Biological protein inducer for controlling plant diseases

Abstract

The present invention relates to a biological inducer and inducer compositions comprising HRP proteins from phytopathogenic bacteria, particularly from Xanthomonas sp., which are capable of inducing defense gene expression against bacterial agents, inducing a state of physiological resistance in a plant, and also preventing and treating diseases in plants. The present invention also relates to methods for inducing defense gene expression against bacterial agents in a plant, inducing a state of physiological resistance in a plant, as well as preventing and treating bacterial diseases in a plant.

Description

PROTEIN BIOLOGICAL INDUCER FOR THE CONTROL OF PLANT DISEASES: Field of the invention

[0001] The present invention relates to agriculture, and more particularly to a biological inducer for controlling plant diseases. The biological inducer is also related to the identification and characterization of 23 hypersensitive response and pathogenicity proteins (HRP proteins) and pathogen-associated molecular patterns (MAMPs) of the Xanthomonas genus that are involved in activating a physiological state of resistance. Therefore, the application of this inducer protects plants of agricultural interest from bacterial diseases. Background of the invention

[0002] Plant immune responses have been described as comprising pathogen-triggered immunity (PTI) and effector-triggered immunity (ETI) (Jones & Dangl, 2006). In the first line of defense (PTI), pathogen-associated molecular patterns (MAMPs) are recognized by pattern recognition receptors (PRRs) located on the surface of plant cells (Ausbel, 2005). Activation of these receptors triggers a series of plant defense responses to stop the spread and colonization of the pathogen. One of the rapid responses is the influx of extracellular Ca2+ into the cytosol, followed by the activation of mitogen-activated protein kinases, reactive oxygen species (ROS) signaling, and other signaling molecules such as reactive nitrogen species, lipids, callose, salicylic acid, n-hydroxypipecolic acid, jasmonic acid, ethylene, and cytokinin.

[0003] The second line of defense (SLD) consists of the direct or indirect recognition of effector proteins produced by pathogens that interfere with the host's metabolism and promote its virulence. R proteins are plant proteins that recognize constituents, most of which are leucine-rich receptors with nucleotide-binding sites (LBRs). Once R proteins recognize constituent proteins, defense mechanisms are triggered that halt disease development, primarily through localized cell death, known as the hypersensitive response (HR) (Jones & Dangl, 2006).

[0004] On the other hand, the genus Xanthomonas comprises Gram-negative bacteria of the Gamma-proteobacteria class, many of which are phytopathogens of plant species, including agriculturally important species such as rice, wheat, banana, tomato, citrus, and cotton (Robin et al., 2014). In Mexico, bacterial spot frequently affects the main producing areas of chili (Capsicum annuum) and red tomato (Solanum lycopersicum) (López-Vielma et al., 2016; Jones et al., 2004). The causal agent of this disease is Xanthomonas euvesicatoha (previously classified as Xanthomonas campestris pv. vesicatoria or Xanthomonas vesicatoria). X.euvesicatoha is a vascular phytopathogen that spreads through water and air, once in the plant, the bacteria enters the leaves through stomata, hydathodes or lesions, subsequently begins its growth and multiplication within them and in the last stages of the disease, cell death, tissue necrosis and the exit of Xanthomonas to the leaf surface occur, which increases the population of the bacteria in the phyllosphere and restarts the infection cycle (Potnis et al., 2015). Specifically, during the early stages of tissue colonization and the beginning of the invasion of X. euvesicatoha in plants, a high level of expression of hypersensitive response and pathogenicity genes (hrp genes) of this bacteria has been observed (Zhang et al., 2009).

[0005] In Xanthomonas, the hrp (hypersensitive response and pathogenicity) genes encode the type III secretion system (TS3), pathogenic effectors and harpin proteins, on the other hand, the hrc (conserved hrp) genes are highly conserved among various genera of bacteria, the hrp and hrc genes are grouped in a chromosomal region that covers 20 to 30 kb called pathogenicity islands (Kim et al., 2003). The expression of hrp genes and their encoded products are key elements in the virulence of phytopathogenic Xanthomonas, specifically, SST3 is a molecular syringe that facilitates the secretion of elector proteins and toxins within the plant cells of its host, these proteins allow the modulation of the cellular functions of its host to establish the infection (Galán & Collmer, 1999).

[0006] The expression of hrp genes, and therefore, of HRP proteins, is known to be highly regulated, being induced in the bacteria during the infection processes in host plants (González et al., 2012) or in synthetic media poor in nutrients, such as the HRP protein induction medium XOM1 and XOM2 described for Xanthomonas (Tsuge et al., 2002), or in HRP protein induction media (IPH media), which are based solely on freeze-dried plant tissue from host plants as the main source of nutrients and minerals (patent application MX / a / 2020 / 013638, Valerio-Landa et al., 2020).

[0007] Patent document MX / a / 2020 / 013638 demonstrates the ability of IPH media based on Solanum lycopersicum or Capsicum annuum tissue to modify the proteome of the bacterium Xanthomonas (X. euvesicatoha); it was found that the induced proteomes show an increase in their biological activity related to HRP proteins (Valerio-Landa et al., 2021). However, the characterization and identification of the induced proteins has not been carried out; likewise, the resistance effect induced by these proteins in plants to pathogens was not analyzed; likewise, of the set of these proteins, it is not yet known whether all of them have a function assigned in bacterial physiology.

[0008] Although in document MX / a / 2020 / 013638 resistance induction bioassays were carried out with bacterial extracts obtained from a bacterium of the genus Xanthomonas sp., said bacterial extracts include a diversity of proteins that are not differentially expressed, so that resistance induction is not significantly effective at different concentration levels. This is confirmed by Figures 8 and 12 of MX / a / 2020 / 013638, where it is observed that there are no significant differences between extract concentrations, probably because the proteins responsible for induction are diluted and therefore the induction of the physiological defense state is not maximized in plants treated with these bacterial extracts.

[0009] Furthermore, patent document PCT / EP2013 / 062254 proposes the development of chimeric pattern recognition receptors (PRRs) capable of recognizing MAMPs from phytopathogens, as well as plants that express said receptors; in preferred embodiments, the receptor is REMAX or is derived from REMAX, a PRR that recognizes a Xanthomonas MAMP (eMAX). The document also describes an inducer of a defense reaction in a plant, which is obtained from a Xanthomonas cell lysate, wherein said lysate contains or is the REMAX ligand. It is highlighted that the inducer is obtained from the growth of Xanthomonas axonopodis pv. citri in a rich culture medium.

[0010] Although the objective of document PCT / EP2013 / 062254 is to improve plant resistance to bacterial pathogens and it mentions that chimeric PRRs, inducers of a defense reaction in a plant and the methods described can be used to treat plants, plant cells or plant tissues to stimulate their immune response, said document does not challenge transgenic plants to infection by phytopathogenic microorganisms. Instead, it only mentions that plant immunity is measured by oxidative burst, ethylene production and / or the expression of immune response genes or reporter genes, despite the fact that this mechanism is a general response to both abiotic and biotic stress. Furthermore, in the case of inducers, it is not detailed how they are used to stimulate the immune response, that is, no application methods or quantities used in cultivated plants in real situations (greenhouse or field) are exemplified.

[0011] Since bacterial plant diseases cause economic losses if left uncontrolled, there is a need to identify and characterize hypersensitive response proteins and pathogenicity proteins (HRP proteins) produced by plant pathogenic bacteria, as well as to develop products and methods that can improve plant resistance to plant pathogens that are easy to apply in the field, cost-effective, and scalable at the industrial level. Objects of the invention

[0012] Considering the shortcomings of the prior art, one object of the present invention is to identify, isolate, and characterize HRP proteins produced by phytopathogenic bacteria. Another object of the invention is to provide methods that improve plant resistance to bacterial infections that are easy to apply in the field, cost-effective, and scalable to industrial scale.

[0013] These and other objects are achieved by a proteinaceous biological inducer for the control of plant diseases in accordance with the present invention. Brief description of the invention

[0014] For this purpose, a first aspect of the present invention relates to a biological inducer comprising a bacterial extract of phytopathogenic bacteria of the genus Xanthomonas sp.

[0015] In one embodiment, said biological inducer comprises hypersensitive response and pathogenicity proteins (HRPs). In a preferred embodiment, the biological inducer comprises 23 HRP proteins.

[0016] In one embodiment, the bacterial extract is obtained from the bacterium Xanthomonas euvesicatoria. In a preferred embodiment, the bacteria are grown in an HRP protein induction medium (IPH medium). In a more preferred embodiment, the IPH medium comprises plant tissue. In an even more preferred embodiment, the plant tissue is selected from red tomato (Solanum lycopersicum) and chili (Capsicum annuum) tissue.

