Parent breeding method suitable for mechanical mixed sowing and ratoon seed production of rice

Abstract

The present invention relates to a parent breeding method suitable for mechanical mixed sowing and ratooning seed production of rice. By hybridizing and selfing a rice parent having recessive brown, or recessive mottled husk or recessive dark brown husk color specific marker with a parent having a blast resistance gene, and incorporating molecular marker-assisted selection, a seed-producing male parent having a primary-crop growth period of 118d ± 3d, a ratoon-crop growth period of 70d ± 2d, and a ratooning ability of 1.8 or more, and possessing the described gene is selected; additionally, a seed-producing female parent having a normal husk color is selected by means of hybridization, selfing, and backcrossing, wherein the growth periods and the ratooning ability of the female parent are consistent with those of the male parent. The bred rice male parent and female parent have significant differences in husk color, and mechanical harvesting and mechanical sorting are achieved, thereby liberating the workforce, saving seed production costs, increasing the seed production yield, and improving economic benefits; strong ratooning ability after one season of mechanical mixed harvesting is achieved; and additionally, the consistent development progress of the male parent and the female parent solves the bottleneck problem of the mechanical mixed sowing seed production.

Description

A parent breeding method suitable for rice mechanical mixed sowing regeneration seed production Technical Field

[0001] The invention belongs to the technical field of crop breeding, and in particular relates to a parent breeding method suitable for mechanical mixed sowing and regeneration seed production of rice. Background Art

[0002] Hybrid rice mixed sowing regeneration seed production is a new approach to hybrid rice seed production, which has the characteristics of saving labor, fertilizer, seeds, short growing period and significant benefits. However, due to the long growing period of the seed production parents and the lack of flowering period in the regeneration season, the seed production yield of regeneration in one season in existing research is less than 60kg, which seriously restricts the development of regeneration seed production technology.

[0003] At present, agricultural machinery and equipment are constantly improving, and seed drills and transplanters are more accurate and faster. There is an urgent need for seed parents with similar growth periods to achieve a leap in the efficiency and yield of mixed seed production; with the continuous development of photoelectric color sorting technology, color sorting machinery and equipment are used to achieve sorting through the color difference of the husk. To achieve high-precision sorting, the greater the color difference between the husks of the parent seeds, the better the purity of the color sorting. At present, the color difference between the husks of the parent seeds in mixed seed production is not obvious, and it is difficult to accurately screen and ensure the purity of the seeds to achieve mechanical sowing, mechanical transplanting, etc., which restricts the application and promotion of hybrid rice full mechanized seed production technology. SUMMARY OF THE INVENTION

[0004] The present invention discloses a parent breeding method suitable for mechanical mixed sowing and regeneration seed production of rice. The method comprises hybridizing and self-pollinating a rice parent with a recessive brown, recessive hull, or recessive black-brown hull color-specific marker with a parent containing a blast-resistant gene, and combining molecular marker-assisted selection to obtain a seed production male parent with a first-season growth period of 118d±3d, a regeneration season growth period of 70d±2d, a regeneration capacity of 1.8 or above, and the above-mentioned gene. Simultaneously, hybridization, selfing, and backcrossing are used to breed a seed production female parent with normal hull color, whose growth period and regeneration capacity are consistent with those of the male parent. The rice parents selected by the method of the present invention have a large difference in hull color, which realizes mechanical harvesting and mechanical sorting, liberates labor, saves seed production costs, increases seed production yield, and also improves economic benefits. The method realizes strong regeneration capacity after one season of mechanical mixed harvesting. At the same time, the consistent growth process of the parents solves the bottleneck problem of mechanized mixed sowing and seed production. Technical issues

[0005] The present invention aims to solve the following technical problems existing in the prior art: the color difference of the husks of the parent plants in mixed seed production is not obvious, which makes it difficult to accurately screen to ensure seed purity, and therefore it is difficult to achieve mechanical sowing and mechanical transplanting, which in turn restricts the application and promotion of hybrid rice full-process mechanized seed production technology. Technical Solutions

[0006] The present invention solves the technical problem through the following technical solutions:

[0007] Provided is a parent breeding method suitable for mechanical mixed sowing and regeneration seed production of rice.

