Multispecific binding protein and use thereof

Abstract

Provided are a multispecific binding protein, which is capable of specifically binding to a mannose-6-phosphate receptor (M6PR) and a cell surface molecule or extracellular molecule. Further provided is an antigen binding protein capable of specifically binding to CI-M6PR, and the use thereof in the mediation of lysosome endocytosis and degradation, protein transport and the treatment of diseases.

Description

A multispecific binding protein and its application Technical Field

[0001] The present application relates to the field of biomedicine, and specifically to an antigen binding protein targeting CI-M6PR, and its application in treating diseases induced by endocytic degradation. Background Art

[0002] Specific degradation of target molecules has become a very promising therapeutic approach in disease treatment. After entering the cell, the compound of protein degradation targeting chimera (PROTAC) can simultaneously target intracellular tumor-related proteins and E3 ligases to achieve degradation of intracellular proteins. However, it is difficult for such compounds to achieve degradation of cell surface proteins or extracellular molecules, and it is more difficult to screen small molecules with high affinity for targeting membrane proteins. Lysosome targeting chimera (LYTAC) technology couples oligosaccharides targeting the cell surface receptor CI-M6PR to antibodies against target proteins through chemical reactions. However, the synthetic route of oligosaccharides in the preparation of LYTAC compounds is very complicated, and the coupling technology used cannot obtain a uniform product. The binding ability and degradation efficiency of LYTAC compounds to target molecules also need to be improved. The large-sized monoclonal antibody constructs need to be expressed in mammalian cells, and their biodistribution in solid tissues is also limited, which hinders the in vivo application and large-scale production of this technology. AbTAC has developed a bispecific antibody in which one domain targets the endocytic receptor RNF43 and the other domain targets the target protein. However, the preparation of uniform bispecific antibodies is very challenging, and the technology is limited by the expression of the endocytic receptor RNF43 in target cells.

[0003] Therefore, in the therapeutic approach of targeting protein degradation, a new and efficient lysosome targeting method needs to be developed to overcome the above-mentioned obstacles of existing lysosome targeting strategies.

[0004] Summary of the Invention

[0005] The present application provides an antigen-binding protein that specifically binds to the mannose-6-phosphate receptor (CI-M6PR), a multispecific binding protein based on the antigen-binding protein, and their use in treating diseases. The antigen-binding protein of the present application binds to a targeting moiety specific for an extracellular protein, a secreted protein, a cell surface protein, or a transmembrane protein, thereby causing M6PR-mediated lysosomal uptake and degradation.

[0006] On the one hand, the present application provides a multispecific binding protein comprising a first targeting portion and a second targeting portion, wherein the first targeting portion comprises an antibody or an antigen-binding fragment thereof that can specifically bind to the mannose-6-phosphate receptor (CI-M6PR), and the second targeting portion can specifically bind to a cell surface molecule or an extracellular molecule.

[0007] In certain embodiments, the multispecific binding protein is capable of enhancing endocytic degradation of the cell surface molecule or extracellular molecule relative to the presence of only the second targeting moiety or the first targeting moiety.

[0008] In certain embodiments, the first targeting moiety comprises the complementarity determining region 3 (HCDR3) of an antibody heavy chain variable region, and the HCDR3 comprises an amino acid sequence selected from any one of SEQ ID NOs. 3, 6, 41, 18, 44, 47, 35, and 38. In certain embodiments, the HCDR3 comprises an amino acid sequence selected from any one of SEQ ID NOs. 3, 6, 9, 12, 15, 18, 21, 24, 26, 29, 32, 35, and 38.

[0009] In certain embodiments, the first targeting moiety comprises the complementarity determining region 2 (HCDR2) of an antibody heavy chain variable region, and the HCDR2 comprises an amino acid sequence selected from any one of SEQ ID NOs. 2, 5, 40, 17, 43, 46, 34, and 37. In certain embodiments, the HCDR2 comprises an amino acid sequence selected from any one of SEQ ID NOs. 2, 5, 8, 11, 14, 17, 20, 23, 25, 28, 31, 34, and 37.

[0010] In certain embodiments, the first targeting moiety comprises the complementarity determining region 1 (HCDR1) of an antibody heavy chain variable region, and the HCDR1 comprises an amino acid sequence selected from any one of SEQ ID NOs: 1, 4, 39, 16, 42, 45, 33, and 36. In certain embodiments, the HCDR1 comprises an amino acid sequence selected from any one of SEQ ID NOs: 1, 4, 7, 10, 13, 16, 19, 22, 27, 30, 33, and 36.

[0011] In certain embodiments, the first targeting moiety comprises HCDR1, HCDR2, and HCDR3, and the HCDR1, HCDR2, and HCDR3 comprise an amino acid sequence selected from any one of the following groups:

[0012] 1) HCDR1: SEQ ID NO.16, HCDR2: SEQ ID NO.17 and HCDR3: SEQ ID NO.18;

[0013] 2) HCDR1: SEQ ID NO.1, HCDR2: SEQ ID NO.2 and HCDR3: SEQ ID NO.3;

[0014] 3) HCDR1: SEQ ID NO.4, HCDR2: SEQ ID NO.5 and HCDR3: SEQ ID NO.6;

[0015] 4) HCDR1: SEQ ID NO.39, HCDR2: SEQ ID NO.40 and HCDR3: SEQ ID NO.41;

[0016] 5) HCDR1: SEQ ID NO.42, HCDR2: SEQ ID NO.43 and HCDR3: SEQ ID NO.44;

[0017] 6) HCDR1: SEQ ID NO.45, HCDR2: SEQ ID NO.46 and HCDR3: SEQ ID NO.47;

[0018] 7) HCDR1: SEQ ID NO. 33, HCDR2: SEQ ID NO. 34 and HCDR3: SEQ ID NO. 35; and,

[0019] 8) HCDR1: SEQ ID NO.36, HCDR2: SEQ ID NO.37 and HCDR3: SEQ ID NO.38.

[0020] In certain embodiments, the first targeting moiety comprises HCDR1, HCDR2, and HCDR3, and the HCDR1, HCDR2, and HCDR3 comprise an amino acid sequence selected from any one of the following groups:

[0021] 1) HCDR1: SEQ ID NO.16, HCDR2: SEQ ID NO.17 and HCDR3: SEQ ID NO.18;

[0022] 2) HCDR1: SEQ ID NO.1, HCDR2: SEQ ID NO.2 and HCDR3: SEQ ID NO.3;

[0023] 3) HCDR1: SEQ ID NO.4, HCDR2: SEQ ID NO.5 and HCDR3: SEQ ID NO.6;

[0024] 4) HCDR1: SEQ ID NO.7, HCDR2: SEQ ID NO.8 and HCDR3: SEQ ID NO.9;

[0025] 5) HCDR1: SEQ ID NO.10, HCDR2: SEQ ID NO.11 and HCDR3: SEQ ID NO.12;

[0026] 6) HCDR1: SEQ ID NO.13, HCDR2: SEQ ID NO.14 and HCDR3: SEQ ID NO.15;

[0027] 7) HCDR1: SEQ ID NO.19, HCDR2: SEQ ID NO.20 and HCDR3: SEQ ID NO.21;

[0028] 8) HCDR1: SEQ ID NO.22, HCDR2: SEQ ID NO.23 and HCDR3: SEQ ID NO.24;

[0029] 9) HCDR1: SEQ ID NO.19, HCDR2: SEQ ID NO.25 and HCDR3: SEQ ID NO.26;

[0030] 10) HCDR1: SEQ ID NO.27, HCDR2: SEQ ID NO.28 and HCDR3: SEQ ID NO.29;

[0031] 11) HCDR1: SEQ ID NO.30, HCDR2: SEQ ID NO.31 and HCDR3: SEQ ID NO.32;

[0032] 12) HCDR1: SEQ ID NO. 33, HCDR2: SEQ ID NO. 34 and HCDR3: SEQ ID NO. 35; and

[0033] 13) HCDR1: SEQ ID NO.36, HCDR2: SEQ ID NO.37 and HCDR3: SEQ ID NO.38.

[0034] In certain embodiments, the first targeting moiety comprises an antibody heavy chain variable region VH, and the VH comprises the amino acid sequence shown in any one of SEQ ID NOs: 48 to 60. In certain embodiments, the first targeting moiety is VHH, and the VHH comprises the amino acid sequence shown in any one of SEQ ID NOs: 48 to 60.

[0035] In certain embodiments, the second targeting moiety targets a cell surface molecule present on tumor cells and / or immune cells. In certain embodiments, the cell surface molecule comprises a tumor antigen, an immune checkpoint molecule, an inhibitory immune receptor, and / or an inhibitory immune receptor ligand. In certain embodiments, the cell surface molecule is selected from the group consisting of PD-1, PD-L1, HER2, and CD20.

[0036] In certain embodiments, the second targeting moiety targets an extracellular molecule, including cytokines, growth factors, and ligands for cell surface receptors. In certain embodiments, the extracellular molecule is selected from the group consisting of TNF-α and EGF. In certain embodiments, the second targeting moiety comprises one or more selected from the group consisting of a polypeptide, a ligand, an aptamer, a nanoparticle, and a small molecule.

[0037] In certain embodiments, the second targeting moiety comprises an antibody or an antigen-binding fragment thereof. In certain embodiments, the antigen-binding fragment is selected from the group consisting of Fab, Fab', F(ab)2, Fv fragment, F(ab')2, VHH, scFv, di-scFv and / or dAb. In certain embodiments, the second targeting moiety is a VHH.

[0038] In certain embodiments, the second targeting moiety comprises an amino acid sequence as shown in any one of SEQ ID NOs. 72-74.

[0039] In certain embodiments, the first targeting moiety and the second targeting moiety are directly or indirectly linked by a covalent bond. In certain embodiments, the indirect link comprises a peptide linker. In certain embodiments, the linker is a peptide linker rich in glycine and serine. In certain embodiments, the amino acid sequence of the linker comprises the amino acid sequence set forth in any one of SEQ ID NOs. 77-78.

[0040] In certain embodiments, in the multispecific binding protein, from N-terminus to C-terminus, it comprises the first targeting moiety and the second targeting moiety in sequence.

[0041] In certain embodiments, the multispecific binding protein comprises the amino acid sequence shown in any one of SEQ ID NOs: 61 and 64.

[0042] In certain embodiments, the multispecific binding protein further comprises an Fc domain, and the first targeting moiety and the second targeting moiety are connected via the Fc domain.

[0043] In certain embodiments, the multispecific binding protein forms a dimer through the first subunit and the second subunit of the Fc domain.

[0044] In certain embodiments, the Fc domain comprises a modification that promotes dimerization between the first subunit and the second subunit. In certain embodiments, the Fc domain comprises the amino acid sequence shown in any one of SEQ ID NOs: 75-76.

[0045] In certain embodiments, the multispecific binding protein comprises a first polypeptide chain and a second polypeptide chain.

[0046] In certain embodiments, the first targeting moiety is located at the N-terminus of the first subunit, and the second targeting moiety is located at the N-terminus of the second subunit. In certain embodiments, the first targeting moiety is located at the C-terminus of the first subunit, and the second targeting moiety is located at the C-terminus of the second subunit.

[0047] In certain embodiments, in the first polypeptide chain, from N-terminus to C-terminus, it comprises the first targeting moiety and the first subunit in sequence; and in the second polypeptide chain, from N-terminus to C-terminus, it comprises the second targeting moiety and the second subunit in sequence.

[0048] In certain embodiments, the Fc domain comprises modifications that promote dimerization between the first polypeptide chain and the second polypeptide chain.

[0049] In certain embodiments, the first polypeptide chain and the second polypeptide chain are different.

[0050] In certain embodiments, the first polypeptide chain comprises the amino acid sequence set forth in any one of SEQ ID NOs: 62, 63, and 65. In certain embodiments, the second polypeptide chain comprises the amino acid sequence set forth in any one of SEQ ID NOs: 67-71.

[0051] In certain embodiments, the first targeting moiety is located at the C-terminus of the first subunit, and the second targeting moiety is located at the N-terminus of the first subunit. In certain embodiments, the first targeting moiety is located at the C-terminus of the second subunit, and the second targeting moiety is located at the N-terminus of the second subunit.

[0052] In certain embodiments, the first targeting moiety is located at the N-terminus of the first subunit, and the second targeting moiety is located at the C-terminus of the first subunit. In certain embodiments, the first targeting moiety is located at the N-terminus of the second subunit, and the second targeting moiety is located at the C-terminus of the second subunit.

[0053] In certain embodiments, the multispecific binding protein comprises two or more of the first targeting moieties.

[0054] In certain embodiments, the multispecific binding protein comprises two or more second targeting moieties.

[0055] In certain embodiments, in the first polypeptide chain, from N-terminus to C-terminus, it comprises the second targeting moiety, the first subunit and the first targeting moiety in sequence; and in the second polypeptide chain, from N-terminus to C-terminus, it comprises the second targeting moiety, the second subunit and the first targeting moiety in sequence.

[0056] In certain embodiments, in the first polypeptide chain, from N-terminus to C-terminus, it comprises the first targeting moiety, the first subunit and the second targeting moiety in sequence; and in the second polypeptide chain, from N-terminus to C-terminus, it comprises the first targeting moiety, the second subunit and the second targeting moiety in sequence.

[0057] In some embodiments, the first polypeptide chains are identical. In some embodiments, the first polypeptide chain comprises the amino acid sequence shown in SEQ ID NO:66, and the second polypeptide chain comprises the amino acid sequence shown in SEQ ID NO:66.

[0058] On the other hand, the present application provides an isolated antigen-binding protein that can specifically bind to 6-phosphate mannose receptor (CI-M6PR) and has one or more of the following properties: (1) can specifically bind to CI-M6PR with a KD value of about 300nM or less; and (2) can mediate cellular endocytosis and / or protein degradation through the lysosomal pathway.

[0059] In certain embodiments, the antigen binding protein comprises a HCDR3 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs. 3, 6, 41, 18, 44, 47, 35, and 38. In certain embodiments, the HCDR3 comprises an amino acid sequence selected from the group consisting of SEQ ID NOs. 3, 6, 9, 12, 15, 18, 21, 24, 26, 29, 32, 35, and 38.

