C and 200 rpm / min for 1 h. Pour them into a culture dish for later use.

[0091] (3) Infection and co-cultivation: Use sterile tweezers and a scalpel to cut the hypocotyls of the seedlings, each 0.8-1.0 cm in length (try to cut the explants vertically with one knife); place the cut explants in a dish containing bacterial solution and immerse them for 10 minutes, shaking them every once in a while; dry the infected explants with sterile filter paper and transfer them to medium numbered M1, and culture them at 22°C for 36-48 hours until cloud-like bacterial colonies appear around the explants.

[0092] (4) Selective culture for callus induction: The hypocotyl explants after co-culture are transferred to M2 medium for callus induction, which contains timentin (TMT) to inhibit the growth of Agrobacterium and hygromycin (Hyg), a selection antibiotic, and cultured under light for 18-21 days.

[0093] (5) Differentiation and bud regeneration: Eliminate brown explants and transfer explants with normal growth and swollen ends to differentiation medium M3 for light culture. Subculture once every 2-3 weeks until green buds appear.

[0094] (6) Bud growth and rooting: The differentiated green buds are transferred to M4 culture medium and grown for 4 weeks. They will then grow roots and are then transferred to small pots and transplanted to the field.

[0095] 4. Arabidopsis genetic transformation:

[0096] The genetic transformation method for Arabidopsis thaliana is called the floral dip method, and the specific steps are as follows:

[0097] (1) The correctly sequenced vector was electroporated into the corresponding Agrobacterium competent cells GV3101-pMP90G, and the positive clones were detected and preserved.

[0098] (2) Take 1 ml of activated bacterial solution and add it to 250 mL of LB medium. Incubate it in a shaking incubator at 28°C overnight until the OD 600 0.8-1.2;

[0099] (3) Collect the cells at room temperature and centrifuge at 5000 rpm for 8 min;

[0100] (4) Discard the supernatant and resuspend in 250 mL of 5% sucrose solution;

[0101] (5) Add 100 μL of surfactant Silwet L-77 (GE Healthcare) to complete the preparation of the infection solution;

[0102] (6) Arabidopsis thaliana at its peak flowering stage was selected for transformation;

[0103] (7) Carefully immerse the Arabidopsis inflorescence in the infection solution for 40 seconds;

[0104] (8) Place the transformed Arabidopsis thaliana flat on a tray covered with plastic wrap, keep it moist and away from light overnight, and take it out the next day and culture it normally under light;

[0105] (9) After the plant seeds mature, harvest the seeds and screen for plant resistance based on the vector for subsequent experiments.

[0106] 5. Poplar genetic transformation:

[0107] This operation process takes the transformation of poplar 717 with the hyg resistance vector as an example. Other varieties and screening systems can be fine-tuned according to this operation experimental process:

[0108] (1) Shaking bacteria

[0109] Incubate the cells in liquid LB with kanamycin (final concentration 50 mg / L) and rifampicin (final concentration 25 mg / L) by shaking (28°C) until the OD600 value reaches approximately 0.6. Transfer 50 mL of the bacterial suspension to a 50 mL centrifuge tube and centrifuge at 18°C, 3500 rpm, for 15 minutes. Discard the supernatant and resuspend in the resuspension buffer. Add the resuspension buffer to a final volume of approximately 100 mL (OD600 approximately 0.3) before infection.

[0110] (2) Infection

[0111] Remove the leaves of sterile seedlings (sterile seedlings grown in tissue culture bottles for 2-3 months) (leaves are selected from the 3rd to the 8th leaves from the top of the seedling, and yellow or dying leaves cannot be selected), use a scalpel to cut wounds on the leaves on filter paper, and infect the leaves in the infection solution for 10-15 minutes, shaking them from time to time.

[0112] (3) Co-culture

[0113] Use filter paper to absorb the bacterial liquid on the infected leaves, but do not let the leaves dry out too much. Place them upside down on the co-culture medium (WPMC) and place them away from light for about 2 days (the length of time depends on the situation, as long as bacteria appear on the edge of the leaves but there are no large areas of bacterial plaques).

[0114] (4) Screening culture medium

[0115] Tear the leaves apart and transfer them to the screening medium (WPMS①) (hyg is 1.5 mg / L), continue to culture in the dark for about two weeks, and after callus grows out, subculture them to a new screening medium (WPMS②) (hyg is 2 mg / L), subculture once every two weeks, and later subculture them to WPMS②. Callus with a diameter of about 0.5 cm will grow in about one and a half months.

[0116] (5) Differentiation culture

[0117] After the callus grows to about 0.5 cm, transfer it to differentiation medium (hyg 1.5 mg / L) and subculture it about every three weeks. During this period, the callus will turn green (or red) and harden. This stage lasts about two months.