[0008] The present invention provides a method for selecting and breeding parents suitable for mechanical mixed sowing and regeneration of rice seeds, comprising the following steps:

[0009] (1) A rice parent containing a blast-resistant gene is hybridized with a hybrid rice parent with a recessive husk color-specific marker to obtain a hybrid F1;

[0010] (2) Using a method combining conventional breeding and molecular marker-assisted selection (MAS), single plants with the recessive husk color-specific marker described in step (1) and a homozygous rice blast resistance gene are selected from the F2 and continuously self-pollinated. After continuous self-pollination, male parent lines with a first-season growth period of 118 days ± 3 days, a regeneration growth period of 70 days ± 2 days, a regeneration capacity of 1.8 or above, and stable agronomic traits are selected;

[0011] (3) The rice parent containing the blast-resistant gene is hybridized with another parent and self-pollinated to obtain F2. The single plant containing the homozygous blast-resistant gene, high stigma exsertion rate, and the same growth period and regeneration ability as the male parent line in step (2) is screened by molecular detection, and the female parent line with stable agronomic traits is obtained by continuous self-pollination and backcrossing;

[0012] (4) The stable male parent line described in step (2) is matched with the stable female parent line described in step (3), and samples are taken for testing when mature. Parents with good combining ability, obvious difference in husk color, containing rice blast resistance gene, and high seed production yield are selected and harvested separately to obtain male and female parents with the same growth period and stubble regeneration ability of more than 1.8.

[0013] As a further optimized solution of the present invention, in step (1), the recessive husk color-specific marker is any one of recessive brown, recessive hemp husk, and recessive dark brown marker.

[0014] As a further optimized solution of the present invention, in step (3), the other parent is any one of a two-line sterile line and a three-line maintainer line.

[0015] As a further optimization scheme of the present invention, in step (4), the obtained male parent has a recessive husk color-specific marker, the obtained female parent has a normal husk color, and the husk colors of the parent and the mother are significantly different.

[0016] The technical solution of the present invention is further described as follows:

[0017] The present invention provides a method for selecting parents suitable for mechanical mixed sowing and regeneration seed production of rice, comprising the following steps: hybridizing a rice parent X containing a disease-resistant gene I with a rice parent Y containing a recessive husk color-specific marker gene k, and then continuously inbred pedigrees to select n lines that are homozygous for the recessive husk color-specific marker gene k (please confirm that the color marker gene must be homozygous to ensure rice color specificity) (i.e., have the recessive husk color-specific marker) and contain the homozygous disease-resistant gene I, whose first-season growth period and regeneration growth period meet growth period targets and whose regeneration capacity reaches 1.8 or above, as candidate father parents (candidate father E1, candidate father E2, ..., candidate father E1, candidate father E2, ..., candidate father E1, candidate father E2, ..., candidate father E1, ... ... n After hybridizing a rice parent Z containing a disease-resistant gene J with another parent W, continuous self-pollination and backcrossing are performed to select m sterile lines containing the homozygous disease-resistant gene J, whose first-season growth period and regeneration growth period are consistent with those of the n lines, and whose regeneration capacity reaches 1.8 or above, and which are respectively used as candidate maternal parents (candidate maternal parent F1, candidate maternal parent F2, ..., candidate maternal parent F3, etc.); m ); Use m candidate female parents as female parents and n candidate male parents as male parents, conduct hybridization and matching, select hybrid combinations with good compatibility and high seed production yield, harvest seeds from both parents separately, and obtain male parents E and female parents F with consistent growth periods and stubble regeneration abilities exceeding 1.8.

[0018] In the above method, since the father E is homozygous for the recessive husk color-specific marker gene, its husk color is a recessive husk color-specific marker, and the mother F has a normal husk color. The husk colors of the father E and the mother F are obviously different, easy to distinguish, and can be mechanically sorted.