[0017] A second aspect of the present invention relates to an inducer composition comprising the biological inducer. In a preferred embodiment, the inducer composition comprises a diluent.

[0018] A third aspect of the present invention relates to a method for inducing the expression of defense genes against bacterial agents in a plant.

[0019] In one embodiment, the method is carried out by applying the biological inducer of the invention. In another embodiment, the method is carried out by applying the inducer composition of the invention.

[0020] In one embodiment, the method employs soil application or foliar application. In a preferred embodiment, the method employs foliar application.

[0021] In another embodiment, the bacterial agent against which defense genes are induced in the plant is Xanthomonas sp.

[0022] In a further embodiment, the plant in which the expression of genes against bacterial agents is induced is a plant of agricultural interest. In a preferred embodiment, the plant of agricultural interest is selected from the group consisting of rice, wheat, banana, tomato, citrus, chili, and cotton plants.

[0023] A fourth aspect of the present invention relates to a method for inducing a physiological state of resistance in a plant.

[0024] In one embodiment, the method is carried out by applying the biological inducer of the invention. In another embodiment, the method is carried out by applying the inducer composition of the invention.

[0025] In one embodiment, the method employs soil application or foliar application. In a preferred embodiment, the method employs foliar application.

[0026] In another embodiment, the physiological state of resistance is against a bacterial disease. In a preferred embodiment, the bacterial disease is bacterial spot. In an even more preferred embodiment, the bacterial disease agent is Xanthomonas sp.

[0027] In a further embodiment, the plant in which the physiological state of resistance is induced is a plant of agricultural interest. In a preferred embodiment, the plant of agricultural interest is selected from the group consisting of rice, wheat, banana, tomato, citrus, chili, and cotton plants.

[0028] A fifth aspect of the present invention relates to a method for preventing and treating a bacterial disease in a plant.

[0029] In one embodiment, the method is carried out by applying the biological inducer of the invention. In another embodiment, the method is carried out by applying the inducer composition of the invention.

[0030] In one embodiment, the method employs foliar application. In an even more preferred embodiment, application is performed on the upper and lower surfaces.

[0031] In another embodiment, the bacterial disease is bacterial spot. In an even more preferred embodiment, the bacterial disease agent is Xanthomonas sp.

[0032] In a further embodiment, the plant in which the physiological state of resistance is induced is a plant of agricultural interest. In a preferred embodiment, the plant of agricultural interest is selected from the group consisting of rice, wheat, banana, tomato, citrus, chili, and cotton plants.

[0033] In a further aspect of the present invention, methods are provided for identifying differentially expressed proteins from phytopathogenic bacteria in vitro in rich control media and IPH media. Brief description of the figures

[0034] The novel aspects considered characteristic of the present invention will be set forth with particularity in the appended claims. However, certain embodiments, features, objects, and advantages thereof will be better understood from the detailed description when read in conjunction with the accompanying drawings, in which: Figs.1 A-1B

[0035] [Figs. 1 A-1 B] Figs. 1 A and 1 B show protein profiles of X. euvesicatoha strain BV801 obtained by the 16% SDS-PAGE method. Fig. 1 A corresponds to the protein profile obtained from bacteria grown in rich control medium (NYGA), while Fig. 1 B shows the protein profile obtained from bacteria grown in IPH-AWSL inducing medium. For each gel, the first column shows the molecular weight marker from 10 to 250 kDa. The numbers indicate the concentration in (mg / mL) of proteins. The arrows indicate protein bands overexpressed in BV801 in IPH-AWSL medium. Figs. 2A-2B

[0036] [Figs.2A-2B] Figs. 2A and 2B represent a 2D protein map of X. euvesicatoha strain BV801. Fig. 2A corresponds to the 2D protein map obtained from bacteria grown in rich control medium (NYGA), while Fig. 2B shows the 2D protein map obtained from bacteria grown in IPH-AWSL inducing medium. The left column shows the molecular weight marker from 10 to 250 kDa. The linear pH of the gel is indicated by the upper numbers on the horizontal arrow. Figs. 3A-3D

[0037] [Figs.3A-3D] Figs. 3A-3D show a comparison of 2D gel images of proteins obtained from X. euvesicatoha strain BV801. Figs. 3A and 3B correspond to the 2D map of proteins obtained from bacteria grown in rich control medium (NYGA). Figs. 3C and 3D correspond to the 2D map of proteins obtained from bacteria grown in IPH-AWSL inducing medium. Figs. 3B and 3D correspond to the calibrated grayscale gels. Figs. 4A-4B [Figs.4A-4B] Figs. 4A and 4B are a comparison of 2D gel images of X. euvesicatoha strain BV801. Fig. 4A is the 2D pixel map and Fig. 4B is the 3D pixel map. In both Figs, the light shade represents the protein map obtained from bacteria grown in NYGA medium and the gray shade represents the protein map obtained from bacteria grown in IPH-AWSL medium. The numbers indicate the isolated protein spot for identification by mass spectrometry (MS). Fig. 5 [Fig. 5] Fig. 5 is a graph of the median damage of plants treated with the inducer compositions in chili plants in vitro against bacterial spot. As detailed in Fig. 5, the first 7 columns show the protective effect of the inducer compositions when challenged with the phytopathogenic bacteria after treatment; the 7 columns on the right side correspond to a negative disease control. The letters above the columns show differences between treatments according to Kruskal-Wallis. and median confidence intervals (P<0.05); bars above columns indicate standard error. Fig.6

[0038] [Fig.6] Fig. 6 shows a graph of the accumulated damage index between the treatments with the inducing compositions and with the control (water), which were challenged against the phytopathogenic bacteria. Fig.7

[0039] [Fig.7] Fig. 7 illustrates the determination of the proliferation of X. euvesicatoria (in UCF) in chili plants under in vitro conditions. The upper titer on the plates indicates the inducing treatment applied. The titers on the left show the application or not of the pathogenic bacteria. The numbers on the plates indicate the base logarithmic dilution (10x). A representative plate of each treatment is shown and three instrumental replicates for each serial dilution are shown in each of them. Fig.8

[0040] [Fig. 8] Fig. 8 corresponds to the quantitative analysis of CaBPRI gene expression in chili plants due to the application of the inducer compositions under in vitro conditions. The letters above the columns show differences between treatments according to Fisher's LSD test (p<0.05); the bars above the columns indicate the standard error. The dotted line is an extension of the mean of the calibrator treatment. Figs.9A-9B

[0041] [Figs.9A-9B] Figs. 9A and 9B show a protein profile of Xanthomonas euvesicatoria strains BV801, BV869 and BV824, from Jalisco, Michoacán and Sinaloa, Mexico respectively, as well as Xanthomonas sp. strain BV861, originally from Argentina. Fig. 9A corresponds to the protein profile obtained from bacteria grown in rich control medium (NYGA) (A) and Fig. 9B corresponds to the protein profile obtained from bacteria grown in IPH-AWSL inducing medium. For both figures, the first column shows the molecular weight marker from 10 to 250 kDa. The higher titers indicate the bacterial strain from which the protein extract was obtained. The arrows indicate Protein bands overexpressed in X. euvesicatoria strains in IPH-AWSL induction medium. Detailed description of the invention

[0042] It should be understood that the present invention is not limited to the methodologies, protocols, and reagents provided in the detailed description, as these may vary. It should also be understood that the terminology used herein is merely for the purpose of describing particular embodiments and is not intended to limit the scope of the present disclosure, which will be limited only by the appended claims. Unless otherwise defined, all technical and scientific terms used herein have the same meanings as those commonly understood by one skilled in the art.

[0043] As used herein, the term “biological inducer” refers to an exogenous molecule that activates or increases the level of resistance in a plant.

[0044] The term “physiological state of resistance” refers to a state in which the plant is able to delay or suppress the invasion of its tissues by a potential phytopathogen.

[0045] The term “phytopathogen” refers to an organism that is capable of causing a disease in a plant.

[0046] The term "defense genes" refers to genes that express proteins that protect the plant under biotic or abiotic stress conditions. The encoded proteins include pathogenesis-related proteins (PR proteins).

[0047] The term “PR proteins” refers to pathogenesis-related proteins that contribute to cell wall rigidity, signal transduction, and antimicrobial activity.

[0048] The term “hypersensitive response and pathogenicity proteins (HRP proteins)” refers to proteins produced by phytopathogens that interfere with plant metabolism and promote their virulence, these proteins include pathogenic constituents, harpin proteins and proteins related to the secretion system.

[0049] The term “overexpression” refers to the increased expression of a gene, resulting in a large amount of products, for example, RNA or proteins.

[0050] The term “bacterial leaf spot” refers to a plant disease caused by a bacterium, primarily a member of the genus Xanthomonas sp. The disease is characterized by circular, chlorotic lesions anywhere on the leaves, which progress to brown (necrotic) lesions that cause premature leaf death and drop (defoliation).