[0060] In certain embodiments, the antigen binding protein comprises a HCDR2 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs. 2, 5, 40, 17, 43, 46, 34, and 37. In certain embodiments, the HCDR2 comprises an amino acid sequence selected from the group consisting of SEQ ID NOs. 2, 5, 8, 11, 14, 17, 20, 23, 25, 28, 31, 34, and 37.

[0061] In certain embodiments, the antigen binding protein comprises a HCDR1 comprising an isolated amino acid sequence selected from any one of SEQ ID NOs. 1, 4, 39, 16, 42, 45, 33, and 36. In certain embodiments, the HCDR1 comprises an amino acid sequence selected from any one of SEQ ID NOs. 1, 4, 7, 10, 13, 16, 19, 22, 27, 30, 33, and 36.

[0062] In certain embodiments, the antigen binding protein comprises HCDR1, HCDR2 and HCDR3, and the HCDR1, HCDR2 and HCDR3 comprise amino acid sequences selected from any one of the following groups: (1) HCDR1: SEQ ID NO.16, HCDR2: SEQ ID NO.17 and HCDR3: SEQ ID NO.18; (2) HCDR1: SEQ ID NO.1, HCDR2: SEQ ID NO.2 and HCDR3: SEQ ID NO.3; (3) HCDR1: SEQ ID NO.4, HCDR2: SEQ ID NO.5 and HCDR3: SEQ ID NO.6; (4) HCDR1: SEQ ID NO.39, HCDR2: SEQ ID NO.40 and HCDR3: SEQ ID NO.41; (5) HCDR1: SEQ ID NO.42, HCDR2: SEQ ID NO.43 and HCDR3: SEQ ID NO.44; (6) HCDR1: SEQ ID NO.45, HCDR2: SEQ ID NO.46 and HCDR3: SEQ ID NO.47; NO.46 and HCDR3: SEQ ID NO.47; (7) HCDR1: SEQ ID NO.33, HCDR2: SEQ ID NO.34 and HCDR3: SEQ ID NO.35; and, (8) HCDR1: SEQ ID NO.36, HCDR2: SEQ ID NO.37 and HCDR3: SEQ ID NO.38.

[0063] In certain embodiments, the HCDR1, HCDR2, and HCDR3 comprise amino acid sequences selected from any one of the following groups: (1) HCDR1: SEQ ID NO.16, HCDR2: SEQ ID NO.17, and HCDR3: SEQ ID NO.18;

[0064] (2) HCDR1: SEQ ID NO.1, HCDR2: SEQ ID NO.2 and HCDR3: SEQ ID NO.3; (3) HCDR1: SEQ ID NO.4, HCDR2: SEQ ID NO.5 and HCDR3: SEQ ID NO.6; (4) HCDR1: SEQ ID NO.7, HCDR2: SEQ ID NO.8 and HCDR3: SEQ ID NO.9; (5) HCDR1: SEQ ID NO.9 ID NO.10, HCDR2: SEQ ID NO.11 and HCDR3: SEQ ID NO.12; (6) HCDR1: SEQ ID NO.13, HCDR2: SEQ ID NO.14 and HCDR3: SEQ ID NO.15; (7) HCDR1: SEQ ID NO.19, HCDR2: SEQ ID NO.20 and HCDR3: SEQ ID NO.21; (8) HCDR1: SEQ ID NO.19 NO.22, HCDR2: SEQ ID NO.23 and HCDR3: SEQ ID NO.24; (9) HCDR1: SEQ ID NO.19, HCDR2: SEQ ID NO.25 and HCDR3: SEQ ID NO.26; (10) HCDR1: SEQ ID NO.27, HCDR2: SEQ ID NO.28 and HCDR3: SEQ ID NO.29; (11) HCDR1: SEQ ID NO.30, HCDR2: SEQ ID NO.31 and HCDR3: SEQ ID NO.32; (12) HCDR1: SEQ ID NO.33, HCDR2: SEQ ID NO.34 and HCDR3: SEQ ID NO.35; and (13) HCDR1: SEQ ID NO.36, HCDR2: SEQ ID NO.37 and HCDR3: SEQ ID NO.38.

[0065] In certain embodiments, the antigen binding protein comprises an antibody heavy chain variable region VH, and the VH comprises the amino acid sequence shown in any one of SEQ ID NOs: 48-60.

[0066] In certain embodiments, the antigen-binding protein comprises an antibody or an antigen-binding fragment thereof. In certain embodiments, the antigen-binding fragment is selected from the group consisting of Fab, Fab', F(ab)2, Fv fragment, F(ab')2, VHH, scFv, di-scFv and / or dAb. In certain embodiments, the antigen-binding protein is a VHH.

[0067] In certain embodiments, the antigen binding protein capable of specifically binding to 6-phosphate mannose receptor (CI-M6PR) further comprises an Fc domain.

[0068] On the other hand, the present application provides a PD-1 antigen binding protein comprising the amino acid sequence shown in SEQ ID NO:74.

[0069] In another aspect, the present application provides a multispecific antibody comprising the isolated antigen-binding protein.

[0070] In another aspect, the present application provides a fusion protein comprising the antigen-binding protein capable of specifically binding to CI-M6PR described herein and an Fc domain. For example, the fusion protein comprises a VHH capable of specifically binding to CI-M6PR and an Fc domain.

[0071] In another aspect, the present application provides a nucleic acid molecule encoding the multispecific binding protein, the isolated antigen binding protein, the fusion protein, or the multispecific antibody.

[0072] In another aspect, the present application provides a vector comprising the nucleic acid molecule.

[0073] In another aspect, the present application provides a cell comprising the nucleic acid molecule or the vector.

[0074] On the other hand, the present application provides a method for preparing the multispecific binding protein, the isolated antigen-binding protein or the multispecific antibody, which comprises culturing the cells under conditions such that the multispecific binding protein, the isolated antigen-binding protein or the multispecific antibody is expressed.

[0075] In another aspect, the present application provides a method for degrading a cell surface molecule or an extracellular molecule, comprising contacting the cell surface molecule or the extracellular molecule with the multispecific binding protein, the fusion protein, or the isolated antigen binding protein. In certain embodiments, the method is an in vitro method or an ex vivo method.

[0076] On the other hand, the present application provides a method for lysosomal delivery or tracing, which comprises administering the multispecific binding protein, the fusion protein or the isolated antigen binding protein. In certain embodiments, the method is an in vitro method or an ex vivo method.

[0077] On the other hand, the present application provides a pharmaceutical composition comprising the multispecific binding protein, the isolated antigen binding protein, the fusion protein, the multispecific antibody, the nucleic acid molecule, the vector and / or the cell, and optionally a pharmaceutically acceptable carrier.

[0078] In another aspect, the present application provides uses of the multispecific binding protein, the isolated antigen-binding protein, the multispecific antibody, the fusion protein, the nucleic acid molecule, the vector, the cell, and / or the pharmaceutical composition in the preparation of a medicament for alleviating and / or treating a disease. In certain embodiments, the disease comprises cancer and / or an autoimmune disease.

[0079] In certain embodiments, the disease is associated with high expression of PD-1, PD-L1, HER2, CD20, or TNF-α.

[0080] Those skilled in the art can easily discern other aspects and advantages of the present application from the detailed description below. In the detailed description below, only exemplary embodiments of the present application are shown and described. As will be appreciated by those skilled in the art, the content of this application enables those skilled in the art to modify the disclosed specific embodiments without departing from the spirit and scope of the invention to which this application relates. Accordingly, the descriptions in the drawings and specification of this application are merely exemplary and not restrictive. BRIEF DESCRIPTION OF THE DRAWINGS

[0081] The specific features of the inventions of this application are set forth in the appended claims. The features and advantages of the inventions of this application can be better understood by referring to the exemplary embodiments described in detail below and the accompanying drawings. A brief description of the drawings is as follows:

[0082] Figure 1 shows the flow cytometric characterization of the binding of 13 CI-M6PR-targeting single-domain antibodies to M6PR on the surface of K562 cells.

[0083] Figure 2 shows confocal imaging characterizing the binding and internalization of 13 CI-M6PR-targeting single-domain antibodies to M6PR on the surface of K562 cells.

[0084] FIG3 shows confocal imaging characterizing the binding and internalization of 13 CI-M6PR-targeting single-domain antibodies to M6PR on the surface of HepG2 cells.

[0085] Figure 4 shows the flow cytometry characterization of the degradation of PD-1 on the surface of Jurkat PD-1 cells by the non-IgG-like bispecific antibody 28-P1-02.

[0086] FIG5 shows immunoblotting analysis of the degradation of PD-1 on the surface of Jurkat PD-1 cells by the non-IgG-like bispecific antibody 28-P1-02.

[0087] Figure 6 shows the SDS-PAGE gel electrophoresis characterization of the bispecific antibody targeting the degradation of PD-1 based on the CI-M6PR nanobody.

[0088] FIG7 shows immunoblotting analysis of the degradation of PD-1 by the IgG-like bispecific antibody 28-P1-02Fc.

[0089] FIG8 shows the effect of the concentration and time of IgG-like bispecific antibody on PD-1 degradation as characterized by immunoblotting.

[0090] FIG9 shows the immunoblotting analysis of the effects of different CI-M6PRs on the degradation of IgG-like bispecific antibodies.

[0091] Figure 10 shows the immunoblotting method to characterize the effects of different PD-1 nanoantibodies on the degradation of IgG-like bispecific antibodies.

[0092] FIG11 shows the degradation mechanism of the CI-M6PR-based bispecific antibody.

[0093] Figure 12 shows the T cell activation experiment characterizing the activation effect of the IgG-like bispecific antibody 28-P1-02Fc in degrading PD-1.

[0094] Figure 13 shows the animal experiment characterizing the degradation effect of IgG-like bispecific antibody 28-P1-02Fc on PD-1 in vivo.

[0095] FIG14 shows an exemplary structure of the multispecific antibody of the present application.

[0096] FIG15 shows flow cytometry characterization of the degradation effects of two different bispecific antibodies on CD20.

[0097] FIG16 shows immunoblotting analysis to characterize the degradation of CD20 by two different bispecific antibodies.

[0098] FIG17 shows an exemplary non-IgG-like structure of the multispecific binding protein of the present application.

[0099] Figures 18 and 19 show two exemplary IgG-like structures of the multispecific binding proteins of the present application.

[0100] FIG20 shows a schematic diagram of the degradation of the multispecific binding protein of the present application. DETAILED DESCRIPTION

[0101] The following describes the implementation of the present invention through specific embodiments. People familiar with this technology can easily understand other advantages and effects of the present invention from the contents disclosed in this specification.

[0102] Definition of terms

[0103] In the present application, the term "first targeting moiety" generally refers to a portion that can specifically bind to a lysosomal targeting molecule. Non-limiting examples of lysosomal targeting molecules include mannose-6-phosphate receptor (CI-M6PR), sortilin, folate receptor, ASPGR, IFITM3, molecules in the endosomal / lysosomal pathway (e.g., LIMP-1, LIMP-2), etc. In the present application, lysosomal targeting molecules generally refer to mannose-6-phosphate receptor.

[0104] In the present application, the term "second targeting moiety" generally refers to a moiety that can specifically bind to a cell surface molecule or an extracellular molecule.

[0105] "Cell surface molecules" generally refer to molecules that are expressed on the surface of a cell membrane, typically having a domain that inserts into or spans the cell membrane. Cell surface molecules can be naturally expressed on the cell surface or artificially modified (e.g., by fusion to the cell membrane or by adding a transmembrane domain) for expression on the cell surface.

[0106] In this application, the term "extracellular molecule" generally refers to a soluble molecule outside the cell membrane of any cell, particularly a molecule that is accessible outside the cell.

[0107] In this application, the term "multispecific binding protein" generally refers to a protein that can specifically bind to two or more targets. Non-limiting examples of multispecific binding proteins include "bispecific" binding proteins, "trispecific" binding proteins, "tetraspecific" binding proteins, etc. For example, a multispecific binding protein can be a bispecific protein that can bind to two targets. The two or more targets can be two or more different antigens, different epitopes of two or more of the same antigens, or a combination of the aforementioned different antigens or different epitopes of the same antigen. At least one of the targets is an M6PR antigen.

[0108] In this application, the term "specific binding" generally refers to binding of a molecule with a specific binding affinity of less than or equal to about 10 -5 In certain embodiments, the first targeting moiety and the second targeting moiety bind to their respective targets with an affinity or KD of less than or equal to about 10 -5 M, less than or equal to about 10 -6 M, less than or equal to about 10 -7 M, less than or equal to about 10 -8 M, or less than or equal to about 10 -9 M, 10 -10 M, 10 -11 M or 10 -12Binding affinity can be readily determined using conventional techniques, for example, by competitive ELISA (enzyme-linked immunosorbent assay), equilibrium dialysis, by using surface plasmon resonance (SPR) technology, based on biofilm interferometry (BLI), by radioimmunoassay, etc.

[0109] In this application, the term "antigen binding protein" generally refers to a protein comprising a portion that binds to an antigen, and optionally a scaffold or backbone portion that allows the portion that binds to the antigen to adopt a conformation that promotes binding of the antigen binding protein to the antigen. Examples of antigen binding proteins include, but are not limited to, antibodies, antigen binding fragments (Fab, Fab', F(ab)2, Fv fragments, F(ab')2, VHH, scFv, di-scFv and / or dAb), immunoconjugates, multispecific antibodies (e.g., bispecific antibodies), antibody fragments, antibody derivatives, antibody analogs or fusion proteins, etc., as long as they exhibit the desired antigen binding activity.

[0110] In the present application, the term "VHH" may also be referred to as nano antibody, heavy chain single domain antibody, generally refers to a heavy chain antibody variable region of a natural missing antibody light chain. The term "VHH" is used to distinguish between the heavy chain variable domain (VH) and light chain variable domain region (VL) present in conventional 4-chain antibodies. Further description of VHH or nano antibody can refer to the article (Reviews in Molecular Biotechnology 74:277-302,2001) of Muyldermans. VHH or nano antibody is characterized in that they can have one or more "Hallmark residues" in one or more framework sequences. The VHH may also include its humanized or camelized form, as well as other modifications, parts or fragments, derivatives or "nano antibody fusions", multivalent or multispecific constructs, and modifications that improve the VHH half-life. VHH forms a minimum antigen-binding fragment, retaining the binding affinity and specificity of a full-length antibody. VHH has a longer CDR3 loop and a convex paratope, which enables them to enter the inner cavity of the target antigen.