[0118] (6) Rooting culture

[0119] When the seedlings grow to about 1 cm, cut them and place them on rooting medium (hyg is 1.5 mg / L). They will take root in about a week.

[0120] Positive detection of transgenic plants

[0121] (1) To detect the expression of the target gene in overexpressing transgenic plants, the applicant used real-time PCR to analyze the expression of transgenic T0 plants. The total RNA used in the experiment was seedling RNA. After reverse transcription, the product was used to detect the transcription level of DUD1 using real-time fluorescence quantitative PCR.

[0122] The PCR parameters were pre-denaturation at 95°C for 10 seconds, denaturation at 95°C for 5 seconds, and annealing and extension at 60°C for 30 seconds, for 40 cycles. The primer sequences used for real-time PCR were:

[0123] DUD1-QF:TACGCTTCTGCCGGATTTGT

[0124] DUD1-QR: CCATCGATACCCCTCCCGTA

[0125] The target gene expression levels were measured in T0 and T1 transgenic plants. The final results of DUD1 expression in the T1-generation overexpressing transgenic rice are shown in Figure 3(d). Real-time PCR results showed that DUD1 expression levels in transgenic rice lines OE1 and OE4 were significantly increased compared to wild-type KY131, demonstrating a strong overexpression effect.

[0126] In transgenic maize, Arabidopsis, rapeseed, and poplar materials, expression levels of positive plants were also detected. Real-time PCR results showed that among the transgenic maize materials, the expression levels of DUD1 in individual plants of families OE#53, OE#55, and OE#57 were significantly increased compared with the wild-type KN5585, indicating that they were over-expressing materials (Figure 4c).

[0127] Among the transgenic Arabidopsis thaliana materials, the expression levels of DUD1 in individual plants of families OE23 and OE27 were significantly increased compared with the wild type KN5585, indicating that they were overexpressing materials (Figure 5a).

[0128] Among the transgenic rapeseed materials, the expression levels of DUD1 in individual plants of families OE#11, OE#17, and OE#27 were significantly increased compared with the wild-type Westar, indicating that they were over-expressing materials (Figure 6a).

[0129] Among the transgenic poplar materials, the expression levels of DUD1 in individual plants of families OE-3 and OE-19 were significantly increased compared with the wild type 717, indicating that they were overexpressing materials (Figure 7b).

[0130] (2) To detect gene editing in CRISPR mutant plants, total DNA was extracted from leaves of T0 and T1 rice plants using the CTAB method (Zhang et al., Genetic diversity and differentiation of indica an japonica rice detected by RFLP analysis, 1992, Theor Appl Genet, 83, 495-499). Using total leaf DNA as a template, PCR was performed on T0 and T1 CRISPR-transformed plants using the following primers for positive detection.

[0131] The sequences of the primers are as follows:

[0132] DUD1-CRI-F:AGCAAATGATTATTGTAGCACCAC;

[0133] DUD1-CRI-R:TGACCAACTCCGCCGAAACC;

[0134] The above primers were synthesized by Qingke Biotechnology Co., Ltd.

[0135] The total volume of the PCR reaction was 20 μl, and the specific preparation was: template 100 ng, 10xPCR buffer 2 μl, 10 mM dNTP 1.6 μl, 2.5 mM Mg 2+1.5 μl, 0.4 μl each of forward primer and reverse primer (DUD1-CRI-F and DUD1-CRI-R), 0.2 μl of r-Taq enzyme, add deionized water to 20 μl (the PCR buffer, dNTP, Mg 2+ , r-Taq enzyme, etc. were purchased from Takara Biotechnology (Dalian) Co., Ltd.). PCR reaction conditions were as follows: ① 94°C for 4 minutes, ② 94°C for 30 seconds, ③ 57°C for 30 seconds, ④ 72°C for 1 minute, ⑤ 32 cycles from ② to ④, ⑥ 72°C for 7 minutes, and ⑦ storage at 4°C. PCR products were electrophoresed on a 1% (w / v) TBE agarose gel. Amplified fragments were sent to a sequencing company for sequencing, and the sequencing results were compared with reference sequences to determine genotypes. Homozygous mutants CRI#6 and CRI#27 were obtained from transgenic T1 plants. The sequencing results are shown in Figure 1.

[0136] Among them, CRI#6 contains a mutated gene, and its polynucleotide sequence is shown in SEQ ID NO.3.

[0137] CRI#27 contains a mutated gene, and its polynucleotide sequence is shown in SEQ ID NO.4.

[0138] Example 5:

[0139] Method for Identifying Drought Resistance of Rice Genetic Materials in Pots at Booting Stage

[0140] The potted drought resistance identification of relevant materials was completed on the rice phenotyping platform.