[0051] The term "plants of agricultural interest" refers to plants that are in high demand and economically important due to their use in human or livestock food, textile manufacturing, oil production, or use in any industry.

[0052] The term “soil application” refers to the direct application of substances or compositions to the base of the plant or to the soil, preferably in the hydrosphere zone.

[0053] The term “foliar application” refers to the application of substances or compositions in the form of rain (by sprinkling) to the leaves of a plant.

[0054] The term “beam” or “adaxial side” refers to the upper surface of a leaf.

[0055] The term “underside” or “abaxial side” refers to the lower surface of a leaf.

[0056] The term “priming” refers to a state in which the plant is able to detect potential damage and react to it quickly and efficiently.

[0057] It has been found that proteins from phytopathogenic bacteria differentially expressed in an IPH medium are capable of protecting plants against diseases of bacterial origin.

[0058] Thus, in one aspect of the invention, a biological inducer is claimed that comprises a bacterial extract of phytopathogenic bacteria, wherein the biological inducer is a bacterial extract that comprises proteins that are overexpressed when the bacteria are grown in IPH media; in one embodiment Preferred, the biological inducer comprises 23 HRP proteins related to the virulence and pathogenicity of the bacteria; in a more preferred embodiment, the HRP proteins have a molecular weight between 10 to 250 kDa;In a more preferred embodiment, the HRP proteins are selected from the group consisting of alpha / beta hydrolase, transcription termination / antitermination protein NusG, BON domain protein, nucleoid-associated protein XVE_3567z, GatB / YgeY domain-containing protein, DUF4845 domain-containing protein, conjugal transfer protein, 50S hbosomal protein L5, 3-oxoacid CoA transferase subunit B, response regulator with a CheY-like receptor domain and a winged helix DNA-binding domain, lipopolysaccharide export system protein LptA, plasmid conjugal transfer protein TrbL / VirB6, putative outer membrane lipoprotein, glycerophosphodiester phosphodiesterase, succinate-CoA ligase [ADP-forming] beta subunit, and uncharacterized proteins;In a more preferred embodiment, the HRP proteins have at least 80%, preferably at least 90%, more preferably at least 99% sequence identity with the sequences SEQ ID NO. 1 to SEQ ID NO. 21, preferably the proteins have the sequences of SEQ ID NO. 1 to SEQ ID NO. 21;

[0059] The biological inducer of the present invention is obtained from extracts obtained from phytopathogenic bacteria grown in an HRP protein induction medium (IPH medium). As used in the present invention, the IPH medium comprises a plant source and a gelling agent; in one embodiment, the plant source is selected from pulverized tomato tissue (Solanum lycopersicum) or chili pepper tissue (Capsicum annuum); in another embodiment, the gelling agent is agar; in a preferred embodiment, the plant tissue is present at a concentration of 0.1 to 0.2%, while the gelling agent is present at a concentration of 1.5%.

[0060] In one embodiment, the phytopathogenic bacteria belong to the genus Xanthomonas sp., such that they can be selected from the following genera: X. euvesicatoha, X. campesths, X. translucens, Xanthomonas gardneh, X. hortorum, X beticola and X. arboricola. In a further embodiment, the phytopathogenic bacteria are selected from the following pathovars Xanthomonas campestris pv. phaseoli, Xanthomonas campestris pv. campestris, Xanthomonas campestris pv. vesicatoria, Xanthomonas translucens pv. undolosa, Xanthomonas translucens pv. hordei, Xanthomonas campestris pv. holcicola, In a more preferred embodiment, the phytopathogenic bacterium is X. euvesicatoria.

[0061] In another aspect, the present invention provides inducer compositions comprising the biological inducer described above and, in a preferred embodiment, also comprising an agrochemically acceptable diluent. The agrochemically acceptable diluent can be selected from, but is not limited to, deionized water, distilled water, and a pH buffer of 6.0 to 6.6, preferably at pH 6.5. In a preferred embodiment, the biological inducer is present at a concentration of 0.1 to 10 pg / mL, preferably the biological inducer is present at a concentration of 10 pg / mL.

[0062] In one embodiment, the biological inducer or inducer composition activates resistance genes in the plants, thereby inducing their expression. In a preferred embodiment, the expression of the resistance genes is increased by at least 1.5-fold, preferably at least 2-fold, more preferably at least 2.5-fold, more preferably at least 3-fold, more preferably at least 3.5-fold, more preferably at least 4-fold, and even more preferably at least 4.5-fold compared to a plant not treated with the biological inducer or inducer composition. In a more preferred embodiment, the resistance gene is selected from the group consisting of NLR-type genes encoding nucleotide-binding leucine-rich repeat receptor proteins and “E” genes encoding executioner proteins; in this regard, a person skilled in the art would be familiar with the list of plant resistance genes.In an even more preferred embodiment, the resistance gene is CaBPRI which encodes the enzyme [3-1,3-glucanase.

[0063] In another embodiment, the biological inducer or inducer composition activates a physiological state of resistance by activating resistance genes in the plants.

[0064] In a further embodiment, the biological inducer or inducer composition protects plants against pathogens that cause disease. In In a preferred embodiment, the biological inducer or inducer composition reduces the severity of a bacterial disease by at least 60%, preferably at least 70%, more preferably by at least 80%, more preferably by at least 90%. In an even more preferred embodiment, plants treated with the biological inducer or inducer composition do not show symptoms. In a more preferred embodiment, the biological inducer or inducer composition decreases the bacterial titer in the phyllosphere of plants exposed to phytopathogens, compared to plants not treated with the biological inducer or inducer composition; the bacterial titer is decreased by at least 40%, preferably by at least 50%, more preferably by at least 60%.In a more preferred embodiment, the biological inducer or inducing composition decreases the quantitative damage variable (NHD) in plants exposed to pathogens, compared to plants not treated with the biological inducer or the inducing composition; the NHD is decreased by at least 40%, preferably by at least 50%, more preferably by at least 60%, even more preferably by at least 70%. In an even more preferred embodiment, the biological inducer or the inducing composition decreases the percentage of damaged leaves (DL) in plants exposed to pathogens, compared to plants not treated with the biological inducer or the inducing composition; the percentage ofDL is decreased by at least 40%, preferably by at least 50%, more preferably by at least 60%, even more preferably by at least 70%.

[0065] Therefore, in another aspect, the invention is directed to a method for inducing the expression of defense genes against bacterial agents in a plant, said method being carried out by treating plants with the biological inducer or the inducing composition described above. In a preferred embodiment, the treatment includes the application of the inducer or the inducing composition by methods known to those skilled in the art, including but not limited to soil application (in the zoosphere zone) and foliar application on the upper side and / or the underside of the leaf (adaxial and / or abaxial side). In a preferred embodiment, the application is foliar and in a more preferred embodiment the application is carried out on the upper side (adaxial).

[0066] In another aspect, the invention is directed to a method for inducing a physiological state of resistance in a plant, said method being carried out by treating plants with the biological inducer or inducer composition described above. In a preferred embodiment, the treatment includes the application of the inducer or inducer composition by methods known to those skilled in the art, including but not limited to soil application (directed at the rhizosphere) and foliar application to the upper and / or underside of the leaf (adaxial and / or abaxial side). In a preferred embodiment, the application is foliar, and in a more preferred embodiment, the application is carried out on the upper side of the leaf (adaxial).

[0067] In a further aspect, the invention is directed to a method for preventing and treating a bacterial disease in a plant, said method being carried out by treating plants with the biological inducer or inducer composition described above. In a preferred embodiment, the treatment includes applying the inducer or inducer composition by methods known to those skilled in the art, including but not limited to soil application (to the rhizosphere) and foliar application to the upper surface and / or underside of the leaf (adaxial and / or abaxial side). In a preferred embodiment, the application is foliar, and in a more preferred embodiment, the application is carried out on the upper surface (adaxial) side.

[0068] The plants to which the biological inducer or inducer compositions of the present invention can be administered, and thus the methods for inducing the expression of defense genes, inducing a physiological state of resistance, as well as preventing and treating a bacterial disease, can be applied, are plants of agricultural interest. In a more preferred and non-limiting embodiment, the plant of interest is selected from the group consisting of rice, wheat, banana, tomato, citrus fruit, chili, cotton, almond, cherry, and peach; in an even more preferred embodiment, the plant of interest is selected from the group consisting of rice, wheat, banana, tomato, citrus fruit, chili, and cotton. Examples

[0069] The present invention will be better understood from the following examples, which are presented solely for illustrative purposes to allow a full understanding of the preferred embodiments of the present invention, without implying that there are no other non-illustrated embodiments that can be put into practice based on the detailed description above. Example 1. Obtaining strains of phytopathogenic bacteria.