[0111] In this application, the term "antibody" generally refers to an immunoglobulin that can undergo a specific binding reaction with the corresponding antigen. The antibody can be secreted by an immune cell (e.g., an effector B cell). The antibody can be a monoclonal antibody (including a full-length monoclonal antibody comprising two light chains and two heavy chains), a polyclonal antibody, a multispecific antibody (e.g., a bispecific antibody), a humanized antibody, a fully human antibody, a chimeric antibody, and / or a camelized single domain antibody. An "antibody" can generally comprise a protein comprising at least two heavy chains (HC) and two light chains (LC) interconnected by disulfide bonds, or an antigen-binding fragment thereof. Each heavy chain comprises a heavy chain variable region (VH) and a heavy chain constant region. In some naturally occurring IgG, IgD, and IgA antibodies, the heavy chain constant region comprises three domains, CH1, CH2, and CH3. In some naturally occurring antibodies, each light chain comprises a light chain variable region (VL) and a light chain constant region. The light chain constant region comprises one domain, CL. The VH and VL regions can be further subdivided into regions of hypervariability, called complementarity determining regions (CDRs), which alternate with more conserved regions called framework regions (FRs). Each VH and VL comprises three CDRs and four framework regions (FRs), arranged in the following order from amino-terminus to carboxyl-terminus: FR1, CDR1, FR2, CDR2, FR3, CDR3, and FR4. The variable domains of native heavy and light chains each comprise four FR regions (H-FR1, H-FR2, H-FR3, H-FR4, L-FR1, L-FR2, L-FR3, L-FR4), most of which adopt a β-sheet configuration and are connected by three CDRs, forming loops connecting and, in some cases, forming part of the β-sheet structure. The CDRs in each chain are brought together in close proximity by the FR regions and, together with the CDRs from the other chain, form the antigen binding site of the antibody.

[0112] In the present application, term " variable " generally refers to such fact, and some part of the sequence of the variable domain of antibody changes strongly, and it forms the combination and specificity of various specific antibodies to its specific antigen. However, variability is not evenly distributed in the whole variable region of antibody. It is concentrated in three sections in light chain and heavy chain variable region, and is referred to as complementary determining region (CDR) or hypervariable region (HVR). The more highly conserved part in variable domain is referred to as framework (FR). In the art, the CDR of antibody can be defined by several methods, such as the Kabat definition rule based on sequence variability (see, Kabat et al., Immunological Protein Sequence, 5th edition, National Institutes of Health, Bethesda, Maryland (1991)), the Chothia definition rule based on structural loop region position (see, Al-Lazikani et al., J Mol Biol 273:927-48,1997) and the KABAT definition rule based on the concept of IMGT ontology (IMGT-ONTOLOGY) and IMGT Scientific chart rule.

[0113] In this application, the term "mannose-6-phosphate receptor" or "M6PR" generally refers to a lysosomal targeting molecule.

[0114] M6PR is present in tissues throughout the body and is responsible for transporting mannose-6-phosphate (M6P)-labeled substances (e.g., acid hydrolases) from the Golgi compartment and the extracellular space to lysosomes. Examples of M6PRs described herein may be cation-dependent M6PRs (CD-M6PRs) under UniProtKB-P20645, or cation-independent M6PRs (CI-M6PRs) under UniProtKB-P11717.

[0115] The terms "protein", "polypeptide" and "peptide" are used interchangeably herein and generally refer to polymers of amino acid residues and variants and synthetic analogs thereof. A "peptide" may also refer to a partial amino acid sequence derived from its original protein, for example after trypsin digestion. One or more amino acid residues in the polymer may be synthetic non-naturally occurring amino acids, for example chemical analogs of the corresponding naturally occurring amino acids, as well as naturally occurring amino acid polymers. The term also includes post-translational modifications of the polypeptide, such as glycosylation, phosphorylation and acetylation. In this application, the term "isolated" antigen-binding protein generally refers to an antigen-binding protein that has been identified, separated and / or recovered from components of its production environment (e.g., natural or recombinant). Contaminating components of its production environment are generally substances that interfere with its research, diagnostic or therapeutic use, and may include enzymes, hormones and other proteins or non-protein solutes. An isolated antigen-binding protein or antibody will generally be prepared by at least one purification step.

[0116] The proteins and / or amino acid sequences referred to in this application should also be understood to include at least the following scope: variants or homologs that have the same or similar functions as the protein. In this application, the variant can be a protein or polypeptide that has one or more amino acids substituted, deleted, or added in the amino acid sequence of the protein (e.g., the multispecific binding protein or antigen-binding protein described in this application). For example, the functional variant can include a protein or polypeptide that has amino acid changes through at least 1, such as 1-30, 1-20, or 1-10, and for example 1, 2, 3, 4, or 5 amino acid substitutions, deletions, and / or insertions. The functional variant can substantially retain the biological properties of the protein or polypeptide before the change (e.g., substitution, deletion, or addition). For example, the functional variant can retain at least 60%, 70%, 80%, 90%, or 100% of the biological activity (e.g., antigen binding ability) of the protein or polypeptide before the change. For example, the substitution can be a conservative substitution.

[0117] In the present application, a portion of the amino acid sequence of the multispecific binding protein or antigen-binding protein may be homologous to a corresponding amino acid sequence in an antibody from a particular species, or belong to a particular class. For example, both the variable region and the constant region of an antibody may be derived from the variable region and constant region of an antibody from a single animal species (e.g., human).

[0118] In the present application, the homolog can be a protein or polypeptide having at least about 85% (e.g., at least about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99% or more) sequence homology with the amino acid sequence of the protein and / or the polypeptide (e.g., the antigen-binding protein described herein).

[0119] In the present application, described homology generally refers to the similarity, similarity or association between two or more sequences.Can calculate " sequence homology per-cent " in the following manner: two sequences to be compared are compared in comparison window, determine that there is identical nucleic acid base (for example, A, T, C, G) or identical amino acid residue (for example, Ala, Pro, Ser, Thr, Gly, Val, Leu, Ile, Phe, Tyr, Trp, Lys, Arg, His, Asp, Glu, Asn, Gln, Cys and Met) number in the position to obtain the number of matching positions, with the number of matching positions divided by the total number of positions (that is, window size) in the comparison window, and result is multiplied by 100, to produce sequence homology per-cent.Comparison carried out in order to determine the sequence homology per-cent, can realize by several ways known in the art, for example, use publicly available computer software such as BLAST, BLAST-2, ALIGN or Megalign (DNASTAR) software. Those skilled in the art can determine appropriate parameters for aligning sequences, including any algorithms needed to achieve maximum alignment over the full length of the sequences being compared or within a region of interest. Homology can also be determined by the following methods: FASTA and BLAST. A description of the FASTA algorithm can be found in W. R. Earson and D. J. Lipman, "Improved tools for biological sequence comparison," Proc. Natl. Acad. Sci., 85: 2444-2448, 1988; and D. J. Lipman and W. R. Earson, "Rapid and sensitive protein similarity search," Science, 227: 1435-1441, 1989. A description of the BLAST algorithm can be found in S. Altschul, W. Gish, W. Miller, E. W. Myers, and D. Lipman, "A basic local alignment search tool," J. Mol. Biol., 215: 403-410, 1990.

[0120] In this application, the term "isolated nucleic acid molecule" or "isolated polynucleotide" generally refers to DNA or RNA of genomic, mRNA, cDNA, or synthetic origin, or a combination thereof. The isolated nucleic acid molecule may not be associated with all or a portion of a polynucleotide found in nature, or linked to a polynucleotide to which it is not linked in nature.

[0121] In this application, the term "vector" generally refers to a nucleic acid molecule that can self-replicate in a suitable host, which transfers the inserted nucleic acid molecule into and / or between host cells. The vector may include a vector primarily used for inserting DNA or RNA into a cell, a vector primarily used for replicating DNA or RNA, and a vector primarily used for expression of the transcription and / or translation of DNA or RNA. The vector also includes a vector with a variety of the above-mentioned functions. The vector may be a polynucleotide that can be transcribed and translated into a polypeptide when introduced into a suitable host cell. Typically, the vector can produce a desired expression product by cultivating a suitable host cell containing the vector.

[0122] In this application, the term "cell" generally refers to an individual cell, cell line or cell culture that may or has contained a plasmid or vector comprising a nucleic acid molecule as described herein, or that can express an antibody or its antigen-binding fragment as described herein. The cell may include the progeny of a single host cell. Due to natural, accidental or deliberate mutations, the progeny cells may not necessarily be identical in morphology or genome to the original parent cell, but may be able to express the antibody or its antigen-binding fragment as described herein. The cell may be obtained by transfecting cells in vitro using the vectors described herein. The cell may be a prokaryotic cell (e.g., Escherichia coli) or a eukaryotic cell (e.g., a yeast cell, e.g., a COS cell, a Chinese hamster ovary (CHO) cell, a HeLa cell, a HEK293 cell, a COS-1 cell, a NSO cell or a myeloma cell). In this application, the cell may include a cell into which the vector has been introduced. The cell may include not only a specific cell, but also the offspring of these cells.

[0123] In this application, the term "pharmaceutically acceptable adjuvant" generally includes pharmaceutically acceptable carriers, excipients or stabilizers that are non-toxic to cells or mammals exposed thereto at the dosages and concentrations employed. Typically, a physiologically acceptable carrier is a pH buffered aqueous solution.

[0124] As used herein, the term "administering" generally refers to the application of an exogenous drug, therapeutic agent, diagnostic agent or composition to an animal, a human, a subject, a cell, a tissue, an organ or a biological fluid. "Administering" can refer to treatment, pharmacokinetics, diagnosis, research and experimental methods. The processing of cells can include contact of a reagent (e.g., a reagent comprising the isolated antigen-binding protein) with a cell, and contact of a reagent with a fluid, contact of a fluid with a cell. "Administering" also means in vitro and ex vivo treatment by a reagent, a diagnosis, a combination composition or by another cell. "Treatment" when applied to a human, an animal or a research subject refers to therapeutic treatment, prophylactic or preventative measures, research and diagnosis; for example, it can include contact of the isolated antigen-binding protein with a human or animal, a subject, a cell, a tissue, a physiological compartment or a physiological fluid.

[0125] As used herein, the term "treating" refers to administering an internal or external therapeutic agent, such as a multispecific binding protein, isolated antigen binding protein, and / or pharmaceutical composition comprising any of the disclosed embodiments, to a patient who has one or more symptoms of a disease for which the therapeutic agent is known to have a therapeutic effect. Typically, the therapeutic agent is administered to a patient in an amount effective to alleviate one or more symptoms of the disease (a therapeutically effective amount). Desirable effects of treatment include a reduction in the rate of disease progression, improvement or alleviation of the disease state, and regression or improved prognosis. For example, an individual is successfully "treated" if one or more symptoms associated with cancer are alleviated or eliminated, including, but not limited to, reducing (or destroying) cancer cell proliferation, reducing symptoms resulting from the disease, improving the quality of life of individuals with the disease, reducing the dose of other drugs needed to treat the disease, delaying the progression of the disease, and / or prolonging the survival of the individual.

[0126] In this application, the term "include" generally means to include, encompass, contain or encompass. In some cases, it also means "to be", "to be composed of..."

[0127] In this application, the term "about" generally refers to a variation within a range of 0.5%-10% above or below the specified value, for example, a variation within a range of 0.5%, 1%, 1.5%, 2%, 2.5%, 3%, 3.5%, 4%, 4.5%, 5%, 5.5%, 6%, 6.5%, 7%, 7.5%, 8%, 8.5%, 9%, 9.5%, or 10% above or below the specified value.

[0128] Detailed Description of the Invention

[0129] Multispecific binding proteins

[0130] On the one hand, the present application provides a multispecific binding protein, which may include a first targeting moiety and a second targeting moiety, wherein the first targeting moiety includes an antibody or antigen-binding fragment thereof that can specifically bind to a mannose-6-phosphate receptor (M6PR), and the second targeting moiety can specifically bind to a cell surface molecule or an extracellular molecule. Compared to the presence of only the second targeting moiety, the multispecific binding protein can enhance the endocytic degradation of the cell surface molecule or extracellular molecule. By binding to the cell surface CI-M6PR, the multispecific binding protein of the present application can be endocytosed by the cell, for example, in the form of a complex of the multispecific binding protein with the cell surface molecule or extracellular molecule and CI-M6PR, the multispecific binding protein is internalized into the cell and then degraded through the lysosomal pathway, while the cell surface molecule or extracellular molecule in the complex is also degraded, and at least part of the M6PR dissociates from the complex (for example, dissociates at a suitable lower pH value) and circulates to the extracellular membrane. A schematic diagram of the multispecific binding protein of the present application causing cell surface molecules or extracellular molecules to be endocytosed and degraded by the cell through the lysosomal pathway can be seen in Figure 20.

[0131] In the present application, the first targeting moiety may comprise a VHH, for example, those VHHs mentioned in the “M6PR antigen binding protein” section below.

[0132] Second targeting moiety

[0133] In certain embodiments, the second targeting moiety of the multispecific binding protein is capable of specifically binding to a cell surface molecule. The cell surface molecule can be any cell surface molecule that can be targeted for degradation via the endosomal / lysosomal pathway.

[0134] Cell surface molecules can be cell surface receptors.Cell surface receptors can include but are not limited to stem cell receptors, immune cell receptors, growth factor receptors, cytokine receptors, hormone receptors, receptor tyrosine kinases, receptors in epidermal growth factor receptor (EGFR) family (for example, HER2 (human epidermal growth factor receptor 2) etc.), receptors in fibroblast growth factor receptor (FGFR) family, receptors in vascular endothelial growth factor receptor (VEGFR) family, receptors in platelet-derived growth factor receptor (PDGFR) family, receptors in rearranged (RET) receptor family, receptors in Eph receptor family, receptors in discoid domain receptor (DDR) family and mucin (for example, MUC1).In the present application, cell surface receptors can be selected from any one of the following immune cell receptors: T cell receptor, B cell receptor, natural killer (NK) cell receptor, macrophage receptor, monocyte receptor, neutrophil receptor, dendritic cell receptor, mast cell receptor, basophil receptor and eosinophil receptor. For example, the second targeting moiety can comprise an antibody to epidermal growth factor receptor.For example, the second targeting moiety is a HER2 antibody or an antigen binding fragment thereof.