[0141] The tested materials were sown in bread pots for seedling cultivation and transplanted into medium-sized blue buckets after 25 days. Each bucket was filled with 4.5 kg of air-dried soil (bucket weight 0.2 kg), and the soil was soaked two days before transplanting the seedlings. During transplanting, one rice seedling was planted in each medium-sized blue bucket, and 12 seedlings were planted in each family, of which 6 were subjected to drought stress as the treatment group and 6 were grown normally as the normal group. During the tillering period of rice, 150 ml of liquid fertilizer was added to each bucket. The liquid fertilizer formula was 371 g of urea, 331 g of KH2PO4, and 94 g of KCl, and then water was added to 60 L. When the rice entered panicle differentiation, the water in the treatment buckets was discarded. At the beginning of the drought treatment, each bucket was weighed at 5.8 kg (including the bucket weight) using a platform scale to initiate drought stress. The weight was then slowly reduced to 5.4 kg (including the bucket weight). The drought stress lasted for 10 days, during which time 50 ml of water was poured into each bucket each evening. After the drought treatment ended, the rice was rewatered to ensure that there was surface water on the soil surface for normal rice growth. Throughout this experiment, the rice was transported to the rice phenotyping platform to obtain I-traits before, during, and after three days of rewatering.

[0142] Example 6:

[0143] Identification of drought stress phenotypes of rice dud1 CRISPR mutants at the booting stage in potted plants

[0144] The drought resistance of identified homozygous mutants (dud1-Cri, i.e., C6 and C27) and transgenic recipient wild-type rice KY131 was assessed according to the procedures of Example 5. The phenotypic results are shown in Figure 2(a). Under normal conditions, there was no difference in growth between the control KY131 and the dud1 CRI SPR homozygous mutant plants. However, after drought stress, the mutants had significantly more dead leaves than the control KY131. The relative stay-green values ​​of the two mutant lines were 0.51 and 0.48, respectively, significantly lower than the control's 0.93 (Figure 2(c)). These data indicate that knocking out DUD1 in rice reduces its drought tolerance (Figure 2).

[0145] Example 7:

[0146] Identification of drought stress phenotypes in rice DUD1 overexpressing materials at the booting stage

[0147] The drought resistance of the identified genotypes of the overexpressing rice and the transgenic recipient wild-type KY131 material was assessed according to the method described in Example 5. The phenotypic results are shown in Figure 3(a). Under normal conditions, there was no growth difference between the control KY131 and the DUD1 overexpressing family. However, after drought stress, the overexpressing rice had significantly fewer dead leaves than the control KY131. The relative green retention of the two overexpressing families was 0.95 and 0.93, respectively, significantly higher than the 0.62 of the control KY131 (Figure 3(c)). These data indicate that overexpressing the DUD1 gene can significantly enhance rice drought tolerance (Figure 3).

[0148] Example 8:

[0149] Identification of Drought Stress Phenotypes of DUD1 Transgenic Maize Materials in Pots at the Seedling Stage

[0150] Genotype-identified overexpressing materials and transgenic and wild-type maize materials were germinated and seeded directly into small drums. Seedlings with consistent growth were transplanted into medium-sized blue drums. The experimental soil was a mixture of southern Chinese paddy soil and coarse sand in a 2:3 volume ratio. Each drum contained an equal volume of uniform sandy soil and water, which was allowed to seep through to ensure consistent soil compaction. The experiment was replicated five times. Healthy, four-leaf plants were photographed as pre-drought phenotypes, and i-traits were extracted using the crop phenotyping platform. Then, water was withheld for 20 days of drought stress. When significant differences in leaf wilting between the wild-type and transgenic materials were observed, photos were taken as post-drought phenotypes, and i-traits were extracted using the crop phenotyping platform.

[0151] The phenotypic results are shown in Figure 4. Under normal growth conditions, there was no significant difference in growth between the transgenic material and the isolated wild-type material (Figure 4a). After drought treatment, the transgenic material showed significantly higher stay-green properties than the wild-type (Figure 4b). The GPAR_R indices of the three transgenic families were 0.59, 0.69, and 0.70, respectively, significantly higher than the wild-type material's 0.02 (Figure 4d). These data indicate that overexpressing the rice DUD1 gene in maize can significantly enhance maize's drought tolerance (Figure 4).