[0070] The BV801 strain of Xanthomonas euvesicatoha from the microorganism collection of the Plant Pathology Laboratory of the Center for Research and Assistance in Technology and Design (CIATE J) of the State of Jalisco, Mexico, was used, which was originally isolated from lesions associated with bacterial spot in chili crops in Jalisco, Mexico.

[0071] For this purpose, the bacteria was reactivated by culturing it in NYGA solid medium (0.5% peptone, 0.3% yeast extract, 2% glycerol, 1.5% agar, pH 7.0) at a temperature of 28 °C for 36 h. Example 2. Growth in HRP protein induction media.

[0072] The amount of microorganisms used in the growth in IPH media was standardized. For this purpose, an isolated colony of the Xanthomonas euvesicatoha strain BV801 was seeded in rich NYG medium (0.5% peptone, 0.3% yeast extract, 2% glycerol, pH 7) and incubated at 28 °C for 24 h. Bacterial cells were harvested from liquid medium by centrifugation at 8000 rpm (7012 xg) for 5 min in a microcentrifuge. The supernatant (culture medium) was removed and 3 washes were performed with sterile deionized water; the centrifugation process was repeated between washes. Subsequently, the concentration of bacteria was adjusted to an optical density (OD) of 1.0 at 600 nm (GD600=1.0), which is equivalent to approximately 1x108 CFU / mL by a spectrophotometer, 100 pL of this bacteria solution were spread on IPH-AWSL medium (Solanum lycopersicum plant tissue 0.1-0.2%, agar 1.5%) and rich control medium (NYGA).Incubation of BV801-inoculated plates was carried out at 28 °C and cell harvesting was performed after 72 h. Bacteria were harvested from solid media by scraping the bacterial mats and washing with 1X phosphate buffer (PBS) (Na2HPO4-7H2O 2.56 g / L; NaCl 8 g / L; KCl 0.2 g / L; KH2PO4 0.2 g / L) to facilitate cell collection. Example 3. Extraction of proteins from HRP.

[0073] Bacteria lysate was performed with SDS-Tris buffer (SDS 0.1%; Tris-base 100 mM; pH 9.5), 1 mL of SDS-Tris buffer was used for every 0.1 g of cells at the start of the extraction.

[0074] Lysed bacterial cells were incubated for 20 min at room temperature (25-28 °C) and subsequently centrifuged at 14,000 rpm (11,304 xg) for 30 min at 4 °C; the supernatant was recovered in SDS-Tris with soluble proteins. Next, protein precipitation was performed with pure acetone (5 mL of acetone per 1 mL of protein), incubating the sample at -80 °C for 2 h. Subsequently, the sample was centrifuged at 12,000 rpm (10,465 xg) for 20 min at 4 °C and the supernatant was removed by decantation and evaporation. Finally, the protein sample was resuspended in 0.25 mL of Laemmli sample buffer (2X) for every 0.1 g of cells used at the beginning of the extraction. Protein samples were stored at -20 °C until use (Valerio-Landa et al., 2021).

[0075] A preliminary SDS-PAGE electrophoresis of proteins from the extract of X. euvesicatoria strain BV801 obtained from control medium (NYGA) and IPH-AWSL medium was performed to observe variations in banding patterns before separation of protein components in 2D.

[0076] Referring now to Figs. 1A and 1B, these show protein profiles of the X. euvesicatoria strain BV801; a comparison of bacterial proteins harvested at 72 h and different protein concentrations is presented. As can be seen, the protein patterns of bacteria grown in control medium (NYGA) (Fig. 1A) and HRP protein-inducing medium (IPH-AWSL) (Fig. 1B) are similar. Similar bands were observed, which have a size between 10 and 250 kDa; however, due to the intensity of the bands, there is a difference in their expression. Specifically, it was identified that the proteins corresponding to the bands with a size of 10, 11, 13, 15, 19, 21, 24 and 26 kDa are overexpressed in bacteria grown in an HRP protein-inducing medium compared to a control culture medium (rich medium). The above indicates that the components of the IPH-AWSL medium are capable of inducing and / or repressing specific proteins of Xanthomonas sp.(X. euvesicatoria strain BV801). Example 4. Separation of total proteins from X. euvesicatoria.

[0077] After protein extraction, protein quantification was performed using the Bradford colorimetry assay and the BSA protein standard (Bradford, 1976). Protein isoelectric focusing (IEF) methodology was subsequently used using 125 mg of protein; for this, 200 pL of protein solution was precipitated at a concentration of 0.628 mg / mL with 5 volumes of cold acetone by incubation at -20 °C for 2 h and subsequent centrifugation for 10 min at 12,000 rpm (10,465 xg) at 4 °C. The 125 mg sample was rehydrated with 115.5 pL of rehydration solution (DeStreak™ Rehydration Solution, GE17-6003-19). To reduce disulfide bonds in the sample, 9 pL of Dithiothreitol (DTT) (1 M) was added and incubated for 10 min at room temperature (25-28 °C), then 0.9 pL of IPG ampholyte buffer pH 4-7 (IPG-Buffer, pH 4-7, GE17-6000-86) was added. Samples were applied to 7 cm pH 4-7 linear IPG strips (ReadyStñp™ IPG Strips, 1632001, Bio-Rad).The IPG strip was passively rehydrated for 16 h at 4 °C. IEF was performed on an IPGphor™ system (Ettan™ IPGphor™ 3 IEF system) using the following program: 30 min, 0 V; 30 min, 30 V; 45 min, 500 V; 45 min, 1000 V; 45 min, 2000 V; 45 min, 3000 V; 45 min, 4000 V; 45 min, 5000 V. IEF was terminated after 5000 V. Post-IEF, the IPG strips were equilibrated in equilibration buffer I and II.

[0078] The IPG strip was placed in a clean trough and 600 pL of equilibration buffer I (equilibration buffer I: 2 M Tris-base, 0.12 M SDS, 2 M Glycerol, 0.01% w / v DTT) was added, and the mixture was incubated on a rocking shaker for 15 min at room temperature (25-28 °C). The strip was then incubated for 15 min with 600 pL of equilibration buffer II (equilibration buffer II: 2 M Tris-base, 0.12 M SDS, 2 M Glycerol, 0.025% w / v iodoacetamide). After equilibration, the strips were mounted on an SDS-PAGE (sodium dodecyl sulfate polyacrylamide gel electrophoresis) gel for second-dimension electrophoresis.

[0079] The second dimension (2D) of proteins was performed by SDS-PAGE electrophoresis as described by Laemmli (1970). The packing gel was prepared with 4% acrylamide (0.5 M Tris-HCI, pH 6.8, 10% SDS w / v) and the resolving gel was prepared with 16% acrylamide (1.5 M Tris-HCI, pH 8.8, 10% SDS w / v). w / v). The IPG strip was loaded with 200 pL of Laemmli sample buffer. Electrophoresis was performed in 1X SDS-PAGE buffer (250 mM Tris, 1.92 M glycine, 1% SDS, pH 8.3). Electrophoresis conditions were 120 V for 100 min. The gel was stained with Coomassie blue R-250 (50% methanol, 10% acetic acid, 0.25% Coomassie blue R-250). Excess dye was removed with vanishing solution (45% methanol, 10% acetic acid). Visualization and imaging of resolved protein gels were performed on a photodocumenter (Bio-Rad®, Gel Doc XR System).

[0080] With respect to Figs. 2A and 2B, these show a 2D protein map of the X. euvesicatoria strain BV801 grown in control medium (NYGA) (Fig. 2A) and in HRP protein-inducing medium (IPH-AWSL) (Fig. 2B). Figs. 2A and 2B show the protein spots that were resolved in a 1D by their isoelectric point (pI) from 4.0 to 7.0 and in a 2D by molecular weight (MW) from 10 to 250 kDa. In each gel, 125 mg of total proteins were resolved for each culture condition treatment of the BV801 strain. Three replicates of each treatment were considered for the final analysis of the spots. Small and weak bands that showed little consistency between gels were discarded in the analysis. In general, basic protein spots (right half of the gels) were found in low numbers and most of the spots were located in the acidic region (left and middle half of the gels).Notable differences in protein expression were observed between treatment gels, particularly overexpression of proteins from 10 to 55 kDa at pH 4.5 to 6.5 in inducing medium (IPH-AWSL) was observed compared to the proteins of that region obtained when the bacteria were grown in control medium (NYGA). Example 5. In silico analysis of protein images of X. euvesicatoria separated by two-dimensional electrophoresis.

