Amylosome capable of saccharifying starch, and method for treating waste food by using same

Abstract

The present invention relates to an amylosome capable of saccharifying starch, and a method for treating waste food by using same. The amylosome capable of saccharifying starch, according to the present invention, can directly saccharify starch at a medium temperature in merely a single step, and can effectively decompose waste food contaminated with mold since, in addition to starch-degrading enzymes, mold-degrading enzymes are additionally introduced.

Description

Amylosome capable of saccharifying starch and method for processing food waste using the same

[0001] The present invention relates to an amylosome capable of saccharifying starch and a method for processing waste food using the same.

[0002] Food waste is discarded in large quantities worldwide, much of it containing starch or sugar. This waste is difficult to recycle due to mold contamination, and its saccharification efficiency is also low due to mold inhibition (blocking access to the internal starch matrix).

[0003] Cellulosomes, enzyme complexes involved in cellulose degradation, are known to exist in the outer cell walls of anaerobic microorganisms that decompose biomass. The cellulosome scaffold structure contains a cohesin domain, while the exocrine enzyme portion, linked to the cellulosome scaffold, contains a dockerin domain. Cohesin and dockerin bind to each other via calcium ions, allowing various dockerin-linked exocrine enzymes to bind to the cohesin of the scaffold, forming an enzyme complex. Cellulosome-containing strains express and attach various enzymes to different substrates, utilizing the synergy among these enzymes to efficiently obtain and utilize nutrients. By utilizing the cohesin-dockerin interaction, enzymes can be attached to cellulosomes, resulting in enhanced synergistic enzymatic reactions.

[0004] Amylosomes are enzyme complexes capable of degrading starch and are known to be abundant in anaerobic gut microbes. Their structure, similar to that of cellulosomes, consists of cohesin and dockerin, along with a variety of starch-attaching proteins and enzymes related to starch degradation. However, research on artificially created amylosomes has not been widely reported.

[0005] Accordingly, the inventors of the present invention modified cellulosomes, which are protein complexes that decompose cellulose, to produce amylosomes that can directly saccharify starch, and confirmed that when a fungal decomposition enzyme was added to the amylosomes, fungal-contaminated waste food waste could be directly saccharified, thereby completing the present invention.

[0006] An object of the present invention is to provide a starch binding scaffold protein prepared by modifying a mini cellulose binding protein A comprising a carbohydrate binding module family 3 and two type 1 cohesins.

[0007] In addition, another object of the present invention is to provide an amylosome capable of starch saccharification, which includes a starch decomposition enzyme and a starch binding scaffold protein.

[0008] In addition, another object of the present invention is to provide a composition for treating waste food, which comprises the amylosome capable of saccharifying starch.

[0009] In addition, another object of the present invention is to provide a method for treating waste food, which includes a step of treating waste food with amylosomes capable of saccharifying starch.

[0010] To achieve the above object, the present invention provides an amylosome capable of starch saccharification, characterized in that a starch-binding scaffold protein is prepared by modifying a mini cellulose binding protein A comprising a carbohydrate binding module family 3 and two type 1 cohesins, wherein the modification is characterized in that a) the carbohydrate binding module family 3 is replaced with a starch binding protein, b) the modification is modified to further include two type 1 cohesins, or c) the carbohydrate binding module family 3 is replaced with a starch binding protein and modified to further include two type 1 cohesins.

[0011] Next, the present invention provides an amylosome capable of starch saccharification, comprising a starch-degrading enzyme and a starch-binding scaffold protein.

[0012] Additionally, the amylosome capable of starch saccharification may further contain a fungal decomposition enzyme.

[0013] Furthermore, the present invention provides a composition for treating waste food containing the above starch saccharifying amylosomes.

[0014] In addition, the present invention provides a method for treating waste food, which includes a step of treating the waste food with amylosomes capable of starch saccharification.

[0015] Amylosomes capable of starch saccharification according to the present invention are capable of direct starch saccharification at medium temperature in a single step, and have the effect of effectively decomposing waste food contaminated with mold by additionally introducing a fungal decomposition enzyme in addition to a starch decomposition enzyme.

[0016] Figure 1 is a schematic diagram showing the process of developing an amylosome capable of direct starch saccharification according to one embodiment of the present invention.

