Computer-implemented method for providing alignment information about oligonucleotide sequence for target nucleic acid sequence

Abstract

The present invention relates to a computer-implemented method for providing alignment information about oligonucleotides for a target nucleic acid sequence. The present invention can provide a semi-global alignment of oligonucleotides for a target nucleic acid sequence by utilizing dynamic programming. The present invention can provide alignment information for the entire length of oligonucleotides with greater speed and accuracy using less computer resources than existing methods, and can provide oligonucleotide coverage for a plurality of target nucleic acid sequences.

Description

Computer-implemented method for providing alignment information of an oligonucleotide sequence with respect to a target nucleic acid sequence

[0001] Cross-reference to related applications

[0002] This patent application claims priority to Republic of Korea Patent Application No. 2023-0096963, filed with the Korean Intellectual Property Office on July 25, 2023, the disclosures of which are incorporated herein by reference.

[0003] Technology field

[0004] The present invention relates to a computer-implemented method for providing alignment information of an oligonucleotide sequence to a target nucleic acid sequence.

[0005] Polymerase chain reaction (PCR), a nucleic acid amplification method, involves repeated cycles of denaturation of double-stranded DNA, annealing of oligonucleotide primers to a DNA template, and extension of the primers by DNA polymerase (Mullis et al., U.S. Pat. Nos. 4,683,195, 4,683,202, and 4,800,159; Saiki et al., (1985) Science 230, 1350-1354).

[0006] PCR-based technologies are widely used in scientific applications or methods in biological and medical research as well as for amplification of target DNA sequences, such as reverse transcriptase PCR (RT-PCR), differential display PCR (DD-PCR), cloning of known or unknown genes by PCR, rapid amplification of cDNA ends (RACE), arbitrary priming PCR (AP-PCR), multiplex PCR, SNP genomic typing, and PCR-based genomic analysis (McPherson and Moller, 2000). PCR. BIOS Scientific Publishers, Springer-Verlag New York Berlin Heidelberg, NY).

[0007] In order to provide an oligonucleotide capable of amplifying and detecting multiple nucleic acid sequences of a specific target nucleic acid molecule with maximum coverage, first, an oligonucleotide having the performance to amplify and / or detect multiple nucleic acid sequences of a specific target nucleic acid molecule with maximum coverage must be designed, and a specificity and sensitivity test of the oligonucleotide must be performed to test the performance of the oligonucleotide.

[0008] Before these performance tests, it was necessary to confirm the specificity of the designed oligonucleotide set, or after passing the performance test and commercializing the product, if new nucleic acid sequences for a specific target nucleic acid molecule are sequenced or new nucleic acid sequences are registered in a database, it was necessary to additionally confirm the specificity of the commercialized oligonucleotide set.

[0009] The most commonly used programs to confirm the specificity of oligonucleotides include the BLAST (Basic Local Alignment Search Tool) and Primer-BLAST algorithms available at NCBI (National Center for Biotechnology Information).

[0010] In particular, in the case of BLAST (blast.ncbi.nlm.nih.gov / Blast.cgi) (Altschul et al., J. Mol. Biol. 215:403-10(1990)) as a local alignment, the nucleic acid sequence or oligonucleotide sequence to be analyzed is input as a query sequence, a nucleotide database containing nucleic acid sequences for which similar sequences are to be found is selected, and then nucleotide BLAST is executed. This shows sequence information (Accession No., etc.) containing sequences similar to the oligonucleotide sequence input as a query sequence, taxonomy, and alignment information of nucleic acid sequences hit as sequences similar to the oligonucleotide sequence.

[0011] In addition, BLAST finds a complete match (seed match) between the oligonucleotide and the aligned nucleic acid sequence by considering the word size, identity, and E-value entered in the parameters, and shows the match or mismatch pattern result between the oligonucleotide and the aligned nucleic acid sequence by extending to both sides of the complete match.

[0012] However, BLAST checks for mismatches through seed matches and extensions between oligonucleotides and aligned nucleic acid sequences, and due to the nature of local alignment, it shows match or mismatch pattern results for some nucleotides, not the entire oligonucleotide, so there was a problem that it was impossible to know the mismatch pattern results for the entire length of the oligonucleotide with respect to the nucleic acid sequence, or an additional program had to be developed to know this.

[0013] In order to solve these problems, the applicant developed a technology for evaluating the specificity of oligonucleotides (WO 2017 / 209575), and in order to confirm the match or mismatch pattern result of some nucleotide part of an oligonucleotide for which a match or mismatch pattern result was not confirmed through BLAST, all multiple nucleic acid sequences for which coverage is to be confirmed are loaded into a computer memory or disk, a nucleic acid sequence previously confirmed through BLAST is found, a nucleotide part showing a match or mismatch pattern result confirmed through BLAST between the nucleic acid sequence and the aligned oligonucleotide is found, and then a part of the nucleotide part of the oligonucleotide for which a match or mismatch pattern result was not confirmed through BLAST is restored (repaired) to show a match or mismatch pattern result for the entire length of the oligonucleotide.

[0014] The conventional method for evaluating the specificity of an oligonucleotide, which uses this repair method to show a match or mismatch pattern result up to a portion of the nucleotide of an oligonucleotide that has not been confirmed through BLAST, has a problem in that it takes a long time to show a match or mismatch pattern result for the entire length of the oligonucleotide even when the data capacity of multiple nucleic acid sequences included in the nucleotide database, which is the subject of the coverage, is appropriate.

[0015] Additionally, with the recent global outbreak of SARS-CoV-2, over 13 million genomic sequences have been registered with GISAID. Assuming a single SARS-CoV-2 sequence is 30,000 bp long, the data volume of the SARS-CoV-2 sequences listed above exceeds 300 Gb.

[0016] When a program including the above repair method is used to check the coverage of an oligonucleotide designed to detect SARS-CoV-2 for SARS-CoV-2 sequences having a data capacity of 300 Gb or more, there is a problem that when the SARS-CoV-2 sequence is loaded into memory, the data capacity is too large to show the match or mismatch pattern result for the entire length of the oligonucleotide due to a memory failure, or when the SARS-CoV-2 sequence is loaded into a disk, the data capacity is too large to show the match or mismatch pattern result for the entire length of the oligonucleotide.

[0017] Accordingly, the inventors of the present invention recognized the need for developing a technology that efficiently utilizes computer resources and provides alignment information of oligonucleotides for target nucleic acid sequences in order to evaluate the specificity of oligonucleotides or provide coverage, and to provide alignment information more quickly.

[0018] Numerous references and patents are cited and cited throughout this specification. The disclosures of these references and patents are incorporated herein by reference in their entirety to further clarify the state of the art and the scope of the present invention.

[0019] The present inventors have endeavored to develop a method for efficiently utilizing computer resources and increasing the speed of providing alignment information for oligonucleotides relative to a target nucleic acid sequence. As a result, the present invention has developed a technology capable of providing semi-global alignment of oligonucleotides relative to a target nucleic acid sequence by applying dynamic programming. As a result, the present invention has been completed by confirming that, compared to conventional methods, alignment information for the entire length of oligonucleotides can be provided more accurately and quickly with fewer computer resources.

[0020] Accordingly, an object of the present invention is to provide a computer-implemented method for providing alignment information of oligonucleotides with respect to a target nucleic acid sequence.

[0021] Another object of the present invention is to provide a computer-readable recording medium including instructions for implementing a processor for executing a method for providing alignment information of an oligonucleotide for a target nucleic acid sequence.

[0022] Other objects and advantages of the present invention will become more apparent from the following examples, claims and drawings.

[0023] I. Method for providing alignment information without considering gap (first aspect)

[0024] According to one aspect of the present invention, there is provided a computer-implemented method for providing alignment information of an oligonucleotide for a target nucleic acid sequence, the method comprising the steps of: (a) providing a target nucleic acid sequence comprising m nucleotides and an oligonucleotide sequence comprising n nucleotides; wherein the target nucleic acid sequence is provided as an m × 1 matrix including m nucleotides as matrix elements, and the oligonucleotide sequence is provided as a 1 × n matrix including n nucleotides as matrix elements, and wherein the nucleotides are expressed with 4 bits for each type of base; (b) performing a matrix operation on the oligonucleotide sequence for the target nucleic acid sequence to obtain a match value or a mismatch value between nucleotides of the target nucleic acid sequence and the oligonucleotide sequence; The above matrix operation is a multiplication of the m × 1 matrix and the 1 × n matrix and an AND operation of 4 bits of nucleotides which are components of the m × 1 matrix and 4 bits of nucleotides which are components of the 1 × n matrix, and if the matrix operation value is the same as 4 bits of any one of the nucleotides which performed the matrix operation, it indicates that the nucleotides which performed the matrix operation match, and the match value is a value expressing the match as a predetermined match score, and if the matrix operation value is different from 4 bits of all of the nucleotides which performed the matrix operation, it indicates that the nucleotides which performed the matrix operation mismatch, and the mismatch value is a value expressing the mismatch as a predetermined mismatch score, and (c) a trace operation of an n × n square matrix is ​​performed on the m × n matrix which performed the matrix operation to obtain the match values ​​of the diagonal elements of the n × n square matrix and / or the mismatch of the Step of finding the sum of values;And (d) providing alignment information of nucleotides of a target nucleic acid sequence in a row component corresponding to a diagonal component of an n × n square matrix having a sum satisfying a predetermined threshold value, and nucleotides of an oligonucleotide sequence in a column component, when the sum satisfies a predetermined threshold value for match or mismatch; wherein the alignment information includes information selected from the group consisting of matches and / or mismatches between nucleotides of the target nucleic acid sequence and the oligonucleotide sequence, an alignment pattern including match and / or mismatch information, the number of mismatches, and a position of the oligonucleotide sequence in the aligned target nucleic acid sequence.

[0025] The present inventors have endeavored to develop a method for efficiently utilizing computer resources and increasing the speed of providing alignment information for oligonucleotides relative to a target nucleic acid sequence. As a result, the present invention has developed a technology capable of providing semi-global alignment of oligonucleotides relative to a target nucleic acid sequence by applying dynamic programming. As a result, it has been confirmed that, compared to conventional methods, alignment information for the entire length of oligonucleotides can be provided more accurately and quickly with fewer computer resources.

[0026] The method of the first aspect of the present invention relates to a technique for providing alignment information of oligonucleotides for a target nucleic acid sequence without considering gaps.

[0027] When aligning a target nucleic acid sequence and an oligonucleotide sequence, a gap is formed in the target nucleic acid sequence and / or the oligonucleotide sequence to display an alignment result showing a predetermined degree of similarity. However, when an oligonucleotide hybridizes to a target nucleic acid sequence present in a nucleic acid sample, a gap is not formed. Therefore, considering that the oligonucleotide will hybridize to the actual target nucleic acid sequence, there is a need to provide alignment information without a gap between the target nucleic acid sequence and the oligonucleotide sequence. Therefore, the method of the first aspect of the present invention aims to provide alignment information that does not consider a gap.

[0028] As used herein, “alignment information that does not consider gaps” means alignment information without gaps.

[0029] "Dynamic programming," as used herein, is a technique in optimization theory and an algorithm design technique that efficiently derives values ​​within a specific range by utilizing values ​​within a different range. In other words, dynamic programming is a general term for algorithms that consider a problem as an extension of a smaller problem and leverage previously derived solutions to solve it.

[0030] Figure 1 is a flowchart of processes for implementing the method of the present invention according to one embodiment of the present invention. The method of the present invention is described with reference to Figure 1 as follows:

[0031] Step (a): Providing a target nucleic acid sequence and an oligonucleotide sequence (110)

[0032] First, the method of the present invention comprises the step of (a) providing a target nucleic acid sequence comprising m nucleotides and an oligonucleotide sequence comprising n nucleotides. The target nucleic acid sequence is provided as an m × 1 matrix including m nucleotides as matrix elements, and the oligonucleotide sequence is provided as a 1 × n matrix including n nucleotides as matrix elements, and the nucleotides are expressed in 4 bits for each type of base.

[0033] The method of the present invention is a method implemented on a computer, wherein the provision of the target nucleic acid sequence and the oligonucleotide sequence is performed by inputting information on the target nucleic acid sequence and the oligonucleotide sequence into a user interface (UI).

[0034] Although the present specification expresses that m nucleotides of a target nucleic acid sequence are provided as an m × 1 matrix and n nucleotides of an oligonucleotide sequence are provided as a 1 × n matrix, it is clearly understood by those skilled in the art that the method of the present invention described below can be performed by changing the expression to provide m nucleotides of a target nucleic acid sequence as a 1 × m matrix and n nucleotides of an oligonucleotide sequence as an n × 1 matrix. In addition, it is clearly understood by those skilled in the art that the method of the present invention performed by providing m nucleotides of a target nucleic acid sequence as a 1 × m matrix and n nucleotides of an oligonucleotide sequence as an n × 1 matrix is ​​also included in the scope of the present invention.

[0035] That is, it can be clearly understood by those skilled in the art that the method of the present invention is performed by providing m nucleotides of the target nucleic acid sequence as an m × 1 matrix and n nucleotides of the oligonucleotide sequence as a 1 × n matrix, and that the method of the present invention is performed by providing m nucleotides of the target nucleic acid sequence as a 1 × m matrix and n nucleotides of the oligonucleotide sequence as an n × 1 matrix, and that this is within the equivalent scope.

[0036] If the order of the rows and columns of the target nucleic acid sequence and the oligonucleotide sequence are changed, the order is also changed and performed in the process described below.

[0037] As used herein, the term "target nucleic acid sequence" or "target sequence" refers to a specific nucleic acid sequence comprising a specific target nucleic acid molecule of a specific organism for which an oligonucleotide is to be amplified and / or detected. As used herein, the term "target nucleic acid sequence" or "target sequence" refers to a specific nucleic acid sequence comprising a specific target nucleic acid molecule of a specific organism for which an oligonucleotide alignment information is to be confirmed.

[0038] The term "organism" as used herein means an organism belonging to a genus, species, subspecies, subtype, genotype, sirotype, strain, isolate or cultivar. Organisms include, for example, prokaryotic cells (such as Mycoplasma pneumoniae, Chlamydophila pneumoniae, Legionella pneumophila, Haemophilus influenzae, Streptococcus pneumoniae, Bordetella pertussis, Bordetella parapertussis, Neisseria meningitidis, Listeria monocytogenes, Streptococcus agalactiae, Campylobacter, Clostridium difficile, Clostridium perfringens, Salmonella, Escherichia coli, Shigella, Vibrio, Yersinia enterocolitica, Aeromonas, Chlamydia trachomatis, Neisseria gonorrhoeae, Trichomonas vaginalis, Mycoplasma hominis, Mycoplasma genitalium, Ureaplasma urealyticum, Ureaplasma parvum, Mycobacterium tuberculosis), eukaryotic cells (e.g. Protozoa and parasites, fungi, yeasts, higher plants, lower animals, and higher animals including mammals and humans), viruses, or viroids. Examples of parasites among the above eukaryotic cells include Giardia lamblia, Entamoeba histolytica, Cryptosporidium, Blastocystis hominis, Dientamoeba fragilis, and Cyclospora cayetanensis.Examples of the above viruses include influenza A virus (Flu A), influenza B virus (Flu B), respiratory syncytial virus A (RSV A), respiratory syncytial virus B (RSV B), parainfluenza virus 1 (PIV 1), parainfluenza virus 2 (PIV 2), parainfluenza virus 3 (PIV 3), parainfluenza virus 4 (PIV 4), metapneumovirus (MPV), human enterovirus (HEV), human bocavirus (HBoV), human rhinovirus (HRV), coronaviruses (e.g., CoV NL63, CoV 229E, CoV OC43, CoV HKU1, SARS-CoV, MERS-CoV, SARS-CoV-2) and adenoviruses that cause respiratory diseases, and more specifically, SARS-CoV-2. Including. In addition, examples of the virus include norovirus, rotavirus, adenovirus, astrovirus, and sapovirus that cause gastrointestinal diseases. In addition, examples of the virus include human papillomavirus (HPV), Middle East respiratory syndrome-related coronavirus (MERS-CoV), dengue virus, herpes simplex virus (HSV), human herpes virus (HHV), Epstein-Barr virus (EMV), varicella zoster virus (VZV), cytomegalovirus (CMV), HIV, hepatitis virus, and poliovirus.

[0039] As used herein, the terms "target nucleic acid molecule," "target molecule," or "target nucleic acid" refer to a nucleotide molecule within an organism to be detected. Target nucleic acid molecules are generally given a specific name and include the entire genome and all nucleotide molecules that make up the genome (e.g., genes, pseudogenes, non-coding sequence molecules, untranslated regions, and portions of the genome). Target nucleic acid molecules include, for example, nucleic acids within an organism.

[0040] In this specification, the length of a sequence can be expressed using nucleotides, bases, bp or mer, and the length of a sequence can also be expressed through the number of nucleotides.

[0041] The length of the target nucleic acid sequence can vary and is therefore difficult to specify, but for example, if the target nucleic acid sequence is a SARS-CoV-2 sequence and is 30,000 bp long, the target nucleic acid sequence provided in this step can be expressed as containing 30,000 nucleotides.

[0042] According to one embodiment of the present invention, m is a natural number. m may vary depending on the length of the target nucleic acid sequence. Specifically, m may be selected from 10 to 50,000. In addition, m is at least 30, at least 50, at least 100, at least 200, at least 300, at least 400, at least 500, at least 600, at least 700, at least 800, at least 900, or at least 1000.

[0043] As used herein, "oligonucleotide" refers to a short polynucleotide whose alignment information (or coverage) is to be confirmed. The oligonucleotide or oligonucleotide sequence may be referred to as a "query" or "query or query sequence."

[0044] The term "oligonucleotide" as used herein refers to a linear oligomer of natural or modified monomers or linkages, comprising deoxyribonucleotides and ribonucleotides, capable of specifically hybridizing to a target nucleic acid sequence, and which may be naturally occurring or artificially synthesized. The oligonucleotide is particularly single-stranded for maximum efficiency in hybridization. Specifically, the oligonucleotide is an oligodeoxyribonucleotide. The oligonucleotide used in the present invention may include naturally occurring dNMPs (i.e., dAMP, dGMP, dCMP, and dTMP), nucleotide analogs, or derivatives. The oligonucleotide may also include ribonucleotides. For example, the oligonucleotide used in the present invention may include a backbone modified nucleotide, such as a peptide nucleic acid (PNA) (M. Egholm et al., Nature, 365:566-568 (1993)), Locked Nucleic Acid (LNA) (WO1999 / 014226), Bridged Nucleic Acid (BNA) (WO2005 / 021570), phosphorothioate DNA, phosphorodithioate DNA, phosphoroamidate DNA, amide-linked DNA, MMI-linked DNA, 2'-O-methyl RNA, alpha-DNA and methylphosphonate DNA, sugar-modified nucleotides such as 2'-O-methyl RNA, 2'-fluoro RNA, 2'-amino RNA, 2'-O-alkyl DNA, 2'-O-allyl DNA, 2'-O-alkynyl DNA, hexose DNA, pyranosyl RNA and anhydrohexitol DNA, and nucleotides having base modifications such as C-5 Substituted pyrimidines (substituents include fluoro-, bromo-, chloro-, iodo-, methyl-, ethyl-, vinyl-, formyl-, ethynyl-, propynyl-, alkynyl-, thiazolyl-, imidazolyl-, and pyridyl-), 7-deazapurines having a C-7 substituent (substituents include fluoro-, bromo-, chloro-, iodo-, methyl-, ethyl-, vinyl-, formyl-, alkynyl-, alkenyl-, thiazolyl-, imidazolyl-, and pyridyl-), inosine, and diaminopurines. In particular, the term "oligonucleotide" as used herein is a single strand composed of deoxyribonucleotides. The term "oligonucleotide" includes oligonucleotides that hybridize with cleavage fragments that occur in a sequence-dependent manner relative to the target nucleic acid.