[0081] The 2D gel images obtained after staining were visually analyzed using the free version of the Melanie Viewer 7.0 software (https: / / 2d-gel-analysis.com / melanie-expression / ). First, protein spot detection was performed manually between control gels (proteome of strain BV801 from NYGA medium) and induction gels (proteome of strain BV801 from IPH-AWSL medium). Proteins conserved in both gels and that showed the same isoelectric point (i.e., pl) and molecular weight (MW) were selected. The software's automatic method was used to perform a grayscale calibration of the gel images to be compared. The software's automatic method was used to overlay the images and detect the relative abundance of pixels in the protein spots of each gel. Protein spots with differences between gels were visually determined by using the 3D pixel map automatically generated by the software, where the pixel abundance between the images was compared. Those protein spots that were differentially regulated were selected.

[0082] Figs. 3A-3D represent a 2D map of the proteins of the X. euvesicatoria strain BV801. The 2D protein gel images were visually analyzed in Melanie Viewer 7.0 software and it was found that the proteins overexpressed in BV801 when grown in IPH-AWSL medium (Figs. 3A and 3B) are located in the pH region of 4.5 to 7.0 and in a molecular weight of 10 to 50 kDa. A calibration of the grayscale gels was performed to superimpose the images and the 3D pixel map, which, as shown in Figs. 4A and 4B, allowed the detection of differentially expressed protein spots between gels. A total of 23 protein spots of the BV801 strain in IPH-AWSL induction medium were selected.For these spots, their isoelectric point and molecular weight were determined using the SDS-Page gel, quantified directly from the gel once the 2 dimensions were completed; and once the sequences of the 23 proteins were obtained, the molecular weight and isoelectric point were determined from the protein using software from the spectrophotometer database. The determination using the SDS-Page gel provides approximate values ​​(gel), while the in silico determination (software) provides more precise results; these results are shown in Table 1. Table 1. Comparison of isoelectric point and molecular weight of protein spots determined from the gel and in silico by the software. Example 6. Isolation of proteins obtained from the BV801 strain of X. euvesicatoria, mass spectrometry analysis and in silico analysis based on the database of the analyzed spots.

[0083] After identifying the overexpressed proteins in X. euvesicatoria strain BV801 when grown in IPH-AWSL medium, protein isolation was performed by 2D gel exclusion. Proteins were selected from Coomassie blue stained 2D gels, exclusion was performed using a sterile plastic tip, and placed in a sterile tube for protein identification by mass spectrometry (MS).

[0084] Protein identification was performed by peptide fingerprinting (PMF), whereby resolved proteins were digested and the masses of SDS-PAGE bands were detected by MALDI-TOF. In silico analysis allows the association of studied proteins with proteins contained in databases, so it will be understood that the actual sequence of the 23 proteins overexpressed in BV801 in the IPH-AWSL medium can be vahar.

[0085] The results of the in silico analysis of the blots are presented in Table 2. This table shows the 23 proteins overexpressed in BV801 in the IPH-AWSL medium and implicated in virulence and pathogenicity; their UniProt database accession number, name, and sequence are provided. Table 2. Identification of overexpressed proteins of X. euvesicatoha in inducing medium.

[0086] Spot 1 corresponds to the protein with accession number A0A6B3KFE6 and is an alpha / beta hydrolase, a protein with hydrolase activity and associated with hydrolytic enzymes of phylogenetic origin and different catalytic functions (Ollis et al., 1992). In this sense, Xanthomonas could have used these hydrolytic enzymes to take advantage of the carbon and nutrient source of the plant tissue contained in the IPH-AWSL medium.

[0087] Spot 8a corresponds to the protein with the accession A0A1 L5QYM8, which is a protein containing the DUF4845 domain, this protein is mainly found in proteobacteria and, based on distant homology analysis, it is suggested that proteins of this family are related to type IV pilin proteins. Interestingly, in Escherichia coli type IV pilin proteins play a role in virulence, pathogenicity, autoaggregation and localized adherence to epithelial cells (Blank et al., 2000). However, the prediction of the DUF4845 domain with type IV pilin is not confirmed by any experimental evidence. Spot 8b was related to the protein with the accession A0A1 L5QYX5, corresponding to the conjugal transfer protein TraM, which is related to quorum sensing. It is known that bacteria can regulate their gene expression in response to their population density in a process called “quorum sensing” (Miller & Bassler, 2001).Specifically, Gram-positive and Gram-negative bacteria utilize quorum-sensing communication circuits to regulate their physiological activities, including virulence, competition, conjugation, symbiosis, antibiotic production, motility, sporulation, and biofilm formation (Miller & Bassler, 2001 ). In particular, the quorum-sensing transcriptional activator TraR of Agrobacterium tumefaciens controls replication and conjugal transfer of the Ti virulence plasmid, whereas TraM is an antiactivator that inhibits TraR through the formation of a large and stable TraM-TraR antiactivation complex (Chen et al., 2004 ). Xanthomonas likely relies on this regulatory circuitry to control host infection or biofilm production.

[0088] Spot 9 was associated with protein accession F0BC07, which is an uncharacterized protein; furthermore, no homologous proteins were found to predict a putative biological function.

[0089] Spot 10 corresponds to the protein with accession A0A1 L5QW88, which is a 50S ribosomal protein L5, which is a structural constituent of the hbosome. Ribosomes are the particles that catalyze protein synthesis directed by mRNA in all organisms. Specifically, the hbosomal protein L5 is one of the proteins that constitute the large ribosomal subunit (Yang et al., 1991) and in Escherichia coli, L5 is known to participate in the binding of 5S RNA to the large hbosomal subunit (Hatakeyama & Hatakeyama, 1990).

[0090] Spot 11 was linked to protein accession A0A6B3KN86, which is the [3] subunit of 3-oxoacid CoA transferase. Coenzyme A (CoA) transferases belong to a family of evolutionarily conserved enzymes that catalyze the reversible transfer of CoA from one carboxylic acid to another (Corthésy-Theulaz et al., 1997). Bacterial CoAs are heterodimers of two subunits (a and [3]) of approximately 25 Kd each, whereas the active site of eucalyptus CoA is homodimeric and may have resulted from a gene fusion of the bacterial a and [3] subunit genes during evolution (Parales & Harwood, 1992). The [3] subunit contains a glutamate and is involved in the catalytic mechanism, specifically, the transfer of CoA from one substrate to another occurs by a ping-pong mechanism and involves the formation of a thioester bond between CoA and a conserved glutamate residue in the active site of the enzyme (Selmer & Buckel, 1999).

[0091] Spot number 12 was found to be related to the protein with the accession F0BJU2, a response regulator with a CheY-like receptor domain and a winged helix DNA-binding domain. The CheY domain is a member of the two-component signaling system family of bacterial regulators. In particular, two-component signal transduction systems composed of histidine kinases and their response regulator substrates allow bacteria to sense, respond to, and adapt to a wide range of environments, stresses, and growth conditions (Skerker et al., 2005). Specifically, CheY receives the signal from the partner sensor, usually a histidine protein kinase, while signal transduction involves phosphotransfer, whereby the histidine kinase phosphorylates a conserved aspartate in the response regulator and thus activates the CheY receptor. responses to environmental cues (Wolanin et al., 2003). In this sense, response regulators act as phosphorylation-activated switches to affect a cellular response, usually through transcriptional regulation. These pathways have adapted to coordinate a wide variety of stimuli, including nutrients, cellular redox state, changes in osmolarity, quorum signals, antibiotics, and more (Wolanin et al., 2002). In this sense, up-regulation of a two-component bacterial signaling system such as the CheY domain may have been involved in the ability of Xanthomonas to sense molecular elements of its host plant that were present in the AWSL medium.

[0092] Spot 13 corresponds to an uncharacterized protein (accession A0A1 L5QLC5) and for which no homologous proteins were found to predict a putative biological function.

[0093] Spot number 14 was linked to the protein with the accession A0A2S7EGG6, corresponding to the lipopolysaccharide export system protein LptA. Lipopolysaccharides (LPS) are an essential component of the outer membrane in most Gram-negative bacteria, the outer membrane is an effective permeability barrier that protects cells from toxic compounds, such as antibiotics and detergents, allowing bacteria to inhabit a number of different and often hostile environments (Sperandeo et al., 2008). LPS are molecules unique to Gram-negative bacteria and are responsible for the permeability properties of the outer membrane, furthermore, LPS consist of the lipid A moiety (a glucosamine-based phospholipid) linked to the short core oligosaccharide and the distal O antigen polysaccharide chain (Sperandeo et al., 2007). In E.coli the protein LptA has been implicated in the transport of LPS from the inner to the outer membrane, it may act as a chaperone facilitating the transfer of LPS across the aqueous environment of the pelplasm and specifically interacts with the lipid A domain of LPS (Tran et al., 2008). Xanthomonas probably depends on the overproduction of LPS to ensure its survival in an adverse environment such as the surface of a host plant during infection and that in the AWSL medium could have been simulated.