[0019] In the above method, the recessive husk color-specific marker is any one of recessive brown, recessive husk, and recessive black-brown markers.

[0020] In the above method, since the male parent E contains the homozygous disease-resistant gene I and the female parent F contains the homozygous disease-resistant gene J, the hybrid produced by the hybridization of the two contains the disease-resistant gene I and the disease-resistant gene J, and has a strong resistance to rice blast.

[0021] In the above method, the disease-resistant gene I and the disease-resistant gene J can be rice blast-resistant genes (such as rice blast-resistant gene Pi2, rice blast-resistant gene Pigm, rice blast-resistant gene Pi9, etc.) or bacterial blight-resistant gene (such as bacterial blight-resistant gene Xa23) or genes resistant to other rice diseases.

[0022] In the above method, the father parent E contains the homozygous disease-resistant gene I, and the mother parent F contains the homozygous disease-resistant gene J. A method combining conventional breeding and molecular marker-assisted selection (MAS) is adopted. Generally, individual plants containing the homozygous disease-resistant gene can be selected in the F2 generation or F3 generation by molecular marker-assisted selection for subsequent breeding, and finally a strain containing the homozygous disease-resistant gene is obtained.

[0023] In the above method, the first-season growth period and the regeneration growth period meet the target, and backcrossing can be selected to select a first-season growth period between 118d±3d and a regeneration growth period of 70d±2d.

[0024] In the above method, the n strains and the m strains all have stable agronomic traits.

[0025] In the above method, the additional parent W is either a two-line sterile line or a three-line maintainer line. When parent W is a two-line sterile line, the recurrent parent of the backcross is parent W, and the resulting candidate female parent is a two-line sterile line. When parent W is a three-line maintainer line, the recurrent parent of the backcross is the three-line sterile line corresponding to parent W (the three-line maintainer line), and the resulting candidate female parent is a three-line sterile line.

[0026] In the above method, when the parent W is a three-line maintainer line, the line with a high stigma exposure rate is preferentially selected for backcrossing with the recurrent parent, and the line with excellent agronomic traits and 100% sterility under pollen microscopy is preferentially selected as the candidate female parent obtained by breeding. Beneficial effects

[0027] The rice husks of the parental rice lines selected and bred by the present invention have distinct differences in color, and qualified hybrid seeds can be easily obtained after screening with a color sorter, thus ensuring seed purity. Furthermore, the consistent growth period of the parental lines provides a technical guarantee for the full mechanization of hybrid rice seed production. During the breeding process, the present invention utilizes molecular marker-assisted selection breeding technology to improve breeding efficiency. The method of the present invention strictly screens the regeneration capacity of the parental lines, and after one season of mixed seed production, the yield reaches approximately 200 kilograms; after one season of regeneration, the yield reaches over 80 kilograms, significantly improving seed production yield compared to existing technologies. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 is a specific technical roadmap for obtaining the seed-producing male parent "Yinhui 082" and the seed-producing female parent "Tsuen Kuang 93A".

[0029] Figure 2 is a comparison of the hull colors of the seed-producing male parent "Yinhui 082" with a recessive hull marker and the seed-producing female parent "Tsuen Kuang 93A" with normal hull color.

[0030] Figure 3 is a mixed seed production diagram of "Yinhui 082" and "Tsuen Kuang 93A". Modes for Carrying Out the Invention

[0031] The present application is described in further detail below in conjunction with the accompanying drawings. It is necessary to point out that the following specific implementation methods are only used to further illustrate the present application and cannot be understood as limiting the scope of protection of the present application. Technicians in this field can make some non-essential improvements and adjustments to the present application based on the above application content.