[0135] In the present application, cell surface molecules can be present on the surface of immune cells. Immune cells can be selected from T cells, B cells, natural killer (NK) cells, macrophages, monocytes, neutrophils, dendritic cells, mast cells, basophils and eosinophils. In the present application, the cell surface molecules present on immune cells can be inhibitory immunoreceptors, or ligands of inhibitory immunoreceptors. In certain embodiments, the cell surface molecules present on immune cells are immune checkpoint molecules. Non-limiting examples of immune checkpoint molecules that the first targeting moiety can specifically bind to include members of PD-1, PD-L1, CTLA4, TIM3, LAG3, TIGIT and B7 families. For example, the second targeting moiety can include an antibody of an immune checkpoint inhibitor. For example, the second targeting moiety is a PD-1 / PD-L1 antibody or its antigen-binding fragment.

[0136] In the present application, the cell surface molecule can be present on the surface of a tumor cell. For example, the cell surface molecule is a tumor-associated antigen or a tumor-specific antigen. Exemplary tumor antigens can include, but are not limited to, the group consisting of: MAGE, HER2, PSA, TRP-2, EpCAM, GPC3, MSLN, and EGFR. For example, the second targeting moiety can comprise an antibody to a tumor antigen. For example, the second targeting moiety is a CD20 antibody or an antigen-binding fragment thereof.

[0137] In certain embodiments, the second targeting moiety of the multispecific binding protein is capable of specifically binding to an extracellular molecule. The extracellular molecule can be any extracellular molecule that can be targeted for degradation via the endosomal / lysosomal pathway.

[0138] The extracellular molecule can be a ligand of a cell surface receptor. The ligand of a cell surface receptor can include, but is not limited to, growth factors (e.g., epidermal growth factor (EGF), vascular endothelial growth factor (VEGF) etc.), cytokines (e.g., interleukins, interferons, tumor necrosis factor (TNF), transforming growth factor beta (TGF-β), including any specific subtype of such cytokines), hormones etc. In the present application, the extracellular molecule can be an antibody, e.g., an antibody that specifically binds to a cell surface molecule or a different extracellular molecule. In certain embodiments, the antibody is an autoantibody. In the present application, the extracellular molecule can be a secretory protein that accumulates in a disease (e.g., α-synuclein), a cholesterol carrier (e.g., ApoB), an infectious toxin (e.g., AB toxin, ESAT-6), an infectious particle (e.g., a whole virus, a whole bacterium, etc.), a coagulation factor (e.g., Factor IX), a target of any FDA-approved antibody that binds to an extracellular molecule (e.g., TNFα), any chemokine or cytokine (e.g., a mediator of sepsis or chronic inflammation, such as IL-1), a protein hormone (e.g., insulin, ACTH, etc.), a protein mediator of mood disorders, a protein mediator of energy homeostasis (e.g., leptin, ghrelin, etc.), a protein allergen present in the blood or an antibody against such an allergen (e.g., for peanut allergy), a protein toxin (e.g., snake venom hyaluronidase, etc.), etc. For example, the second targeting moiety can comprise an antibody against a cytokine. For example, the second targeting moiety is a TNF-α antibody or an antigen-binding fragment thereof. For example, the second targeting moiety can comprise an antibody against a growth factor. The second targeting moiety is an EGF antibody or an antigen-binding fragment thereof.

[0139] In certain embodiments, the multispecific binding proteins of the present application are capable of enhancing the degradation of a cell surface molecule or an extracellular molecule relative to the degradation of the cell surface molecule or the extracellular molecule in the presence of only the second targeting moiety. In certain embodiments, the multispecific binding proteins of the present application are capable of enhancing the degradation of a cell surface molecule or an extracellular molecule relative to the degradation of the cell surface molecule or the extracellular molecule in the presence of only the second targeting moiety or the first targeting moiety.

[0140] In the application, "enhanced degradation" means that the cell surface molecule or extracellular molecule is degraded in the presence of a multispecific binding protein, and is not degraded in the presence of only the first targeting portion or only the second targeting portion under the same conditions; or, under the same conditions, the cell surface molecule or extracellular molecule is degraded to a higher extent in the presence of a multispecific binding protein than in the presence of only the first targeting portion or only the second targeting portion. When the extent of degradation of a cell surface molecule or extracellular molecule in the presence of the multispecific binding protein is greater than the extent of degradation of the cell surface molecule or extracellular molecule in the presence of the first targeting moiety alone or the second targeting moiety alone under the same conditions, the extent of degradation can be 1.2-fold or greater, 1.4-fold or greater, 1.6-fold or greater, 1.8-fold or greater, 2-fold or greater, 2.5-fold or greater, 3-fold or greater, 3.5-fold or greater, 4-fold or greater, 4.5-fold or greater, 5-fold or greater, 5.5-fold or greater, 6-fold or greater, 6.5-fold or greater, 7-fold or greater, 7.5-fold or greater, 8-fold or greater, 8.5-fold or greater, 9-fold or greater, 9.5-fold or greater, or 10-fold or greater.

[0141] In the present application, the first targeting moiety and the second targeting moiety can be directly connected or formed by connexon fusion. Connexon can be a chemical functional group, a peptide connexon or a combination thereof. Suitable connexons can maintain a fixed distance between different targeting moieties, and maintain the independent function (such as antigen binding) of each targeting moiety. Peptide connexons can be peptides with about ten amino acid lengths. Peptide connexons can also be longer polypeptides, to allow multispecific binding proteins to reach or combine at least two different binding sites simultaneously. For example, a peptide connexon can be a connexon rich in glycine and serine, for example, a connexon comprising 1-15 G4S units (for example, 7 G4S). For example, a peptide connexon can be an antibody Fc hinge region.

[0142] In one embodiment, the multispecific binding protein comprises, from N-terminus to C-terminus, the first targeting moiety, a peptide linker, and the second targeting moiety, or the second targeting moiety, a peptide linker, and the first targeting moiety. An exemplary structure can be shown in Figure 17.

[0143] For example, the structure of the multispecific binding protein can be "a first targeting moiety in VHH format - a linker - a second targeting moiety in VHH format," or "a second targeting moiety in VHH format - a linker - a first targeting moiety in VHH format." For example, the multispecific binding protein comprises the amino acid sequence shown in SEQ ID NO. 61 or 64.

[0144] In one embodiment, the multispecific binding protein may further comprise an antibody Fc domain, wherein the Fc domain comprises a first subunit and a second subunit. The multispecific binding protein of the present application forms a dimer through dimerization between the first and second subunits. The antibody Fc domain may be an Fc domain derived from IgG1 or an Fc domain derived from IgG4.

[0145] The first targeting moiety and the second targeting moiety can be located at the same end or different ends of the antibody Fc domain.For example, the multispecific binding protein can comprise a first polypeptide chain and a second polypeptide chain, wherein the first polypeptide chain and the second polypeptide chain form a dimer through dimerization between a first subunit and a second subunit.

[0146] For example, the first targeting moiety and the second targeting moiety can be located at the N-terminus of the antibody Fc domain. For example, the first targeting moiety and the second targeting moiety can be located at the C-terminus of the antibody Fc domain.

[0147] For example, the structure of the first polypeptide chain of a multispecific binding protein can be "a first targeting moiety in a VHH format-the first subunit or the second subunit of an Fc domain," and the structure of the second polypeptide chain can be "a second targeting moiety in a VHH format-the second subunit or the first subunit of an Fc domain." For example, an exemplary structure can be shown in Figure 18.

[0148] For example, the structure of the first polypeptide chain of the multispecific binding protein can be "the first subunit or the second subunit of the Fc domain-the first targeting moiety in the form of VHH", and the structure of the second polypeptide chain can be "the second subunit or the first subunit of the Fc domain-the second targeting moiety in the form of VHH".

[0149] For example, the first targeting moiety can be located at the N-terminus of the antibody Fc domain, and the second targeting moiety can be located at the C-terminus of the antibody Fc domain.

[0150] For example, the structure of the first polypeptide chain of the multispecific binding protein can be "a first targeting moiety in the form of VHH-the first subunit of the Fc domain or the second subunit-the second targeting moiety in the form of VHH", and the structure of the second polypeptide chain can be "a first targeting moiety in the form of VHH-the second subunit of the Fc domain or the first subunit-the second targeting moiety in the form of VHH".

[0151] For example, the first targeting moiety can be located at the C-terminus of the antibody Fc domain, and the second targeting moiety can be located at the N-terminus of the antibody Fc domain.

[0152] For example, the structure of the first polypeptide chain of the multispecific binding protein can be "the second targeting moiety in the form of VHH-the first subunit or the second subunit of the Fc domain-the first targeting moiety in the form of VHH", and the structure of the second polypeptide chain can be "the second targeting moiety in the form of VHH-the second subunit or the first subunit of the Fc domain-the first targeting moiety in the form of VHH".

[0153] For example, an exemplary structure may be as shown in FIG19 .

[0154] In one embodiment, in the multispecific binding protein, the first targeting moiety or the second targeting moiety can be directly connected to the Fc domain, or indirectly fused through a linker. The peptide linker can be a peptide having a length of about ten amino acids, or a longer polypeptide, to allow the multispecific binding protein to reach or bind to at least two different binding sites at the same time. For example, the peptide linker can be a linker rich in glycine and serine, for example, a linker comprising 1-15 G4S units (e.g., 7 G4S). For example, the peptide linker can be an antibody Fc hinge region.

[0155] In the present application, the Fc domain may include modifications that promote dimerization. Exemplary modifications may be knob-into-hole methods, or other modifications known in the art that can reduce mispairing between two different peptide chains. For example, for an Fc region derived from human IgG1, modifications to one subunit may include Y349C, E357K, T366S, L368A, D399K, and / or Y407V, while modifications to another subunit may include S354C, T366W, K370E, and / or R409D.

[0156] M6PR antigen binding protein

[0157] In another aspect, the present application provides an isolated antigen-binding protein that specifically binds to M6PR (e.g., CI-M6PR). In one embodiment, in the multispecific binding protein of the present application, the first targeting moiety comprises an antigen-binding protein that specifically binds to M6PR (e.g., CI-M6PR) as described herein, comprising the amino acid sequence features described herein.

[0158] The antigen binding protein described in the present application can compete with a reference antibody for binding to M6PR.

[0159] In certain embodiments, the reference antibody comprises HCDR1, HCDR2 and HCDR3, and the HCDR1 comprises the amino acid sequence shown in SEQ ID NO.16, the HCDR2 comprises the amino acid sequence shown in SEQ ID NO.17, and the HCDR3 comprises the amino acid sequence shown in SEQ ID NO.18.

[0160] In certain embodiments, the reference antibody comprises HCDR1, HCDR2 and HCDR3, and the HCDR1 comprises the amino acid sequence shown in SEQ ID NO.1, the HCDR2 comprises the amino acid sequence shown in SEQ ID NO.2, and the HCDR3 comprises the amino acid sequence shown in SEQ ID NO.3.

[0161] In certain embodiments, the reference antibody comprises HCDR1, HCDR2 and HCDR3, and the HCDR1 comprises the amino acid sequence shown in SEQ ID NO.4, the HCDR2 comprises the amino acid sequence shown in SEQ ID NO.5, and the HCDR3 comprises the amino acid sequence shown in SEQ ID NO.6.

[0162] In certain embodiments, the reference antibody comprises HCDR1, HCDR2 and HCDR3, and the HCDR1 comprises the amino acid sequence shown in SEQ ID NO.7, the HCDR2 comprises the amino acid sequence shown in SEQ ID NO.8, and the HCDR3 comprises the amino acid sequence shown in SEQ ID NO.9.

[0163] In certain embodiments, the reference antibody comprises HCDR1, HCDR2 and HCDR3, and the HCDR1 comprises the amino acid sequence shown in SEQ ID NO.10, the HCDR2 comprises the amino acid sequence shown in SEQ ID NO.11, and the HCDR3 comprises the amino acid sequence shown in SEQ ID NO.12.

[0164] In certain embodiments, the reference antibody comprises HCDR1, HCDR2 and HCDR3, and the HCDR1 comprises the amino acid sequence shown in SEQ ID NO.13, the HCDR2 comprises the amino acid sequence shown in SEQ ID NO.14, and the HCDR3 comprises the amino acid sequence shown in SEQ ID NO.15.

[0165] In certain embodiments, the reference antibody comprises HCDR1, HCDR2 and HCDR3, and the HCDR1 comprises the amino acid sequence shown in SEQ ID NO.19, the HCDR2 comprises the amino acid sequence shown in SEQ ID NO.20, and the HCDR3 comprises the amino acid sequence shown in SEQ ID NO.21.

[0166] In certain embodiments, the reference antibody comprises HCDR1, HCDR2 and HCDR3, and the HCDR1 comprises the amino acid sequence shown in SEQ ID NO.22, the HCDR2 comprises the amino acid sequence shown in SEQ ID NO.23, and the HCDR3 comprises the amino acid sequence shown in SEQ ID NO.24.

[0167] In certain embodiments, the reference antibody comprises HCDR1, HCDR2 and HCDR3, and the HCDR1 comprises the amino acid sequence shown in SEQ ID NO.19, the HCDR2 comprises the amino acid sequence shown in SEQ ID NO.25, and the HCDR3 comprises the amino acid sequence shown in SEQ ID NO.26.

[0168] In certain embodiments, the reference antibody comprises HCDR1, HCDR2 and HCDR3, and the HCDR1 comprises the amino acid sequence shown in SEQ ID NO.27, the HCDR2 comprises the amino acid sequence shown in SEQ ID NO.28, and the HCDR3 comprises the amino acid sequence shown in SEQ ID NO.29.

[0169] In certain embodiments, the reference antibody comprises HCDR1, HCDR2 and HCDR3, and the HCDR1 comprises the amino acid sequence shown in SEQ ID NO.30, the HCDR2 comprises the amino acid sequence shown in SEQ ID NO.31, and the HCDR3 comprises the amino acid sequence shown in SEQ ID NO.32.

[0170] In certain embodiments, the reference antibody comprises HCDR1, HCDR2 and HCDR3, and the HCDR1 comprises the amino acid sequence shown in SEQ ID NO.33, the HCDR2 comprises the amino acid sequence shown in SEQ ID NO.34, and the HCDR3 comprises the amino acid sequence shown in SEQ ID NO.35.