[0094] Spot 15 was linked to protein accession F0BI80, which is a conjugative transfer protein from the TrbL / VirB6 plasmid. TrbL is a protein encoded by the trb locus of the tumor-inducing (Ti) virulence plasmids of Agrobactehum, and is involved in the type IV secretion system for the conjugative transfer of plasmids (L¡ et al., 1999). Moreover, the VirB6 protein in Agrobactehum is an essential component of the type IV secretion machinery for T pilus formation and genetic transformation of plants (Liang et al., 1998). Protein secretion by the type IV secretion system is known to be a process in which bacterial proteins are transferred into the extracellular medium or directly into host cells, through the type IV protein secretion system.In this sense, the expression of virulence factors related to the type IV secretion system such as type IV pilin, could be pathogenicity mechanisms of Xanthomonas and are induced in an artificial medium related to its host plant.

[0095] Spot 16 was linked to the protein with the accession A0A6B3KKL1 , which is an ExbB biopolymer transport protein. The protein includes the MotA_ExbB domain, this family groups integral membrane proteins that are involved in the translocation of proteins through a membrane. In E. coli MotA is an essential component of the flagellar motor that uses a proton gradient to generate rotational movement in the flagellum, while ExbB is part of the TonB-dependent transduction complex, the TonB complex uses the proton gradient across the inner bacterial membrane to transport large molecules through the outer bacterial membrane (Braun et al., 1999). Although these proteins are not structural elements of the flagella, they are key proteins in their motility and functionality.Bacterial motility is key to their virulence because bacteria actively enter their host plant through stomata, hydathodes and / or lesions.

[0096] Similar to spot 10, spots 17 and 20 correspond to the protein with accession A0A1 L5QW88, which is a 50S ribosomal protein L5. Spot 18, like spot 15, is related to the protein with accession F0BI80 (conjugal transfer protein of plasmid TrbL / VirB6). Spot 19 is associated with the protein with accession A0A2S7E8F6, which, like accession Q3BWZ6 (spot 2), corresponds to a transcription termination / antitermination NusG protein. The function of the proteins, as well as their possible role in Xanthomonas virulence, has been described previously.

[0097] Spot number 21 was related to the protein with accession F0B830, which is a putative outer membrane lipoprotein. The protein contains the Glycine Zipper 2TM domain, this domain includes a possible two-transmembrane alpha-helical region containing glycine zipper motifs (Kim et al., 2005). This structural motif has been linked to a wide variety of normal and pathological processes; in bacteria of the genus Rickettsia this domain is found in several 17 kDa surface antigen proteins (Anderson et al., 1988). Xanthomonas probably uses this lipoprotein with the Glycine Zipper domain to associate with an antigen or activate an immune response in plants; however, further studies are needed to test this hypothesis.

[0098] Spot number 22 is related to the protein with the accession A0A2S7EAS5, a Glycerophosphodiester phosphodiesterase, which is involved in the lipid metabolic process. The protein contains the glycerophosphodiester phosphodiesterase (GD-PDE) domain, in bacteria this domain has diverse functional roles both for the production of metabolic sources of carbon and phosphate from glycerophosphodiesters, also, it is related to adhesion, degradation of host cell membranes and as virulence factors (Rao et al., 2006). In this sense, Xanthomonas can overproduce GD-PDE to improve its virulence against elements related to its host and that it perceived from the IPH-AWSL medium.

[0099] Spot 23 is related to the protein with the accession A0A1 L5QR05, a Succinate-CoA ligase (ADP-forming) beta subunit. Succinyl-CoA synthetase functions in the citric acid (TCA) cycle, coupling succinyl-CoA hydrolysis to ATP or GTP synthesis and therefore represents the only substrate-level phosphorylation step in TCA (Fraser et al., 1999). In E. coli the enzyme has a molecular weight of 140,000 and comprises two types of subunits assembled as an (α[32) tetramer, specifically, the subunit a (29500 MW) binds ATP and catalyzes the transfer of phosphoryl to one of its histidine residues, while subunit [3 (38500 MW) contains the binding sites for succinate and CoA (Buck et al., 1985). Example 7. Preparation of inducing compositions.

[0100] Six resistance-inducing compositions were prepared, each containing bacterial extracts of X. euvesicatoria strain BV801 grown in different culture media (compositions 1-4), as well as inducing compositions based on commercial products (compositions 5-6). The formulation of the compositions is described in Table 3. Table 3. Components of the inducing compositions. The diluent used in all cases was sterile deionized water. Example 8. In vitro physiological resistance induction assay.

[0101] For resistance induction assays, 20-day-old chili plants with two pairs of true leaves grown under in vitro conditions were used. Physiological resistance induction against bacterial spot was performed with 10 pL of each inducing composition and 10 pL of sterile water as a control. Inducing and control compositions were applied to the adaxial side of a single fully developed true leaf.

[0102] After 48 h of application of the inducing and control compositions, a challenge with phytopathogenic bacteria was carried out, for which 10 µL of a cell suspension of the Xanthomonas euvesicatoha strain BV801 (1 x 108 CFU / mL) was inoculated onto a true leaf different from the one treated with the resistance inducer; sterile distilled water was used as a negative infection control. The plants were maintained in a growth room under 10 / 14 h light / dark conditions at a temperature of 25-28 °C for 20 days until the end of the bioassay.

[0103] The severity of bacterial spot infection in chili plants in vitro was determined 20 days after challenge (ddr) with the phytopathogenic bacterium X. euvesicatoha, using a damage scale based on the percentage of damaged tissue: 0 = healthy plant; 1 = 20%; 2 = 40%; 3 = 60%; 4 = 80%; 5 > 90% or dead plant. The number of damaged leaves (NHD) was determined as the amount of leaves that showed symptoms associated with bacterial spot, leaf damage was characterized by the presence of watery pustules with blackened halos, deformed necrotic spots, leaves with a high degree of necrosis and partial or total detachment from the plant. The percentage of damaged leaves (HD percentage) was calculated using the following formula: loo where: HD (%) is the percentage of damaged leaves; NHD is the number of leaves with damage; NHT is the total number of leaves.

[0104] The bacterial concentration quantified in colony forming units (CFU) of X. euvesicatoha per g of fresh tissue was determined at the end of the bioassay (20 ddr). The aerial tissue of the plant was collected in sterile 1.5 mL microtubes and in a laminar flow hood. The tissue was macerated with the aid of a polypropylene micropistil in 500 pL of sterile distilled water and brought to a vortex mixer for 1 min. Decimal serial dilutions (10-n) were made up to the order of 10-6. 10 pL drops of each dilution were added in triplicate onto NYGA solid medium plates and allowed to dry under a flow hood. CFU counting was performed after 36 h of incubation at 28 °C.

[0105] Fourteen treatments were evaluated using a completely randomized, two-factor design with 15 replicates per treatment. The bacteria factor consisted of two levels: plants with and without bacteria. The inducer factor consisted of seven levels: six inducer compositions (SP-AWSL, SP-AWCA, SP-NYGA, SP-M9, Actigard®, and Messenger Gold®) and a control composition of sterile distilled water. A simple ANOVA was used to analyze treatments. The severity scale was analyzed using the nonparametric Kruskal-Wallis technique with median confidence intervals (p<0.05). The tissue damage and bacterial proliferation variables were analyzed with a Tukey test and confidence intervals between means (p<0.05). Data were analyzed using Statgraphics Centurion ver. XV. II (http: / / www.statgraphics.com / ).

[0106] As can be seen in Fig. 5, which shows a graph of the median of the comparison of damage in plants treated with inducing compositions and challenged with pathogenic bacteria and those not challenged with the bacteria, a significant effect in reducing the severity of bacterial spot in vitro (95% confidence interval of the median) was found in chili plants pretreated with physiological resistance inducing compositions. In particular, plants pretreated with inducer compositions SP-AWSL, SP-AWCA, SP-NYGA and SP-M9, as well as commercial inducer compositions (Actigard® and M. Gold®) showed activation of physiological resistance state (EFR) and protection against bacterial spot, this can be seen in Fig.6, which is a graph of the accumulated damage index between inducer compositions resulting in statistical reductions of up to 67% in disease severity, in relation to plants in the water control treatment (without inducer) and that were challenged with the pathogenic bacteria (diseased plants).

[0107] On the other hand, chili plants that were not challenged with the phytopathogenic bacteria but were treated with the inducing compositions and control plants without inducer, did not show symptoms associated with the bacterial spot. However, as shown in Fig. 6, differences were observed in the cumulative damage index of plants challenged with the phytopathogenic agent (X. euvesicatoña) that causes bacterial spot between treatments with the inducer compositions. The Actigard® and Messenger Gold® treatments showed less protection against bacterial spot, leading to an increase in the number of individuals with a higher level of damage. In contrast, the inducer compositions SP-AWSL and SP-AWCA were the treatments that reduced the level of bacterial spot damage in chili plants and showed greater effectiveness than compositions based on commercial inducers Actigard® and Messenger Gold®.