[0032] 1. Materials

[0033] In the following examples, "Tsuen Kuang B", "Tsuen Kuang A", and "YR0822" carrying the rice blast resistance gene Pi2 are all excellent hybrid parents bred by Anhui Tsuen Yin Hi-Tech Seed Co., Ltd., among which "Tsuen Kuang B" is the maintainer line of "Tsuen Kuang A" (sterile line); "9311" carrying the rice blast resistance gene Pigm was provided by the Center for Excellence in Molecular Plant Sciences, Chinese Academy of Sciences; "Zhe Fu 802" (recessive Ma Ke) with the recessive specific marker gene gh1 (A mutation in the rice chalcone isomerase gene causes the golden hull and internode 1 phenotype) was provided by the China National Rice Research Institute.

[0034] Unless otherwise specified, the methods used in this example are conventional methods known to those skilled in the art, and the reagents and other materials used are commercially available products unless otherwise specified.

[0035] 2. Methods

[0036] A method for selecting and breeding parents suitable for mechanical mixed-seeding regeneration of rice seeds comprises the following steps:

[0037] (1) The hybrid "YR0822" containing the rice blast resistance gene Pi2 was hybridized with the Zhefu 802 containing the recessive specific marker gene gh1 to obtain the hybrid F1;

[0038] (2) Using a method combining conventional breeding and molecular marker-assisted selection (MAS), single plants with the recessive specific marker described in step (1) and homozygous rice blast resistance gene Pi2 were selected from the F2 and self-pollinated for more than 5 generations, and the paternal line was bred with a first-season growth period of 118 days ± 3 days, a regeneration growth period of 70 days ± 2 days, a regeneration capacity of 1.8 or more, and stable agronomic traits;

[0039] (3) The “9311” containing the rice blast resistance gene Pigm was hybridized with the maintenance line “Tsuen Kuang B” and self-pollinated to obtain F2. Through molecular detection, F3 plants containing the homozygous rice blast resistance gene Pigm, with a high stigma exposure rate, and with a growth period and regeneration ability consistent with the male parent line selected in step (2) were screened.

[0040] (4) The F3 of step (3) is continuously self-pollinated, and a stable strain with a high stigma exposure rate and a growth period and regeneration ability consistent with the male strain selected in step (2) is selected as the maintenance strain corresponding to the female parent; and from the F3 generation, hybridization and backcrossing with Tsuen Kuang A are respectively performed to obtain F1, BC1F1, and BC2F1, and a stable female strain with excellent agronomic traits, 100% sterile plants under pollen microscopy, and a regeneration ability of more than 1.8 is screened.

[0041] (5) The stable male parent line described in step (2) is tested and matched with the stable female parent line described in step (4). Samples are taken for testing when mature. Parents with good combining ability, obvious difference in husk color, containing Pigm gene and Pi2 gene, and high seed production are selected and harvested separately. The male and female parents with the same growth period and the regeneration ability of cuttings reaching 1.8 or more are obtained and named Yinhui 082 and Quanguang 93A respectively.

[0042] The specific method is as follows:

[0043] (1) The rice parent YR0822 containing the disease resistance gene Pi2 (in this example, "YR0822" containing the rice blast resistance gene Pi2 was selected as the rice parent X) was crossed with the rice parent Zhefu 802 containing the recessive husk color specific marker gene gh1 (in this example, Zhefu 802 containing the recessive specific marker gene gh1 was selected as the rice parent Y) to obtain the hybrid F1. Subsequently, continuous self-bred lineage selection was carried out to select the molecular marker-assisted selection for the rice blast resistance gene Pi2.

[0044] The primer pair for Pi2 gene used in molecular marker-assisted selection consists of Pi2F and Pi2R:

[0045] Pi2F: GTGCATGAGTCCAGCTCAAA (as shown in SEQ ID No. 1);

[0046] Pi2R: GTGTACTCCCATGGCTGCTC (as shown in SEQ ID No. 2).