[0045] According to one embodiment of the present invention, the oligonucleotide is a primer or a probe.

[0046] The term "primer" as used herein refers to an oligonucleotide that can act as an initiator of synthesis under conditions that induce the synthesis of a primer extension product complementary to a nucleic acid strand (template), i.e., the presence of nucleotides and a polymerization agent such as DNA polymerase, and conditions of suitable temperature and pH. The primer must be sufficiently long to prime the synthesis of the extension product in the presence of the polymerization agent. The appropriate length of the primer is determined by several factors, including, for example, temperature, the application, and the source of the primer.

[0047] The term "probe" as used herein refers to a single-stranded nucleic acid molecule comprising a portion or portions complementary to a target nucleic acid sequence. The probe may also include a label capable of generating a signal for target detection.

[0048] The length of the oligonucleotide used in the present invention is, for example, 10-60 nucleotides, 10-50 nucleotides, 10-45 nucleotides, 10-40 nucleotides, 10-35 nucleotides, 15-60 nucleotides, 15-50 nucleotides, 15-45 nucleotides, 15-40 nucleotides, 15-35 nucleotides, 20-60 nucleotides, 20-50 nucleotides, 20-45 nucleotides, 20-40 nucleotides or 20-35 nucleotides.

[0049] If the length of the oligonucleotide is 60 nucleotides, it can be expressed that the oligonucleotide contains 60 nucleotides.

[0050] According to one embodiment of the present invention, n is a natural number. Specifically, n may be selected from 10 to 60.

[0051] According to one embodiment of the present invention, m has a number greater than n.

[0052] The terms "annealing" or "priming" as used herein refer to the juxtaposition of oligodeoxynucleotides or nucleic acids to a template nucleic acid, which causes a polymerase to polymerize the nucleotides to form a nucleic acid molecule complementary to the template nucleic acid or a portion thereof. The term "hybridization" as used herein refers to the formation of a double-stranded nucleic acid from a complementary single-stranded nucleic acid. The terms "annealing" and "hybridization" are not different and are used interchangeably herein.

[0053] The oligonucleotide may have a conventional primer and probe structure composed of a sequence that hybridizes to a target nucleic acid sequence. Alternatively, the structure of the oligonucleotide may be modified to have a unique structure. For example, the oligonucleotide may have a structure of a scorpion primer, a molecular beacon probe, a sunrise primer, a hybeacon probe, a tagging probe, a DPO primer or probe (WO 2006 / 095981), and a PTO probe (see WO 2012 / 096523).

[0054] The oligonucleotide may be a modified oligonucleotide, such as a degenerate base-containing oligonucleotide and / or a universal base-containing oligonucleotide, in which a degenerate base and / or a universal base are introduced into a conventional primer or probe. The terms "conventional primer," "conventional probe," and "conventional oligonucleotide" as used herein refer to typical primers, probes, and oligonucleotides in which no degenerate base or unnatural base is introduced. According to one embodiment of the present invention, the degenerate base-containing oligonucleotide or the universal base-containing oligonucleotide is at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 95% unmodified oligonucleotide. According to one embodiment of the present invention, the range of the number of degenerate bases or universal bases introduced into the conventional oligonucleotide is specifically 7 or less, 5 or less, 4 or less, 3 or less, or 2 or less. Or, the usage ratio of the degenerate bases and / or universal bases introduced into the conventional oligonucleotide is specifically 25% or less, 20% or less, 18% or less, 16% or less, 14% or less, 12% or less, 10% or less, 8% or less, or 6% or less. The usage ratio of the degenerate bases or universal bases represents the ratio of the degenerate bases or universal bases among the total nucleotides of the oligonucleotide into which the degenerate bases or universal bases are introduced.

[0055] The degenerate bases include various degenerate bases known in the art: R: A or G; Y: C or T; S: G or C; W: A or T; K: G or T; M: A or C; B: C, G, or T; D: A, G, or T; H: A, C, or T; V: A, C, or G; N: A, C, G, or T.

[0056] The above universal bases include various universal bases known in the art: deoxyinosine, inosine, 7-diaza-2'-deoxyinosine, 2-aza-2'-deoxyinosine, 2'-OMe inosine, 2'-F inosine, deoxy 3-nitropyrrole, 3-nitropyrrole, 2'-OMe 3-nitropyrrole, 2'-F 3-nitropyrrole, 1-(2'-deoxy-beta-D-ribofuranosyl)-3-nitropyrrole, deoxy 5-nitropyrrole, 5-nitroindole, 2'-OMe 5-nitroindole, 2'-F 5-nitroindole, deoxy 4-nitrobenzimidazole, 4-nitrobenzimidazole, deoxy 4-aminobenzimidazole, 4-Aminobenzimidazole, Deoxynebularine, 2'-F nebularine, 2'-F 4-nitrobenzimidazole, PNA-5-introindole, PNA-nebularine, PNA-inosine, PNA-4-nitrobenzimidazole, PNA-3-nitropyrrole, Morpholino-5-nitroindole, Morpholino-nebularine, Morpholino-inosine, Morpholino-4-nitrobenzimidazole, Morpholino-3-nitropyrrole, Phosphoramidate-5-nitroindole, Phosphoramidate-nebularine, Phosphoramidate-inosine, Phosphoramidate-4-nitrobenzimidazole, Phosphoramidate-3-nitropyrrole, 2'-0-methoxyethylinosine, 2'-0-methoxyethyl Nebularine, 2'-0-methoxyethyl 5-nitroindole, 2'-0-methoxyethyl 4-nitro-benzimidazole, 2'-0-methoxyethyl 3-nitropyrrole, and combinations of the above bases. More specifically, the universal base is deoxyinosine, inosine, or a combination thereof.

[0057] According to one embodiment of the present invention, the oligonucleotide is an oligonucleotide represented by the following formula (I):

[0058] 5'-XYZ-3' (I)

[0059] In the above formula, X represents a site including a hybridization nucleotide sequence that hybridizes to a target nucleic acid sequence, Y represents a cleavage site including two or more consecutive bases that do not participate in Watson-Crick base pairing, and Z represents a site including a hybridization nucleotide sequence that hybridizes to a target nucleic acid sequence.

[0060] The oligonucleotide of formula (I) has three different sites with distinct properties, and its annealing specificity for a target nucleic acid sequence is doubly determined by its two separate sites, site X and site Z.

[0061] In general, the annealing specificity of a conventional (typical) primer or probe is governed by its entire sequence. In contrast, the annealing specificity of the oligonucleotide of formula (I) is doubly determined by two sites, namely site X and site Z, separated by site Y.

[0062] In the oligonucleotide of formula (I), region Y comprises two or more consecutive bases, each of which does not participate in Watson-Crick base pairing.

[0063] In this specification, Watson-Crick base pairing means that adenine (A) binds to thymine (T) or uracil (U), while guanine (G) binds to cytosine (C).

[0064] Therefore, a base that does not participate in Watson-Crick base pairing refers to any base that does not form a Watson-Crick base pair with a base on the opposite side of the target nucleic acid sequence. In particular, a base that does not participate in Watson-Crick base pairing includes any base that exhibits lower strength (lower melting temperature) of base pairing between the base and the base on the opposite side of the target nucleic acid sequence than the strength of base pairing between natural bases.

[0065] In one embodiment, site Y is designed to have the lowest Tm value among the three sites when the oligonucleotide anneals to the target nucleic acid sequence.

[0066] These bases, which do not participate in Watson-Crick base pairing, generate a bubble structure during annealing (hybridization) or amplification, particularly under conditions where sites X and / or Y specifically anneal (hybridize) to the target nucleic acid sequence, thereby dividing site X and site Z, thereby enhancing the annealing specificity of the primer or probe for the target nucleic acid sequence.

[0067] Examples of bases that do not participate in Watson-Crick base pairing include: (i) unnatural bases; (ii) universal bases; and (iii) mismatched bases. In one embodiment, the bases included in the cleavage site Y are selected from unnatural bases; universal bases; mismatched bases, and combinations thereof.

[0068] The term "unnatural base" as used herein refers to derivatives of natural bases, such as adenine (A), guanine (G), thymine (T), cytosine (C), and uracil (U), which can form hydrogen-bonding base pairs with each other (see U.S. Patent No. 8,440,406).

[0069] The unnatural base included in the oligonucleotide of formula (I) does not participate in Watson-Crick base pairing when the opposite base in the target nucleic acid sequence is a natural base. Base pairing between the unnatural base and the opposite base in the target nucleic acid sequence has a lower strength (lower melting temperature) than base pairing between natural bases. Therefore, this base pairing forms a bubble structure and serves to separate sites X and Z.

[0070] Specific examples of unnatural bases include the following base pair combinations: iso-C / iso-G, iso-dC / iso-dG, K / X, H / J, and M / N (see U.S. Pat. Nos. 7,422,850 and 8,440,406).

[0071] The term "universal base" as used herein means a base that can form base pairs with each of the natural DNA / RNA bases without distinction, and said base pairs do not participate in Watson-Crick base pairing.

[0072] Base pairing between the universal base included in the oligonucleotide of formula (I) and the opposite base included in the target nucleic acid sequence has a lower strength (lower melting temperature) than base pairing between natural bases. Examples of the universal base are as described above.

[0073] The term "mismatched base" as used herein refers to a base that cannot form a hydrogen bond base pair with an opposite base within a target nucleic acid sequence (see WO 2013 / 123552 and WO 2014 / 124290). The mismatched base may vary depending on the type of opposite base within the target nucleic acid.

[0074] Since the mismatched base contained in the oligonucleotide of formula (I) cannot form a base pair with the opposite base contained in the target nucleic acid, the site Y containing the mismatched base creates a bubble structure and serves to separate sites X and Z.

[0075] Site Y may have two consecutive bases that do not participate in Watson-Crick base pairing, preferably three, four, five, six, seven, or more consecutive bases that do not participate in Watson-Crick base pairing.

[0076] In the oligonucleotide of formula (I), sites X and Z are each sites having a hybridizing nucleotide for the target nucleic acid sequence, i.e., sites having a hybridizing nucleotide sequence complementary to a position on the template nucleic acid to which each is hybridized.

[0077] The term "complementary" is used herein to mean sufficiently complementary to selectively hybridize to a target nucleic acid sequence under specified annealing conditions or stringent conditions, and includes the terms "substantially complementary" and "fully complementary," preferably fully complementary.

[0078] The lengths of regions X and Z may each range from 3 to 50 nucleotide residues.

[0079] In one embodiment, region X is longer than region Z. Specifically, the length of region X is 15 to 50, 15 to 40, 15 to 30, or 15 to 25 nucleotide residues.

[0080] The length of the Z region is 3 to 15, 3 to 12 or 3 to 10 nucleotide residues.

[0081] In another embodiment, region Z is longer than region X. Specifically, region Z is 15 to 50, 15 to 40, 15 to 30, or 15 to 25 nucleotide residues in length. Region X is 3 to 15, 3 to 12, or 3 to 10 nucleotide residues in length.

[0082] In one embodiment, the Tm of each of regions X and Z is in the range of 6°C to 80°C, 6°C to 70°C, 6°C to 50°C, 6°C to 40°C, 10°C to 80°C, 10°C to 70°C, 10°C to 60°C, 10°C to 50°C, 10°C to 40°C, 20°C to 80°C, 20°C to 70°C, 20°C to 60°C, 20°C to 50°C, 20°C to 40°C, 30°C to 80°C, 30°C to 70°C, 30°C to 60°C, 30°C to 50°C, or 30°C to 40°C. In one embodiment, the Tm of region Y is 1°C to 15°C, 1°C to 20°C, 1°C to 5°C, 2°C to 15°C, 2°C to 10°C, 2°C to 5°C, 3°C to 15°C, 3°C to 10°C, or 3°C to 5°C. In one embodiment, the Tm of region Y is lower than the Tm of each of regions X and Z.

[0083] In one embodiment, the Tm of region X is higher than the Tm of region Z. In a particular embodiment, the Tm of region X is 5°C, 10°C, 15°C, 20°C, or 25°C higher than the Tm of region Z. In another embodiment, the Tm of region Z is higher than the Tm of region X. In a particular embodiment, the Tm of region Z is 5°C, 10°C, 15°C, 20°C, or 25°C higher than the Tm of region Z.

[0084] In the oligonucleotide of formula (I), either or both of the X and Z moieties may include at least one universal base or degenerate base.

[0085] In one embodiment, when either or both of site X and site Z in the oligonucleotide of formula (I) comprise two or more universal bases, the universal bases are not present contiguously in the oligonucleotide sequence, but are present separately. When site Y also comprises two or more contiguous universal bases, the two or more universal bases contained in either or both of site X and site Z are distinguished from the two or more contiguous universal bases in site Y in that they are present separately in the sequence.

[0086] The term "degenerate base" as used herein means that any of the four bases (A, C, G, or T) or a specific subset of the four bases (two or three bases) can be present at a given nucleotide position. The term also refers to the possibility of more than one base at a given position. An oligo sequence can be synthesized to have multiple bases at the same position, which is often referred to as a degenerate base, also called a "wobble" position or a "mixed base." Examples of degenerate bases are as described above.

[0087] According to a specific embodiment of the present invention, the oligonucleotide represented by formula (I) is a dual-specific oligonucleotide (referred to as DSO or DPO) as disclosed in WO 2006 / 095981. For details regarding the dual-specific oligonucleotide, please refer to the above document.

[0088] According to another specific embodiment of the present invention, the oligonucleotide represented by formula (I) is a target-differentiating (TD) probe as disclosed in WO 2011 / 028041. For details regarding the target-differentiating probe, please refer to the above document.

[0089] The oligonucleotide of formula (I) provided in this step may be a pre-existing oligonucleotide (primer or probe).

[0090] Alternatively, the oligonucleotide of formula (I) provided in this step may be an oligonucleotide designed based on a target nucleic acid sequence to be amplified or detected.

[0091] The oligonucleotide of formula (I) is designed such that its X and Y moieties have sequences that can substantially hybridize to a target nucleic acid sequence. To this end, the X and Y moieties within the oligonucleotide of formula (I) are designed to match (have substantial sequence similarity to) a specific region of the target nucleic acid sequence.

[0092] According to one embodiment of the present invention, the oligonucleotide is a universal base primer (UBP). Specifically, the UBP has 1-3 universal base nucleotides; one or two of the universal base nucleotides are located in a core region ranging from the 3rd nucleotide to the 6th nucleotide at the 3'-end of the UBP, and the remainder are located in a range from the 4th nucleotide at the 5'-end of the UBP to the 7th nucleotide at the 3'-end of the UBP, wherein the universal base nucleotides are discontinuous in the UBP.

[0093] As used herein, the term "universal base primer" refers to a primer in which at least one nucleotide in the primer contains a universal base instead of a naturally occurring base (A, C, G, or T(U)). The UBP acts as an inhibitor of primer dimer formation. In particular, a primer containing deoxyinosine or inosine among the universal bases is referred to as an inosine primer (IPm).

[0094] The term "core region" as used herein refers to the optimal position range for positioning one or two universal base nucleotides within a UBP to achieve inhibition of primer dimer formation, particularly double-stranded extendible primer dimer formation. In other words, the core region refers to a specific region within a UBP where one or two universal base nucleotides are positioned to exert their maximum effect.

[0095] For details regarding the above universal base primer, please refer to the disclosure in WO 2006 / 095981.

[0096] The oligonucleotide used in the present invention may be an oligonucleotide designed or designed to amplify and detect multiple nucleic acid sequences of a specific target nucleic acid molecule of a specific organism and whose performance has been verified.

[0097] Oligonucleotides can be designed manually or by design programs widely known in the art. Examples of conventional primer / probe design programs include Primer3 (http: / frodo.wi.mit.edu / ), Visual OMP TM Software (DNA Software, Inc., Ann Arbor, Mich.), Integrated DNA Technology (IDT) OligoAnalyzer 3.0 program (http: / scitools.idtdna.com / Analvzer / oligocalc.asp), DINAmelt TM Program (http: / dinamelt.bioinfo.rpi.edu / ), OLIGO 7 (Wojciech Rychlik (2007). "OLIGO 7 Primer Analysis Software". Methods MoI. Biol. 402: 35-60), Primer Express 3.0 software (Applied Biosystems USA), etc., are examples but are not limited thereto.

[0098] The oligonucleotide comprises a probe designed to satisfy at least one of the following conditions: (i) a Tm value of 50-85°C, (ii) a length of 15-50 nucleotides, (iii) a mononucleotide (G). n Excluding run sequences; (iv) the 5'-terminus is G or C, (v) the GC content of the 5'-terminus is greater than or equal to 40%.

[0099] Among the above design conditions, the Tm value is, for example, 50-80°C, 50-75°C, 55-80°C, 55-75°C, 60-80°C, 60-75°C, 65-80°C, or 60-75°C. Specifically, the Tm value among the design conditions is 55-80°C, 60-78°C, 63-78°C, 65-75°C, 67-75°C, or 65-73°C.

[0100] Among the above design conditions, the length is, for example, 10-60 nucleotides, 10-50 nucleotides, 10-45 nucleotides, 10-40 nucleotides, 10-35 nucleotides, 15-60 nucleotides, 15-50 nucleotides, 15-45 nucleotides, 15-40 nucleotides, 15-35 nucleotides, 20-60 nucleotides, 20-50 nucleotides, 20-45 nucleotides, 20-40 nucleotides or 20-35 nucleotides.

[0101] Among the above design conditions, for example, a mononucleotide (G) in which n is at least 3 or 4 n Run sequence is excluded.

[0102] The GC content of the 5'-terminal portion of the probe is 40% or more, specifically 40-70% or 40-60%. The 5'-terminal portion refers to a portion within 10 nucleotides from the 5'-terminal portion of the probe.

[0103] The oligonucleotide comprises a tagging probe designed to satisfy at least one of the following conditions: (i) a Tm value of the targeting region of 50-85°C, (ii) a length of the targeting region of 15-50 nucleotides, (iii) at least three G-run sequences are excluded from the targeting region, (iv) the 5'-end of the targeting region is G or C, (v) the GC content of the 5'-end of the targeting region is at least 40%, (vi) a tagging region length of 6-30 nucleotides, (vii) a mismatch sequence of at least 30% for the tagging region length, and (viii) a mismatch sequence of at least 40% for the 3'-end of the tagging region.

[0104] Among the design conditions for the targeting portion of the tagging probe, the Tm value, length, exclusion of G-run sequences, G or C at the 5'-terminal, and GC content at the 5'-terminal portion can be described with reference to the description of the general probe.

[0105] The length of the above tagging portion is specifically 6-20 nucleotides, 10-30 nucleotides, 10-20 nucleotides, 12-30 nucleotides or 12-20 nucleotides.

[0106] The tagging portion must be sufficiently non-complementary to a specific region of the nucleic acid sequence to which the tagging probe hybridizes, so that it does not hybridize to the specific region under conditions in which the targeting portion of the tagging probe hybridizes. Specifically, the tagging portion comprises a mismatched sequence of at least 40%, and more specifically, at least 50%, of its length. Specifically, the 3'-terminal portion of the tagging portion comprises a mismatched sequence of at least 50% of its length.

[0107] The oligonucleotide comprises a primer designed to satisfy at least one of the following conditions: (i) a Tm value of 40-70°C, (ii) a length of 15-60 nucleotides, and (iii) a mononucleotide (G). n Excluding run sequences; where n is at least 3.

[0108] Among the above design conditions, the Tm value is, for example, 40-70°C, 50-70°C, 55-70°C, 45-65°C, 50-65°C, 55-65°C, 45-60°C or 50-65°C. Specifically, the Tm value among the design conditions is 40-70°C, 45-65°C, 50-65°C, 50-60°C, 55-65°C or 55-60°C.