[0017] Figure 2 is a diagram showing the SDS-PAGE results of four types of starch decomposing enzymes and starch binding proteins in one embodiment of the present invention.

[0018] Figure 3 is a diagram showing the results of measuring the optimal temperature conditions of starch-decomposing enzymes and an enzyme mixture in one embodiment of the present invention.

[0019] Figure 4 is a diagram showing the results of measuring the optimal pH conditions of starch-decomposing enzymes and an enzyme mixture in one embodiment of the present invention.

[0020] FIG. 5 is a diagram showing the results of measuring the specific activity of starch-decomposing enzymes on glucose or reducing sugar-based starch-related substrates in one embodiment of the present invention.

[0021] FIG. 6 is a diagram showing the results of an evaluation of the adhesion ability of a starch-binding scaffold protein to a waste food substrate containing a lot of water-soluble starch and mold-contaminated starch, in one embodiment of the present invention.

[0022] FIG. 7 is a diagram showing the results of evaluating the decomposition ability of starch-decomposing enzymes, enzyme mixtures, and amylosomes for starch-related substrates in one embodiment of the present invention.

[0023] FIG. 8 is a diagram showing the starch saccharification efficiency of amylosomes bound with various ratios of starch-decomposing enzymes in one embodiment of the present invention.

[0024] FIG. 9 is a diagram showing the results of evaluating the thermal stability of amylosomes capable of starch saccharification in one embodiment of the present invention.

[0025] FIG. 10 is a diagram showing the results of comparing the saccharification efficiency of an amylosome containing a starch-decomposing enzyme and an amylosome additionally combined with a fungal-decomposing enzyme in addition to the starch-decomposing enzyme for waste food contaminated with mold in one embodiment of the present invention.

[0026] Hereinafter, the present invention will be described in detail with reference to the attached drawings and exemplary embodiments thereof. However, the following exemplary embodiments are provided as illustrative examples of the present invention. If a detailed description of a technology or configuration well known to those skilled in the art is judged to unnecessarily obscure the gist of the present invention, such detailed description may be omitted, and the present invention is not limited thereby. The present invention is capable of various modifications and applications within the scope of the following claims and equivalents interpreted therefrom.

[0027] In addition, the terms used in this specification are terms used to appropriately express preferred embodiments of the present invention, and may vary depending on the intention of the user or operator, or the customs of the field to which the present invention belongs. Therefore, the definitions of these terms should be determined based on the contents throughout this specification. Throughout the specification, when a part is said to "include" a certain component, this does not mean that other components are excluded, but rather that other components may be included, unless specifically stated otherwise.

[0028] Throughout this specification, '%' used to indicate the concentration of a particular substance means solid / solid (w / w) %, solid / liquid (w / v) %, and liquid / liquid (v / v) %, unless otherwise stated.

[0029] The term “medium temperature” used in the present invention means 25°C to 40°C.

[0030] Hereinafter, the present invention will be described in more detail.

[0031] In one aspect, the present invention relates to a starch binding scaffold protein prepared by modifying a mini cellulose binding protein A comprising a carbohydrate binding module family 3; and two type 1 cohesins.

[0032] In one embodiment of the present invention, the deformation is

[0033] a) The carbohydrate binding module family 3 is replaced with a starch binding protein, or

[0034] b) modified to include two more Type 1 cohesins, or

[0035] c) The carbohydrate binding module family 3 may be replaced with a starch binding protein and modified to further include two type 1 cohesins, but is not limited thereto.

[0036] In one embodiment of the present invention, the Type 1 cohesin may be a starch-decomposing enzyme linked to Type 1 dockerin, but is not limited thereto.

[0037] The term “mini cellulose binding protein A” used in the present invention is derived from Cellulose-binding protein A (CbpA) from Clostridium cellulovorans, and refers to a cellulosome containing a carbohydrate binding module family 3 and two type 1 cohesins.

[0038] In one embodiment of the present invention, the starch decomposing enzyme may be at least one enzyme selected from the group consisting of alpha-amylase, alpha-glucosidase, oligo 1,6 glucosidase, trehalase, glucoamylase, 4-α-glucanotransferase, amylopullulanase, amylomaltase, β-amylase, and isoamylase, and preferably alpha-amylase, alpha-glucosidase, oligo 1,6 glucosidase, and It may be any one or more enzymes selected from Trehalase, and more preferably, it may be α-Amylase, α-Glucosidase, Oligo 1,6 glucosidase and Trehalase.