[0047] In this embodiment, molecular marker-assisted selection is performed in the F2 generation to select individual plants that are homozygous for the rice blast-resistance gene Pi2, meet the growth period target, and have a regeneration capacity of 1.8 or more. After that, self-pollination is continued for more than 5 generations, and finally, n lines that are homozygous for the recessive husk color-specific marker gene k (homozygous for the gh1 marker, i.e., have the recessive husk color-specific marker, and the husk color appears as a husk) and contain the homozygous disease-resistance gene Pi2 (as the disease-resistance gene I) are selected, and the first-season growth period and the regeneration growth period meet the growth period target (the growth period target in this embodiment is set as a first-season growth period of 118d±3d and a regeneration growth period of 70d±2d. In breeding in different regions, the growth period target can be adaptively adjusted), the regeneration capacity reaches 1.8 or more, and the agronomic traits are stable are selected as candidate male parents. In this embodiment, 7 candidate male parent lines are bred, and are numbered E1, E2, E3, E4, E5, E6, and E7 respectively.

[0048] (2) A rice parent Z containing the disease-resistant gene J (in this example, "9311" containing the blast-resistant gene Pigm was selected as the rice parent Z) was hybridized with another parent W (in this example, the three-line maintainer line "Tsuen Kuang B" was selected as the parent W) and then continuously selfed and backcrossed (the backcross parent was the three-line sterile line "Tsuen Kuang A" corresponding to the three-line maintainer line "Tsuen Kuang B"). In this example, molecular marker-assisted selection targeting the blast-resistant gene Pigm was used. The primer pair targeting the Pigm gene used in the molecular marker-assisted selection consisted of PigmF and PigmR:

[0049] PigmF: GGATTGTCTTGTCTCTCTCGC (as shown in SEQ ID No. 3);

[0050] PigmR: CAGGACTTAGGGTTTCTCTCTTT (as shown in SEQ ID No. 4).

[0051] In the F3 generation, auxiliary selection is performed on single plants containing homozygous disease-resistant gene Pigm (as disease-resistant gene J), ​​high stigma exposure rate, meeting the growth period target, and regeneration capacity of more than 1.8, and hybridization and backcrossing with "Tsuen Kuang A" are carried out respectively from the F3 generation to obtain F1, BC1F1, and BC2F1, and finally the first season growth period, regeneration growth period and the first season growth period and regeneration growth period of the n lines are selected (consistent with the target in step (1), that is, the first season growth period is between 118d±3d and the regeneration growth period is 70d±2d), the regeneration capacity reaches more than 1.8, contains homozygous disease-resistant gene J, and has stable agronomic traits. The m sterile lines with 100% sterility under pollen microscopy are respectively used as candidate female parents. In this embodiment, 5 candidate female parent lines are selected and numbered as (F1, F2, F3, F4, F5;

[0052] The five candidate maternal parents were used as maternal parents, and the seven candidate paternal parents were used as paternal parents. Hybridization was performed and the following hybrid combinations were formed (the combination name format is: maternal parent / paternal parent): F1 / E1, F1 / E2, F1 / E3, F1 / E4, F1 / E5, F1 / E6, F1 / E7, F2 / E1, F2 / E2, F2 / E3, F2 / E4, F2 / E5, F2 / E 6. F2 / E7, F3 / E1, F3 / E2, F3 / E3, F3 / E4, F3 / E5, F3 / E6, F3 / E7, F4 / E1, F4 / E2, F4 / E3 , F4 / E4, F4 / E5, F4 / E6, F4 / E7, F5 / E1, F5 / E2, F5 / E3, F5 / E4, F5 / E5, F5 / E6, F5 / E7.

[0053] The hybrid combination E3 / F4 has excellent combining ability and high seed production. Its corresponding parents, named Yinhui 082 and Tsuen Kuang 93A, were harvested separately to obtain male parent E (Yinhui 082) and female parent F (Tsuen Kuang 93A), with consistent growth periods and stubble regeneration abilities exceeding 1.8.

[0054] The above-described embodiments merely illustrate several implementations of the present invention. While the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that a person skilled in the art would be able to make numerous variations and improvements without departing from the spirit of the present invention, and all such variations and improvements fall within the scope of protection of the present invention.