[0109] Among the above design conditions, the length is, for example, 15-60 nucleotides, 15-50 nucleotides, 15-45 nucleotides, 15-40 nucleotides, 15-35 nucleotides, 15-30 nucleotides, 15-25 nucleotides, 18-45 nucleotides, 18-40 nucleotides, 18-35 nucleotides, 18-30 nucleotides or 18-25 nucleotides.

[0110] Mononucleotide (G) among the above design conditions n The criteria for a run sequence are, for example, mononucleotides (G) where n is at least 3 or 4. n Run sequence is excluded.

[0111] If the above primer is a DPO primer developed by the applicant of the present invention (see U.S. Patent No. 8,092,997), the description of the Tm and length of the DPO primer disclosed in the above patent document may be presented as the design conditions.

[0112] In order to perform an operation to provide alignment information, in this step, the target nucleic acid sequence is provided as an m × 1 matrix including m nucleotides as matrix elements, and the oligonucleotide sequence is provided as a 1 × n matrix including n nucleotides as matrix elements.

[0113] Figure 2 shows a process of performing a matrix operation of an oligonucleotide sequence for a target nucleic acid sequence in an operation table to obtain a match value or mismatch value between nucleotides of the target nucleic acid sequence and the oligonucleotide sequence.

[0114] In FIG. 2, the target nucleic acid sequence (5'-TCAGCCAGCTGCA-3'; SEQ ID NO: 1) provided as a 13 × 1 matrix can be identified in the leftmost column, and the oligonucleotide sequence (5'-CAGCAG-3'; SEQ ID NO: 2) provided as a 1 × 6 matrix can be identified in the topmost row.

[0115] The target nucleic acid sequence and the nucleotides included in the oligonucleotide are expressed in 4 bits according to the type of base.

[0116] According to the present invention, in order to determine a match or mismatch between nucleotides of a target nucleic acid sequence and an oligonucleotide sequence, rather than checking a string match to determine whether characters between bases are identical, the nucleotides are expressed as 4 bits according to the type of base, and a match or mismatch between nucleotides is checked through bit operations.

[0117] According to one embodiment of the present invention, the base comprises a degenerate base and / or a universal base. The degenerate base and the universal base are described above.

[0118] In this specification, the term "4 bits" means a number in which each of the four digits is expressed in binary.

[0119] According to the IUPAC nucleotide code, the natural bases include adenine (A), guanine (G), cytosine (C), and thymine (T) (uracil (U)), and the degenerate bases include R (A or G), Y (C or T), S (G or C), W (A or T), K (G or T), M (A or C), B (C, G, or T), D (A, G, or T), H (A, C, or T), V (A, C, or G), and N (A, C, G, or T, i.e., any base). Meanwhile, an example of a universal base is inosine (I).

[0120] Nucleotides can be expressed randomly in 4 bits according to the type of base, but they can also be expressed according to certain rules. For example, if the natural bases are expressed in 4 bits in the order of adenine (A), guanine (G), cytosine (C), and thymine (T) (uracil (U)), adenine (A) can be expressed as 1000, guanine (G) as 0100, cytosine (C) as 0010, and thymine (T) and uracil (U) as 0001. Considering these rules, degenerate bases can be expressed in 4 bits as follows: R (A or G): 1100; Y (C or T): 0011; S (G or C): 0110; W (A or T): 1001; K (G or T): 0101; M (A or C): 1010; B(C, G or T): 0111; D(A, G or T): 1101; H(A, C or T): 1011; V(A, C or G): 1110; N(A, C, G or T(any base)): 1111. And the universal base, inosine (I), can be expressed as 1111. Meanwhile, the 4-bit representation of the base in the reverse direction can be written as the opposite of the 4 bits. For example, the reverse adenine (A) of the adenine (A) (1000) is expressed as 0001.

[0121] Step (b): Performing matrix operations to obtain match or mismatch values ​​between nucleotides of the target nucleic acid sequence and the oligonucleotide sequence (120)

[0122] Next, the method of the present invention includes the step of (b) performing a matrix operation of the oligonucleotide sequence with respect to the target nucleic acid sequence to obtain a match value or a mismatch value between nucleotides of the target nucleic acid sequence and the oligonucleotide sequence. The above matrix operation is a multiplication of the m × 1 matrix and the 1 × n matrix and an AND operation of 4 bits of nucleotides which are components of the m × 1 matrix and 4 bits of nucleotides which are components of the 1 × n matrix, and if the matrix operation value is the same as 4 bits of any one of the nucleotides which performed the matrix operation, it indicates that the nucleotides which performed the matrix operation match, and the match value is a value expressing the match as a predetermined match score, and if the matrix operation value is different from 4 bits of all of the nucleotides which performed the matrix operation, it indicates that the nucleotides which performed the matrix operation mismatch, and the mismatch value is a value expressing the mismatch as a predetermined mismatch score.

[0123] The above matrix operation is the multiplication of the m × 1 matrix and the 1 × n matrix, resulting in an m × n matrix.

[0124] In this specification, the bitwise AND operation represents 1 if the digits in each digit are the same as 1, and represents 0 if the digits in each digit are different as 1 and 0 or the same as 0. For example, the bitwise AND operation value of 0010 and 0011 is 0010, and the bitwise AND operation value of 1010 and 0100 is 0000.

[0125] According to one embodiment of the present invention, the predetermined match score and mismatch score are integers. Specifically, the predetermined match score is an integer selected from -20 to 20, more specifically an integer selected from -10 to 10, and even more specifically an integer selected from -5 to 5.

[0126] In addition, the above-described mismatch score is specifically an integer selected from -20 to 20, more specifically an integer selected from -10 to 10, and even more specifically an integer selected from -5 to 5.

[0127] In Fig. 2, a predetermined match score is set to 0 and a predetermined mismatch score is set to 1.

[0128] According to one embodiment of the present invention, the predetermined match score and mismatch score are either identical or different. More specifically, the predetermined match score and mismatch score are different. For example, if the match score is set to 0, the mismatch score can be set to 1, and vice versa.

[0129] According to one embodiment of the present invention, when the matrix operation value is identical to 4 bits of a nucleotide of a target nucleic acid sequence among the nucleotides on which the matrix operation was performed, the nucleotides on which the matrix operation was performed are indicated to be a match, and the match value is a value that expresses the match as a predetermined match score.

[0130] According to one embodiment of the present invention, when the matrix operation value is equal to 4 bits of a nucleotide of an oligonucleotide sequence among the nucleotides on which the matrix operation was performed, the nucleotides on which the matrix operation was performed are indicated to be matched, and the match value is a value that expresses the match as a predetermined match score.

[0131] According to one embodiment of the present invention, the method further includes indicating that, if the matrix operation value is different from 4 bits of a nucleotide of a target nucleic acid sequence among the nucleotides on which the matrix operation was performed, the nucleotides on which the matrix operation was performed are mismatched, and the mismatch is expressed as a value of a predetermined mismatch score.

[0132] According to one embodiment of the present invention, the step (b) further includes that if the matrix operation value is identical to 4 bits of a nucleotide of the target nucleic acid sequence among the nucleotides on which the matrix operation was performed, the nucleotides on which the matrix operation was performed match, and the match value is a value expressing the match with a predetermined match score, and if the matrix operation value is different from 4 bits of all the nucleotides on which the matrix operation was performed or is different from 4 bits of a nucleotide of the target nucleic acid sequence, the nucleotides on which the matrix operation was performed mismatch, and the mismatch value is a value expressing the mismatch with a predetermined mismatch score.

[0133] FIG. 2 shows a process of performing a matrix operation of an oligonucleotide sequence for a target nucleic acid sequence in an operation table to obtain a match value or a mismatch value between nucleotides of the target nucleic acid sequence and the oligonucleotide sequence, wherein the operation table is an m × n matrix component (C) obtained by multiplying the m × 1 matrix and the 1 × n matrix. i,j , 1≤i≤m, 1≤j≤n, m is 13, n is 6). In Fig. 2, a given match score is 0, and a given mismatch score is 1.

[0134] In Fig. 2, the element of row 1 and column 1 of the 13 × 6 matrix (C 1,1 ) is the component of a 13 × 1 matrix (A 1,1 ) base T (0001) and the elements of the 1 × 6 matrix (B 1,1 ) of the base C (0010) represents the matrix operation value 0000 by matrix operation (matrix multiplication and bitwise AND operation), and the matrix operation value 0000 is an element (A) of the 13 × 1 matrix 1,1 ) of the base T 4 bits 0001, and the elements of the 1 × 6 matrix (B 1,1) are all different from the 4-bit 0010 of the base C, so the elements of the 13 × 1 matrix (A 1,1 ) and the elements of the 1 × 6 matrix (B 1,1 ) indicates a mismatch, and a mismatch value of 1 is assigned.

[0135] In Fig. 2, the element of row 2 and column 1 of the 13 × 6 matrix (C 2,1 ) is the component of a 13 × 1 matrix (A 2,1 ) base C (0010) and the components of the 1 × 6 matrix (B 1,1 ) of the base C (0010) represents the matrix operation value 0010 by matrix operation (matrix multiplication and bitwise AND operation), and the matrix operation value 0010 is an element (A) of a 13 × 1 matrix 2,1 ) of the base C 4 bits 0010, and the elements of the 1 × 6 matrix (B 1,1 ) is identical to the 4-bit 0010 of the base C, so the elements of the 13 × 1 matrix (A 2,1 ) and the elements of the 1 × 6 matrix (B 1,1 ) indicates a match, and 0 is assigned as the match value.

[0136] In this way, the match value or mismatch value of the operation table of Fig. 2 is obtained.

[0137] If the elements of the 1 × 6 matrix in Fig. 2 (B 1,1 ) is a degenerate base W(A or T) (1001), then the elements of the 13 × 1 matrix (A 1,1 ) base T (0001) and the elements of the 1 × 6 matrix (B 1,1 ) of the base W(A or T) (1001) by matrix operation (matrix multiplication and bitwise AND operation) to represent the matrix operation value 0001, and the matrix operation value 0001 is an element of the 13 × 1 matrix (A 1,1 ) is equal to 4 bits 0001 of the base T, so the elements of the 13 × 1 matrix (A 1,1 ) and the elements of the 1 × 6 matrix (B1,1 ) indicates a match, and 0 is assigned as the match value.

[0138] Step (c): Performing a diagonal sum operation on a square matrix to obtain the sum of match values ​​and / or mismatch values ​​of diagonal elements of a square matrix (130)

[0139] Next, the method of the present invention includes the step of (c) performing a trace operation of an n × n square matrix on an m × n matrix on which the matrix operation has been performed to obtain the sum of match values ​​and / or mismatch values ​​of diagonal elements of the n × n square matrix.

[0140] In this specification, the term "trace operation" refers to an operation that calculates the sum of the diagonal elements of an n × n square matrix.

[0141] By performing a trace operation at this stage, semi-global alignment information can be quickly provided without considering gaps in the aligned target nucleic acid sequence and oligonucleotide sequence.

[0142] Figure 3 shows a process of performing a trace operation on a 6 × 6 square matrix in a 13 × 6 matrix on which a matrix operation has been performed to obtain the sum of the match values ​​and / or mismatch values ​​of the diagonal elements of the 6 × 6 square matrix.

[0143] In FIG. 3, among the oligonucleotide sequences that are 1 × n matrices (n is 6) and the target nucleic acid sequences that are m × 1 matrices (m is 13) that can form an n × n square matrix (n is 6), multiple target nucleic acid sequences that are n × 1 matrices (n is 6) can be formed. Accordingly, it can be confirmed in FIG. 3 that in the 13 × 6 matrix on which the matrix operation is performed, the trace operation of the 6 × 6 square matrix can be performed eight times.

[0144] As a result of performing the diagonal sum operation of the first 6 × 6 square matrix in Fig. 3, the matrix component C 1,1Mismatch value (1), C 2,2 Mismatch value (1), C 3,3 Mismatch value (1), C 4,4 Mismatch value (1), C 5,5 Mismatch values ​​(1) and C 6,6 All mismatch values ​​(1) are added together to calculate 6, and the result of the diagonal sum operation of the second 6 × 6 square matrix in Fig. 3 is the matrix component C. 2,1 Match value (0), C 3,2 Match value (0), C 4,3 Match value (0), C 5,4 Match value (0), C 6,5 Mismatch values ​​(1) and C 7,6 All mismatch values ​​(1) are added together to calculate 2. The results of performing the diagonal sum operation on the third, fourth, and fifth 6 × 6 square matrices using the above-described method are 3, 6, and 5, respectively.

[0145] As a result of performing the diagonal sum operation on the sixth 6 × 6 square matrix in Fig. 3, the matrix component C 6,1 Match value (0), C 7,2 Match value (0), C 8,3 Match value (0), C 9,4 Match value (0), C 10,5 Mismatch values ​​(1) and C 11,6 All match values ​​(0) are added together to calculate 1, and the result of performing the diagonal sum operation of the seventh 6 × 6 square matrix in this way is 6.

[0146] Finally, the result of performing the diagonal sum operation on the eighth 6 × 6 square matrix in Fig. 3 is the matrix component C 8,1 Mismatch value (1), C 9,2 Mismatch value (1), C 10,3 Mismatch value (1), C 11,4 Mismatch value (1), C 12,5 Mismatch values ​​(1) and C 13,6All mismatch values ​​(1) are added together to calculate 6.

[0147] Step (d): Providing alignment information of nucleotides of a target nucleic acid sequence in a row component corresponding to a diagonal component of a square matrix having a sum satisfying a predetermined reference value and nucleotides of an oligonucleotide sequence in a column component (140)

[0148] Finally, the method of the present invention comprises the step of (d) providing alignment information of nucleotides of a target nucleic acid sequence in a row component corresponding to a diagonal component of an n × n square matrix having a sum satisfying a predetermined threshold value, and nucleotides of an oligonucleotide sequence in a column component, when the sum satisfies a predetermined threshold value for match or mismatch. The alignment information comprises information selected from the group consisting of matches and / or mismatches between nucleotides of the target nucleic acid sequence and the oligonucleotide sequence, an alignment pattern including match and / or mismatch information, the number of mismatches, and positions of the oligonucleotide sequences in the aligned target nucleic acid sequence.

[0149] The above-described match or mismatch criterion value may be expressed as the number of matches or mismatches, or as the ratio of the number of matches or mismatches to the nucleotide length of the oligonucleotide sequence. When the above-described match or mismatch criterion value is expressed as the number of matches or mismatches, it may be determined as an absolute criterion, and when the above-described match or mismatch criterion value is expressed as the ratio of the number of matches or mismatches to the nucleotide length of the oligonucleotide sequence, it may be determined as a relative criterion.

[0150] The above predetermined match criterion value may be selected from 3 to 60 when expressed as the number of matches. The above predetermined match criterion value may be selected from 5% to 100% when expressed as the ratio of the number of matches to the nucleotide length of the oligonucleotide sequence.

[0151] The above predetermined mismatch reference value may be selected from 0 to 40 when expressed as the number of mismatches. The above predetermined mismatch reference value may be selected from 0% to 60% when expressed as the ratio of the number of mismatches to the nucleotide length of the oligonucleotide sequence.

[0152] Alternatively, the predetermined match or mismatch criterion value may be determined according to the match or mismatch value. For example, when the match or mismatch value is a number greater than 0, the match or mismatch criterion value may be selected from a number between 1 and 100. When the match or mismatch value is 0, the match or mismatch criterion value is 0, and when the match or mismatch value is a number less than 0, the match or mismatch criterion value may be selected from a number between -1 and -100.

[0153] According to one embodiment of the present invention, if the sum satisfies a predetermined match criterion value, it indicates that the sum is greater than or equal to the predetermined match criterion value, and if the sum satisfies a predetermined mismatch criterion value, it indicates that the sum is less than or equal to the predetermined mismatch criterion value. For example, if the predetermined match criterion value is 2, it indicates a case where the sum is at least 2, and if the predetermined mismatch criterion value is 2, it indicates a case where the sum is at most 2.

[0154] In FIG. 3, when the mismatch value is 1 and the match value is 0, the diagonal sum operation value of the first 6 × 6 square matrix is ​​6, the diagonal sum operation value of the second 6 × 6 square matrix is ​​2, the diagonal sum operation value of the third 6 × 6 square matrix is ​​3, the diagonal sum operation value of the fourth 6 × 6 square matrix is ​​6, the diagonal sum operation value of the fifth 6 × 6 square matrix is ​​5, the diagonal sum operation value of the sixth 6 × 6 square matrix is ​​1, and the diagonal sum operation value of the last eighth 6 × 6 square matrix is ​​6.

[0155] In this case, if the predetermined mismatch criterion value is 2, the diagonal sum operation value of the 6 × 6 square matrix is ​​equal to or less than 2, and the diagonal sum operation value of the second and sixth square matrices satisfies the predetermined mismatch criterion value, and the alignment information of the nucleotide of the target nucleic acid sequence of the row component corresponding to the diagonal component of the second and sixth 6 × 6 square matrices having the sum satisfying the predetermined criterion value and the nucleotide of the oligonucleotide sequence of the column component is provided as shown in Table 1 below:

[0156]

[0157] In the above Table 1, the vertical bar (|) of the pattern indicates a match between aligned nucleotides, X indicates a mismatch between aligned nucleotides, and in the match type, the vertical bar N (|N) indicates a conventional oligonucleotide rather than a DPO primer having a cleavage site, and the number before the vertical bar (|) indicates the number of mismatches. If 0 or a number is written after the vertical bar (|) in the match type, the match type indicates the match type of the DPO primer.

[0158] As used herein, “providing alignment information” includes displaying alignment information on an output device (e.g., a user terminal), enabling users to download alignment information to a storage medium, or building a database of alignment information on a computer.

[0159] In this way, semi-global alignment information of oligonucleotides can be provided with respect to a target nucleic acid sequence without considering gaps.

[0160] Sequence alignment algorithms or programs can be broadly classified into local alignment, global alignment, and semi-global alignment.

[0161] Local alignment locally checks for mismatches between a query sequence and a subject sequence, providing match or mismatch information even when a match or mismatch result that satisfies a cutoff value input as a parameter exists in a portion of the query sequence. As a result, match or mismatch information for the entire query sequence may not be known, and there is a characteristic of showing multiple match or mismatch results of the query sequence with respect to the subject sequence.

[0162] In order to provide coverage for the entire sequence (full length) of an oligonucleotide, an additional repair method is required to overcome the problem caused by the characteristics of such local alignment (specifically, checking for local mismatches). However, in the case where the number of conventional nucleic acid sequences is very large, there was a problem in that the match or mismatch pattern for the entire oligonucleotide could not be shown due to a failure of memory, etc.

[0163] Global alignment checks for mismatches between the query sequence and the subject sequence across the entire sequence, and provides a single match or mismatch if a match or mismatch result that satisfies the cutoff value entered as a parameter exists across the entire query sequence and the subject sequence. As a result, it provides match or mismatch information for the entire query sequence through the match or mismatch results of parts of the query sequence for the entire subject sequence.

[0164] Semi-global alignment checks for mismatches between the entire query sequence and a portion of the subject sequence, and displays a match or mismatch result if a match or mismatch result satisfies a cutoff value input as a parameter. Specifically, semi-global alignment is a sequence alignment algorithm or program that performs global alignment for the query sequence and local alignment for the subject.

[0165] In the present invention, there is no need to use a program including a repair method to overcome the problem of checking for local mismatches in conventional local alignments (specifically, BLAST) through an algorithm that implements semi-global alignment. That is, according to the present invention, match or mismatch information can be provided for the entire oligonucleotide without using a repair method for the target nucleic acid sequence using semi-global alignment, thereby utilizing fewer computer resources than in the case of conventional local alignment, and showing an improved effect in the speed of providing alignment information.