[0039] The term “α-amylase” used in the present invention is an enzyme that breaks down α-1,4 linkage in starch to produce maltose and maltooligosaccharide.

[0040] The term “α-Glucosidase” used in the present invention is an exo-type hydrolase, which is an enzyme that breaks down the terminal of α-1,4 linkage disaccharides and oligosaccharides to produce glucose.

[0041] The term “oligo 1,6 glucosidase” used in the present invention is an enzyme that decomposes isomaltose, a disaccharide having an α-1,6 linkage or an α-1,6 linkage of a branch structure in starch.

[0042] The term “Trehalase” used in the present invention is an enzyme that decomposes trehalose having an α-1,1 linkage.

[0043] In one embodiment of the present invention, the carbohydrate binding module family 3 may be represented by the amino acid sequence of sequence number 1, but is not limited thereto.

[0044] In one embodiment of the present invention, the Type 1 cohesin may be represented by the amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 3, but is not limited thereto.

[0045] In one embodiment of the present invention, the starch binding protein may be represented by the amino acid sequence of SEQ ID NO: 4, but is not limited thereto.

[0046] In one embodiment of the present invention, the a) starch binding scaffold protein in which the carbohydrate binding module family 3 is replaced with a starch binding protein may be represented by the amino acid sequence of SEQ ID NO: 5, but is not limited thereto.

[0047] In one embodiment of the present invention, the starch-binding scaffold protein modified to further include two Type 1 cohesins (b) may be represented by the amino acid sequence of SEQ ID NO: 6, but is not limited thereto.

[0048] In one embodiment of the present invention, the c) starch binding scaffold protein in which the carbohydrate binding module family 3 is replaced with a starch binding protein and is modified to further include two type 1 cohesins may be represented by the amino acid sequence of SEQ ID NO: 7, but is not limited thereto.

[0049] In one aspect, the present invention relates to an amylosome capable of starch saccharification, comprising a starch decomposing enzyme and the starch binding scaffold protein.

[0050] Since the amylosomes capable of starch saccharification of the present invention include the starch-binding scaffold protein described above, descriptions of the overlapping contents with the starch-binding scaffold protein of the present invention described above are omitted to avoid excessive complexity of the present specification due to descriptions of overlapping contents.

[0051] In one embodiment of the present invention, the starch decomposing enzyme may be at least one enzyme selected from the group consisting of alpha-amylase, alpha-glucosidase, oligo 1,6 glucosidase, trehalase, glucoamylase, 4-α-glucanotransferase, amylopullulanase, amylomaltase, β-amylase, and isoamylase, and preferably alpha-amylase, alpha-glucosidase, oligo 1,6 glucosidase, and It may be any one or more enzymes selected from Trehalase, and more preferably, it may be α-Amylase, α-Glucosidase, Oligo 1,6 glucosidase and Trehalase.

[0052] In one embodiment of the present invention, the starch decomposing enzyme may have a type 1 dockerin linked to the C-terminal, but is not limited thereto.

[0053] In one embodiment of the present invention, the starch decomposing enzyme and Type 1 dockerin may be connected by a linker, but are not limited thereto.

[0054] In addition, the linker may be composed of a sequence of 3 to 60 bases, and may preferably be a linker represented by the base sequence of SEQ ID NO: 17, but any linker known in the art may be used without limitation.

[0055] In one embodiment of the present invention, the Type 1 dockerin may be represented by the base sequence of SEQ ID NO: 18, but is not limited thereto.

[0056] In one embodiment of the present invention, the gene encoding α-Amylase having Type 1 dockerin linked to the C-terminal may be represented by the base sequence of SEQ ID NO: 19, but is not limited thereto.

[0057] In one embodiment of the present invention, the gene encoding α-glucosidase having Type 1 dockerin linked to the C-terminal may be represented by the base sequence of SEQ ID NO: 20, but is not limited thereto.

[0058] In one embodiment of the present invention, the gene encoding Oligo 1,6 glucosidase having Type 1 dockerin linked to the C-terminal may be represented by the base sequence of SEQ ID NO: 21, but is not limited thereto.