[0171] In certain embodiments, the reference antibody comprises HCDR1, HCDR2 and HCDR3, and the HCDR1 comprises the amino acid sequence shown in SEQ ID NO.36, the HCDR2 comprises the amino acid sequence shown in SEQ ID NO.37, and the HCDR3 comprises the amino acid sequence shown in SEQ ID NO.38.

[0172] In certain embodiments, the antigen-binding protein comprises HCDR1, HCDR2 and HCDR3, and the HCDR1 comprises the amino acid sequence as shown in SEQ ID NO.39: LX1X2SCAASGX3TFTRYX4X5X6, wherein X1 represents R or no amino acid, X2 represents L or no amino acid, X3 represents H or T, X4 represents A or V, X5 represents M or no amino acid, and X6 represents A or no amino acid; the HCDR2 comprises the amino acid sequence as shown in SEQ ID NO.40: AIX1WITGSTSYA, wherein X1 represents K, N or R; the HCDR3 comprises the amino acid sequence as shown in SEQ ID NO.41: ASNX1PDX2X3QILX4TRGYNY, wherein X1 represents D or N, X2 represents I or V, X3 represents K or R, and X4 represents S or T.

[0173] In certain embodiments, the antigen-binding protein comprises HCDR1, HCDR2 and HCDR3, and the HCDR1 comprises the amino acid sequence shown in SEQ ID NO.42: LTLSCAVSGRX1SDRHLLA, wherein X1 represents P or T; the HCDR2 comprises the amino acid sequence shown in SEQ ID NO.43: SINWX1AX2TPYYV, wherein X1 represents I or V; the HCDR3 comprises the amino acid sequence shown in SEQ ID NO.44: ATQDX1GX2X3VWRLRX4DD, wherein X1 represents S or T, X2 represents N or T, X3 represents F or Y, and X4 represents F or Y.

[0174] In certain embodiments, the antigen-binding protein comprises HCDR1, HCDR2 and HCDR3, and the HCDR1 comprises the amino acid sequence as shown in SEQ ID NO.45: LRLX1CAASGFX2X3SX4YX5, wherein X1 represents F or S, X2 represents A or T, X3 represents F or V, X4 represents N or S, and X5 represents A or V; the HCDR2 comprises the amino acid sequence as shown in SEQ ID NO.46: DIX1SGX2GX3TX4YA, wherein X1 represents D or N, X2 represents A or G, X3 represents G or S, and X4 represents F or Y; the HCDR3 comprises the amino acid sequence as shown in SEQ ID NO.47: RGGYX1X2X3DX4RX5, wherein X1 represents G or S, X2 represents T or no amino acid, X3 represents S or T, X4 represents V or no amino acid, and X5 represents P or no amino acid.

[0175] In certain embodiments, the antigen-binding protein comprises HCDR1, HCDR2 and HCDR3, and the HCDR1 comprises the amino acid sequence shown in SEQ ID NO.16, the HCDR2 comprises the amino acid sequence shown in SEQ ID NO.17, and the HCDR3 comprises the amino acid sequence shown in SEQ ID NO.18.

[0176] For example, the antigen-binding protein may be a VHH comprising the amino acid sequence shown in SEQ ID NO.53.

[0177] In certain embodiments, the antigen binding protein comprises HCDR1, HCDR2 and HCDR3, and the HCDR1 comprises the amino acid sequence shown in SEQ ID NO.1, the HCDR2 comprises the amino acid sequence shown in SEQ ID NO.2, and the HCDR3 comprises the amino acid sequence shown in SEQ ID NO.3.

[0178] For example, the antigen-binding protein may be a VHH comprising the amino acid sequence shown in SEQ ID NO.48.

[0179] In certain embodiments, the antigen binding protein comprises HCDR1, HCDR2 and HCDR3, and the HCDR1 comprises the amino acid sequence shown in SEQ ID NO.4, the HCDR2 comprises the amino acid sequence shown in SEQ ID NO.5, and the HCDR3 comprises the amino acid sequence shown in SEQ ID NO.6.

[0180] For example, the antigen-binding protein may be a VHH comprising the amino acid sequence shown in SEQ ID NO.49.

[0181] In certain embodiments, the antigen-binding protein comprises HCDR1, HCDR2 and HCDR3, and the HCDR1 comprises the amino acid sequence shown in SEQ ID NO.7, the HCDR2 comprises the amino acid sequence shown in SEQ ID NO.8, and the HCDR3 comprises the amino acid sequence shown in SEQ ID NO.9.

[0182] For example, the antigen-binding protein may be a VHH comprising the amino acid sequence shown in SEQ ID NO.50.

[0183] In certain embodiments, the antigen binding protein comprises HCDR1, HCDR2 and HCDR3, wherein the HCDR1 comprises the amino acid sequence shown in SEQ ID NO.10, the HCDR2 comprises the amino acid sequence shown in SEQ ID NO.11, and the HCDR3 comprises the amino acid sequence shown in SEQ ID NO.12.

[0184] For example, the antigen-binding protein may be a VHH comprising the amino acid sequence shown in SEQ ID NO.51.

[0185] In certain embodiments, the antigen-binding protein comprises HCDR1, HCDR2 and HCDR3, and the HCDR1 comprises the amino acid sequence shown in SEQ ID NO.13, the HCDR2 comprises the amino acid sequence shown in SEQ ID NO.14, and the HCDR3 comprises the amino acid sequence shown in SEQ ID NO.15.

[0186] For example, the antigen-binding protein may be a VHH comprising the amino acid sequence shown in SEQ ID NO.52.

[0187] In certain embodiments, the antigen-binding protein comprises HCDR1, HCDR2 and HCDR3, and the HCDR1 comprises the amino acid sequence shown in SEQ ID NO.19, the HCDR2 comprises the amino acid sequence shown in SEQ ID NO.20, and the HCDR3 comprises the amino acid sequence shown in SEQ ID NO.21.

[0188] For example, the antigen-binding protein may be a VHH comprising the amino acid sequence shown in SEQ ID NO.54.

[0189] In certain embodiments, the antigen-binding protein comprises HCDR1, HCDR2 and HCDR3, and the HCDR1 comprises the amino acid sequence shown in SEQ ID NO.22, the HCDR2 comprises the amino acid sequence shown in SEQ ID NO.23, and the HCDR3 comprises the amino acid sequence shown in SEQ ID NO.24.

[0190] For example, the antigen binding protein may be a VHH comprising the amino acid sequence shown in SEQ ID NO.55.

[0191] In certain embodiments, the antigen-binding protein comprises HCDR1, HCDR2 and HCDR3, and the HCDR1 comprises the amino acid sequence shown in SEQ ID NO.19, the HCDR2 comprises the amino acid sequence shown in SEQ ID NO.25, and the HCDR3 comprises the amino acid sequence shown in SEQ ID NO.26.

[0192] For example, the antigen-binding protein may be a VHH comprising the amino acid sequence shown in SEQ ID NO.56.

[0193] In certain embodiments, the antigen-binding protein comprises HCDR1, HCDR2 and HCDR3, and the HCDR1 comprises the amino acid sequence shown in SEQ ID NO.27, the HCDR2 comprises the amino acid sequence shown in SEQ ID NO.28, and the HCDR3 comprises the amino acid sequence shown in SEQ ID NO.29.

[0194] For example, the antigen-binding protein may be a VHH comprising the amino acid sequence shown in SEQ ID NO.57.

[0195] In certain embodiments, the antigen binding protein comprises HCDR1, HCDR2 and HCDR3, wherein the HCDR1 comprises the amino acid sequence shown in SEQ ID NO.30, the HCDR2 comprises the amino acid sequence shown in SEQ ID NO.31, and the HCDR3 comprises the amino acid sequence shown in SEQ ID NO.32.

[0196] For example, the antigen-binding protein may be a VHH comprising the amino acid sequence shown in SEQ ID NO.58.

[0197] In certain embodiments, the antigen-binding protein comprises HCDR1, HCDR2 and HCDR3, and the HCDR1 comprises the amino acid sequence shown in SEQ ID NO.33, the HCDR2 comprises the amino acid sequence shown in SEQ ID NO.34, and the HCDR3 comprises the amino acid sequence shown in SEQ ID NO.35.

[0198] For example, the antigen-binding protein may be a VHH comprising the amino acid sequence shown in SEQ ID NO.59.

[0199] In certain embodiments, the antigen-binding protein comprises HCDR1, HCDR2 and HCDR3, and the HCDR1 comprises the amino acid sequence shown in SEQ ID NO.36, the HCDR2 comprises the amino acid sequence shown in SEQ ID NO.37, and the HCDR3 comprises the amino acid sequence shown in SEQ ID NO.38.

[0200] For example, the antigen-binding protein may be a VHH comprising the amino acid sequence shown in SEQ ID NO.60.

[0201] On the other hand, the present application provides a conjugate comprising the multispecific binding protein, the isolated antigen binding protein, or the multispecific antibody, and one or more selected from the following groups: a chemotherapeutic agent, a toxin, an immunotherapeutic agent, an imaging probe, a spectroscopic probe, a fluorescent protein, etc.

[0202] Kits and pharmaceutical compositions

[0203] In another aspect, the present application provides a nucleic acid molecule encoding the multispecific binding protein, the isolated antigen binding protein, or the multispecific antibody.

[0204] In another aspect, the present application provides a vector comprising the nucleic acid molecule.

[0205] In another aspect, the present application provides a cell comprising the nucleic acid molecule or the vector.

[0206] In another aspect, the present application provides a pharmaceutical composition comprising the multispecific binding protein, the isolated antigen-binding protein, the multispecific antibody, the nucleic acid molecule, the vector and / or the cell, and optionally a pharmaceutically acceptable carrier.

[0207] In certain embodiments, the pharmaceutical composition may also include one or more (pharmaceutically effective) adjuvants, stabilizers, excipients, diluents, solubilizers, surfactants, emulsifiers and / or preservatives. The acceptable ingredients of the composition can be non-toxic to the recipient at the dosage and concentration used. The pharmaceutical composition of the present invention may include but is not limited to liquid, frozen and lyophilized compositions. In certain embodiments, the pharmaceutical composition may also contain more than one active compound, generally those active compounds with complementary activities that do not adversely affect each other. The type and effective amount of such drugs may depend on the amount and type of the antagonist present in the preparation, as well as the clinical parameters of the subject. In certain embodiments, the pharmaceutically acceptable carrier may include any and all solvents, dispersion media, coatings, isotonic agents and absorption delay agents compatible with drug administration, generally safe and non-toxic.

[0208] In another aspect, the present application provides a kit comprising the multispecific binding protein, the isolated antigen-binding protein, the multispecific antibody, the nucleic acid molecule, the vector, the cell and / or the pharmaceutical composition.

[0209] Methods and uses

[0210] In another aspect, the present application provides a method for causing protein degradation, comprising administering the multispecific binding protein, the isolated antigen-binding protein, the multispecific antibody, the nucleic acid molecule, the vector, the cell, and / or the pharmaceutical composition. The method can be an in vitro or ex vivo method.

[0211] On the other hand, the present application provides applications or uses of the multispecific binding protein, the isolated antigen-binding protein, the multispecific antibody, the nucleic acid molecule, the vector, the cell, and / or the pharmaceutical composition in drug discovery, structural analysis or screening assays.

[0212] In another aspect, the present application provides uses of the multispecific binding protein, the isolated antigen binding protein, the multispecific antibody, the nucleic acid molecule, the vector, the cell, and / or the pharmaceutical composition for in vitro lysosomal tracking, for example, when operably linked or chemically coupled to a label.

[0213] On the other hand, the present application provides the use of the multispecific binding protein, the isolated antigen-binding protein, the multispecific antibody, the nucleic acid molecule, the vector, the cell, and / or the pharmaceutical composition in the preparation of a drug for alleviating and / or treating a disease.

[0214] In another aspect, the present application provides a method for alleviating and / or treating a disease, comprising administering the multispecific binding protein, the isolated antigen-binding protein, the multispecific antibody, the nucleic acid molecule, the vector, the cell, and / or the pharmaceutical composition to a subject in need thereof.

[0215] More specifically, the multispecific binding protein, the isolated antigen binding protein, the multispecific antibody, the nucleic acid molecule, the vector, the cell, and / or the pharmaceutical composition can be used to treat lysosomal storage diseases or for protein replacement therapy.

[0216] The disease may be a disease or condition caused or associated with an extracellular molecule or a cell surface molecule. In certain embodiments, the disease is associated with abnormal expression (eg, high expression) of an extracellular molecule or a cell surface molecule.

[0217] For example, the disease may be a tumor. For example, the disease may be a tumor with abnormal expression of cell surface molecules.

[0218] For example, the disease can be an autoimmune disease. For example, the disease can be an autoimmune disease in which extracellular molecules are abnormally expressed.

[0219] Without intending to be bound by any theory, the following examples are merely intended to illustrate the fusion protein, preparation method, and use of the present application, and are not intended to limit the scope of the present invention.

[0220] Example

[0221] Example 1 Expression and purification of human CI-M6PR protein

[0222] The nucleotide sequence corresponding to the extracellular domain amino acids was reverse-translated from the amino acid sequence of the human CI-M6PR protein (UniProt P11717). After codon optimization, gene synthesis was performed and cloned into the pcDNA3.1(+) expression vector. LPETG and His tags or a human IgG1 constant region tag were added to this plasmid to generate the final protein expression plasmid, pcDNA3.4 CI-M6PR(ECD)His.

[0223] The plasmid was extracted using a large extraction kit (MACHEREY-NAGEL, Cat#740410.100) and then transformed into 293F cells for expression as follows: HEK 293F cells were cultured to 2.0×10 6 The plasmid was mixed with the transfection reagent PEI at a 1:1 ratio in OptiMEM (Gibco, Cat# 31985070) at a density of 100 cells / mL. After 10 minutes of incubation, the cells were added to HEK 293F cells and cultured in a shaking incubator at 37°C, 6% CO2 for 4 days. The supernatant was obtained by two centrifugation steps. CI-M6PR(ECD)His was purified using a nickel column and a Protein A prepacked column, respectively. The supernatant was then ultrafiltered into HBSS buffer and used for subsequent analysis. The purified protein was then analyzed by SDS-PAGE electrophoresis.

[0224] The results of electrophoresis detection showed that the antigen CI-M6PR (ECD) His prepared by this method had a purity of >95%, which was suitable for subsequent alpaca immunization and screening of CI-M6PR single domain antibodies.