[0166] Semi-global alignment can be used to check for mismatches between regions of a target nucleic acid sequence corresponding to the entire length of an oligonucleotide. For example, in the case of a tagging probe comprising a tagging region and a targeting region, conventional local alignment can be used to check for mismatches between the targeting region of the tagging probe and the region of the corresponding nucleic acid sequence, but cannot check for mismatches in the tagging region. However, according to the present invention, it is possible to check for mismatches across the entire tagging probe. And, in the case of a DPO primer including a 5'-high Tm specificity region (X) - cleavage region (Y) - 3'-low Tm specificity region (Z), an algorithm or program using a conventional local alignment and repair method uses local alignment to check whether there is a mismatch between the 5'-high Tm specificity region (X) and the region of the corresponding nucleic acid sequence, and does not check whether there is a mismatch between the cleavage region (Y) and the region of the corresponding nucleic acid sequence, and can check whether there is a mismatch between the 3'-low Tm specificity region (Z) and the region of the corresponding nucleic acid sequence through a repair method. However, according to the present invention using semi-global alignment, alignment information for the entire length of the DPO primer can be provided more quickly.

[0167] According to one embodiment of the present invention, the method provides coverage of oligonucleotides for a plurality of target nucleic acid sequences.

[0168] By performing the method of the present invention for each of a plurality of target nucleic acid sequences, coverage of oligonucleotides for a plurality of target nucleic acid sequences can be provided.

[0169] The above multiple target nucleic acid sequences are at least 3, at least 5, at least 10, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90 or at least 100 target nucleic acid sequences.

[0170] The plurality of target nucleic acid sequences in the present invention are target nucleic acid sequences having sequence similarity. Specifically, the target nucleic acid sequences having sequence similarity may be multiple target nucleic acid sequences of a single target nucleic acid molecule or multiple target nucleic acid sequences of two or more target nucleic acid molecules.

[0171] According to one embodiment of the present invention, the plurality of target nucleic acid sequences in the present invention are a plurality of nucleic acid sequences having sequence similarity of one target nucleic acid molecule having genetic diversity.

[0172] For example, the plurality of target nucleic acid sequences used in the present invention are a plurality of nucleic acid sequences that have sequence similarity to target nucleic acid molecules exhibiting genetic diversity, such as the genome sequence of a virus. For example, if an influenza A virus is to be detected and the M gene is selected as the target nucleic acid molecule, diverse target nucleic acid sequences of the M gene of the influenza A virus can be used in the present invention.

[0173] More specifically, the plurality of target nucleic acid sequences are the entire genome sequence of a virus or bacterium having genetic diversity, a partial sequence of the genome, or a plurality of nucleic acid sequences of one gene.

[0174] Multiple target nucleic acid sequences may be included and provided in a nucleotide database. The nucleotide database used in the present invention refers to a set or collection of data regarding two or more nucleotide sequences derived from various sources, and may be used interchangeably with the terms "nucleotide sequence database," "nucleotide sequence database," or "database."

[0175] The nucleotide database may include information related to nucleotide sequences (e.g., their specific sequences, taxonomy IDs, taxonomy names, organism names, and accession numbers, etc.).

[0176] The above database may be publicly available, commercially available, or created by the inventor. The above database is a collection arranged for convenience and speed of computer search.

[0177] Examples of databases known in the art include the GenBank database, the EST database, the EMBL nucleotide sequence database, the Entrez nucleotide database, and the LIFESEQ database. TM Including, but not limited to, the database and the GISAID database.

[0178] The term "coverage" as used herein means providing information on target nucleic acid sequences that are hybridized or covered by an oligonucleotide or have a sequence similar to the oligonucleotide sequence. The information on the target nucleic acid sequences includes the number of target nucleic acid sequences, the Accession No. of the target nucleic acid sequence, the taxonomy name to which the target nucleic acid sequence belongs, the taxonomy ID assigned to the taxonomy name, the ratio of target nucleic acid sequences hybridized or covered by the oligonucleotide to the entire target nucleic acid sequence, the number of matches or mismatches of the oligonucleotide, or information on the mismatch pattern of the oligonucleotide.

[0179] Recording media, devices and programs

[0180] According to another aspect of the present invention, a computer-readable recording medium including instructions for implementing a processor for executing a method for providing alignment information of an oligonucleotide for a target nucleic acid sequence, the method including the steps of: (a) providing a target nucleic acid sequence including m nucleotides and an oligonucleotide sequence including n nucleotides; wherein the target nucleic acid sequence is provided as an m × 1 matrix including m nucleotides as matrix elements, and the oligonucleotide sequence is provided as a 1 × n matrix including n nucleotides as matrix elements, and wherein the nucleotides are expressed with 4 bits for each type of base; (b) performing a matrix operation of the oligonucleotide sequence for the target nucleic acid sequence to obtain a match value or a mismatch value between nucleotides of the target nucleic acid sequence and the oligonucleotide sequence;The above matrix operation is a multiplication of the m × 1 matrix and the 1 × n matrix and an AND operation of 4 bits of nucleotides which are components of the m × 1 matrix and 4 bits of nucleotides which are components of the 1 × n matrix, and if the matrix operation value is the same as 4 bits of any one of the nucleotides which performed the matrix operation, it indicates that the nucleotides which performed the matrix operation match, and the match value is a value expressing the match as a predetermined match score, and if the matrix operation value is different from 4 bits of all of the nucleotides which performed the matrix operation, it indicates that the nucleotides which performed the matrix operation mismatch, and the mismatch value is a value expressing the mismatch as a predetermined mismatch score, and (c) a trace operation of an n × n square matrix is ​​performed on the m × n matrix which performed the matrix operation to obtain the match values ​​and / or mismatch values ​​of the diagonal elements of the n × n square matrix. A step of obtaining a sum; and (d) providing alignment information of nucleotides of a target nucleic acid sequence in a row component corresponding to a diagonal component of an n × n square matrix having a sum satisfying a predetermined threshold value if the sum satisfies a predetermined match or mismatch threshold value and nucleotides of an oligonucleotide sequence in a column component; wherein the alignment information includes information selected from the group consisting of matches and / or mismatches between nucleotides of the target nucleic acid sequence and the oligonucleotide sequence, an alignment pattern including match and / or mismatch information, the number of mismatches, and a position of the oligonucleotide sequence in the aligned target nucleic acid sequence.

[0181] According to another aspect of the present invention, there is provided a computer program stored in a computer-readable recording medium, which implements a processor for executing a method for providing alignment information of an oligonucleotide for a target nucleic acid sequence, the method comprising the steps of: (a) providing a target nucleic acid sequence including m nucleotides and an oligonucleotide sequence including n nucleotides; wherein the target nucleic acid sequence is provided as an m × 1 matrix including m nucleotides as matrix elements, and the oligonucleotide sequence is provided as a 1 × n matrix including n nucleotides as matrix elements, and wherein the nucleotides are expressed in 4 bits for each type of base; (b) performing a matrix operation of the oligonucleotide sequence for the target nucleic acid sequence to obtain a match value or a mismatch value between nucleotides of the target nucleic acid sequence and the oligonucleotide sequence;The above matrix operation is a multiplication of the m × 1 matrix and the 1 × n matrix and an AND operation of 4 bits of nucleotides which are components of the m × 1 matrix and 4 bits of nucleotides which are components of the 1 × n matrix, and if the matrix operation value is the same as 4 bits of any one of the nucleotides which performed the matrix operation, it indicates that the nucleotides which performed the matrix operation match, and the match value is a value expressing the match as a predetermined match score, and if the matrix operation value is different from 4 bits of all of the nucleotides which performed the matrix operation, it indicates that the nucleotides which performed the matrix operation mismatch, and the mismatch value is a value expressing the mismatch as a predetermined mismatch score, and (c) a trace operation of an n × n square matrix is ​​performed on the m × n matrix which performed the matrix operation to obtain the match values ​​and / or mismatch values ​​of the diagonal elements of the n × n square matrix. A step of obtaining a sum; and (d) providing alignment information of nucleotides of a target nucleic acid sequence in a row component corresponding to a diagonal component of an n × n square matrix having a sum satisfying a predetermined threshold value if the sum satisfies a predetermined match or mismatch threshold value and nucleotides of an oligonucleotide sequence in a column component; wherein the alignment information includes information selected from the group consisting of matches and / or mismatches between nucleotides of the target nucleic acid sequence and the oligonucleotide sequence, an alignment pattern including match and / or mismatch information, the number of mismatches, and a position of the oligonucleotide sequence in the aligned target nucleic acid sequence.

[0182] According to another aspect of the present invention, there is provided an apparatus for providing alignment information of an oligonucleotide for a target nucleic acid sequence, the apparatus comprising (a) a computer processor, and (b) a computer-readable recording medium of the present invention coupled to the computer processor.

[0183] The recording medium, device, and computer program of the present invention enable the method of the present invention described above to be implemented on a computer. The description of common contents among them is omitted to avoid excessive complexity of this specification due to repeated description.

[0184] The program instructions, when executed by a processor, cause the processor to perform the method of the present invention described above. The program instructions for performing a method for providing alignment information of an oligonucleotide for a target nucleic acid sequence may include the following instructions: (i) instructions for providing a target nucleic acid sequence comprising m nucleotides and an oligonucleotide sequence comprising n nucleotides; (ii) instructions for performing a matrix operation on the oligonucleotide sequence for the target nucleic acid sequence to obtain a match value or a mismatch value between nucleotides of the target nucleic acid sequence and the oligonucleotide sequence; (iii) instructions for performing a trace operation on an n × n square matrix on which the matrix operation was performed to obtain a sum of match values ​​and / or mismatch values ​​of diagonal elements of the n × n square matrix; And (iv) if the sum satisfies a predetermined match or mismatch criterion value, an instruction to provide (e.g., display on an output device) alignment information of nucleotides of a target nucleic acid sequence of a row component corresponding to a diagonal component of an n × n square matrix having a sum that satisfies the predetermined criterion value and nucleotides of an oligonucleotide sequence of a column component.

[0185] The method of the present invention is executed in a processor, which may be a stand alone computer, a network attached computer, or a processor in a data acquisition device such as a real-time PCR device.

[0186] Computer-readable recording media include, but are not limited to, various storage media known in the art, such as CD-R, CD-ROM, DVD, flash memory, floppy disk, hard drive, portable HDD, USB, magnetic tape, MINIDISC, non-volatile memory card, EEPROM, optical disk, optical storage medium, RAM, ROM, system memory, and web server.

[0187] According to one embodiment of the present invention, the computer-readable recording medium is a non-transitory computer-readable recording medium.

[0188] The alignment information of an oligonucleotide to a target nucleic acid sequence can be provided in a variety of ways. For example, the alignment information of an oligonucleotide to a target nucleic acid sequence can be provided to a separate system, such as a desktop computer system, via a network connection (e.g., a LAN, VPN, the Internet, or an intranet) or a direct connection (e.g., a USB or other direct wired or wireless connection), or can be provided on a portable medium, such as a CD, DVD, floppy disk, or portable HDD. Similarly, the alignment information of an oligonucleotide to a target nucleic acid sequence can be provided to a server system via a network connection (e.g., a LAN, VPN, the Internet, an intranet, or a wireless communication network) to a client, such as a laptop or desktop computer system.

[0189] Instructions for implementing a processor executing the present invention may be included in a logic system. These instructions may be provided on software storage media (e.g., portable hard drives, USB drives, floppy disks, CDs, and DVDs), but may also be downloadable and stored in a memory module (e.g., a hard drive or other memory such as local or attached RAM or ROM). Computer code for executing the present invention may be implemented in various coding languages, such as C, C++, Java, Visual Basic, VBScript, JavaScript, Perl, and XML. Furthermore, various languages ​​and protocols may be used for the external and internal storage and transmission of signals and commands according to the present invention.

[0190] A computer processor may be configured to perform all of the above-described performances on a single processor. Alternatively, the processor unit may be configured to have multiple processors each performing a specific function.

[0191] Ⅱ. Method for providing alignment information considering gaps (second aspect)

[0192] According to another aspect of the present invention, the present invention provides a computer-implemented method for providing alignment information of an oligonucleotide for a target nucleic acid sequence, comprising the following steps:

[0193] (a) providing a target nucleic acid sequence including m nucleotides and an oligonucleotide sequence including n nucleotides; wherein the target nucleic acid sequence is provided as an m × 1 matrix including m nucleotides as matrix elements, and the oligonucleotide sequence is provided as a 1 × n matrix including n nucleotides as matrix elements, and the nucleotides are expressed in 4 bits for each type of base,

[0194] (b) a step of providing an operation table; the operation table includes a part where an operation is performed and a part where a gap score is input, and the part where the operation is performed includes an element (C) of an m × n matrix by multiplying the m × 1 matrix and the 1 × n matrix. i,j , 1≤i≤m, 1≤j≤n), and the part where the gap score is input is the origin (C 0,0 ), 0 row component (C 0,j , 1≤j≤n) and 0 column components (C i,0 , 1≤i≤m),

[0195] (c) a step of inputting a gap score into a part of the above operation table where a gap score is input; in the 0 row component of the part where the gap score is input, an origin value + (jx gap score (k)) (1≤j≤n, k is an integer) is input for each column component, and in the 0 column component of the part where the gap score is input, an origin value + (ix gap score (k)) (1≤i≤n, k is an integer) is input for each row component.

[0196] (d) a step of performing an operation and inputting an operation value into a section of the operation table where the operation is performed; the operation is performed in a manner including the following steps for each row in order from the first row to the last row of the section where the operation is performed:

[0197] d-1) A step of obtaining the maximum value of one of the addition operation values ​​selected from among the addition operation values ​​in the relationship with the matrix element i-1) above and the addition operation values ​​in the relationship with the matrix element on the left i-2) and the addition operation values ​​in the relationship with the left diagonal matrix element i-3) for the row of the part where the above operation is performed, and inputting the maximum value as the operation value of each matrix element;The operation value of addition in the relation with the matrix elements above i-1) is an operation value of addition obtained by adding a gap score (k, k is an integer) to the value of the matrix element above each matrix element of the row of the part where the operation is performed, the operation value of addition in the relation with the left matrix element above i-2) is an operation value of addition obtained by adding a gap score (k, k is an integer) to the value of the left matrix element of each matrix element of the row of the part where the operation is performed, and the operation value of addition in the relation with the left diagonal matrix element above i-3) is an operation value of addition obtained by performing a matrix operation of the oligonucleotide sequence for the target nucleic acid sequence for the row of the part where the operation is performed to obtain a match value or mismatch value between the nucleotides of the target nucleic acid sequence and the oligonucleotide sequence for each matrix element, and adding the match value or mismatch value for each matrix element and the value of the left diagonal element of each matrix element, and the matrix The operation is a multiplication of the m × 1 matrix and the 1 × n matrix and an AND operation of 4 bits of nucleotides which are components of the m × 1 matrix and 4 bits of nucleotides which are components of the 1 × n matrix, and if the matrix operation value is equal to 4 bits of any one of the nucleotides which performed the matrix operation, it indicates that the nucleotides which performed the matrix operation match, and the match value is a value expressing the match with a predetermined match score, and if the matrix operation value is different from 4 bits of all the nucleotides which performed the matrix operation, it indicates that the nucleotides which performed the matrix operation mismatch, and the mismatch value is a value expressing the mismatch with a predetermined mismatch score, and;

[0198] d-2) A step of obtaining the maximum value of the operation value of each matrix element input in step d-1) in the order from the first matrix element to the last matrix element of the row of the part where the operation is performed and the operation value of the addition of any one of i-1) and i-2) not selected in step d-1), inputting the maximum value as the operation value of each matrix element of the part where the operation is performed, and indicating which matrix element among the upper, left diagonal, and left matrix elements of the corresponding matrix element the input operation value is derived from;

[0199] (e) a step of performing backtracking according to the indication of step d-2) from the matrix element that satisfies a predetermined score threshold value among the operation values ​​of the matrix element of the last column of the part where the operation in which the operation value is input is performed; and

[0200] (f) a step of providing alignment information between nucleotides of a target nucleic acid sequence and nucleotides of an oligonucleotide sequence according to the origin of the operation value of the backtracked matrix element; the alignment information includes information selected from the group consisting of matches, mismatches and / or gaps between nucleotides of the target nucleic acid sequence and the oligonucleotide sequence, an alignment pattern including the match, mismatch and / or gap information, the number of mismatches, and the position of the oligonucleotide sequence in the aligned target nucleic acid sequence.

[0201] The present inventors have endeavored to develop a method for efficiently utilizing computer resources and increasing the speed of providing alignment information for oligonucleotides relative to a target nucleic acid sequence. As a result, the present invention has developed a technology capable of providing semi-global alignment of oligonucleotides relative to a target nucleic acid sequence by applying dynamic programming. As a result, it has been confirmed that, compared to conventional methods, alignment information for the entire length of oligonucleotides can be provided more accurately and quickly with fewer computer resources.

[0202] The method of the second aspect of the present invention relates to a technique for providing alignment information of an oligonucleotide for a target nucleic acid sequence by taking into account a gap.

[0203] When aligning a target nucleic acid sequence and an oligonucleotide sequence, gaps are created in the target nucleic acid sequence and / or oligonucleotide sequence to produce alignment results demonstrating a predetermined degree of similarity. Accordingly, the method of the second aspect of the present invention seeks to provide alignment information by taking gaps into account.

[0204] As used herein, “providing alignment information taking gaps into account” means providing alignment information that may include gaps.

[0205] "Dynamic programming," as used herein, is a technique in optimization theory and an algorithm design technique that efficiently derives values ​​within a specific range by utilizing values ​​within a different range. In other words, dynamic programming is a general term for algorithms that consider a problem as an extension of a smaller problem and leverage previously derived solutions to solve it.

[0206] Figure 4 is a flowchart of processes for implementing the method of the present invention according to another embodiment of the present invention. The method of the present invention is described with reference to Figure 4 as follows:

[0207] Step (a): Providing a target nucleic acid sequence and an oligonucleotide sequence (210)

[0208] First, the method of the present invention comprises the step of (a) providing a target nucleic acid sequence comprising m nucleotides and an oligonucleotide sequence comprising n nucleotides. The target nucleic acid sequence is provided as an m × 1 matrix including m nucleotides as matrix elements, and the oligonucleotide sequence is provided as a 1 × n matrix including n nucleotides as matrix elements, and the nucleotides are expressed in 4 bits for each type of base.

[0209] In the method of the present invention of the second aspect, step (a) can be described with reference to the description of step (a) of the first aspect described above. Therefore, description of common contents between them is omitted to avoid excessive complexity of the present specification.

[0210] Although the present specification expresses that m nucleotides of a target nucleic acid sequence are provided as an m × 1 matrix and n nucleotides of an oligonucleotide sequence are provided as a 1 × n matrix, it is clearly understood by those skilled in the art that the method of the present invention described below can be performed by changing the expression to provide m nucleotides of a target nucleic acid sequence as a 1 × m matrix and n nucleotides of an oligonucleotide sequence as an n × 1 matrix. In addition, it is clearly understood by those skilled in the art that the method of the present invention performed by providing m nucleotides of a target nucleic acid sequence as a 1 × m matrix and n nucleotides of an oligonucleotide sequence as an n × 1 matrix is ​​also included in the scope of the present invention.

[0211] That is, it can be clearly understood by those skilled in the art that the method of the present invention is performed by providing m nucleotides of the target nucleic acid sequence as an m × 1 matrix and n nucleotides of the oligonucleotide sequence as a 1 × n matrix, and that the method of the present invention is performed by providing m nucleotides of the target nucleic acid sequence as a 1 × m matrix and n nucleotides of the oligonucleotide sequence as an n × 1 matrix, and that this is within the equivalent scope.