[0059] In one embodiment of the present invention, the gene encoding trehalase having Type 1 dockerin linked to the C-terminal may be represented by the base sequence of SEQ ID NO: 22, but is not limited thereto.

[0060] In one embodiment of the present invention, the amylosome capable of starch saccharification may further include a fungal decomposition enzyme, but is not limited thereto.

[0061] In one embodiment of the present invention, the fungal decomposition enzyme may be at least one enzyme selected from the group consisting of N-acetylglucosaminidase (GlcNACase), beta-1,3 glucanase (β-1,3 Glucanase), and chitinase (Chitinase), and preferably N-acetylglucosaminidase (CcGlcNACase), but is not limited thereto.

[0062] In one embodiment of the present invention, the N-acetylglucosaminidase (GlcNACase) may be, but is not limited to, an N-acetylglucosaminidase derived from Clostridium cellulovorans.

[0063] In one embodiment of the present invention, the fungal decomposition enzyme may have a type 1 dockerin linked to the C-terminal, but is not limited thereto.

[0064] In one embodiment of the present invention, the gene encoding the N-acetylglucosaminidase (CcGlcNACase) derived from Clostridium cellulovorans may be represented by the base sequence of SEQ ID NO: 23.

[0065] The term “Clostridium cellulovorans derived N-acetylglucosaminidase (CcGlcNACase)” used in the present invention is a chitin degrading enzyme based on high homology with discoidin domain-containing proteins and chitobiase / β-hexosaminidase C-terminal domains, which produces N-acetyl-D-glucosamine from N-acetyl-D-glucosamine of various lengths, and contains a Type 1 dockerin domain within the enzyme (Myeong-Eun Lee et al. 2021. Bioresource Technology).

[0066] In one aspect, the present invention relates to a composition for treating waste food, comprising amylosomes capable of saccharifying starch.

[0067] In one embodiment of the present invention, it may further include one or more enzymes selected from the group consisting of amylase, cellulase, lipase, and protease, but is not limited thereto.

[0068] In one embodiment of the present invention, the composition for processing waste food waste may further include, but is not limited to, microorganisms having a waste food waste decomposition function that are generally included in the composition.

[0069] In one aspect, the present invention relates to a method for treating waste food, comprising a step of treating waste food with amylosomes capable of saccharifying starch.

[0070] Since the method for processing waste food of the present invention includes the amylosome capable of starch saccharification described above, descriptions of overlapping contents with the amylosome capable of starch saccharification of the present invention described above are omitted to avoid excessive complexity of the present specification due to descriptions of overlapping contents.

[0071] The above-mentioned amylosomes capable of starch saccharification have high decomposition activity on starch-related substrates such as amylose, amylopectin, isomaltose, and trehalose, can decompose waste food in a single step, and exhibit excellent starch saccharification efficiency at medium temperatures. Therefore, when the above-mentioned amylosomes are applied to waste food, waste food can be converted into useful products, and thus can be utilized in an economical and environmentally friendly manner.

[0072] Hereinafter, the present invention will be described in more detail through examples. These examples are intended to more specifically illustrate the present invention, and the scope of the present invention is not limited to these examples.

[0073] <Example 1> Preparation of amylosomes capable of direct starch saccharification

[0074] 1-1. Amplification and cloning of various types of starch-binding scaffold protein genes for amylosomes.

[0075] Referring to Figure 1, a starch-binding scaffold protein was prepared by modifying mini cellulose binding protein A (mCbpA) including carbohydrate binding module family 3 and two type 1 cohesins. By binding a starch-degrading enzyme to the starch-binding scaffold protein, an amylosomes capable of directly saccharifying starch can be prepared.

[0076] To design and express various starch-binding scaffold proteins for amylosomes, we carried out a process of securing the gene of cellulosomal mCbpA, a structural protein that serves as the basis. The base sequence of mCbpA (SEQ ID NO: 16), which includes carbohydrate binding module family 3 (SEQ ID NO: 9) and type 1 cohesin (SEQ ID NO: 10 or SEQ ID NO: 11), was amplified from the genomic DNA of Clostridium cellulovorans. To modify carbohydrate binding module family 3 (CBM3) included in the existing mCbpA into starch binding protein (Sbp), the base sequence (SEQ ID NO: 12) encoding Sbp was gene synthesized. The primers and plasmids for each starch-binding scaffold protein used in the present invention are shown in Table 1 below.