[0225] Example 2 Construction and Screening of CI-M6PR Single Domain Antibody Immune Library

[0226] 2.1 Alpaca Immunity

[0227] A Chilean alpaca (Lama alpacos) was selected, and 1 mg of antigen protein was fully mixed with adjuvant and then immunized at multiple points for a total of 5 immunizations. The second to fifth immunizations were each mixed with 0.5 mg of antigen protein and adjuvant.

[0228] One week after each immunization, blood was collected from the alpacas and the antibody titer in the serum was determined by enzyme-linked immunosorbent assay (ELISA). The coating protein was CI-M6PR (ECD) His and the detection antibody was Goat anti-llama IgG (HRP) (Abcam, Cat#ab112786). The antibody titer results showed that the alpacas produced specific antibodies against CI-M6PR (ECD) after two rounds of immunization, and the fourth and fifth rounds of immunization further increased the antibody titer in the serum.

[0229] 2.2 Construction of phage display library

[0230] After five immunizations, 50 mL of peripheral blood lymphocytes were extracted from the alpaca and total mRNA was extracted using an RNA extraction kit. The extracted mRNA was reverse transcribed into cDNA using the HiScript II 1st Strand cDNA Synthesis Kit (Vazyme, Cat# R312-01). Nested PCR was used to amplify the variable region nucleic acid fragments of the heavy chain antibody:

[0231] First round PCR:

[0232] Primer F1: CTTGGTGGTCCTGGCTGC (SEQ ID NO: 79);

[0233] Primer R1: GGTACGTGCTGTTGAACTGTTCC (SEQ ID NO: 80);

[0234] The second round of PCR was performed using the first round PCR product as a template:

[0235] Primer F2: ACTGTGGCCCAGGCGGCCCAGKTGCAGCTCGTGGAGTC (SEQ ID NO: 81, wherein K is a degenerate site, representing G / T merger);

[0236] Primer R2-1: CTCGCGGCCGGCCTGGCCATGGGGGTCTTCGCTGTGGTGCG (SEQ ID NO: 82);

[0237] Primer R2-2: CTCGCGGCCGGCCTGGCCGTCTTGTGGTTTTGGTGTCTTGGG (SEQ ID NO: 83);

[0238] The target heavy chain antibody variable region fragment was recovered from the gel. The VHH fragment and the phage display vector pComb3XSS were digested with the restriction endonuclease Sfi I. The digested VHH fragment and the vector were then ligated at a molar ratio of 1:3 at 16°C for 16 h. The ligation product was electroporated into E. coli TG1 competent cells to construct the CI-M6PR single domain antibody phage display library, and the library quality was evaluated. The library capacity was tested to be 6.72×10 8 In order to detect the insertion rate of the library, 20 colony clones were randomly picked for sequencing and identification. The results showed that the correct insertion rate was 100%, indicating that the constructed phage display library was of high quality and could be used for screening of CI-M6PR single domain antibodies.

[0239] 2.3 Screening of CI-M6PR single-domain antibodies:

[0240] 100 μg CI-M6PR (ECD) His protein was labeled with GGGK (biotin) (custom synthesized by Hangzhou Peptide Biotechnology) using Srt A-mediated labeling reaction, and then combined with 100 μL SA magnetic beads (Beaver, Cat# 22307-1). 10 μL of magnetic beads loaded with antigen protein was mixed with 100 μL of phage (1x10 12 The cells were then incubated with 500 μg / mL of PBST (pH 7.4, 0.05% Tween 20) at room temperature for 1 hour. The cells were then washed five times with PBST (PBS pH 7.4, 0.05% Tween 20) to remove phage-displaying single-domain antibodies that did not bind to the CI-M6PR (ECD) antigen. Phage specifically targeting the CI-M6PR single-domain antibody were then eluted with 100 mM triethylamine and used to infect Escherichia coli TG1 cells in the logarithmic growth phase. The infection was incubated at 37°C for 1 hour, followed by overnight incubation and collection of phage for the next round of screening. The same screening process was repeated five times to gradually enrich phage specifically targeting the CI-M6PR single-domain antibody.

[0241] 2.4 Phage enzyme-linked immunosorbent assay to screen positive clones that specifically bind to CI-M6PR:

[0242] After five rounds of biopanning, Escherichia coli were infected with CI-M6PR-binding phage. 128 individual colonies were selected and cultured, and the corresponding M13 phage displaying the single-domain antibody was purified. These phage were added to the wells of an ELISA plate coated overnight with CI-M6PR (ECD) His and incubated at 37°C for 1 hour. The plates were washed five times with PBST to remove nonspecifically bound single-domain antibody. Mouse Anti-M13 Antibody (HRP) (Sino Biological, Cat# 11973-MM05T-H) was added and incubated at 37°C for 1 hour. The plates were washed five times with PBST to remove unbound primary antibody. Luminescent substrate was added, and luminescence was read on a microplate reader. A positive clone was identified when the value of the experimental well was three times or more higher than that of the control well. The corresponding colonies were inoculated in LB liquid medium and sent for sequencing. Amino acid sequence alignment of the sequencing results revealed 13 sequence-specific single-domain antibodies, whose amino acid sequences are shown in Tables 1 and 2 below.

[0243] Table 1 CI-M6PR single domain antibody CDR sequences

[0244] Table 2 CI-M6PR single domain antibody sequences

[0245] Example 3 Affinity determination of CI-M6PR targeting single domain antibody

[0246] 3.1 Expression and purification of CI-M6PR-targeting single-domain antibodies in Escherichia coli

[0247] Thirteen single-domain antibody-encoding nucleic acid sequences obtained by synthetic sequencing were cloned into the expression vector pET-21a(+) (Novagen, Cat#69740) and His-tagged. The clones were then transformed into the Escherichia coli BL21(DE3) expression strain and plated onto solid LB medium supplemented with 100 μg / mL ampicillin. The clones were cultured overnight at 37°C in a constant-temperature incubator. Individual clones were selected and inoculated into 2 mL of liquid LB medium supplemented with ampicillin and incubated at 37°C in a shaker for 6-8 hours until the plateau phase was reached. The clones were then transferred to fresh medium at a 1:100 ratio and incubated at 37°C in a shaker until the OD reached 0.6-0.8. IPTG was then added to a final concentration of 0.5 mM and expression was induced at 28°C for 12-16 hours. The cells were harvested by centrifugation, disrupted by sonication, and the supernatant collected by high-speed centrifugation. The His-tagged single-domain antibodies were then purified using a nickel column.

[0248] 3.2 Fortebio determination of affinity of single-domain antibodies for CI-M6PR

[0249] The assay used a Fortebio Octet Red 96 instrument and a matching streptavidin probe (Fortebio, CAT#18-5020). Single-domain antibodies purified from Escherichia coli were diluted in equilibration buffer (PBS, 0.05% Tween-20, 0.5% BSA) to 500 nM, 125 nM, 31 nM, 7.8 nM, and 1.95 nM. BLI assays were performed as follows: (1) Sensor check: The sensor was immersed in equilibration buffer for 60 s. (2) CI-M6PR immobilization: The sensor was immersed in a 5 μg / ml biotylated-CI-M6PR solution for 200 s. (3) Baseline: The sensor was immersed in equilibration buffer for 60 s. (4) Association: The sensor was immersed in different concentrations of the test sample for 200 s. (5) Dissociation: The sensor was immersed in equilibration buffer for 200 s. (6) Washing: The sensor was immersed in wash buffer 1 (0.1 M glycine-HCl, pH 2.2) for 5 s, followed by immersion in wash buffer 2 (PBS, 0.05% Tween-20-20, 0.5% BSA) for 5 s, for three cycles. Curve fitting was performed using Fortebio Octet data analysis software, and the measured binding capacity is shown in Table 3.

[0250] Table 3 Affinity of single domain antibodies binding to antigens

[0251] Example 4 Flow cytometry and imaging identification of the binding of CI-M6PR-targeting single-domain antibodies to endogenous CI-M6PR in cells

[0252] 4.1 Flow cytometric characterization of the binding of CI-M6PR-targeting single-domain antibody to CI-M6PR on the surface of K562 cells

[0253] Biotin-labeled anti-M6PR single-domain antibody was co-incubated with PE-streptavidin (Biolegend, Cat#405203) for 30 min, and then K562 cells were washed three times with HBSS, centrifuged, and the supernatant was discarded. The cells were resuspended in HBSS and dispensed into centrifuge tubes, with 200 μL (about 1x10 5 The antibody was incubated with K562 cells at 4°C for 1 hour, centrifuged, washed three times with HBSS, and resuspended in 500 mL of HBSS. Fluorescence intensity changes were detected by flow cytometry. The results are shown in Figure 1.

[0254] In K562 cells, CI-M6PR nanobodies showed a binding affinity of more than 40 times.

[0255] 4.2 Confocal imaging characterization of the binding and internalization of CI-M6PR-targeted single-domain antibody to cell surface CI-M6PR

[0256] Biotin-labeled anti-CI-M6PR single domain antibody was co-incubated with PE-streptavidin for 30 min, and then K562 cells were washed with HBSS, centrifuged, and resuspended in HBSS. The cells were then dispensed into centrifuge tubes, with 500 μL per tube (approximately 2 × 10 5 The antibody was incubated with K562 cells at 4°C for 1 hour, centrifuged, washed three times with HBSS, resuspended in 500 μL HBSS, and transferred to an imaging dish. The binding and internalization of the anti-M6PR single-domain antibody were observed using an LSM980 confocal microscope. The results are shown in Figure 2.

[0257] HepG2 cells were seeded into imaging dishes and cultured overnight, with approximately 2×10 cells per well. 5 Biotin-labeled anti-CI-M6PR single-domain antibody was incubated with PE-streptavidin for 30 minutes and then added to an imaging dish with HepG2 cells for 1 hour at 4°C. Hoechst 33342 (Invitrogen, Cat# R37605) was then added for 1 hour and washed three times with HBSS. Binding and internalization of the anti-M6PR single-domain antibody were observed using an LSM980 confocal microscope. The results are shown in Figure 3.

[0258] CI-M6PR nanoantibodies can bind to cell surface CI-M6PR and be internalized into cells. The aggregation phenomenon in K562 cells that express more M6PR is significantly stronger than that in HepG2 cells that express less M6PR.

[0259] Example 5 Cellular analysis to detect bispecific antibodies capable of degrading PD-1

[0260] 5.1 Expression and purification of a non-IgG-like bispecific antibody targeting PD-1 based on the CI-M6PR single-domain antibody in Escherichia coli

[0261] The anti-M6PR single domain antibody with clone number I2-28 and the anti-PD-1 single domain antibody P1-02 (amino acid sequence as shown in SEQ ID NO.72) were constructed into the expression vector pET-21a (+) (Novagen, Cat# 69740) and a His tag was added. They were transformed into the Escherichia coli expression strain BL21 (DE3), which was spread on LB solid medium containing 100 μg / mL ampicillin and cultured in a constant temperature incubator at 37 ° C overnight. A single clone was selected and inoculated into 2 mL of LB liquid medium containing ampicillin and cultured at 37 ° C in a constant temperature shaker for 6-8 hours to the stationary phase. 1:100 was transferred to fresh culture medium and cultured at 37 ° C in a constant temperature shaker until the OD value reached 0.6-0.8. Then, IPTG inducer with a final concentration of 0.5 mM was added and induced at 28 ° C for 12-16 hours. The cells were collected by centrifugation, and the cells were disrupted by ultrasound to obtain a lysate. The supernatant was collected by high-speed centrifugation, and the His-tagged bispecific single-domain antibody 28-P1-02 was purified using a nickel column. The structure is shown in Figure 4A, and the purification results are shown in Figure 4B.

[0262] 5.2 Flow cytometry characterization of 28-P1-02 degradation of PD-1 on the surface of Jurkat PD-1 cells

[0263] Jurkat PD-1 cells were cultured in RPMI 1640 medium containing 10% FBS and 1% PS. Jurkat PD-1 cells were taken at a density of 2×10 5 Cells were seeded at a density of 100 μL into a 24-well plate containing 500 μL of RPMI 1640 medium. The 28-P1-02 antibody was then added for co-incubation. A PBS buffer group served as a blank control, while groups containing only the anti-M6PR single-domain antibody I2-28 and only the anti-PD-1 single-domain antibody P1-02 served as negative controls. After 24 hours of co-incubation, the cells were removed, washed three times with HBSS, and incubated with PE-anti-PD-1 flow cytometry antibodies for 1 hour. The cells were then centrifuged and washed three times with HBSS. The degradation activity of the bispecific single-domain antibody 28-P1-02 was detected by flow cytometry. The results are shown in Figure 4C.

[0264] 5.3 Immunoblotting to characterize the degradation effect of 28-P1-02 on PD-1 on the surface of Jurkat PD-1 cells

[0265] Jurkat PD-1 cells were cultured in RPMI 1640 medium containing 10% FBS and 1% PS. Jurkat PD-1 cells were taken at a density of 2×10 5Cells were seeded at a density of 100 μg / mL into a 24-well plate containing 500 mL of fresh RPMI 1640 medium. 28-P1-02 (working concentrations of the antibody were 100 nM, 50 nM, 25 nM, 10 nM, 5 nM, 2.5 nM, and 1 nM, respectively) was then added and incubated for 24 hours. The cells were then removed and lysed with PIRA lysis buffer. Protein was quantified using a BCA quantification kit. Immunoblotting was used to detect the degradation of PD-1 on the surface of Jurkat PD-1 cells by 28-P1-02 at different concentrations. The results are shown in Figure 5. 28-P1-02 can effectively degrade PD-1, which is highly expressed on the surface of Jurkat PD-1 cells, at concentrations of 1 to 100 nM.