[0108] In relation to the quantitative variables of damage (NHD, percentage HD and bacterial concentration in CFU / g fresh tissue) statistical differences were found through an analysis of factors and treatments, which is detailed in Table 4. Among the levels of the bacteria factor, it was observed that chili plants challenged with the phytopathogenic bacteria maintained the highest statistical mean of NHD (1.9), percentage HD (26.8%) and bacterial proliferation in tissue expressed in Log CFU (4.2), this in relation to chili plants that were not challenged with the bacteria and that did not show symptoms associated with bacterial spot.Among the levels of the inducing factor, it was observed that chili plants pretreated with the inducing compositions SP-AWSL, SP-AWCA, SP-NYGA, BV801-M9, Messenger Gold® and Actigard® reduced the quantitative variables of damage with respect to control plants without inducer (water), causing a decrease in NHD (66, 51, 51, 46, 41 and 46%, respectively) and the HD percentage (66, 54, 52, 47, 49 and 47%, respectively). In addition, treatments with the inducing compositions improved the response of plants to bacterial infection and reduced the bacterial concentration of X. euvesicatoña in chili plant tissue (53, 55, 58, 58, 50 and 42%, respectively). Table 4. Quantitative damage variables Concentration Bacterial Factor Number Percentage Sample Size (n) Damaged leaves CFU / g of tissue] X. euvesicatoria (Xe) With Xe 35 1.9±0.1 to 26.8±2.2 to 4.2±0.5 to Without Xe 35 0.0±0.0 b 0.0±0.0 b 0.0±0.0 b Inductor Water (control) 10 1.7±0.5 to 24.4±7.6 to 4.0±1.3 a AWSL 10 0.6±0.2 b 8.3±2.8 b 1.9±0.9 b AWCA 10 0.8±0.3 b 11.2±3.6 b 1.8±0.9 b 10 DAYS 0.8±0.3 b 11.8±4.2 b 1.7±0.8 b M9 10 0.9±0.3 b 13.0±4.5 b 1.7±0.7 b Messenger Gold® 10 1.0±0.3 b 12.3±5.8 b 2.0±ll b Actigard® 10 0.9±0.3 b 12.9±4.6 b 2.3±0.9 b Treatments Water 3.4±0.2 to 48.9±5.1 to 8.0±0.4 a (sick) AWSL 5 1.2±0.2 b 16.7±4.0 b 3.8±1.9 b AWCA 5 1.7±0.2 b 22.3±2.4 b 3.6±1.5 b With X YEAR 5 1.7±0.3 b 23.5±2.9 b 3.4±1.1 b euvesicatory M9 5 1.8±0.3 b 25.9±4.9 b 3.3±1.0 b Messenger 2.0±0.4 b 30.6±4.6 b 4.0±1.9 b Gold® Actigard® 5 1.8±0.4 b 25.7±7.4 b 4.6±1.2 b Water (healthy) 5 0.0±0.0 c 0.0±0.0 c 0.0±0.0 c AWSL 5 0.0±0.0 c 0.0±0.0 c 0.0±0.0 c AWCA 5 0.0±0.0 c 0.0±0.0 c 0.0±0.0 c Without Messenger 0.0±0.0 c 0.0±0.0 c 0.0±0.0 c Gold® Actigard® 5 0.0±0.0 c 0.0±0.0 c 0.0±0.0 c

[0109] In summary, the inducer compositions comprising the biological inducers of X. euvesicatoha (strain BV801) conferred a physiological state of resistance (EFR) to Capsicum annuum against bacterial spot showing disease severity reduction levels of up to 67% and reduction of quantitative variables of damage with respect to diseased control plants. Likewise, in relation to Fig. 7, which represents the determination of the proliferation of X. euvesicatoña (in UCF) in chili plants under in vitro conditions, the induced EFR improved the physiological response of plants to bacterial spot infection and significantly reduced the bacterial concentration or titer by up to 4 logarithms in relation to control plants (diseased plants without inducer treatment). Furthermore, the inducer compositions SP-AWSL and SP-AWCA displayed the best protection in plants against bacterial spot and maintained a higher efficiency than inducer compositions based on commercial inducers such as Messenger Gold® and Actigard®, by maintaining the lowest number of diseased individuals or a lower degree of severity. Example 9. Quantification of the expression of genes involved in plant cellular defense.

[0110] For gene expression assays, aerial tissue was collected from plants at the end of the bioassay (20 days after transplant). Samples were wrapped in aluminum foil and stored in liquid nitrogen for transport to the laboratory, where they were stored in an ultra-freezer at -80 °C until processing. Total RNA was extracted from 250 mg of tissue using the TRIzol® Reagent method (Thermo Fisher Scientific), following the instructions in the manufacturer's data sheet (Thermo-Fisher-Scientific, 2020). To eliminate genomic DNA residue, RNA purification was performed by treatment with the enzyme DNase I (Thermo Fisher Scientific), following the specifications in the manufacturer's data sheet (Thermo-Fisher-Scientific, 2016a). RNA integrity was visually assessed on 2% agar electrophoresis gels, using 1% commercial chlorine as a denaturing agent, based on the methodology described by Aranda et al. (2012).Total RNA concentration in ng / pL was determined by spectrophotometry at a 260 / 230 nanometer (nm) ratio using a NanoDrop (ThermoScientific) system. Approximately 1000 ng of total RNA was used as a template for cDNA synthesis using the SuperScript® III reverse transcyptase enzyme (Thermo Fisher Scientific) according to the specifications in the manufacturer's data sheet (Thermo-Fisher). Scientific, 2016b). The synthesized cDNA was separated and stored at -20 °C until use.

[0111] Gene expression quantification of CaBPRI, which encodes an enzyme [3-1,3-glucanase, which has lysozyme activity capable of hydrolyzing peptidoglycans, was performed in chili plants by the effect of the application of compositions that induce the physiological state of resistance. The primers used for this quantification were: forward (CAGGATGCAACACTCTGGTGG) and reverse (ATCAAAGGCCGGTTGGTC) that amplify a fragment of a size of 310 bp (Choi et al., 2008).

[0112] For quantitative gene expression assays by real-time PCR (RT-qPCR), the Maxima SYBR Green / ROX qPCR Master Mix reagent [2X] was used, based on the manufacturer's technical data sheet (ThermoScientific, 2011). Each RT-qPCR reaction contained Maxima SYBR Green / ROX qPCR Master Mix [1 X]; forward primer [1 pM]; reverse primer [1 pM]; cDNA template [50 ng]. The final reaction volume was adjusted to 10 pL with ultrapure milli-Q® H2O. The amplification conditions were one cycle at 95 °C for 10 min for enzyme activation, followed by 40 cycles at 95 °C for 15 s for denaturation and 60 °C for 45 s for annealing and extension. The dissociation curve was generated by cycling from 60 to 95°C in 0.5°C increments every 5 s. All of this was done in a StepOne™ Real-Time PCR System (Thermo Scientific).

[0113] For each primer pair evaluated, a calibration curve was performed by RT-qPCR, for which serial dilutions based on 10 (100, 10-1 , 10-2, 10-3, 10-4, 10-5) of the cDNA template were made according to Bustin et al. (2009). The amplification efficiency was determined from the slope of the Logarithmic-linear portion of the calibration curve, this when the logarithm of the initial concentration of the template (independent variable) was plotted on the X axis and the Ct (dependent variable) was plotted on the Y axis. The calculation was performed based on the following formula: % PCR efficiency = 10^ slope) x oo

[0114] The theoretical maximum amplification efficiency is 1.0, indicating that the amount of reaction product doubles with each cycle. For this work, the efficiency range was set between 0.95 and 1.05 as the lower and upper limits. The 2-AACt method (Livack & Schmittgen, 2001) was used to analyze the normalized expression of the target genes. The following formula was used: Where: AACt = (Ct, objetivo - Ct, endogenous) calibrador ~ Ct 'target~ Ct 'endogenous ) tratamien to Where: Cq is the quantization cycle; Ct is the cycle threshold.

[0115] The results are expressed as the change in the relative expression level of mRNA of the target gene (CaBPRI) of each treatment in relation to the control treatment (diseased plants without treatment with inducing composition).

[0116] Quantitative gene expression variables were analyzed using an LSD test with confidence intervals between means (p<0.05). Data were analyzed using Statgraphics Centurion version XV. II (http: / / www.statgraphics.com / ).