[0077] Primer sequence (5'→3')mCbpA-F(EcoRI)accctGAATTCgcagcgacatcatcaatgmCbpA-R(PstI)cccCTGCAGtcatataggatctccaa tatttattgtaacgCCmCbpA-F(SacI)cccGAGCTCccagatgtaccatcttcaataattaaCCmCbpA-R(XhoI)ccccCTCGAGtatagg atctccaatatttattgtaacgcSbp-F(EcoRI)cccaaGAATTCTCTCGCAATCGTTACCTGSbp_CbpA-R(ov)tgaagatggtacatctggGAACGTGCCGACACTCSbp_CbpA-F(ov)GTGTCGGCACGTTCccagatgtaccatcttcaataattPlasmid CharacteristicspColdII_mCbpApColdII carrying mCbpA genepColdII_CCmCbpApColdII carrying CCmCbpA genepColdII_SbpCbpApColdII carrying SbpCbpA genepColdII_CCSbpCbpApColdII carrying CCSbpCbpA gene

[0078] The starch-binding scaffold protein in which CBM3 was substituted with Sbp in mCbpA was named SbpCbpA, the starch-binding scaffold protein recombined to include two more type 1 cohesins at the N-terminus of CBM3 in mCbpA was named CCmCbpA with an additional designation CC, and the starch-binding scaffold protein containing both of the above modifications was named CCSbpCbpA. Information on the starch-binding scaffold proteins produced in the present invention is shown in Table 2 below.

[0079] NameCharacteristicSequence NumberAmino AcidBaseSbpCbpASbp(SEQ ID NO: 12);type 1 cohesin(SEQ ID NO: 10);type 1 cohesin(SEQ ID NO: 11)513CCmCbpAtype 1 cohesin(SEQ ID NO: 10);type 1 cohesin(SEQ ID NO: 11);CBM3(SEQ ID NO: 9);type 1 cohesin(SEQ ID NO: 10);type 1 cohesin(SEQ ID NO: 11)614CCSbpCbpAtype 1 cohesin(SEQ ID NO: 10);type 1 cohesin(SEQ ID NO: 11);Sbp(SEQ ID NO: 12);type 1 cohesin(SEQ ID NO: 10);type 1 cohesin(SEQ ID NO: 11)715

[0080] 1-2. Gene amplification and cloning of enzymes related to starch degradation

[0081] Alpha-amylase, alpha-glucosidase, oligo 1,6 glucosidase, and trehalase were selected as enzymes that directly form amylosomes capable of saccharifying starch.

[0082] Alpha-amylase was obtained from the genomic DNA of Bacillus subtilis, and alpha-glucosidase, oligo 1,6 glucosidase, and trehalase were derived from the genomic DNA of Escherichia coli.

[0083] Each enzyme was recombined to further include a linker (SEQ ID NO: 17, GGATCCGCTGGCTCCGCTGCTGGTTCTGGGGAATTC) and type 1 dockerin (Type 1 dockerin, SEQ ID NO: 18) in the downstream sequence of the gene encoding each enzyme, thereby producing a recombinant enzyme in which type 1 dockerin is linked to the C-terminus of the enzyme. The genes were cloned into the pColdII vector for heterologous expression in E. coli. Finally, the genes were created in the form of each enzyme gene-linker-type 1 dockerin and inserted into the pColdII vector. The primers and plasmids for each enzyme used in the present invention are shown in Table 3 below.

[0084] Primer sequence (5'→3')α-Amylase-F(SacI)attGAGCTCGAAACGGCGAACAAATCGα-Amylase-R(XhoI)ccccCTCGAGTTGAAAGAATGTGTTACACCTGATTα -Glucosidase-F(SacI)aaaGAGCTCATGTTAAATGCATGGCACCTGCα-Glucosidase-R(XhoI)aattCTCGAGGTTCATCCATACCGTAGCCGAOligo1,6 glucosidase-F(SacI)aatGAGCTCAGTGAATGGTGGAAAGAAGCTOligo1,6 glucosidase-R ( colivector for regulating gene expressionpColdII_α-AmylasepColdII carrying α-amylase doc genepColdII_α-GlucosidasepColdII carrying α-glucosidase doc genepColdII_Oligo1,6 glucosidasepColdII carrying oligo1,6 glucosidase doc genepColdII_TrehalasepColdII carrying trehalase doc gene

[0085] 1-3. Expression and purification of starch-degrading enzymes and various starch-binding scaffold proteins in Escherichia coli.