[0055] The present invention claims priority of a Chinese patent application with an application date of July 24, 2023, application number 202310905059.4, and invention name “A parent breeding method suitable for mechanical mixed sowing and regeneration of rice seeds”. Industrial Applicability

[0056] The present invention discloses a parent breeding method suitable for mechanical mixed sowing and regeneration seed production of rice. The method comprises hybridizing and self-pollinating a rice parent with a recessive brown, recessive hull, or recessive black-brown hull color-specific marker with a parent containing a blast-resistant gene, and combining molecular marker-assisted selection to obtain a seed production male parent with a first-season growth period of 118d±3d, a regeneration period of 70d±2d in the regeneration season, a regeneration capacity of 1.8 or above, and the aforementioned gene. Simultaneously, hybridization, selfing, and backcrossing are used to breed a seed production female parent with normal hull color, whose growth period and regeneration capacity are consistent with those of the male parent. The rice parents selected by the present invention have large differences in hull color, which enables mechanical harvesting and mechanical sorting, liberates labor, saves seed production costs, increases seed production yield, and also improves economic benefits. The method realizes strong regeneration capacity after one season of mechanical mixed harvesting. At the same time, the consistent growth process of the parents solves the bottleneck problem of mechanized mixed sowing and seed production. Sequence Listing Free Content

[0057] SEQ ID No.1

[0058] GTGCATGAGTCCAGCTCAAA

[0059] SEQ ID No.2

[0060] GTGTACTCCCATGGCTGCTC

[0061] SEQ ID No.3

[0062] GGATTGTCTTGTCTCTCTCGC

[0063] SEQ ID No.4

[0064] CAGGACTTAGGGTTTCTCTCTTT

Claims

1. A method for parent selection suitable for rice mechanical mixed sowing regeneration seed production, characterized in that: The following steps are involved: (1) A rice parent containing a gene for resistance to rice blast is hybridized with a hybrid rice parent having a recessive husk color-specific marker to obtain a hybrid F1; (2) using a combination of conventional breeding and molecular marker-assisted selection, selecting from the F2 individual plants that have the recessive husk color-specific marker described in step (1) and contain a homozygous rice blast resistance gene, and continuously self-pollinating, and selecting, after continuous self-pollination, a male parent line with a first-season growth period of 118 d ± 3 d, a regeneration growth period of 70 d ± 2 d, a regeneration capacity of 1.8 or more, and stable agronomic traits; (3) The rice parent containing the rice blast resistance gene is hybridized with another parent and self-pollinated to obtain F2, and the single plant containing the homozygous rice blast resistance gene, high stigma exsertion rate, and the growth period and regeneration ability consistent with the male parent line in step (2) is screened by molecular detection, and the single plant is continuously self-pollinated and backcrossed to obtain the female parent line with stable agronomic traits; (4) The stable male parent line described in step (2) is matched with the stable female parent line described in step (3), and samples are taken for testing when they are mature. Parents with good combining ability, obvious difference in husk color, containing rice blast resistance genes, and high seed production yield are selected and harvested separately to obtain male and female parents with the same growth period and stubble regeneration ability of more than 1.

8.

2. The method for parent selection suitable for rice mechanical mixed sowing and regeneration seed production according to claim 1, characterized in that: In step (1), the recessive husk color-specific marker is any one of a recessive brown, a recessive husk, and a recessive dark brown marker.

3. The method for selecting parents suitable for rice mechanical mixed sowing and regeneration seed production according to claim 1, characterized in that: In step (3), the other parent is any one of a two-line sterile line and a three-line maintainer line.

4. The method for selecting parents suitable for rice mechanical mixed sowing and regeneration seed production according to claim 1, characterized in that: In step (4), the obtained male parent has a recessive husk color-specific marker, and the obtained female parent has a normal husk color, and the husk colors of the parent and the male parent are significantly different.

Images