[0212] If the order of the rows and columns of the target nucleic acid sequence and the oligonucleotide sequence are changed, the order is also changed and performed in the process described below.

[0213] According to one embodiment of the present invention, m is a natural number.

[0214] According to one embodiment of the present invention, the oligonucleotide is a primer or a probe.

[0215] According to one embodiment of the present invention, n is a natural number.

[0216] According to one embodiment of the present invention, m has a number greater than n.

[0217] According to one embodiment of the present invention, the oligonucleotide is an oligonucleotide represented by the following formula (I):

[0218] 5'-XYZ-3' (I)

[0219] In the above formula, X represents a site including a hybridization nucleotide sequence that hybridizes to a target nucleic acid sequence, Y represents a cleavage site including two or more consecutive bases that do not participate in Watson-Crick base pairing, and Z represents a site including a hybridization nucleotide sequence that hybridizes to a target nucleic acid sequence.

[0220] Figure 5 shows an operation table in which operations are performed on target nucleic acid sequences and oligonucleotide sequences.

[0221] In FIG. 5, the target nucleic acid sequence (5'-TCAGCCAGCTGCA-3'; SEQ ID NO: 1) provided as a 13 × 1 matrix can be identified in the leftmost column, and the oligonucleotide sequence (5'-CAGCAG-3'; SEQ ID NO: 2) provided as a 1 × 6 matrix can be identified in the topmost row.

[0222] According to one embodiment of the present invention, the base comprises a degenerate base and / or a universal base.

[0223] Step (b): Provide an operation table (220)

[0224] Next, the method of the present invention includes the step of (b) providing an operation table. The operation table includes a part where an operation is performed and a part where a gap score is input, and the part where the operation is performed includes an element (C) of an m × n matrix by multiplying the m × 1 matrix and the 1 × n matrix. i,j , 1≤i≤m, 1≤j≤n), and the part where the gap score is input is the origin (C 0,0 ), 0 row component (C 0,j , 1≤j≤n) and the 0 column component (C i,0 , 1≤i≤m).

[0225] Figure 5 shows an operation table in which operations are performed on a target nucleic acid sequence and an oligonucleotide sequence. The topmost row in the operation table describes an oligonucleotide sequence containing 6(n) nucleotides, indicating that the oligonucleotide sequence is provided as a 1 × 6(n) matrix on the operation table. The leftmost column in the operation table describes a target nucleic acid sequence containing 13(m) nucleotides, indicating that the target nucleic acid sequence is provided as a 13(m) × 1 matrix on the operation table.

[0226] In Fig. 5, the row immediately below the row in which the oligonucleotide sequence is described and the column immediately to the right of the column in which the target nucleic acid sequence is described correspond to the part in the calculation table where the gap score is entered. In addition, in the calculation table of Fig. 5, the remaining part, excluding the part in which the sequence is entered and the part in which the gap score is entered, is the part where the calculation is performed, and the part in which the calculation is performed corresponds to the column of the oligonucleotide sequence and the row of the target nucleic acid sequence.

[0227] In Fig. 5, the part where the above operation is performed is the component (C) of the 13 × 6 matrix by multiplying the 13 × 1 matrix and the 1 × 6 matrix. i,j , 1≤i≤13, 1≤j≤6), and the part where the gap score is input is the origin (C 0,0 ), 0-row component (C 0,j , 1≤j≤6) and 0th row components (C i,0 , 1≤i≤13).

[0228] Step (c): Enter the gap score in the gap score input section of the calculation table (230).

[0229] Next, the method of the present invention includes the step of (c) inputting a gap score into a part of the operation table into which a gap score is input. In the 0-row component of the part into which the gap score is input, for each column component, an origin value + (jx gap score (k)) (1≤j≤n, k is an integer) is input, and in the 0-column component of the part into which the gap score is input, an origin value + (ix gap score (k)) (1≤i≤n, k is an integer) is input for each row component.

[0230] According to one embodiment of the present invention, the origin value included in the gap score is the origin (C 0,0) is an integer as a value, specifically, an integer selected from -20 to 20, more specifically, an integer selected from -10 to 10, even more specifically, an integer selected from -5 to 5, and most specifically, may be 0.

[0231] The above gap score is a score assigned to consider a gap in an aligned sequence, and the degree to which a gap is assigned to a sequence may vary depending on the size of the gap score. Specifically, the gap score (k) is an integer selected from -20 to 20, more specifically an integer selected from -10 to 10, even more specifically an integer selected from -5 to 5, and most specifically an integer selected from -5 to 0.

[0232] Figure 5 illustrates the process of inputting a gap score into the gap score input section of the operation table. In Figure 5, the origin value is 0, and the O row component shows that the gap score decreases by -5 depending on the nucleotide position of the oligonucleotide sequence, and the 0 column component shows the result of inputting a gap score of 0 depending on the nucleotide position of the target nucleic acid sequence.

[0233] Step (d): Perform the operation and input the operation value into the part of the operation table where the operation is performed (240).

[0234] And, the method of the present invention includes the step (d) of performing an operation and inputting an operation value into the section of the operation table where the operation is performed. The operation is performed in a manner that includes the following steps for each row in order from the first row to the last row of the section where the operation is performed:

[0235] d-1) A step of obtaining the maximum value of one of the addition operation values ​​selected from among the addition operation values ​​in the relationship with the matrix element i-1) above and the addition operation values ​​in the relationship with the matrix element on the left i-2) and the addition operation values ​​in the relationship with the left diagonal matrix element i-3) for the row of the part where the above operation is performed, and inputting the maximum value as the operation value of each matrix element;The operation value of addition in the above i-1) matrix element and relationship is an operation value of addition obtained by adding a gap score (k, k is an integer) to the value of the matrix element above each matrix element of the row of the part where the operation is performed, the operation value of addition in the above i-2) left matrix element and relationship is an operation value of addition obtained by adding a gap score (k, k is an integer) to the value of the left matrix element of each matrix element of the row of the part where the operation is performed, and the operation value of addition in the above i-3) left diagonal matrix element and relationship is an operation value of addition obtained by performing a matrix operation of the oligonucleotide sequence for the target nucleic acid sequence for the row of the part where the operation is performed to obtain a match value or mismatch value between the nucleotides of the target nucleic acid sequence and the oligonucleotide sequence for each matrix element, and adding the match value or mismatch value for each matrix element and the value of the left diagonal matrix element of each matrix element, and The matrix operation is a multiplication of the m × 1 matrix and the 1 × n matrix and an AND operation of 4 bits of nucleotides which are components of the m × 1 matrix and 4 bits of nucleotides which are components of the 1 × n matrix, and if the matrix operation value is equal to 4 bits of any one of the nucleotides which performed the matrix operation, it indicates that the nucleotides which performed the matrix operation match, and the match value is a value expressing the match with a predetermined match score, and if the matrix operation value is different from 4 bits of all the nucleotides which performed the matrix operation, it indicates that the nucleotides which performed the matrix operation mismatch, and the mismatch value is a value expressing the mismatch with a predetermined mismatch score, and;

[0236] d-2) A step of obtaining the maximum value of the operation value of each matrix element input in step d-1) in the order from the first matrix element to the last matrix element of the row of the part where the operation is performed and the operation value of the addition of any one of i-1) and i-2) not selected in step d-1), inputting the maximum value as the operation value of each matrix element of the part where the operation is performed, and indicating which matrix element among the upper, left diagonal, and left matrix elements of the corresponding matrix element the input operation value is derived from.

[0237] The present invention does not calculate an operation value for each matrix element, but simultaneously obtains an operation value for the matrix element included in a row i) in relation to the left diagonal matrix element of the matrix element, and simultaneously obtains an operation value for the matrix element included in the row ii) in relation to the matrix element above the matrix element of the matrix element (the order of i) and ii) (the order of i) and ii) is reversed), and then the maximum value of the operation values ​​of i) and ii) is simultaneously obtained for the matrix element included in the row. Then, in order from the first matrix element to the last matrix element of the row, for each matrix element iii) an operation value is obtained in relation to the left matrix element of the matrix element, and the maximum value between the operation value and the maximum value of the operation values ​​of i) and ii) is obtained as the operation value of each matrix element. In this way, the operation values ​​are obtained up to the matrix element included in the last row. According to the present invention, the operation values ​​of ii) and iii) may be reversed.

[0238] This calculation method of the present invention can perform calculations quickly on a computer, thereby providing alignment information more accurately and quickly, which is the greatest feature of the present invention.

[0239] According to one embodiment of the present invention, the operation is performed in a manner including the following steps for each row in order from the first row to the last row of the section where the operation is performed:

[0240] d-1) A step of obtaining the maximum value of the operation value of addition in relation to the matrix element i-1) above and the operation value of addition in relation to the left diagonal matrix element i-3) for the row of the part where the above operation is performed, and inputting the maximum value as the operation value of each matrix element; The operation value of addition in the above i-1) matrix element and relationship is an operation value of addition obtained by adding a gap score (k, k is an integer) to the value of the matrix element above each matrix element of the row of the part where the operation is performed, and the operation value of addition in the above i-3) left diagonal matrix element and relationship is an operation value of addition obtained by performing a matrix operation of the oligonucleotide sequence for the target nucleic acid sequence for the row of the part where the operation is performed to obtain a match value or mismatch value between the nucleotides of the target nucleic acid sequence and the oligonucleotide sequence for each matrix element, and adding the match value or mismatch value for each matrix element and the value of the left diagonal matrix element of each matrix element, and the matrix operation is a multiplication of the m × 1 matrix and a 1 × n matrix and an AND operation of 4 bits of nucleotides which are components of the m × 1 matrix and 4 bits of nucleotides which are components of the 1 × n matrix, and the matrix operation value is the If the 4 bits of any one of the nucleotides that performed the matrix operation are identical, the nucleotides that performed the matrix operation are indicated to be a match, and the match value is a value expressing the match as a predetermined match score, and if the matrix operation value is different from the 4 bits of all the nucleotides that performed the matrix operation, the nucleotides that performed the matrix operation are indicated to be a mismatch, and the mismatch value is a value expressing the mismatch as a predetermined mismatch score, and

[0241] d-2) A step of obtaining the maximum value of the operation value of each matrix element entered in step d-1) in the order from the first matrix element to the last matrix element of the row of the part where the operation is performed and the operation value of addition in the relationship with the left matrix line segment of i-2), inputting the maximum value as the operation value of each matrix element of the part where the operation is performed and indicating which matrix element among the upper, left diagonal, and left matrix element of the corresponding matrix element the input operation value is derived from; The operation value of addition in the relationship with the left matrix element of i-2) is the operation value of addition obtained by adding a gap score (k, k is an integer) to the value of the left matrix element of each matrix element of the row of the part where the operation is performed.

[0242] According to one embodiment of the present invention, the operation is performed in a manner including the following steps for each row in order from the first row to the last row of the section where the operation is performed:

[0243] d-1) A step of obtaining the maximum value of the operation value of addition in relation to the i-2) left matrix element and the i-3) left diagonal matrix element for each row of the part where the above operation is performed, and inputting the maximum value as the operation value of each matrix element; The operation value of addition in the relation with the matrix element on the left of the above i-2) is an operation value of addition obtained by adding a gap score (k, k is an integer) to the value of the left matrix element of each matrix element of the row of the part where the operation is performed, and the operation value of addition in the relation with the left diagonal matrix element on the above i-3) is an operation value of addition obtained by performing a matrix operation of the oligonucleotide sequence for the target nucleic acid sequence for the row of the part where the operation is performed to obtain a match value or mismatch value between the nucleotides of the target nucleic acid sequence and the oligonucleotide sequence for each matrix element, and adding the match value or mismatch value for each matrix element and the value of the left diagonal matrix element of each matrix element, and the matrix operation is a multiplication of the m × 1 matrix and a 1 × n matrix and an AND operation of 4 bits of nucleotides which are components of the m × 1 matrix and 4 bits of nucleotides which are components of the 1 × n matrix, and the matrix operation If the value is equal to 4 bits of any one of the nucleotides that performed the matrix operation, the nucleotides that performed the matrix operation are indicated to be matched, and the match value is a value expressing the match with a predetermined match score; if the matrix operation value is different from 4 bits of all the nucleotides that performed the matrix operation, the nucleotides that performed the matrix operation are indicated to be mismatched, and the mismatch value is a value expressing the mismatch with a predetermined mismatch score; and

[0244] d-2) A step of obtaining the maximum value of the operation value of each matrix element input in step d-1) in the order from the first matrix element to the last matrix element of the row of the part where the operation is performed and the operation value of addition in the relation with the matrix element above i-1), and inputting the maximum value as the operation value of each matrix element of the part where the operation is performed and indicating which matrix element among the upper, left diagonal, and left matrix elements of the corresponding matrix element the input operation value is derived from; The operation value of addition in the relation with the matrix element above i-1) is the operation value of addition obtained by adding a gap score (k, k is an integer) to the value of the matrix element above each matrix element of the row of the part where the operation is performed.

[0245] According to another embodiment of the present invention, the operation is performed in a manner that includes the following steps for each row in order from the first row to the last row of the portion where the operation is performed:

[0246] d-1) i-1) A step of performing a matrix operation of the oligonucleotide sequence for the target nucleic acid sequence for the row of the part where the operation is performed to obtain a match value or mismatch value between nucleotides of the target nucleic acid sequence and the oligonucleotide sequence for each matrix element, and adding the match value or mismatch value for each matrix element and the value of the left diagonal matrix element of each matrix element to obtain an operation value of addition; The above matrix operation is a multiplication of the m × 1 matrix and the 1 × n matrix and an AND operation of 4 bits of nucleotides which are components of the m × 1 matrix and 4 bits of nucleotides which are components of the 1 × n matrix, and if the matrix operation value is equal to 4 bits of any one of the nucleotides which performed the matrix operation, it indicates that the nucleotides which performed the matrix operation match, and the match value is a value expressing the match as a predetermined match score, and if the matrix operation value is different from 4 bits of all the nucleotides which performed the matrix operation, it indicates that the nucleotides which performed the matrix operation mismatch, and the mismatch value is a value expressing the mismatch as a predetermined mismatch score;

[0247] i-2) A step of obtaining an operation value of addition by adding a gap score (k) (k is an integer) to the value of the matrix element above each matrix element of the row of the part where the above operation is performed;

[0248] i-3) A step of obtaining the maximum value of the operation value of the addition obtained in step i-1) and the operation value of the addition obtained in step i-2) for each matrix element for the row of the part where the operation is performed, and inputting the maximum value as the operation value of each matrix element; and

[0249] d-2) A step of obtaining the maximum value of the operation value of each matrix element entered in step d-1) i-3) in the order from the first matrix element to the last matrix element of the row of the part where the operation is performed and the operation value of the left matrix element of each matrix element of the row of the part where the operation is performed plus the gap score (k) (k is an integer), inputting the maximum value as the operation value of each matrix element of the part where the operation is performed, and indicating which matrix element among the upper, left diagonal, and left matrix elements of the corresponding matrix element the input operation value is derived from.

[0250] According to another embodiment of the present invention, in step d-1), steps i-1) and i-2) may be performed by performing step i-1) and then performing step i-2), performing step i-2) and then performing step i-1), or performing step i-1) and then performing step i-2), or performing steps i-1) and i-2) simultaneously.

[0251] According to another embodiment of the present invention, the operation is performed in a manner that includes the following steps for each row in order from the first row to the last row of the portion where the operation is performed:

[0252] d-1) i-1) A step of performing a matrix operation of the oligonucleotide sequence for the target nucleic acid sequence for the row of the part where the operation is performed to obtain a match value or mismatch value between nucleotides of the target nucleic acid sequence and the oligonucleotide sequence for each matrix element, and adding the match value or mismatch value for each matrix element and the value of the left diagonal matrix element of each matrix element to obtain an operation value of addition; The above matrix operation is a multiplication of the m × 1 matrix and the 1 × n matrix and an AND operation of 4 bits of nucleotides which are components of the m × 1 matrix and 4 bits of nucleotides which are components of the 1 × n matrix, and if the matrix operation value is equal to 4 bits of any one of the nucleotides which performed the matrix operation, it indicates that the nucleotides which performed the matrix operation match, and the match value is a value expressing the match as a predetermined match score, and if the matrix operation value is different from 4 bits of all the nucleotides which performed the matrix operation, it indicates that the nucleotides which performed the matrix operation mismatch, and the mismatch value is a value expressing the mismatch as a predetermined mismatch score;

[0253] i-2) A step of obtaining an operation value of addition by adding a gap score (k) (k is an integer) to the value of the left matrix element of each matrix element of the row of the part where the above operation is performed;

[0254] i-3) A step of obtaining the maximum value of the operation value of addition obtained in step i-1) and the operation value of addition obtained in step i-2) for each matrix element for the row of the part where the operation is performed, and inputting the maximum value as the operation value of each matrix element; and

[0255] d-2) A step of obtaining the maximum value of the operation value of each matrix element entered in step d-1) i-3) in the order from the first matrix element to the last matrix element of the row of the part where the operation is performed and the operation value of the addition of the gap score (k) (k is an integer) to the value of the matrix element above each matrix element of the row of the part where the operation is performed, and inputting the maximum value as the operation value of each matrix element of the part where the operation is performed, and indicating which matrix element among the upper, left diagonal, and left matrix elements of the corresponding matrix element the input operation value is derived from.

[0256] According to another embodiment of the present invention, in step d-1), steps i-1) and i-2) may be performed by performing step i-1) and then performing step i-2), performing step i-2) and then performing step i-1), or performing step i-1) and then performing step i-2), or performing steps i-1) and i-2) simultaneously.

[0257] The process of performing a matrix operation of the oligonucleotide sequence for the target nucleic acid sequence to obtain a match value or a mismatch value between the nucleotides of the target nucleic acid sequence and the oligonucleotide sequence is the same as step (b) of the first aspect of the present invention, and therefore, description of common contents between them is omitted to avoid excessive complexity of the present specification due to repeated description.

[0258] According to one embodiment of the present invention, the predetermined match score and mismatch score are integers. Specifically, the predetermined match score is an integer selected from -20 to 20, more specifically an integer selected from -10 to 10, and even more specifically an integer selected from -5 to 5.

[0259] In addition, the above-described mismatch score is specifically an integer selected from -20 to 20, more specifically an integer selected from -10 to 10, and even more specifically an integer selected from -5 to 5.

[0260] In Fig. 6, a given match score is 1, and a given mismatch score is -1.

[0261] According to one embodiment of the present invention, the predetermined match score and mismatch score are either identical or different. More specifically, the predetermined match score and mismatch score are different. For example, if the match score is set to 1, the mismatch score can be set to -1, and vice versa.

[0262] According to one embodiment of the present invention, when the matrix operation value is identical to 4 bits of a nucleotide of a target nucleic acid sequence among the nucleotides on which the matrix operation was performed, the nucleotides on which the matrix operation was performed are indicated to be a match, and the match value is a value that expresses the match as a predetermined match score.

[0263] According to one embodiment of the present invention, when the matrix operation value is equal to 4 bits of a nucleotide of an oligonucleotide sequence among the nucleotides on which the matrix operation was performed, the nucleotides on which the matrix operation was performed are indicated to be matched, and the match value is a value that expresses the match as a predetermined match score.

[0264] According to one embodiment of the present invention, the method further includes indicating that, if the matrix operation value is different from 4 bits of a nucleotide of a target nucleic acid sequence among the nucleotides on which the matrix operation was performed, the nucleotides on which the matrix operation was performed are mismatched, and the mismatch value is a value expressing the mismatch as a predetermined mismatch score.