[0086] The genes obtained in Examples 1-1 and 1-2 and the plasmids cloning them were transformed into Escherichia coli. The recombinant strains thus created were named as shown in Table 4 below. Culture was performed to express enzymes and proteins from the recombinant strains. The recombinant strains were inoculated into 5 ml of LB medium containing ampicillin and cultured at 37°C for 20 hours. The initial culture was transferred to 500 ml of LB medium containing ampicillin and the main culture was performed. The main culture was first started at 37°C, and when the OD600 reached 1, IPTG was added to a final concentration of 1 mM to induce gene expression. After adding IPTG, the culture was cultured at 16°C for 24 hours. The culture was centrifuged to remove the medium supernatant, and the cells were finally collected. The collected recombinant strain cells were disrupted using ultrasound and centrifuged to obtain the supernatant. The protein was purified using an affinity chromatography method using imidazole concentration differences using a His-tag linked to the N-terminus. Electrophoresis was performed on a 10% SDS-PAGE gel, and the results are shown in Fig. 2 (Lane M: protein marker, Lane 1: α-Amylase (59.07 kDa), Lane 2: α-Glucosidase (76.78 kDa), Lane 3: Oligo 1,6 glucosidase (71.94 kDa), Lane 4: Trehalase (68.53 kDa), Lane 5: mCbpA (62.92 kDa), Lane 6: CCmCbpA (104.5 kDa), Lane 7: SbpCbpA (59.07 kDa), Lane 8: CCSbpCbpA (101.64 kDa)).

[0087] As shown in Fig. 2, it was confirmed that the results of staining with Comassie blue dye appeared at the same location as the expected protein sizes [alpha-amylase (59.07 kDa), alpha-glucosidase (76.78 kDa), oligo 1,6 glucosidase (71.94 kDa), trehalase (68.53 kDa), mCbpA (62.92 kDa), CCmCbpA (104.5 kDa), SbpCbpA (59.07 kDa), CCSbpCbpA (101.64 kDa)].

[0088] Recombinant strain name characteristics α-AmylaseE. coliBL21(DE3) harboring pColdII_α-Amylaseα-GlucosidaseE. coliBL21(DE3) Rosetta harboring pColdII_α-GlucosidaseOligo1,6 glucosidaseE. coliBL21(DE3) harboring pColdII_Oligo1,6 glucosidaseTrehalaseE. coliBL21(DE3) harboring pColdII_TreAmCbpAE. coliBL21(DE3) harboring pColdII_mCbpACCmCbpAE. coliBL21(DE3) harboring pColdII_CCmCbpASbpCbpAE. coliBL21(DE3) harboring pColdII_SbpCbpACCSbpCbpAE. coliBL21(DE3) harboring pColdII_CCSbpCbpA

[0089] 1-4. Preparation of amylosomes combined with starch-degrading enzymes and starch-binding scaffold proteins

[0090] Amylosomes capable of directly saccharifying starch were prepared by combining α-amylase, α-glucosidase, Oligo 1,6 glucosidase, and Trehalase with the starch-binding scaffold protein described in Example 1-1.

[0091] Specifically, the linking reaction of the starch-degrading enzymes and starch-binding scaffold proteins was carried out at a concentration of 1:1 according to the number of cohesins in the starch-binding scaffold proteins. The reaction conditions for linking were to proceed at 4°C for 18 hours in a buffer solution containing a mixture of 25 mM sodium citrate (pH 6.0) and 15 mM calcium chloride (CaCl2).