[0117] A quantitative analysis of the CaBPRI gene involved in cellular defense was performed by the quantitative PCR technique (RT-qPCR). The relative fold change of the target gene was calculated by calibrating the data with the control water treatment and inoculated with the pathogenic bacteria (basal expression level = 1 ). As illustrated in Fig. 8, plants challenged against the causal agent of bacterial spot (X. euvesicatoria) and pretreated with the inducer compositions SP-AWSL, SP-AWCA, SP-NYGA, SP-M9, Messenger Gold® and Actigard® significantly increased the relative mRNA levels of the CaBPRI gene (2.9, 3.7, 2.4, 2.1 , 2.2 and 1.4 times, respectively) compared to diseased control plants (used as a basal expression control = 1 ) (Fig. 8). On the other hand, plants treated with the inducer composition Actigard®, but not challenged with the bacteria, maintained an increase of up to 2.4 times of the CaBPRI gene in relation to diseased control plants, this transcriptional upregulation remained latent until the end of the bioassay (20 ddr). Plants that were not challenged against the phytopathogenic bacteria and that were treated with the different inducer compositions and healthy control plants, did not show a significant relative change in the transcripts of the CaBPRI gene with respect to the diseased control.The latter demonstrates that the use of biological inducers of Xanthomonas and commercial harpin proteins in chili plants in vitro, confer the priming state for improved defense against pathogens and only until the challenge with the phytopathogenic bacteria, is that the transcriptional accumulation of PR genes is induced, on the other hand, treatments with Actigard® constitutively induce the accumulation of PR proteins in chili plants even without the presence of the causal agent of bacterial spot (X. euvesicatoha).

[0118] In summary, gene expression analysis (quantitative, RT-qPCR) showed that physiological resistance-inducing compositions (SP-AWSL or SP-AWCA) applied to chili plants in vitro provide protection against bacterial spot infection through the transcriptional accumulation of PR genes related to antimicrobial proteins. It was also demonstrated that the activation of physiological resistance in plants involves the salicylic acid (SA) signaling cascade for resistance in the different inducer compositions evaluated; however, only Actigard® constitutively activates the SA signaling pathway, as well as the defense gene products (PR proteins) associated with this pathway. On the other hand, compositions comprising biological inducers of X.euvesicatoha (strain BV801) (SP-AWSL, SP-AWCA, SP-NYGA, SP-M9) and commercial harpins (Messenger Gold®), activate the priming or preconditioning state for enhanced defense against pathogens and it seems that the AS signal participates in the activation of said resistance state; however, the AS signal is much lower than that obtained by exogenous applications of Actigard® and does not involve the constitutive expression of defense-related genes. Example 10. Production of biological inducers by different strains of X. euvesicatoria.

[0119] In order to show that different strains of X. euvesicatoha from different geographical origins produce the same differential proteins in the induction culture medium (AWSL), an experiment was carried out with the following strains: strain BV801 from Jalisco, Mexico; strain BV869 from Michoacán, Mexico, and BV824 from Sinaloa, Mexico; while strain BV861 of Xanthomonas sp. from Argentina shows a very different protein pattern both in rich medium and in induction medium. The culture, extraction, and migration conditions of the protein extracts were carried out as indicated in examples 1 and 2. Fig. 9B shows that the three strains of X. euvesiactoria from different geographical areas produce the same differential proteins when grown in the IPH-AWSL induction culture medium. This result indicates that these induced proteins can be expressed by any strain of X. euvesiactoria regardless of its geographical origin.

[0120] In accordance with the foregoing, it will be appreciated that the biological inducer for controlling plant diseases, the inducer composition, and the methods described of the present invention have been designed to improve the resistance of plants to bacterial infections, induce a physiological state of resistance in a plant, as well as prevent and treat a bacterial disease in a plant and it will be evident to any person skilled in the art that the embodiments of the biological inducer for controlling plant diseases, the inducer composition, and the methods described above and illustrated in the accompanying drawings are only illustrative but not limiting of the present invention, since numerous significant changes in its details are possible without departing from the scope of the invention. For example, it is possible to use different species of phytopathogenic Xanthomonas or strains of X. euvesicatoha.The invention is also applicable to various agricultural plants affected by bacterial infections, such as rice, wheat, banana, tomato, citrus, chili, and cotton plants.

[0121] Therefore, the present invention should not be considered as restricted except as required by the prior art and by the scope of the appended claims.

Claims

CLAIMS Having described the present invention as above, it is considered as novelty and, therefore, the content of the following claims is claimed as property:

1. A biological inducer, characterized in that it comprises a bacterial extract of phytopathogenic bacteria of the genus Xanthomonas sp.

2. The biological inducer according to claim 1, further characterized in that it comprises hypersensitive response and pathogenicity proteins (HRP).

3. The biological inducer according to claim 1, further characterized in that it comprises 23 HRP proteins.

4. The biological inducer according to claim 1, further characterized in that the HRP proteins have at least 80% sequence identity with the sequences SEQ ID NO: 1 to SEQ ID NO.

21.

5. The biological inducer according to claim 4, further characterized in that the HRP proteins have at least 90% sequence identity with the sequences SEQ ID NO: 1 to SEQ ID NO.

21.

6. The biological inducer according to claim 5, further characterized in that the HRP proteins have at least 99% sequence identity with the sequences SEQ ID NO: 1 to SEQ ID NO.

21.

7. The biological inducer according to claim 1, further characterized in that the HRP proteins have the sequence of SEQ ID NO: 1 to SEQ ID NO.

21.

8. The biological inducer according to claim 1, further characterized in that the bacteria is Xanthomonas euvesicato a.

9. The biological inducer according to claim 1, further characterized in that the bacterial extract is obtained by growing the phytopathogenic bacteria in an HRP protein induction medium (IPH medium).

10. An inducer composition, characterized in that it comprises the biological inducer according to any one of claims 1 to 9.

11. The inducing composition according to claim 10, further characterized in that it comprises an agrochemically acceptable diluent.

12. The inducing composition according to claim 11, further characterized in that the agrochemically acceptable diluent is sterile deionized water.

13. The inducer composition according to claim 10, further characterized in that the biological inducer is in a concentration of 0.01 to 10 pg / mL.

14. The inducer composition according to claim 13, further characterized in that the biological inducer is at a concentration of 10 pg / mL.

15. A method for inducing the expression of defense genes against bacterial agents in a plant, characterized in that it comprises applying the biological inducer according to any of claims 1 to 9 or the inducing composition according to any of claims 10 to 14 in the plant.

16. The method according to claim 15, further characterized in that the defense gene against bacterial agents is the CaBPRI gene.

17. The method according to claim 15, further characterized in that the application is selected from soil application and foliar application.

18. The method according to claim 17, further characterized in that the application is foliar.

19. The method according to claim 17, further characterized in that the foliar application is performed on the adaxial side.

20. The method according to claim 15, further characterized in that the bacterial agent is Xanthomonas sp.

21. The method according to claim 15, further characterized in that the plant is a plant of agricultural interest.

22. The method according to claim 21, further characterized in that the plant is selected from the group consisting of rice, wheat, banana, tomato, citrus, chili and cotton plants.

23. A method for inducing a physiological state of resistance in a plant, characterized in that it comprises applying the biological inducer according to any one of claims 1 to 9 or the inducing composition according to any one of claims 10 to 14 to the plant.

24. The method according to claim 23, further characterized in that the application is selected from soil application and foliar application.

25. The method according to claim 24, further characterized in that the application is foliar.

26. The method according to claim 25, further characterized in that the foliar application is performed on the adaxial side.

27. ​​The method according to claim 23, further characterized in that the physiological state of resistance is against a bacterial disease.

28. The method according to claim 27, further characterized in that the bacterial disease is bacterial spot.

29. The method according to claim 28, further characterized in that the causal agent of the bacterial spot is Xanthomonas sp.

30. The method according to claim 23, further characterized in that the plant is a plant of agricultural interest.

31. The method according to claim 30, further characterized in that the plant is selected from the group consisting of rice, wheat, banana, tomato, citrus, chili and cotton plants.

32. A method for preventing and treating a bacterial disease in a plant, characterized in that it comprises applying the biological inducer according to any one of claims 1 to 9 or the inducer composition according to any one of claims 10 to 14 to the plant.

33. The method according to claim 32, further characterized in that the application is selected from soil application and foliar application.

34. The method according to claim 33, further characterized in that the application is foliar.

35. The method according to claim 34, further characterized in that the foliar application is carried out on the adaxial side.

36. The method according to claim 32, further characterized in that the bacterial disease is bacterial spot.

37. The method according to claim 36, further characterized in that the causal agent of the bacterial spot is Xanthomonas sp.

38. The method according to claim 32, further characterized in that the plant is a plant of agricultural interest.

39. The method according to claim 38, further characterized in that the plant is selected from the group consisting of rice, wheat, banana, tomato, citrus, chili and cotton plants, i.e.

Images