[0265] According to one embodiment of the present invention, the step (d) further includes that if the matrix operation value is identical to 4 bits of a nucleotide of the target nucleic acid sequence among the nucleotides on which the matrix operation was performed, the nucleotides on which the matrix operation was performed match, and the match value is a value expressing the match with a predetermined match score, and if the matrix operation value is different from 4 bits of all the nucleotides on which the matrix operation was performed or is different from 4 bits of a nucleotide of the target nucleic acid sequence, the nucleotides on which the matrix operation was performed mismatch, and the mismatch value is a value expressing the mismatch with a predetermined mismatch score.

[0266] FIG. 6 shows a process of performing a matrix operation on the first nucleotide (base T) of a target nucleic acid sequence and an oligonucleotide sequence for the first row of a portion where an operation is performed, thereby obtaining a match value or mismatch value between nucleotides of the target nucleic acid sequence and the oligonucleotide sequence for each matrix element, and obtaining an operation value of addition between the match value or mismatch value for each matrix element and the value of the left diagonal matrix element of each matrix element. In addition, this process occurs simultaneously in each matrix element of the first row of the portion where an operation is performed.

[0267] The part where the operation is performed in Fig. 6 is the component (C) of the m × n matrix by multiplying the m × 1 matrix and the 1 × n matrix. i,j , 1≤i≤m, 1≤j≤n, m is 13, n is 6). In Fig. 6, a given match score is 1, and a given mismatch score is -1.

[0268] In Fig. 6, for the first row of the section where the operation is performed, the operation values ​​of each matrix element are obtained simultaneously as the operations are performed simultaneously. The simultaneous acquisition of the operation values ​​of each matrix element for the rows of the section where the operation is performed is the most significant feature of the present invention, and this operation method can accelerate the operation speed, thereby providing alignment information of oligonucleotides for the target nucleic acid sequence more quickly.

[0269] Although the operation values ​​of each matrix element are obtained simultaneously, for convenience of explanation, each matrix element is described for the first row of the part where the operation is performed.

[0270] In Fig. 6, the element of row 1 and column 1 of the 13 × 6 matrix (C 1,1 ) is the component of a 13 × 1 matrix (A 1,1 ) base T (0001) and the elements of the 1 × 6 matrix (B 1,1 ) of the base C (0010) represents the matrix operation value 0000 by matrix operation (matrix multiplication and bitwise AND operation), and the matrix operation value 0000 is an element (A) of the 13 × 1 matrix 1,1 ) of the base T 4 bits 0001, and the elements of the 1 × 6 matrix (B 1,1 ) are all different from the 4-bit 0010 of the base C, so the elements of the 13 × 1 matrix (A 1,1 ) and the elements of the 1 × 6 matrix (B 1,1 ) indicates a mismatch, and in this case, a mismatch value of -1 is given. And the component of the first row and first column (C 1,1 ) mismatch value (-1) and the component of the first row and first column (C 1,1 ) is the left diagonal matrix element of the origin (C 0,0 ) and the operation value of addition is -1.

[0271] In Fig. 6, the elements of the 13 × 6 matrix in the 1st row and 2nd column (C 1,2 ) is the component of a 13 × 1 matrix (A 1,1) base T (0001) and the elements of the 1 × 6 matrix (B 1,2 ) of the base A (1000) represents the matrix operation value 0000 by matrix operation (matrix multiplication and bitwise AND operation), and the matrix operation value 0000 is an element of the 13 × 1 matrix (A 1,1 ) of the base T 4 bits 0001, and the elements of the 1 × 6 matrix (B 1,2 ) are all different from the 4-bit 1000 of the base A, so the elements of the 13 × 1 matrix (A 1,1 ) and the elements of the 1 × 6 matrix (B 1,2 ) indicates a mismatch, and in this case, a mismatch value of -1 is given. And the component of the 1st row and 2nd column (C 1,2 ) mismatch value (-1) and the component of the 1st row and 2nd column (C 1,2 ) left diagonal matrix element (C 0,1 ) and the operation value of addition is -6. In this way, each matrix element C of the first row of the part where the operation is performed 1,3 , C 1,4 , C 1,5 , and C 1,6 The operation values ​​are obtained as -11, -16, -21, and -26, respectively.

[0272] In Figure 6, the arrows indicate that operations are performed between each matrix element and the left diagonal matrix element of each matrix element.

[0273] FIG. 7 shows a process of obtaining an operation value of addition by adding a gap score (-5) to the value of the matrix element above each matrix element in the first row of the part where the operation is performed, and then obtaining the maximum value of the operation value of addition by adding a gap score (-5) to the value of the matrix element above each matrix element and the operation value of addition obtained in FIG. 6 for each matrix element for the row of the part where the operation is performed, and obtaining the maximum value as the operation value of each matrix element.

[0274] In Figure 7, the first matrix element of the first row of the part where the operation is performed, the element of row 1 and column 1 (C 1,1 ) is the operation value of -1 obtained in Figure 6 and the component of row 1 and column 1 (C 1,1 ) above the matrix elements (C 0,1 ) is added to the gap score (-5) to obtain the maximum value of the operation value (-10), which is -1. In addition, the component of the 1st row and 2nd column (C 1,2 ) is the operation value of -6 obtained in Figure 6 and the component of row 1 and column 2 (C 1,2 ) above the matrix elements (C 0,2 ) is added to the gap score (-5) by adding the value (-10), and the maximum value of the operation value (-15) is obtained as the operation value. In this way, each matrix element C of the first row of the part where the operation is performed 1,3 , C 1,4 , C 1,5 , and C 1,6 The operation values ​​are obtained as -11, -16, -21, and -26, respectively.

[0275] In Figure 7, arrows indicate that operations are performed between each matrix element and the matrix element above each matrix element. However, although an arrow is displayed in the first column, no operations are performed in the first column.

[0276] FIG. 8 shows a process of obtaining the maximum value of the operation value of each matrix element obtained in FIG. 7 in the order from the first matrix element of the first row to the last matrix element of the part where the operation is performed and the operation value of the addition obtained by adding a gap score (-5) to the value of the left matrix element of each matrix element, and inputting the maximum value as the operation value of each matrix element of the part where the operation is performed, and indicating which matrix element among the upper, left diagonal, and left matrix elements of the corresponding matrix element the input operation value is derived from.

[0277] In Fig. 8, the first matrix element in the part where the operation is performed, the element of row 1 and column 1 (C1,1 ) is the operation value of -1 obtained in Figure 7 and the component of row 1 and column 1 (C 1,1 ) of the left matrix component (C 1,0 ) is added to the value (0) of the gap score (-5), and the maximum value of the operation value (-5) is -1, which is entered as the operation value, and the input operation value is the left diagonal matrix element (C 0,0 ) is derived from the operation value with (the above indication is not shown in Fig. 8). The above indication can be indicated by an arrow, for example, as indicated by the arrow in Fig. 6.

[0278] Also, the components of row 1 and column 2 (C 1,2 ) is the operation value of -6 obtained in Figure 7 and the component of row 1 and column 2 (C 1,2 ) of the left matrix component (C 1,1 ) is added to the gap score (-5) by adding the value (-1), and the maximum value of the operation value (-6) is obtained and input as the operation value, and the input operation value is the left diagonal matrix element (C 0,1 ) and the left matrix element (C 1,1 ) is derived from the operation value (the above indication is not shown in Fig. 8). Even if there are two or more origins of the input operation value, all of them are displayed. However, when backtracking described later, any one of them can be selected and backtracked. In this way, each matrix element C of the first row of the part where the operation is performed 1,3 , C 1,4 , C 1,5 , and C 1,6 The operation values ​​are calculated as -11, -16, -21, and -26, respectively, and their origins are displayed.

[0279] In Figure 8, the arrows indicate that an operation is performed between each matrix element and the left matrix element of each matrix element.

[0280] If we explain the process of obtaining the operation value of each matrix element in the second row of the part where the operation is performed, C2,1 In this case, first, the base C of the target nucleic acid sequence and the base C of the oligonucleotide sequence are matches, so they have a match value of 1, and the match value and the left diagonal matrix element C 1,0 The operation value of addition of the value (0) is 1. Then, C 2,1 C, the upper matrix element of 1,1 The operation value (-6) of the addition by adding the gap score (-5) to the value (-1) is obtained, and the maximum value of the operation value (1) with the left diagonal matrix element is obtained as 1. In this way, each matrix element C of the second row of the part where the operation is performed 2,2 , C 2,3 , C 2,4 , C 2,5 and C 2,6 The operation value of C 2,1 It is obtained simultaneously with the operation value.

[0281] Next, from the first matrix element of the second row to the last matrix element, the operation value is obtained from the relationship between each matrix element and the left matrix element, and the origin of the operation value is indicated. Specifically, C 2,1 In the case of the left matrix element C 2,0 Find the operation value (-5) of addition by adding the gap score (-5) to the value (0) of C 2,1 The maximum value (1) obtained from the relationship between the left diagonal matrix element and the upper matrix element and the maximum value (1) of the operation value (-5) obtained from the relationship with the left matrix element are entered as the operation value and are indicated to be derived from the left diagonal matrix element. Then, each matrix element C of the second row of the part where the operation is performed in this way 2,2 , C 2,3 , C 2,4 , C 2,5 and C 2,6 The operation values ​​are obtained in order and their origins are displayed.

[0282] Figure 9 shows that the operation is performed for each row of the part where the operation is performed in the above-described manner, and the operation values ​​of all matrix elements are input.

[0283] Step (e): Backtracking is performed according to the indication of step d-2) from the matrix elements that satisfy a given score threshold value (250).

[0284] Next, the method of the present invention performs backtracking according to the indication of step d-2) from the matrix element that satisfies a predetermined score threshold value among the operation values ​​of the matrix element of the last column of the part where the operation in which the operation value is input is performed.

[0285] According to one embodiment of the present invention, in the step (e), the case where the operation value satisfies a predetermined score criterion value indicates a case where the operation value is equal to or greater than the predetermined score criterion value.

[0286] The above-described predetermined score reference value can be arbitrarily selected or determined by calculation using a mathematical formula. The above-described predetermined score reference value is, for example, an integer selected from -100 to 100.

[0287] According to one embodiment of the present invention, the predetermined score reference value is calculated by the following mathematical formula 1:

[0288] Mathematical formula 1

[0289] Score threshold value = (mismatch threshold value x mismatch score) + ((oligonucleotide length - mismatch threshold value) x match score)

[0290] In this specification, the score reference value is a value indicating the degree of matching between the aligned target nucleic acid sequence and the nucleotides of the oligonucleotide.

[0291] In the above mathematical expression 1, the length of the oligonucleotide for calculating the score reference value, the mismatch reference value, the mismatch score, and the match score are values ​​known before performing the method of the present invention and are values ​​to be set.

[0292] The mismatch criterion value indicates the criterion value for which a certain number of nucleotides in the oligonucleotide are mismatched. For example, if the mismatch criterion value is 2, it indicates that there are 2 or fewer mismatches between the aligned target nucleic acid sequence and the nucleotides in the oligonucleotide. The mismatch criterion value can be selected from 0 to 60.

[0293] The match score represents a score assigned to a matched nucleotide between the aligned target nucleic acid sequence and the nucleotides of the oligonucleotide, and the match score can be expressed as an integer. Specifically, the match score is an integer selected from -20 to 20, more specifically an integer selected from -10 to 10, and even more specifically an integer selected from -5 to 5.

[0294] The mismatch score represents a score assigned to a mismatched nucleotide between the aligned target nucleic acid sequence and the nucleotides of the oligonucleotide, and the mismatch score can be expressed as an integer. The mismatch score is specifically an integer selected from -20 to 20, more specifically an integer selected from -10 to 10, and even more specifically an integer selected from -5 to 5.

[0295] Figure 10 shows a process of backtracking along the display from a matrix element that satisfies a predetermined score threshold value among the operation values ​​of the matrix elements of the last column of the part where the operation in which the above operation value is input is performed.

[0296] In Fig. 10, when the mismatch criterion value is 2, the mismatch score is -1, the oligonucleotide length is 6, and the match score is 1, the score criterion value according to the above mathematical expression 1 becomes 2. And among the matrix elements of the last column (j = 6) of Fig. 10, the matrix element that satisfies the score criterion value 2 is C 7,6 (2) and C 11,6 (4) and the result of backtracking according to the indication of the origin of the operation value from the above matrix element is C. 7,6 C in the direction of the left diagonal matrix elements from 2,1 It is traced back to C 11,6 C in the direction of the left diagonal matrix elements from 6,1 It is traced back to . As a result of the trace back in Fig. 10, C 1,0 and C 5,0 , but this has no meaning in terms of alignment information.

[0297] Step (f): Providing alignment information of nucleotides of a target nucleic acid sequence and nucleotides of an oligonucleotide sequence (260)

[0298] Finally, the method of the present invention comprises the step of (f) providing alignment information of nucleotides of the target nucleic acid sequence and nucleotides of the oligonucleotide sequence according to the origin of the operation value of the traced matrix element. The alignment information comprises information selected from the group consisting of matches, mismatches and / or gaps between nucleotides of the target nucleic acid sequence and the oligonucleotide sequence, an alignment pattern including the match, mismatch and / or gap information, the number of mismatches, and the position of the oligonucleotide sequence in the aligned target nucleic acid sequence.

[0299] According to one embodiment of the present invention, (i) when the origin of the operation value is a left diagonal matrix element of the matrix element, the alignment information includes match or mismatch information between a nucleotide of a target nucleic acid sequence of a row corresponding to the matrix element and a nucleotide of an oligonucleotide sequence of a column, (ii) when the origin of the operation value is a left matrix element of the matrix element, the alignment information includes gap information between a nucleotide of a target nucleic acid sequence of a row of the matrix element and a nucleotide of a target nucleic acid sequence of a next row, and (iii) when the origin of the operation value is an upper matrix element of the matrix element, the alignment information includes gap information between a nucleotide of a sequence of an oligonucleotide of a column of the matrix element and a nucleotide of an oligonucleotide sequence of a next column.

[0300] FIG. 10 shows a process for providing alignment information of nucleotides of a target nucleic acid sequence and nucleotides of an oligonucleotide sequence according to the origin of the operation value of the traced matrix element, and the results are summarized in Table 2 below: The alignment information includes match or mismatch information of nucleotides of a target nucleic acid sequence of a row corresponding to the matrix element and nucleotides of an oligonucleotide sequence of a column, since the origin of the operation value is a left diagonal matrix element of the matrix element.

[0301]

[0302] In this way, semi-global alignment information of oligonucleotides can be provided with respect to a target nucleic acid sequence, taking gaps into account.

[0303] As used herein, “providing alignment information” includes displaying alignment information on an output device (e.g., a user terminal), enabling users to download alignment information to a storage medium, or building a database of alignment information on a computer.

[0304] The description of local alignment, global alignment, and semi-global alignment described in the method of the first aspect of the present invention is equally applicable to the method of the second aspect of the present invention, and the description of common contents between them is omitted to avoid excessive complexity of this specification due to repeated description.

[0305] According to one embodiment of the present invention, the method provides coverage of oligonucleotides for a plurality of target nucleic acid sequences.

[0306] By performing the method of the present invention for each of a plurality of target nucleic acid sequences, coverage of oligonucleotides for a plurality of target nucleic acid sequences can be provided.

[0307] The description of the plurality of target nucleic acid sequences, nucleotide databases, and coverages described in the method of the first aspect of the present invention also applies to the method of the second aspect of the present invention, and the description of common contents between them is omitted to avoid excessive complexity of the present specification due to repeated description.

[0308] Recording media, devices and programs

[0309] According to another aspect of the present invention, a computer-readable recording medium including instructions for implementing a processor for executing a method for providing alignment information of an oligonucleotide for a target nucleic acid sequence, the method including the following steps: (a) providing a target nucleic acid sequence including m nucleotides and an oligonucleotide sequence including n nucleotides; the target nucleic acid sequence is provided as an m × 1 matrix including m nucleotides as matrix elements, the oligonucleotide sequence is provided as a 1 × n matrix including n nucleotides as matrix elements, and the nucleotides are expressed in 4 bits for each type of base; (b) providing an operation table; the operation table includes a part where an operation is performed and a part where a gap score is input, and the part where the operation is performed includes an element (C) of an m × n matrix by multiplication of the m × 1 matrix and the 1 × n matrix. i,j , 1≤i≤m, 1≤j≤n), and the part where the gap score is input is the origin (C 0,0 ), 0 row component (C 0,j , 1≤j≤n) and 0 column components (C i,0, 1≤i≤m), (c) a step of inputting a gap score into a part of the operation table where a gap score is input; in the 0 row component of the part where the gap score is input, an origin value + (jx gap score(k)) (1≤j≤n, k is an integer) is input for each column component, and in the 0 column component of the part where the gap score is input, an origin value + (ix gap score(k)) (1≤i≤n, k is an integer) is input for each row component, (d) a step of performing an operation and inputting an operation value into a part of the operation table where an operation is performed; The above operation is performed in a manner including the following steps for each row in the order from the first row to the last row of the part where the operation is performed, d-1) a step of obtaining the maximum value of one of the operation values ​​of addition in the relation with the matrix element above i-1) and the operation values ​​of addition in the relation with the matrix element on the left side i-2) and the operation value of addition in the relation with the left diagonal matrix element of each matrix element for the row of the part where the operation is performed and inputting the maximum value as the operation value of each matrix element; The operation value of addition in the relationship with the matrix elements above i-1) is the operation value of addition obtained by adding a gap score (k, k is an integer) to the value of the matrix element above each matrix element of the row of the part where the operation is performed, and the operation value of addition in the relationship with the matrix elements on the left of i-2) is the operation value of addition obtained by adding a gap score (k, k is an integer) to the value of the matrix element on the left of each matrix element of the row of the part where the operation is performed.The operation value of addition in the relation with the left diagonal matrix element of the above i-3) is an operation value of addition obtained by performing a matrix operation of the oligonucleotide sequence for the target nucleic acid sequence for the row of the part where the operation is performed, obtaining a match value or a mismatch value between the nucleotides of the target nucleic acid sequence and the oligonucleotide sequence for each matrix element, and adding the match value or mismatch value for each matrix element and the value of the left diagonal matrix element of each matrix element, and the matrix operation is a multiplication of the m × 1 matrix and a 1 × n matrix and an AND operation of 4 bits of nucleotides which are components of the m × 1 matrix and 4 bits of nucleotides which are components of the 1 × n matrix, and when the matrix operation value is the same as 4 bits of any one of the nucleotides on which the matrix operation was performed, it indicates that the nucleotides on which the matrix operation was performed match, and the match value is a value expressing the match as a predetermined match score, and the matrix operation value is a value of the matrix operation. If all 4 bits of the performed nucleotides are different, it indicates that the nucleotides that performed the matrix operation are mismatched, and the mismatch value is a value that expresses the mismatch as a predetermined mismatch score, and d-2) the maximum value of the operation value of each matrix element input in step d-1) in the order from the first matrix element to the last matrix element of the row of the part where the operation is performed and the operation value of any one of i-1) and i-2) that is not selected in step d-1) is obtained, and the maximum value is input as the operation value of each matrix element of the part where the operation is performed, and the input operation value is above the corresponding matrix element,A step of indicating which matrix element among the left diagonal and left matrix elements is the origin of the value; (e) a step of performing backtracking from a matrix element that satisfies a predetermined score threshold value among the operation values ​​of the matrix elements of the last column of the part where the operation in which the operation value is input is performed, according to the indication of step d-2); and (f) a step of providing alignment information of nucleotides of the target nucleic acid sequence and nucleotides of the oligonucleotide sequence according to the origin of the operation value of the backtracked matrix element; the alignment information includes information selected from the group consisting of matches, mismatches and / or gaps between nucleotides of the target nucleic acid sequence and the oligonucleotide sequence, an alignment pattern including the match, mismatch and / or gap information, the number of mismatches, and a position of the oligonucleotide sequence in the aligned target nucleic acid sequence.