[0152] Example 9:

[0153] Identification of drought stress phenotypes of DUD1 transgenic Arabidopsis thaliana seedlings in potted plants

[0154] Overexpressing materials with identified genotypes and transgenic recipients of wild-type plants from Columbia were sown in seedling trays. When leaves emerged, they were transplanted into small pots, with 24 seedlings per pot and four replicates per family. They were grown under normal conditions for three weeks, and photographed as the pre-drought phenotype. Water was then withheld for 7-9 days. When a significant difference in leaf wilting between the control and experimental groups was observed, photographs were taken to record the post-drought phenotype. Rewatering was then performed by adding water to the tray below the pots to ensure a clear water supply, allowing the Arabidopsis to grow normally. Three days later, photographs were taken again to record the post-rewatering phenotype. The number of surviving seedlings in each pot was then counted, and the survival rate was calculated. Compared to wild-type plants from Columbia, the survival rates of DUD1-overexpressing Arabidopsis plants after rewatering were significantly higher at 58% and 98%, respectively, compared to 8% for wild-type plants. This indicates that expressing rice DUD1 in Arabidopsis can significantly enhance drought resistance (Figures 5b and c).

[0155] Example 10:

[0156] Identification of drought stress phenotypes of DUD1 transgenic rapeseed materials in potted seedlings

[0157] Overexpressing materials with identified genotypes and wild-type Westar transgenic recipients were sown in seedling trays. When leaves emerged, they were transplanted into small pots, with one seedling per pot. Each family was planted in five replicates, with two replicates deprived of water after 10 days of growth and the remaining three replicates deprived of water after 30 days. After observing significant differences in leaf wilting between the control and experimental groups, the two treatments were rewatered after three days of stress. Water was added to the seedling trays to ensure a clear water supply in the tray below the pots, allowing the rapeseed to resume normal growth.

[0158] Compared with wild-type Westar, after rewatering, DUD1-overexpressing rapeseed showed a more drought-resistant phenotype ( Figure 6 b).

[0159] Example 11:

[0160] Identification of Drought Stress Phenotypes of DUD1 Transgenic Poplar Materials in Pots

[0161] The overexpression material and transgenic receptor 717 wild-type material of identified genotype were planted in rooting medium (25 days), and transplanted into potted small red bucket after taking root. Each small red bucket was planted with 1 seedling, and each family planted 4 repetitions. In the growth chamber, growth was carried out for 3 months under normal conditions, with a growth temperature of 23 degrees, illumination for 16 hours, and an indoor humidity of 50%. The water was cut off and the material growth state was recorded the day before, and the leaf number of each strain poplar was recorded. After the water was cut off for 5 days, the plant was rehydrated, and water was added in the large basin below the small red bucket to ensure that the bright water supply of 3-5cm for the normal growth of the poplar was provided in the basin. The rehydration was taken again after 7 days to record the phenotype after the rehydration, and then the leaf number of each strain poplar seedling was added. Compared with the wild-type material 717, after rehydration, the average leaf survival rates of DUD1-overexpressing poplar plants were 35% and 42%, respectively, which were significantly higher than 0% of the wild-type 717. This indicates that expressing rice DUD1 in poplar can significantly enhance the drought resistance of poplar (Figure 7).

Claims

1. Application of DUD1 protein or a gene encoding DUD1 protein in regulating plant drought resistance, wherein the DUD1 protein is shown in SEQ ID NO.

2.

2. The use according to claim 1, characterized in that: The method of increasing the expression level of DUD1 protein or a gene encoding DUD1 protein in a plant to improve the drought resistance of the plant comprises: introducing a substance that increases the expression level of DUD1 protein or a gene encoding DUD1 protein into the plant.

3. The use according to claim 1, characterized in that: Inhibiting or reducing the expression of DUD1 protein in rice can weaken the drought resistance of rice.

4. The use according to claim 1, characterized in that: Knocking out, inhibiting or silencing the expression of the gene encoding the DUD1 protein in rice can weaken the drought resistance of rice.

5. The use according to claim 4, characterized in that: When applied in rice, the knockout adopts the CRISPR / Cas9 system, and the target site of the gRNA in the system is GAACAGAAGAGAAGGAAGCATCGG.

6. The use according to claim 5, characterized in that: The rice with reduced drought resistance after editing by the CRISPR / Cas9 system contains the polynucleotide shown in SEQ ID NO.3 or SEQ ID NO.

4.

7. Use of DUD1 protein or a gene encoding DUD1 protein in preparing drought-resistant transgenic plants, wherein the DUD1 protein is represented by SEQ ID NO. 2, and the method comprises: A substance that increases the expression level of the DUD1 protein or the expression level of the gene encoding the DUD1 protein is introduced into the plant.

8. The use according to claim 2 or claim 7, wherein the substance in the use is a nucleic acid molecule encoding DUD1 protein, or an expression frame thereof, a recombinant vector, or a recombinant microorganism.

9. The use according to claim 7, characterized in that: The introduction method is direct DNA transformation, microinjection or electroporation.

10. The use according to claim 1 or 7, wherein the plant is rice, corn, rapeseed, Arabidopsis or poplar.

Images