[0266] 5.4 Mammalian Cell Expression of an IgG-like Bispecific Antibody Targeting PD-1 Degradation Based on the CI-M6PR Single Domain Antibody

[0267] Human codon-optimized anti-CI-M6PR and anti-PD-1 single-domain antibody nucleic acid sequences were gene synthesized and cloned into the pcDNA 3.4 vector. The anti-CI-M6PR single-domain antibody was tagged with a human IgG1 constant region (Y349C, E357K, T366S, L368A, D399K, Y407V) to generate the pcDNA 3.4anti-M6PR Fc hole plasmid. The anti-PD-1 single-domain antibody was tagged with a human IgG1 constant region (S354C, T366W, K370E, R409D) to generate the pcDNA 3.4anti-PD-1 Fc Knobs plasmid. The amino acid sequences of the two IgG1 constant regions are shown in SEQ ID NOs. 75-76. HEK 293F cells were simultaneously transfected with the extracted pcDNA 3.4anti-CI-M6PR Fc hole and pcDNA 3.4anti-PD-1 Fc Knob plasmids using PEI. The cells were cultured in a shaking incubator at 37°C and 5% CO2 for 96 hours. The supernatant was centrifuged and the human Fc-tagged anti-M6PR-anti-PD-1 bispecific antibody was purified using a Protein A prepacked column. The purified eukaryotic expressed IgG-like bispecific antibody targeting PD-1 degradation was analyzed by SDS-PAGE. The structure is shown in Figure 6A, and the purification results are shown in Figure 6B.

[0268] 5.5 Degradation of 28-P1-02Fc

[0269] Jurkat PD-1 cells were cultured in RPMI 1640 medium containing 10% FBS and 1% PS. Jurkat PD-1 cells were taken at a density of 2×10 5Cells were seeded at a density of 100 μL into a 24-well plate containing 500 μL of RPMI 1640 medium. 28-P1-02Fc with a human Fc tag was then added for co-incubation. A PBS buffer group was set as a blank control, and two groups with only the anti-M6PR single-domain antibody I2-28Fc with a human Fc tag and the anti-PD-1 single-domain antibody P1-02Fc with a human Fc tag were added as negative controls. After 24 hours of co-incubation, the cells were removed and the degradation effect was characterized by immunoblotting. The results are shown in Figure 7. At a concentration of 100 nM, 28-P1-02Fc was able to effectively degrade PD-1, which was highly expressed on the surface of Jurkat PD-1 cells, to 19% of the blank control group, while neither 28Fc nor P1-02Fc showed any degradation effect on PD-1.

[0270] 5.6 Effects of time and concentration on degradation

[0271] Jurkat PD-1 cells were cultured in RPMI 1640 medium containing 10% FBS and 1% PS. Jurkat PD-1 cells were taken at a density of 2×10 5 28-P1-02Fc was inoculated at a density of 100 μL into a 24-well plate containing 500 μL of RPMI 1640 medium. Jurkat PD-1 cells were co-incubated with 28-P1-02Fc at a concentration of 100 nM for 6, 12, 24, and 48 hours, respectively. 28-P1-02Fc was then co-incubated with Jurkat PD-1 cells at concentrations of 100 nM, 50 nM, 10 nM, 1 nM, and 0.1 nM for 24 hours. After 24 hours of incubation, the cells were removed and lysed with PIRA lysis buffer. Protein was quantified using a BCA quantification kit. Immunoblotting was used to detect the degradation of PD-1 on the surface of Jurkat PD-1 cells by 28-P1-02Fc at different concentrations. The results are shown in Figure 8. At a concentration of 100 nM, 28-P1-02Fc was able to degrade PD-1 to 15% of the blank control group after 12 hours of incubation with cells, and the degradation efficiency increased with the increase of antibody concentration.

[0272] 5.7 Effects of different CI-M6PR nanobodies on degradation

[0273] Jurkat PD-1 cells were cultured in RPMI 1640 medium containing 10% FBS and 1% PS. Jurkat PD-1 cells were taken at a density of 2×10 5The cells were seeded at a density of 100 μL into 24-well plates in 500 μL RPMI 1640 medium, and anti-CI-M6PR and anti- PD-1 bispecific antibodies 28-P1-02Fc, 44-P1-02Fc, 45-P1-02Fc, 47-P1-02Fc and 55-P1-02Fc were co-incubated, and the PBS buffer group was set as a blank control. The anti-M6PR single domain antibodies I2-28 (28Fc), I2-44 (44Fc), I2-45 (45Fc), I2-47 (47Fc) and I2-55 (55Fc) with human Fc tags were added as negative controls. After 24 hours of co-incubation, the cells were removed, lysed with PIRA lysis buffer, and protein quantification was performed using a BCA quantitative kit. The effects of different binding epitopes of CI-M6PR nanoantibodies on degradation were detected by immunoblotting. The results are shown in Figure 9. The bispecific antibodies constructed from different CI-M6PR nanoantibodies can all produce good degradation effects, which means that as long as they can bind to CI-M6PR, they can trigger CI-M6PR-mediated degradation.

[0274] 5.8 Effects of Different PD-1 Nanobodies on Degradation

[0275] Jurkat PD-1 cells were cultured in RPMI 1640 medium containing 10% FBS and 1% PS. Jurkat PD-1 cells were taken at a density of 2×10 5 The cells were seeded at a density of 100 μL into a 24-well plate in 500 μL RPMI 1640 medium, and then 28-P1-02Fc and 28-P2-1 Fc with human Fc tags were added for co-incubation. The PBS buffer group was set as a blank control, and only 28Fc with human Fc tags and anti-PD-1 single domain antibody P1-02 / P2-1 Fc groups were added as negative controls. After 24 hours of co-incubation, the cells were removed, lysed with PIRA lysis buffer, and protein quantification was performed using a BCA quantitative kit. The effect of different binding epitopes of CI-M6PR nanoantibodies on degradation was detected by immunoblotting. The results are shown in Figure 10. This shows that the bispecific antibodies 28-P2-1 Fc and 28-P1-02Fc constructed with PD-1 nanoantibodies with different binding forces can effectively degrade PD-1, and 28-P1-02Fc exhibits more efficient degradation at the same concentration.

[0276] Example 6 Degradation Mechanism of CI-M6PR-Based Bispecific Antibodies

[0277] NFAT-Luc / Jurkat cells were cultured in RPMI 1640 medium supplemented with 10% FBS and 1% PS. Jurkat PD-1 cells were taken at 2x105 The cells were seeded at a density of 1 μg / mL into a 24-well plate in 500 μL RPMI 1640 medium. Jurkat PD-1 cells were pretreated with proteasome inhibitor MG132 (working concentration 5 μM) and lysosome inhibitor Bafilomycin (working concentration 100 nM) for 1 hour. 28-P1-02Fc was then added at a concentration of 100 nM and incubated with Jurkat PD-1 cells for 24 hours. PIRA lysis buffer was added for lysis, and protein quantification was performed using a BCA quantitative kit. The effect of different binding epitopes of CI-M6PR nanoantibodies on degradation was detected by immunoblotting. The results are shown in Figure 11. The bispecific antibody based on CI-M6PR mainly exerts its membrane protein degradation effect through the lysosomal pathway.

[0278] Example 7 Cellular analysis characterization of the effect of 28-P1-02Fc degradation of PD-1 on T cell activation

[0279] NFAT-Luc / Jurkat cells were cultured in RPMI 1640 medium supplemented with 10% FBS and 1% PS. Jurkat PD-1 cells were taken at 2x10 5 The cells were seeded at a density of 100 μL into a 24-well plate in 500 μL RPMI 1640 medium, and 100 nM 28-P1-02Fc was added for co-incubation. 28Fc and P1-02Fc were set as negative controls, and HBSS was used as a blank control. The cells were co-incubated for 24 h. 4 The cells were seeded into a white 96-well microplate in 100 μL F12 medium overnight. After the cells adhered, 8,000 PD-1NFAT-Luc / Jurkat cells treated with the above antibodies for 24 hours were added to each well. After incubation for 6 hours, luciferase assay was performed using a luciferase reporter gene assay kit (Yeasen, CAT#11401ES76). The luminescence intensity was measured using a TECAN microplate reader, and the results are shown in Figure 12. 28-P1-02Fc can effectively activate T cells by degrading PD-1, and the activation multiple is about 2.5 times, indicating the feasibility of CI-M6PR-based bispecific antibodies for tumor immunotherapy by degrading cell surface PD-1.

[0280] Example 8 Degradation of PD-1 by Fc-tagged 28-P1-02Fc antibody in mice

[0281] 2×10 6Jurkat PD-1 cells were orthotopically injected with 100 μg of 28-P1-02Fc. 28Fc and P1-02Fc served as negative controls, and the HBSS group served as a blank control. Twenty-four hours after antibody administration, Jurkat PD-1 cells were removed, and the degradation of PD-1 by 28-P1-02Fc was assessed by immunoblotting. The results are shown in Figure 13. This demonstrates that 28-P1-02Fc maintains efficient PD-1 degradation activity in this model.

[0282] Example 9: Different forms of bispecific antibodies based on CI-M6PR nanobody for CD20 degradation

[0283] 9.1 Design of Bispecific Antibodies Targeting CD20 Degradation

[0284] Using the Konbs-into-holes technique and the Fc fusion approach, the CI-M6PR-based IgG-like bispecific antibodies 28-9C07Fc and 28-Fc-9C07 were constructed, respectively, to investigate the effect of different linker lengths on the degradation of the degrader. The linker amino acid sequences are shown in SEQ ID NOs. 77-78. Schematics of the two bispecific antibody formats are shown in Figure 14.

[0285] 9.2 Flow Cytometry Characterization of the Degradation Effects of Different Bispecific Antibodies Targeting CD20

[0286] Ramos cells were cultured in RPMI 1640 medium containing 10% FBS and 1% PS. Ramos cells were taken at 2×10 5 Cells were seeded at a density of 100 μL into a 24-well plate containing 500 μL of RPMI 1640 medium. 28-9C07Fc and 28-Fc-9C07 were then added for co-incubation (working concentration: 100 nM). A PBS buffer group was set up as a blank control. After 48 hours of co-incubation, the cells were removed, washed three times with HBSS, and incubated with FITC-anti-CD20 flow cytometry antibody for 1 hour. The cells were centrifuged and washed three times with HBSS. The degradation function of the two bispecific single-domain antibodies was analyzed by flow cytometry. The results are shown in Figure 15.

[0287] Flow cytometry results showed that as the length of the linker gradually increased, the degradation effect of the bispecific antibody on CD20 also gradually increased.

[0288] 9.3 Characterization of the Degradation Effects of Different Forms of CD20-Targeting Bispecific Antibodies by Immunoblotting

[0289] Ramos cells were cultured in RPMI 1640 medium containing 10% FBS and 1% PS. Ramos cells were taken at 2×10 5 Cells were seeded at a density of 100 μg / mL into a 24-well plate containing 500 mL of fresh RPMI 1640 medium. 28-9C07Fc and 28-Fc-9C07 were then added for co-incubation (working concentration: 100 nM). A PBS buffer group was set up as a blank control. After 48 hours of co-incubation, the cells were removed and lysed with PIRA lysis buffer. Protein was quantified using a BCA quantification kit. The degradation effects of three different forms of bispecific antibodies targeting CD20 were detected by immunoblotting. The results are shown in Figure 9-3.

[0290] The results of immunoblotting were consistent with those of flow cytometry, and the degradation effect was improved with the increase of linker length.

Claims

1. A multispecific binding protein comprising a first targeting moiety and a second targeting moiety, wherein: The first targeting moiety comprises an antibody or an antigen-binding fragment thereof that can specifically bind to mannose-6-phosphate receptor (CI-M6PR), and the second targeting moiety can specifically bind to a cell surface molecule or an extracellular molecule.

2. The multispecific binding protein according to claim 1, wherein The multispecific binding protein is capable of enhancing endocytic degradation of the cell surface molecule or extracellular molecule relative to the presence of the second targeting moiety alone.

3. A multispecific binding protein according to any one of claims 1-2, wherein the first targeting portion comprises the complementarity determining region 3 (HCDR3) of the antibody heavy chain variable region, and the HCDR3 comprises an amino acid sequence selected from any one of SEQ ID NO.3, 6, 41, 18, 44, 47, 35 and 38.

4. The multispecific binding protein of claim 3, wherein the HCDR3 comprises an amino acid sequence selected from any one of SEQ ID NOs. 3, 6, 9, 12, 15, 18, 21, 24, 26, 29, 32, 35 and 38.

5. A multispecific binding protein according to any one of claims 1-4, wherein the first targeting portion comprises the complementarity determining region 2 (HCDR2) of the antibody heavy chain variable region, and the HCDR2 comprises an amino acid sequence selected from any one of SEQ ID NO.2, 5, 40, 17, 43, 46, 34 and 37.

6. The multispecific binding protein of claim 5, wherein the HCDR2 comprises an amino acid sequence selected from any one of SEQ ID NOs. 2, 5, 8, 11, 14, 17, 20, 23, 25, 28, 31, 34 and 37.

7. A multispecific binding protein according to any one of claims 1-6, wherein the first targeting portion comprises the complementarity determining region 1 (HCDR1) of the antibody heavy chain variable region, and the HCDR1 comprises an amino acid sequence selected from any one of SEQ ID NO.1, 4, 39, 16, 42, 45, 33 and 36.

8. The multispecific binding protein of claim 7, wherein the HCDR1 comprises an amino acid sequence selected from any one of SEQ ID NOs: 1, 4, 7, 10, 13, 16, 19, 22, 27, 30, 33, and 36.

9. The multispecific binding protein of any one of claims 1-8, wherein the first targeting moiety comprises HCDR1, HCDR2 and HCDR3, and the HCDR1, HCDR2 and HCDR3 comprise an amino acid sequence selected from any one of the following groups: (1) HCDR1: SEQ ID NO.16, HCDR2: SEQ ID NO.17 and HCDR3: SEQ ID NO.18; (2) HCDR1: SEQ ID NO.1, HCDR2: SEQ ID NO.2 and HCDR3: SEQ ID NO.3; (3) HCDR1: SEQ ID NO.4, HCDR2: SEQ ID NO.5 and HCDR3: SEQ ID NO.6; (4) HCDR1: SEQ ID NO.39, HCDR2: SEQ ID NO.40 and HCDR3: SEQ ID NO.41; (5) HCDR1: SEQ ID NO.42, HCDR2: SEQ ID NO.43 and HCDR3: SEQ ID NO.44; (6) HCDR1: SEQ ID NO.45, HCDR2: SEQ ID NO.46 and HCDR3: SEQ ID NO.47; (7) HCDR1: SEQ ID NO.33, HCDR2: SEQ ID NO.34 and HCDR3: SEQ ID NO.35; and, (8) HCDR1: SEQ ID NO.36, HCDR2: SEQ ID NO.37 and HCDR3: SEQ ID NO.

38.