[0310] According to another aspect of the present invention, there is provided a computer program stored in a computer-readable recording medium, which implements a processor for executing a method for providing alignment information of an oligonucleotide for a target nucleic acid sequence, the method comprising the steps of: (a) providing a target nucleic acid sequence including m nucleotides and an oligonucleotide sequence including n nucleotides; the target nucleic acid sequence is provided as an m × 1 matrix including m nucleotides as matrix elements, the oligonucleotide sequence is provided as a 1 × n matrix including n nucleotides as matrix elements, and the nucleotides are expressed in 4 bits for each type of base; (b) providing an operation table; the operation table includes a part where an operation is performed and a part where a gap score is input, and the part where the operation is performed includes an element (C) of an m × n matrix by multiplication of the m × 1 matrix and the 1 × n matrix. i,j , 1≤i≤m, 1≤j≤n), and the part where the gap score is input is the origin (C 0,0 ), 0 row component (C 0,j , 1≤j≤n) and 0 column components (C i,0, 1≤i≤m), (c) a step of inputting a gap score into a part of the operation table where a gap score is input; in the 0 row component of the part where the gap score is input, an origin value + (jx gap score(k)) (1≤j≤n, k is an integer) is input for each column component, and in the 0 column component of the part where the gap score is input, an origin value + (ix gap score(k)) (1≤i≤n, k is an integer) is input for each row component, (d) a step of performing an operation and inputting an operation value into a part of the operation table where an operation is performed; The above operation is performed in a manner including the following steps for each row in the order from the first row to the last row of the part where the operation is performed, d-1) a step of obtaining the maximum value of one of the operation values ​​of addition in the relation with the matrix element above i-1) and the operation values ​​of addition in the relation with the matrix element on the left side i-2) and the operation value of addition in the relation with the left diagonal matrix element of each matrix element for the row of the part where the operation is performed and inputting the maximum value as the operation value of each matrix element; The operation value of addition in the relationship with the matrix elements above i-1) is the operation value of addition obtained by adding a gap score (k, k is an integer) to the value of the matrix element above each matrix element of the row of the part where the operation is performed, and the operation value of addition in the relationship with the matrix elements on the left of i-2) is the operation value of addition obtained by adding a gap score (k, k is an integer) to the value of the matrix element on the left of each matrix element of the row of the part where the operation is performed.The operation value of addition in the relation with the left diagonal matrix element of the above i-3) is an operation value of addition obtained by performing a matrix operation of the oligonucleotide sequence for the target nucleic acid sequence for the row of the part where the operation is performed, obtaining a match value or a mismatch value between the nucleotides of the target nucleic acid sequence and the oligonucleotide sequence for each matrix element, and adding the match value or mismatch value for each matrix element and the value of the left diagonal matrix element of each matrix element, and the matrix operation is a multiplication of the m × 1 matrix and a 1 × n matrix and an AND operation of 4 bits of nucleotides which are components of the m × 1 matrix and 4 bits of nucleotides which are components of the 1 × n matrix, and when the matrix operation value is the same as 4 bits of any one of the nucleotides on which the matrix operation was performed, it indicates that the nucleotides on which the matrix operation was performed match, and the match value is a value expressing the match as a predetermined match score, and the matrix operation value is a value of the matrix operation. If all 4 bits of the performed nucleotides are different, it indicates that the nucleotides that performed the matrix operation are mismatched, and the mismatch value is a value that expresses the mismatch as a predetermined mismatch score, and d-2) the maximum value of the operation value of each matrix element input in step d-1) in the order from the first matrix element to the last matrix element of the row of the part where the operation is performed and the operation value of any one of i-1) and i-2) that is not selected in step d-1) is obtained, and the maximum value is input as the operation value of each matrix element of the part where the operation is performed, and the input operation value is above the corresponding matrix element,A step of indicating which matrix element among the left diagonal and left matrix elements is the origin of the value; (e) a step of performing backtracking from a matrix element that satisfies a predetermined score threshold value among the operation values ​​of the matrix elements of the last column of the part where the operation in which the operation value is input is performed, according to the indication of step d-2); and (f) a step of providing alignment information of nucleotides of the target nucleic acid sequence and nucleotides of the oligonucleotide sequence according to the origin of the operation value of the backtracked matrix element; the alignment information includes information selected from the group consisting of matches, mismatches and / or gaps between nucleotides of the target nucleic acid sequence and the oligonucleotide sequence, an alignment pattern including the match, mismatch and / or gap information, the number of mismatches, and a position of the oligonucleotide sequence in the aligned target nucleic acid sequence.

[0311] According to another aspect of the present invention, there is provided an apparatus for providing alignment information of an oligonucleotide for a target nucleic acid sequence, the apparatus comprising (a) a computer processor, and (b) a computer-readable recording medium of the present invention coupled to the computer processor.

[0312] The recording medium, device, and computer program of the present invention enable the method of the present invention described above to be implemented on a computer. The description of common contents among them is omitted to avoid excessive complexity of this specification due to repeated description.

[0313] The program instructions, when executed by a processor, cause the processor to perform the method of the present invention described above. The program instructions for performing a method for providing alignment information of an oligonucleotide for a target nucleic acid sequence may include the following instructions: (i) instructions for providing a target nucleic acid sequence comprising m nucleotides and an oligonucleotide sequence comprising n nucleotides; (ii) instructions for providing a calculation table; (iii) instructions for inputting a gap score into a gap score input portion of the calculation table; (iv) instructions for performing an operation and inputting an operation value into a portion of the calculation table where the operation is performed; (v) a step of performing backtracking according to the indication from a matrix element that satisfies a predetermined score threshold value among the operation values ​​of the matrix elements of the last column of the portion where the operation is performed where the operation value is input; And (vi) instructions to provide (e.g., display on an output device) alignment information of nucleotides of a target nucleic acid sequence and nucleotides of an oligonucleotide sequence according to the origin of the operation value of the above-described backtracked matrix component.

[0314] The description of the processor, storage medium, method of providing alignment information, instructions for implementing the processor, and computer processor described in the first aspect of the present invention are equally applicable to the second aspect of the present invention, and description of common contents between them is omitted to avoid excessive complexity of the present specification due to repeated description.

[0315] The features and advantages of the present invention are summarized as follows:

[0316] (a) In the past, when providing alignment information or coverage of oligonucleotides using local alignment (specifically, BLAST) for the nucleic acid sequence itself, alignment information or coverage for a portion of the oligonucleotide sequence (partial length) was provided due to the nature of local alignment that checks for local mismatches. Alternatively, to overcome this problem, a program additionally including a repair method was required. However, even when the repair method was used, there was a problem in that, when the number of nucleic acid sequences was very large, the match or mismatch pattern for the entire oligonucleotide sequence (full length) could not be shown due to a failure of the memory, etc.

[0317] (b) The method of the present invention, which can provide semi-global alignment of oligonucleotides for a target nucleic acid sequence by applying dynamic programming, can provide alignment information for the entire length of oligonucleotides more accurately and at a faster speed with fewer computer resources than conventional methods, and can provide coverage of oligonucleotides for a plurality of target nucleic acid sequences.

[0318] Figure 1 is a flowchart of processes for implementing the method of the present invention according to one embodiment of the present invention.

[0319] FIG. 2 illustrates a process of performing a matrix operation of an oligonucleotide sequence for a target nucleic acid sequence in an operation table according to one embodiment of the present invention to obtain a match value or mismatch value between nucleotides of the target nucleic acid sequence and the oligonucleotide sequence.

[0320] FIG. 3 shows a process of performing a trace operation of a 6 × 6 square matrix in a 13 × 6 matrix on which a matrix operation is performed according to one embodiment of the present invention to obtain the sum of match values ​​and / or mismatch values ​​of diagonal elements of the 6 × 6 square matrix.

[0321] Figure 4 is a flowchart of processes for implementing the method of the present invention according to another embodiment of the present invention.

[0322] FIG. 5 shows a process of inputting a gap score into a part of an operation table where an operation of a target nucleic acid sequence and an oligonucleotide sequence is performed according to another embodiment of the present invention.

[0323] FIG. 6 shows a process of performing a matrix operation on the first nucleotide (base T) of a target nucleic acid sequence and an oligonucleotide sequence for the first row of a portion where an operation is performed according to another embodiment of the present invention, thereby obtaining a match value or mismatch value between nucleotides of the target nucleic acid sequence and the oligonucleotide sequence for each matrix element, and obtaining an operation value of the addition of the match value or mismatch value for each matrix element and the value of the left diagonal matrix element of each matrix element.

[0324] FIG. 7 shows a process of obtaining an operation value of addition by adding a gap score (-5) to the value of the matrix element above each matrix element of the first row of a part where an operation is performed according to another embodiment of the present invention, and then obtaining a maximum value of the operation value of addition by adding a gap score (-5) to the value of the matrix element above each matrix element and the operation value of addition obtained in FIG. 6 for each matrix element for the row of the part where the operation is performed, and obtaining the maximum value as the operation value of each matrix element.

[0325] FIG. 8 shows a process of obtaining the maximum value of the operation value of each matrix element obtained in FIG. 7 in the order from the first matrix element of the first row to the last matrix element of the part where the operation is performed, and the operation value of the addition obtained by adding a gap score (-5) to the value of the left matrix element of each matrix element, and inputting the maximum value as the operation value of each matrix element of the part where the operation is performed, and indicating which matrix element among the upper, left diagonal, and left matrix elements of the corresponding matrix element the input operation value is derived from, according to another embodiment of the present invention.

[0326] FIG. 9 shows that the operation values ​​of all matrix elements are input by performing the operation for each row of the part where the operation is performed according to another implementation example of the present invention.

[0327] FIG. 10 shows a process of backtracking along a mark from a matrix element that satisfies a predetermined score threshold value among the operation values ​​of the matrix elements of the last column of a part where an operation is performed, in which an operation value is input, according to another embodiment of the present invention.

[0328] Hereinafter, the present invention will be described in more detail through examples. These examples are intended solely to illustrate the present invention more specifically. It will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples, in accordance with the gist of the present invention.

[0329] Example

[0330] Comparative Example 1: Providing alignment information and coverage of oligonucleotides for coronavirus nucleic acid sequences using the BLAST-based SCT (Sequence Coverage Tool).

[0331] (1) Provision of oligonucleotides

[0332] We used primer and probe sequence information for amplification and detection of SARS-CoV-2 provided by the CDC as oligonucleotide sequences. Sequence information can be found at CDC's Influenza SARS-CoV-2 Multiplex Assay | CDC. Among the sequences provided here, the forward primer SC2-F (5'-CTGCAGATTTGGATGATTTCTCC-3': SEQ ID NO:3) was used.

[0333] (2) Provision of nucleotide database

[0334] The nucleic acid sequences included in the nucleotide database were sequence information from GISAID (gisaid.org), a publicly available SARS-CoV-2 genome sequence database. Sequences listed in GISAID have collection date information, which indicates the time the sequence was collected. Only sequences up to December 31, 2020, were collected and used in the nucleotide database.

[0335] The GISAID SARS-CoV-2 genome sequences collected through the above method total 722,704 genome sequences, and the data file was saved in the FASTA file format, which is generally used for sequence storage, with a size of 21,433,967,219 bytes (20 Gb).

[0336] (3) Searching in nucleic acid sequences using SCT

[0337] SCT internally uses BLAST to perform pairwise local alignments between each oligonucleotide sequence and target nucleic acid sequences contained in the nucleotide database. The parameters used in SCT are listed in Table 3 below:

[0338]

[0339] SCT was performed on nucleic acid sequences, and analysis of the nucleotide database took approximately 225 minutes. The analysis yielded hit information satisfying the above parameters, and the top four alignment patterns with the highest number of hits are summarized in Table 4 below.

[0340]

[0341] The above output information is the result of BLAST analysis, which is a local alignment, and is expanded to the entire range of the oligonucleotide sequence.

[0342] Example 1: Providing alignment information and coverage of oligonucleotides for coronavirus nucleic acid sequences using OligoSCAN without considering gaps.

[0343] (1) Provision of oligonucleotides

[0344] Oligonucleotides were provided in the same manner as in Comparative Example 1.

[0345] (2) Provision of nucleotide database

[0346] A nucleotide database was provided in the same manner as in Comparative Example 1.

[0347] (3) Searching in nucleic acid sequences using the semi-global alignment method

[0348] OligoScan refers to a series of analysis pipelines (programs) consisting of sequential calls to analysis package functions, and is implemented as an algorithm implemented in a Python environment using bit operations and matrix operations. The internal algorithm is modified into a semi-global alignment method so that only the global alignment of oligonucleotides can be considered. However, Example 1 used OligoScan, which does not consider gaps.

[0349] The command to run the Oligoscan analysis pipeline is as follows. The parameters are listed in Table 5 below. Table 6 shows the information contained in the analysis parameters file.

[0350]

[0351]

[0352] Analysis of nucleic acid sequences using oligoscan, which ignores gaps, took approximately 39 minutes. Hit information satisfying the above parameters was provided, and the top four alignment patterns with the highest number of hits are summarized in Table 7 below.

[0353]

[0354] Example 1, compared to Example 2 described below, confirmed a similar overall pattern, but the number of mismatches was 1 to 2 higher because it did not include gaps. In addition, the coverage of an oligonucleotide can be calculated through the ratio of the number of alignment patterns satisfying the criteria of a given match type to the number of target nucleic acid sequences that serve as a reference.

[0355] Example 2: Providing alignment information and coverage of oligonucleotides for coronavirus nucleic acid sequences using OligoSCAN considering gaps.

[0356] (1) Provision of oligonucleotides

[0357] Oligonucleotides were provided in the same manner as in Comparative Example 1.

[0358] (2) Provision of nucleotide database

[0359] A nucleotide database was provided in the same manner as in Comparative Example 1.

[0360] (3) Searching in nucleic acid sequences using the semi-global alignment method

[0361] The same method as Example 1 was used, but Example 2 used oligoscan considering the gap.

[0362] Gap-adjusted oligoscan analysis of nucleic acid sequences took approximately 45 minutes. Hit information satisfying the above parameters was provided, and the top four alignment patterns with the highest number of hits are summarized in Table 8 below.

[0363]

[0364] Compared to Comparative Example 1, the analysis was performed approximately 5 times faster, and the hit results showed that patterns with fewer mismatches, including gaps, were discovered, or patterns that had not been previously discovered were found.

[0365] In the alignment pattern representing the above match type -7|N, the horizontal bar (-) of the oligonucleotide sequence represents gap information, and the minus (-) sign in the above match type -7|N indicates that the oligonucleotide sequence as the query sequence and the target nucleic acid sequence included in the nucleotide database have been confirmed to be reverse or reverse complementary mismatched.

[0366] Meanwhile, it was confirmed that the coverage of the oligonucleotide representing the match type 0|N among the above four alignment patterns was 95.5%.

[0367] Comparative Example 2: Providing alignment information and coverage of oligonucleotides for Bacteroides fragilis nucleic acid sequences using SCT (Sequence Coverage Tool) based on BLAST.

[0368] (1) Provision of oligonucleotides

[0369] A dual-specificity oligonucleotide (DPO) primer was used as an oligonucleotide, and the sequence information is as follows: DPO-F (5'- GACTCTAGAGAGACTGCCGTCGTAAIIIIIGAGGAAGGTG-3':SEQ ID NO:10, forward primer)

[0370] (2) Provision of nucleotide database

[0371] For Bacteroides fragilis (taxon id: 817), the subtaxon sequence was collected from the GenBank database and used as a nucleotide database.

[0372] A total of 49,889 genome sequences were collected, and the data file was saved in the FASTA file format, which is generally used for sequence storage, with a size of 1,899,478,690 bytes (1.76 Gb).

[0373] (3) Searching in nucleic acid sequences using SCT

[0374] It was performed in the same manner as Comparative Example 1. The parameters shown in Table 3 were used as is, and only the input oligonucleotide sequence and target nucleotide sequence information were changed.

[0375] SCT was performed on nucleic acid sequences, and analysis was performed on the nucleotide database for approximately 10 minutes. The analysis yielded hits satisfying the above parameters, and the top four alignment patterns with the highest number of hits are summarized in Table 9 below.

[0376]

[0377] The above output information is the result of BLAST analysis, which is a local alignment, and is expanded to the entire range of the oligonucleotide sequence.

[0378] Example 3: Providing alignment information and coverage of oligonucleotides for Bacteroides fragilis nucleic acid sequences using OligoSCAN without considering gaps.

[0379] (1) Provision of oligonucleotides

[0380] Oligonucleotides were provided in the same manner as in Comparative Example 2.

[0381] (2) Provision of nucleotide database

[0382] A nucleotide database was provided in the same manner as in Comparative Example 2.

[0383] (3) Searching in nucleic acid sequences using the semi-global alignment method

[0384] The same method as Example 1 was used, except that the changed parts were the calendar sequence information and the target nucleotide sequence information.

[0385] Analysis of nucleic acid sequences using oligoscan, which ignores gaps, took approximately 1 minute and 40 seconds. Hit information satisfying the above parameters was provided, and the top four binding patterns with the highest number of hits are summarized in Table 10 below.

[0386]

[0387] Comparing with Comparative Example 2, it was confirmed that a high number of good match-type patterns were present. In addition, it was confirmed that the results of Example 3 were similar to those of Example 4 described below, and it was confirmed that a higher number of mismatches occurred in some patterns due to the nature of the algorithm not considering gaps.

[0388] Example 4: Providing alignment information and coverage of oligonucleotides for Bacteroides fragilis nucleic acid sequences using OligoSCAN considering gaps.

[0389] (1) Provision of oligonucleotides

[0390] Oligonucleotides were provided in the same manner as in Comparative Example 2.

[0391] (2) Provision of nucleotide database

[0392] A nucleotide database was provided in the same manner as in Comparative Example 2.

[0393] (3) Searching in nucleic acid sequences using the semi-global alignment method

[0394] The same method as Example 2 was used, except that the changed parts were the calendar sequence information and the target nucleotide sequence information.

[0395] Gap-adjusted oligoscan analysis of nucleic acid sequences took approximately 1 minute and 40 seconds. Hit information satisfying the above parameters was provided, and the top four binding patterns with the highest number of hits are summarized in Table 11 below.

[0396]

[0397] Compared to Comparative Example 2, it was confirmed that a high number of good patterns of the match type were present. In addition, Comparative Example 2 used BLAST and only used the front part of the inosine linker when processing the DPO primer, so it was confirmed that many mismatches occurred in the back part of the inosine linker. On the other hand, in Example 4, since alignment was performed on the entire primer sequence, it was confirmed that the number of mismatches was low even in the back part of the inosine linker.

[0398] While specific aspects of the present invention have been described in detail above, it should be apparent to those skilled in the art that these specific descriptions are merely preferred implementation examples and are not intended to limit the scope of the present invention. Therefore, the substantial scope of the present invention is defined by the appended claims and their equivalents.

Claims

1. A computer-implemented method for providing alignment information of an oligonucleotide to a target nucleic acid sequence, comprising the following steps: (a) providing a target nucleic acid sequence including m nucleotides and an oligonucleotide sequence including n nucleotides; wherein the target nucleic acid sequence is provided as an m × 1 matrix including m nucleotides as matrix elements, and the oligonucleotide sequence is provided as a 1 × n matrix including n nucleotides as matrix elements, and the nucleotides are expressed in 4 bits for each type of base, (b) performing a matrix operation of the oligonucleotide sequence for the target nucleic acid sequence to obtain a match value or a mismatch value between nucleotides of the target nucleic acid sequence and the oligonucleotide sequence; the matrix operation is a multiplication of the m × 1 matrix and a 1 × n matrix and an AND operation of 4 bits of nucleotides that are components of the m × 1 matrix and 4 bits of nucleotides that are components of the 1 × n matrix, and if the matrix operation value is identical to 4 bits of any one of the nucleotides on which the matrix operation was performed, the nucleotides on which the matrix operation was performed are in a match, and the match value is a value expressing the match as a predetermined match score, and if the matrix operation value is different from 4 bits of all of the nucleotides on which the matrix operation was performed, the nucleotides on which the matrix operation was performed are in a mismatch, and the mismatch value is a value expressing the mismatch as a predetermined mismatch score, (c) a step of performing a trace operation on an n × n square matrix in an m × n matrix on which the matrix operation is performed to obtain the sum of match values ​​and / or mismatch values ​​of diagonal elements of the n × n square matrix; and (d) providing alignment information of nucleotides of a target nucleic acid sequence in a row component corresponding to a diagonal component of an n × n square matrix having a sum satisfying a predetermined threshold value, and nucleotides of an oligonucleotide sequence in a column component, when the sum satisfies a predetermined threshold value for match or mismatch; wherein the alignment information includes information selected from the group consisting of matches and / or mismatches between nucleotides of the target nucleic acid sequence and the oligonucleotide sequence, an alignment pattern including match and / or mismatch information, the number of mismatches, and a position of the oligonucleotide sequence in the aligned target nucleic acid sequence.

2. A computer-implemented method for providing alignment information of oligonucleotides for a target nucleic acid sequence, comprising the following steps: (a) providing a target nucleic acid sequence including m nucleotides and an oligonucleotide sequence including n nucleotides; wherein the target nucleic acid sequence is provided as an m × 1 matrix including m nucleotides as matrix elements, and the oligonucleotide sequence is provided as a 1 × n matrix including n nucleotides as matrix elements, and the nucleotides are expressed in 4 bits for each type of base, (b) a step of providing an operation table; the operation table includes a part where an operation is performed and a part where a gap score is input, and the part where the operation is performed includes an element (C) of an m × n matrix by multiplying the m × 1 matrix and the 1 × n matrix. i,j , 1≤i≤m, 1≤j≤n), and the part where the gap score is input is the origin (C 0,0 ), 0 row component (C 0,j , 1≤j≤n) and 0 column components (C i,0 , 1≤i≤m), (c) a step of inputting a gap score into a part of the above operation table where a gap score is input; in the 0 row component of the part where the gap score is input, an origin value + (jx gap score (k)) (1≤j≤n, k is an integer) is input for each column component, and in the 0 column component of the part where the gap score is input, an origin value + (ix gap score (k)) (1≤i≤n, k is an integer) is input for each row component. (d) a step of performing an operation and inputting an operation value into a section of the operation table where the operation is performed; the operation is performed in a manner including the following steps for each row in order from the first row to the last row of the section where the operation is performed: d-1) A step of obtaining the maximum value of one of the addition operation values ​​selected from among the addition operation values ​​in the relationship with the matrix element i-1) above and the addition operation values ​​in the relationship with the matrix element on the left i-2) and the addition operation values ​​in the relationship with the left diagonal matrix element i-3) for the row of the part where the above operation is performed, and inputting the maximum value as the operation value of each matrix element;The operation value of addition in the above i-1) matrix element and relationship is an operation value of addition obtained by adding a gap score (k, k is an integer) to the value of the matrix element above each matrix element of the row of the part where the operation is performed, the operation value of addition in the above i-2) left matrix element and relationship is an operation value of addition obtained by adding a gap score (k, k is an integer) to the value of the left matrix element of each matrix element of the row of the part where the operation is performed, and the operation value of addition in the above i-3) left diagonal matrix element and relationship is an operation value of addition obtained by performing a matrix operation of the oligonucleotide sequence for the target nucleic acid sequence for the row of the part where the operation is performed to obtain a match value or mismatch value between the nucleotides of the target nucleic acid sequence and the oligonucleotide sequence for each matrix element, and adding the match value or mismatch value for each matrix element and the value of the left diagonal matrix element of each matrix element, and The matrix operation is a multiplication of the m × 1 matrix and the 1 × n matrix and an AND operation of 4 bits of nucleotides which are components of the m × 1 matrix and 4 bits of nucleotides which are components of the 1 × n matrix, and if the matrix operation value is equal to 4 bits of any one of the nucleotides which performed the matrix operation, it indicates that the nucleotides which performed the matrix operation match, and the match value is a value expressing the match with a predetermined match score, and if the matrix operation value is different from 4 bits of all the nucleotides which performed the matrix operation, it indicates that the nucleotides which performed the matrix operation mismatch, and the mismatch value is a value expressing the mismatch with a predetermined mismatch score, and; d-2) A step of obtaining the maximum value of the operation value of each matrix element input in step d-1) in the order from the first matrix element to the last matrix element of the row of the part where the operation is performed and the operation value of the addition of any one of i-1) and i-2) not selected in step d-1), inputting the maximum value as the operation value of each matrix element of the part where the operation is performed, and indicating which matrix element among the upper, left diagonal, and left matrix elements of the corresponding matrix element the input operation value is derived from; (e) a step of performing backtracking according to the indication of step d-2) from the matrix element that satisfies a predetermined score threshold value among the operation values ​​of the matrix element of the last column of the part where the operation in which the operation value is input is performed; and (f) a step of providing alignment information of nucleotides of a target nucleic acid sequence and nucleotides of an oligonucleotide sequence according to the origin of the operation value of the traced matrix component; the alignment information includes information selected from the group consisting of matches, mismatches and / or gaps between nucleotides of the target nucleic acid sequence and the oligonucleotide sequence, an alignment pattern including the match, mismatch and / or gap information, the number of mismatches, and the position of the oligonucleotide sequence in the aligned target nucleic acid sequence.

3. A method according to claim 1 or 2, characterized in that the oligonucleotide is a primer or a probe.

4. A method according to claim 1 or 2, characterized in that m and n are natural numbers.

5. A method according to claim 1 or 2, characterized in that m has a number greater than n.

6. A method according to claim 1 or 2, characterized in that the base comprises a degenerate base and / or a universal base.

7. A method according to claim 1 or 2, characterized in that the oligonucleotide is an oligonucleotide represented by the following formula (I): 5'-XYZ-3' (I) In the above formula, X represents a site including a hybridization nucleotide sequence that hybridizes to a target nucleic acid sequence, Y represents a cleavage site including two or more consecutive bases that do not participate in Watson-Crick base pairing, and Z represents a site including a hybridization nucleotide sequence that hybridizes to a target nucleic acid sequence.

8. A method according to claim 1 or 2, characterized in that the predetermined match score and mismatch score are integers.

9. A method characterized in that, in the first or second paragraph, if the matrix operation value is identical to 4 bits of a nucleotide of the target nucleic acid sequence among the nucleotides on which the matrix operation was performed, the nucleotides on which the matrix operation was performed are matched, and the match value is a value expressing the match as a predetermined match score.

10. A method characterized in that, in the first or second paragraph, when the matrix operation value is equal to 4 bits of a nucleotide of an oligonucleotide sequence among the nucleotides on which the matrix operation was performed, the nucleotides on which the matrix operation was performed are matched, and the match value is a value expressing the match as a predetermined match score.

11. In the first or second paragraph, the method is characterized in that, if the matrix operation value is different from 4 bits of a nucleotide of a target nucleic acid sequence among the nucleotides on which the matrix operation was performed, the nucleotides on which the matrix operation was performed are mismatched, and the mismatch value is a value that expresses the mismatch as a predetermined mismatch score.

12. A method characterized in that in the first paragraph, if the sum satisfies a predetermined match criterion value, it indicates that the sum is greater than or equal to the predetermined match criterion value, and if the sum satisfies a predetermined mismatch criterion value, it indicates that the sum is less than or equal to the predetermined mismatch criterion value.

13. A method according to claim 1 or 2, characterized in that the method provides coverage of oligonucleotides for a plurality of target nucleic acid sequences.

14. A method according to claim 2, characterized in that the origin value is an integer.

15. In the second paragraph, the method is characterized in that the operation is performed in a manner including the following steps for each row in order from the first row to the last row of the part where the operation is performed: d-1) A step of obtaining the maximum value of the operation value of addition in relation to the matrix element i-1) above and the operation value of addition in relation to the left diagonal matrix element i-3 for the row of the part where the above operation is performed, and inputting the maximum value as the operation value of each matrix element; The operation value of addition in the above i-1) matrix element and relationship is an operation value of addition obtained by adding a gap score (k, k is an integer) to the value of the matrix element above each matrix element of the row of the part where the operation is performed, and the operation value of addition in the above i-3) left diagonal matrix element and relationship is an operation value of addition obtained by performing a matrix operation of the oligonucleotide sequence for the target nucleic acid sequence for the row of the part where the operation is performed to obtain a match value or mismatch value between the nucleotides of the target nucleic acid sequence and the oligonucleotide sequence for each matrix element, and adding the match value or mismatch value for each matrix element and the value of the left diagonal matrix element of each matrix element, and the matrix operation is a multiplication of the m × 1 matrix and a 1 × n matrix and an AND operation of 4 bits of nucleotides which are components of the m × 1 matrix and 4 bits of nucleotides which are components of the 1 × n matrix, and the matrix operation value is the If the 4 bits of any one of the nucleotides that performed the matrix operation are identical, the nucleotides that performed the matrix operation are indicated to be a match, and the match value is a value expressing the match as a predetermined match score, and if the matrix operation value is different from the 4 bits of all the nucleotides that performed the matrix operation, the nucleotides that performed the matrix operation are indicated to be a mismatch, and the mismatch value is a value expressing the mismatch as a predetermined mismatch score,And d-2) obtaining the maximum value of the operation value of each matrix element entered in step d-1) in the order from the first matrix element to the last matrix element of the row of the part where the operation is performed and the operation value of addition in the relationship with the left matrix element of i-2) respectively, and inputting the maximum value as the operation value of each matrix element of the part where the operation is performed and indicating which matrix element among the upper, left diagonal, and left matrix element of the corresponding matrix element the input operation value is derived from; The operation value of addition in the relationship with the left matrix element of i-2) is the operation value of addition obtained by adding a gap score (k, k is an integer) to the value of the left matrix element of each matrix element of the row of the part where the operation is performed.

16. In the second paragraph, the method is characterized in that the operation is performed in a manner including the following steps for each row in order from the first row to the last row of the part where the operation is performed: d-1) i-1) A step of performing a matrix operation of the oligonucleotide sequence for the target nucleic acid sequence for the row of the part where the operation is performed to obtain a match value or mismatch value between nucleotides of the target nucleic acid sequence and the oligonucleotide sequence for each matrix element, and adding the match value or mismatch value for each matrix element and the value of the left diagonal matrix element of each matrix element to obtain an operation value of addition; The above matrix operation is a multiplication of the m × 1 matrix and the 1 × n matrix and an AND operation of 4 bits of nucleotides which are components of the m × 1 matrix and 4 bits of nucleotides which are components of the 1 × n matrix, and if the matrix operation value is equal to 4 bits of any one of the nucleotides which performed the matrix operation, it indicates that the nucleotides which performed the matrix operation match, and the match value is a value expressing the match as a predetermined match score, and if the matrix operation value is different from 4 bits of all the nucleotides which performed the matrix operation, it indicates that the nucleotides which performed the matrix operation mismatch, and the mismatch value is a value expressing the mismatch as a predetermined mismatch score; i-2) A step of obtaining an operation value of addition by adding a gap score (k) (k is an integer) to the value of the matrix element above each matrix element of the row of the part where the above operation is performed; i-3) A step of obtaining the maximum value of the operation value of the addition obtained in step i-1) and the operation value of the addition obtained in step i-2) for each matrix element for the row of the part where the operation is performed, and inputting the maximum value as the operation value of each matrix element; and d-2) A step of obtaining the maximum value of the operation value of each matrix element entered in step d-1) i-3) in the order from the first matrix element to the last matrix element of the row of the part where the operation is performed and the operation value of the left matrix element of each matrix element of the row of the part where the operation is performed plus the gap score (k) (k is an integer), inputting the maximum value as the operation value of each matrix element of the part where the operation is performed, and indicating which matrix element among the upper, left diagonal, and left matrix elements of the corresponding matrix element the input operation value is derived from.

17. A method according to claim 2, characterized in that in the step (e), when the operation value satisfies a predetermined score criterion value, it indicates a case where the operation value is equal to or greater than the predetermined score criterion value.

18. In the second paragraph, the method is characterized in that the predetermined score reference value is calculated by the following mathematical formula 1: Mathematical formula 1 Score threshold value = (mismatch threshold value x mismatch score) + ((oligonucleotide length - mismatch threshold value) x match score) 19. In the second paragraph, (i) when the origin of the operation value is a left diagonal matrix element of the matrix element, the alignment information includes match or mismatch information between a nucleotide of a nucleic acid sequence of a row corresponding to the matrix element and a nucleotide of an oligonucleotide of a column, (ii) when the origin of the operation value is a left matrix element of the matrix element, the alignment information includes gap information between a nucleotide of a nucleic acid sequence of a row of the matrix element and a nucleotide of a nucleic acid sequence of a next row, and (iii) when the origin of the operation value is an upper matrix element of the matrix element, the alignment information includes gap information between a nucleotide of an oligonucleotide of a column of the matrix element and a nucleotide of an oligonucleotide of a next column. A method characterized in that.

20. A computer-readable recording medium comprising instructions for implementing a processor for executing a method for providing alignment information of an oligonucleotide to a target nucleic acid sequence, the method comprising the following steps: (a) providing a target nucleic acid sequence including m nucleotides and an oligonucleotide sequence including n nucleotides; wherein the target nucleic acid sequence is provided as an m × 1 matrix including m nucleotides as matrix elements, and the oligonucleotide sequence is provided as a 1 × n matrix including n nucleotides as matrix elements, and the nucleotides are expressed in 4 bits for each type of base, (b) performing a matrix operation of the oligonucleotide sequence for the target nucleic acid sequence to obtain a match value or a mismatch value between nucleotides of the target nucleic acid sequence and the oligonucleotide sequence; the matrix operation is a multiplication of the m × 1 matrix and a 1 × n matrix and an AND operation of 4 bits of nucleotides that are components of the m × 1 matrix and 4 bits of nucleotides that are components of the 1 × n matrix, and if the matrix operation value is identical to 4 bits of any one of the nucleotides on which the matrix operation was performed, the nucleotides on which the matrix operation was performed are in a match, and the match value is a value expressing the match as a predetermined match score, and if the matrix operation value is different from 4 bits of all of the nucleotides on which the matrix operation was performed, the nucleotides on which the matrix operation was performed are in a mismatch, and the mismatch value is a value expressing the mismatch as a predetermined mismatch score, (c) a step of performing a trace operation on an n × n square matrix in an m × n matrix on which the matrix operation is performed to obtain the sum of match values ​​and / or mismatch values ​​of diagonal elements of the n × n square matrix; and (d) providing alignment information of nucleotides of a target nucleic acid sequence in a row component corresponding to a diagonal component of an n × n square matrix having a sum satisfying a predetermined threshold value, and nucleotides of an oligonucleotide sequence in a column component, when the sum satisfies a predetermined threshold value for match or mismatch; wherein the alignment information includes information selected from the group consisting of matches and / or mismatches between nucleotides of the target nucleic acid sequence and the oligonucleotide sequence, an alignment pattern including match and / or mismatch information, the number of mismatches, and a position of the oligonucleotide sequence in the aligned target nucleic acid sequence.

21. A computer-readable recording medium comprising instructions for implementing a processor for executing a method of providing alignment information of an oligonucleotide to a target nucleic acid sequence, the method comprising the following steps: (a) providing a target nucleic acid sequence including m nucleotides and an oligonucleotide sequence including n nucleotides; wherein the target nucleic acid sequence is provided as an m × 1 matrix including m nucleotides as matrix elements, and the oligonucleotide sequence is provided as a 1 × n matrix including n nucleotides as matrix elements, and the nucleotides are expressed in 4 bits for each type of base, (b) a step of providing an operation table; the operation table includes a part where an operation is performed and a part where a gap score is input, and the part where the operation is performed includes an element (C) of an m × n matrix by multiplying the m × 1 matrix and the 1 × n matrix. i,j , 1≤i≤m, 1≤j≤n), and the part where the gap score is input is the origin (C 0,0 ), 0 row component (C 0,j , 1≤j≤n) and the 0 column component (C i,0 , 1≤i≤m), (c) a step of inputting a gap score into a part of the above operation table where a gap score is input; in the 0 row component of the part where the gap score is input, an origin value + (jx gap score (k)) (1≤j≤n, k is an integer) is input for each column component, and in the 0 column component of the part where the gap score is input, an origin value + (ix gap score (k)) (1≤i≤n, k is an integer) is input for each row component. (d) a step of performing an operation and inputting an operation value into a section of the operation table where the operation is performed; the operation is performed in a manner including the following steps for each row in order from the first row to the last row of the section where the operation is performed: d-1) A step of obtaining the maximum value of one of the addition operation values ​​selected from among the addition operation values ​​in the relationship with the matrix element i-1) above and the addition operation values ​​in the relationship with the matrix element on the left i-2) and the addition operation values ​​in the relationship with the left diagonal matrix element i-3) for the row of the part where the above operation is performed, and inputting the maximum value as the operation value of each matrix element;The operation value of addition in the above i-1) matrix element and relationship is an operation value of addition obtained by adding a gap score (k, k is an integer) to the value of the matrix element above each matrix element of the row of the part where the operation is performed, the operation value of addition in the above i-2) left matrix element and relationship is an operation value of addition obtained by adding a gap score (k, k is an integer) to the value of the left matrix element of each matrix element of the row of the part where the operation is performed, and the operation value of addition in the above i-3) left diagonal matrix element and relationship is an operation value of addition obtained by performing a matrix operation of the oligonucleotide sequence for the target nucleic acid sequence for the row of the part where the operation is performed to obtain a match value or mismatch value between the nucleotides of the target nucleic acid sequence and the oligonucleotide sequence for each matrix element, and adding the match value or mismatch value for each matrix element and the value of the left diagonal matrix element of each matrix element, and The matrix operation is a multiplication of the m × 1 matrix and the 1 × n matrix and an AND operation of 4 bits of nucleotides which are components of the m × 1 matrix and 4 bits of nucleotides which are components of the 1 × n matrix, and if the matrix operation value is equal to 4 bits of any one of the nucleotides which performed the matrix operation, it indicates that the nucleotides which performed the matrix operation match, and the match value is a value expressing the match with a predetermined match score, and if the matrix operation value is different from 4 bits of all the nucleotides which performed the matrix operation, it indicates that the nucleotides which performed the matrix operation mismatch, and the mismatch value is a value expressing the mismatch with a predetermined mismatch score, and; d-2) A step of obtaining the maximum value of the operation value of each matrix element input in step d-1) in the order from the first matrix element to the last matrix element of the row of the part where the operation is performed and the operation value of the addition of any one of i-1) and i-2) not selected in step d-1), inputting the maximum value as the operation value of each matrix element of the part where the operation is performed, and indicating which matrix element among the upper, left diagonal, and left matrix elements of the corresponding matrix element the input operation value is derived from; (e) a step of performing backtracking according to the indication of step d-2) from the matrix element that satisfies a predetermined score threshold value among the operation values ​​of the matrix element of the last column of the part where the operation in which the operation value is input is performed; and (f) a step of providing alignment information of nucleotides of a target nucleic acid sequence and nucleotides of an oligonucleotide sequence according to the origin of the operation value of the traced matrix component; the alignment information includes information selected from the group consisting of matches, mismatches and / or gaps between nucleotides of the target nucleic acid sequence and the oligonucleotide sequence, an alignment pattern including the match, mismatch and / or gap information, the number of mismatches, and the position of the oligonucleotide sequence in the aligned target nucleic acid sequence.

Images