10. The multispecific binding protein of any one of claims 1-8, wherein the first targeting moiety comprises HCDR1, HCDR2, and HCDR3, and the HCDR1, HCDR2, and HCDR3 comprise an amino acid sequence selected from any one of the following groups: (1) HCDR1: SEQ ID NO.16, HCDR2: SEQ ID NO.17 and HCDR3: SEQ ID NO.18; (2) HCDR1: SEQ ID NO.1, HCDR2: SEQ ID NO.2 and HCDR3: SEQ ID NO.3; (3) HCDR1: SEQ ID NO.4, HCDR2: SEQ ID NO.5 and HCDR3: SEQ ID NO.6; (4) HCDR1: SEQ ID NO.7, HCDR2: SEQ ID NO.8 and HCDR3: SEQ ID NO.9; (5) HCDR1: SEQ ID NO.10, HCDR2: SEQ ID NO.11 and HCDR3: SEQ ID NO.12; (6) HCDR1: SEQ ID NO.13, HCDR2: SEQ ID NO.14 and HCDR3: SEQ ID NO.15; (7) HCDR1: SEQ ID NO.19, HCDR2: SEQ ID NO.20 and HCDR3: SEQ ID NO.21; (8) HCDR1: SEQ ID NO.22, HCDR2: SEQ ID NO.23 and HCDR3: SEQ ID NO.24; (9) HCDR1: SEQ ID NO.19, HCDR2: SEQ ID NO.25 and HCDR3: SEQ ID NO.26; (10) HCDR1: SEQ ID NO.27, HCDR2: SEQ ID NO.28 and HCDR3: SEQ ID NO.29; (11) HCDR1: SEQ ID NO.30, HCDR2: SEQ ID NO.31 and HCDR3: SEQ ID NO.32; (12) HCDR1: SEQ ID NO. 33, HCDR2: SEQ ID NO. 34 and HCDR3: SEQ ID NO. 35; and (13) HCDR1: SEQ ID NO.36, HCDR2: SEQ ID NO.37 and HCDR3: SEQ ID NO.

38.

11. The multispecific binding protein of any one of claims 1-9, wherein the first targeting moiety comprises an antibody heavy chain variable region VH, and the VH comprises the amino acid sequence shown in any one of SEQ ID NOs: 48-60.

12. The multispecific binding protein of any one of claims 1-10, wherein the first targeting moiety is a VHH.

13. The multispecific binding protein of any one of claims 1-12, wherein the cell surface molecule is present on a tumor cell and / or on an immune cell.

14. The multispecific binding protein of any one of claims 1-13, wherein the cell surface molecules comprise tumor antigens, immune checkpoint molecules, inhibitory immune receptors and / or ligands of inhibitory immune receptors.

15. The multispecific binding protein of any one of claims 1-14, wherein the cell surface molecule is selected from the group consisting of PD-1, PD-L1, HER2 and CD20.

16. The multispecific binding protein of any one of claims 1-15, wherein the extracellular molecules include cytokines, growth factors, and ligands for cell surface receptors.

17. The multispecific binding protein of any one of claims 1-16, wherein the extracellular molecule is selected from the group consisting of TNF-α and EGF.

18. The multispecific binding protein of any one of claims 1-17, wherein the second targeting moiety comprises one or more selected from the group consisting of a polypeptide, a ligand, an aptamer, a nanoparticle, and a small molecule.

19. The multispecific binding protein of any one of claims 1-18, wherein the second targeting moiety comprises an antibody or an antigen-binding fragment thereof.

20. The multispecific binding protein of claim 19, wherein the second targeting moiety is a VHH.

21. The multispecific binding protein of any one of claims 1-20, wherein the first targeting moiety and the second targeting moiety are linked directly or indirectly via a covalent bond.

22. The multispecific binding protein of claim 21, wherein the indirect linkage comprises linkage through a peptide linker.

23. The multispecific binding protein of claim 22, wherein the linker is a glycine- and serine-rich peptide linker.

24. The multispecific binding protein of claim 22 or 23, wherein the linker comprises the amino acid sequence shown in any one of SEQ ID NOs: 77-78.

25. The multispecific binding protein of any one of claims 1-24, comprising, from N-terminus to C-terminus, the first targeting moiety and the second targeting moiety in sequence.

26. The multispecific binding protein of any one of claims 1-25, comprising the amino acid sequence shown in any one of SEQ ID NOs: 61 and 64.

27. The multispecific binding protein of any one of claims 1-26, further comprising an Fc domain, wherein the first targeting moiety and the second targeting moiety are connected via the Fc domain. The multispecific binding protein of claim 27 , which forms a dimer through the first subunit and the second subunit of the Fc domain.

29. The multispecific binding protein of claim 28, wherein the Fc domain comprises a modification that promotes dimerization between the first subunit and the second subunit.

30. The multispecific binding protein of any one of claims 1-29, comprising a first polypeptide chain and a second polypeptide chain.

31. The multispecific binding protein of any one of claims 28-30, wherein the first targeting moiety is located at the N-terminus or C-terminus of the first subunit, and the second targeting moiety is located at the N-terminus or C-terminus of the second subunit.

32. The multi-specific binding protein according to claim 31, wherein in the first polypeptide chain, from N-terminus to C-terminus, it comprises the first targeting moiety and the first subunit in sequence; and in the second polypeptide chain, from N-terminus to C-terminus, it comprises the second targeting moiety and the second subunit in sequence.

33. The multispecific binding protein of any one of claims 30-32, wherein the first polypeptide chain comprises the amino acid sequence shown in any one of SEQ ID NOs: 62, 63, and 65.

34. The multispecific binding protein of any one of claims 30-33, wherein the second polypeptide chain comprises the amino acid sequence shown in any one of SEQ ID NOs: 67-71.

35. The multispecific binding protein of any one of claims 28-30, wherein the first targeting moiety is located at the C-terminus of the first subunit and / or the second subunit, and the second targeting moiety is located at the N-terminus of the first subunit and / or the second subunit.

36. The multispecific binding protein of claim 35, wherein the first targeting moiety is located at the N-terminus of the first subunit and / or the second subunit, and the second targeting moiety is located at the C-terminus of the first subunit and / or the second subunit.

37. The multispecific binding protein of claim 35, comprising two or more of said first targeting moieties.

38. The multispecific binding protein of claim 35, comprising two or more of said second targeting moieties.

39. The multi-specific binding protein according to any one of claims 35-39, wherein in the first polypeptide chain, from N-terminus to C-terminus, it comprises in sequence the second targeting portion, the first subunit and the first targeting portion; and in the second polypeptide chain, from N-terminus to C-terminus, it comprises in sequence the second targeting portion, the second subunit and the first targeting portion.

40. The multi-specific binding protein according to any one of claims 35-39, wherein in the first polypeptide chain, from N-terminus to C-terminus, it comprises in sequence the first targeting portion, the first subunit and the second targeting portion; and in the second polypeptide chain, from N-terminus to C-terminus, it comprises in sequence the first targeting portion, the second subunit and the second targeting portion.

41. The multispecific binding protein of any one of claims 30-40, wherein the first polypeptide chain comprises the amino acid sequence shown in SEQ ID NO:

66.

42. The multispecific binding protein of any one of claims 30-41, wherein the second polypeptide chain comprises the amino acid sequence shown in SEQ ID NO:

66.

43. An isolated antigen binding protein that is capable of specifically binding to 6-phosphate mannose receptor (M6PR) and has one or more of the following properties: (1) capable of specifically binding to CI-M6PR with a KD value of about 300 nM or less; and (2) Ability to mediate endocytosis and / or protein degradation through the lysosomal pathway.

44. The isolated antigen-binding protein of claim 43, comprising a HCDR3 comprising an amino acid sequence selected from any one of SEQ ID NOs. 3, 6, 41, 18, 44, 47, 35 and 38.

45. The isolated antigen-binding protein of claim 44, wherein the HCDR3 comprises an amino acid sequence selected from any one of SEQ ID NOs. 3, 6, 9, 12, 15, 18, 21, 24, 26, 29, 32, 35 and 38.

46. ​​An isolated antigen-binding protein according to any one of claims 43-45, comprising a HCDR2 comprising an amino acid sequence selected from any one of SEQ ID NOs. 2, 5, 40, 17, 43, 46, 34 and 37.

47. The isolated antigen-binding protein of claim 46, wherein the HCDR2 comprises an amino acid sequence selected from any one of SEQ ID NOs. 2, 5, 8, 11, 14, 17, 20, 23, 25, 28, 31, 34 and 37.

48. An isolated antigen binding protein according to any one of claims 43-47, comprising a HCDR1 comprising an isolated amino acid sequence selected from any one of SEQ ID NOs. 1, 4, 39, 16, 42, 45, 33 and 36.

49. The isolated antigen-binding protein of claim 48, wherein the HCDR1 comprises an amino acid sequence selected from any one of SEQ ID NOs. 1, 4, 7, 10, 13, 16, 19, 22, 27, 30, 33 and 36.

50. The isolated antigen-binding protein according to any one of claims 43-49, comprising HCDR1, HCDR2 and HCDR3, wherein the HCDR1, HCDR2 and HCDR3 comprise an amino acid sequence selected from any one of the following groups: (1) HCDR1: SEQ ID NO.16, HCDR2: SEQ ID NO.17 and HCDR3: SEQ ID NO.18; (2) HCDR1: SEQ ID NO.1, HCDR2: SEQ ID NO.2 and HCDR3: SEQ ID NO.3; (3) HCDR1: SEQ ID NO.4, HCDR2: SEQ ID NO.5 and HCDR3: SEQ ID NO.6; (4) HCDR1: SEQ ID NO.39, HCDR2: SEQ ID NO.40 and HCDR3: SEQ ID NO.41; (5) HCDR1: SEQ ID NO.42, HCDR2: SEQ ID NO.43 and HCDR3: SEQ ID NO.44; (6) HCDR1: SEQ ID NO.45, HCDR2: SEQ ID NO.46 and HCDR3: SEQ ID NO.47; (7) HCDR1: SEQ ID NO. 33, HCDR2: SEQ ID NO. 34 and HCDR3: SEQ ID NO. 35; and, (8) HCDR1: SEQ ID NO.36, HCDR2: SEQ ID NO.37 and HCDR3: SEQ ID NO.

38.

51. The isolated antigen-binding protein of claim 50, wherein the HCDR1, HCDR2 and HCDR3 comprise an amino acid sequence selected from any one of the following groups: (1) HCDR1: SEQ ID NO.16, HCDR2: SEQ ID NO.17 and HCDR3: SEQ ID NO.18; (2) HCDR1: SEQ ID NO.1, HCDR2: SEQ ID NO.2 and HCDR3: SEQ ID NO.3; (3) HCDR1: SEQ ID NO.4, HCDR2: SEQ ID NO.5 and HCDR3: SEQ ID NO.6; (4) HCDR1: SEQ ID NO.7, HCDR2: SEQ ID NO.8 and HCDR3: SEQ ID NO.9; (5) HCDR1: SEQ ID NO.10, HCDR2: SEQ ID NO.11 and HCDR3: SEQ ID NO.12; (6) HCDR1: SEQ ID NO.13, HCDR2: SEQ ID NO.14 and HCDR3: SEQ ID NO.15; (7) HCDR1: SEQ ID NO.19, HCDR2: SEQ ID NO.20 and HCDR3: SEQ ID NO.21; (8) HCDR1: SEQ ID NO.22, HCDR2: SEQ ID NO.23 and HCDR3: SEQ ID NO.24; (9) HCDR1: SEQ ID NO.19, HCDR2: SEQ ID NO.25 and HCDR3: SEQ ID NO.26; (10) HCDR1: SEQ ID NO.27, HCDR2: SEQ ID NO.28 and HCDR3: SEQ ID NO.29; (11) HCDR1: SEQ ID NO.30, HCDR2: SEQ ID NO.31 and HCDR3: SEQ ID NO.32; (12) HCDR1: SEQ ID NO. 33, HCDR2: SEQ ID NO. 34 and HCDR3: SEQ ID NO. 35; and (13) HCDR1: SEQ ID NO.36, HCDR2: SEQ ID NO.37 and HCDR3: SEQ ID NO.

38.

52. The isolated antigen-binding protein according to any one of claims 43-51, comprising an antibody heavy chain variable region VH, and the VH comprises the amino acid sequence shown in any one of SEQ ID NOs: 48-60.

53. An isolated antigen binding protein according to any one of claims 43-52, which comprises an antibody or antigen binding fragment thereof.

54. The isolated antigen binding protein of any one of claims 43-53, which is a VHH.

55. A multispecific antibody comprising the isolated antigen binding protein of any one of claims 43-54.

56. A nucleic acid molecule encoding the multispecific binding protein of any one of claims 1-42, the isolated antigen binding protein of any one of claims 43-54, or the multispecific antibody of claim 55.

57. A vector comprising the nucleic acid molecule of claim 56.

58. A cell comprising the nucleic acid molecule of claim 56 or the vector of claim 57.

59. A method for preparing the multispecific binding protein of any one of claims 1-42, the isolated antigen-binding protein of any one of claims 43-54, or the multispecific antibody of claim 55, the method comprising culturing the cell of claim 58 under conditions such that the multispecific binding protein of any one of claims 1-42, the isolated antigen-binding protein of any one of claims 43-54, or the multispecific antibody of claim 55 is expressed.

60. A method for degrading a cell surface molecule or an extracellular molecule, comprising contacting the cell surface molecule or the extracellular molecule with the multispecific binding protein of any one of claims 1-42 or the isolated antigen binding protein of any one of claims 43-54.

61. A method of lysosomal delivery or tracing comprising administering the multispecific binding protein of any one of claims 1-42 or the isolated antigen binding protein of any one of claims 43-54.

62. A pharmaceutical composition comprising the multispecific binding protein of any one of claims 1-42, the isolated antigen binding protein of any one of claims 43-54, the multispecific antibody of claim 55, the nucleic acid molecule of claim 56, the vector of claim 57 and / or the cell of claim 58, and optionally a pharmaceutically acceptable carrier.

63. Use of the multispecific binding protein of any one of claims 1-42, the isolated antigen binding protein of any one of claims 43-54, the multispecific antibody of claim 55, the nucleic acid molecule of claim 56, the vector of claim 57, the cell of claim 58, and / or the pharmaceutical composition of claim 62 in the preparation of a medicament for alleviating and / or treating a disease.

64. The use according to claim 63, wherein the disease comprises cancer and / or an autoimmune disease.

Images