[0092] <Example 2> Optimal conditions of starch-decomposing enzymes and enzyme mixtures

[0093] In order to confirm the optimal reaction conditions of the starch-degrading enzymes and enzyme mixtures obtained from the recombinant strains in Example 1, reactions were performed with the optimal substrates for each enzyme. Alpha-amylase was reacted with 0.15% soluble starch, alpha-glucosidase with 1 mM 4-Nitrophenyl α-D-glucopyranoside (pNPGlc), oligo-1,6-glucosidase with 1 mM isomaltose, and trihalase with 1 mM trehalose as substrates. The optimal temperature for the reaction was 25-60°C, and an appropriate 10 mM buffer that buffered the pH range of 4-9 was used for the reaction. After the reaction, the reaction using pNPGlc was terminated with 0.1 N NaOH. The 4-nitrophenol released as a reaction product was measured at 400 nm. The reaction with soluble starch was measured at 540 nm using the DNS method. The reaction with isomaltose and trihalose was measured at 340 nm using a glucose oxidase kit. The results were calculated as relative values, and alpha-amylase showed the best enzyme activity at 40°C, sodium citrate pH 6, alpha-glucosidase at 45°C, sodium citrate pH 5, oligo-1,6-glucosidase at 35°C, sodium phosphate pH 6, and trihalase at 35°C, Tris HCl pH 7. Finally, it was confirmed that the enzyme mixture showed the best enzyme activity at 35°C, sodium citrate pH 6. These results are shown in Figures 3 and 4.

[0094] <Example 3> Measurement of specific activity of starch-decomposing enzymes

[0095] In order to confirm the specific activity of the starch-degrading enzymes obtained in Example 1 for starch-related substrates, related reactions were performed. 0.15% soluble starch, 0.15% amylose, 0.15% amylopectin, 1 mM isomaltose, and 1 mM trehalose were used as substrates, and the reaction was carried out for 18 hours at 35°C using sodium citrate pH 6 buffer. The amount of glucose produced in the reactions was measured using a glucose oxidase kit and the reducing equivalent amount was measured using the DNS method, and the specific activity (nmole / min mg or μmole / min mg) was calculated from these.

[0096] As a result, as shown in Fig. 5, in terms of glucose production, alpha amylase, which is an endo type, showed the highest enzyme activity in soluble starch, amylose, and amylopectin. For soluble starch and amylose, alpha glucosidase, which is an exo type, showed the highest enzyme activity, in that order. For amylopectin, which is a branched substrate, oligo 1,6 glucosidase, which breaks down branched structures well, was confirmed to show the highest enzyme activity. For isomaltose, a disaccharide composed of α-1,6 linkages, oligo 1,6 glucosidase showed the highest enzyme activity. For trihalose composed of α-1,1 linkages, several enzymes showed high activity, but among them, trihalase showed the highest enzyme activity. In terms of reducing sugar production, alpha-amylase, an endo-type enzyme, showed the highest enzyme activity against soluble starch, amylose, and amylopectin. Alpha-glucosidase, an exo-type enzyme, showed the highest activity against amylose. Oligo-1,6-glucosidase, capable of decomposing branched structures, showed the highest activity against amylopectin.

[0097] These results indicate that the four selected enzymes will serve as enzymes that best degrade the target substrate and that these enzymes were appropriately selected.

[0098] <Example 4> Adhesion ability of various starch-binding scaffold proteins to soluble starch and mold-contaminated starch-rich waste food waste

[0099] To investigate the adhesion of the starch-binding scaffold proteins mCbpA, CCmCbpA, SbpCbpA, and CCSbpCbpA manufactured in Example 1-1 to soluble starch and mold-contaminated starch-rich food waste, an adhesion reaction was performed. The mold-contaminated food waste was bread, which was purchased from a local bakery. To prepare a substrate in the form of mold-contaminated food waste, the bread was autoclaved and dried in a dry oven. The dried bread was ground into powder, and 15 g of bread powder was placed in a flask and inoculated with Aspergillus nidulrans. The bread powder inoculated with Aspergillus nidulrans was incubated at 37°C for 1 week. After incubation, the mold-contaminated bread substrate was recovered by centrifugation and washed three times with sterile water. The washed waste food substrate was dried in a dry oven and finally ground into powder. Aspergillus nidurans used in the inoculation process was cultured for one week at 37°C using potato dextrose agar and broth. The cultured fungus was harvested and washed three times with sterile water. After homogenizing it, it was inoculated into the bread flour described above.

[0100] To 60 mg of mold-contaminated waste food waste and soluble starch, mCbpA, CCmCbpA, SbpCbpA, or CCSbpCbpA was added at a concentration of approximately 200 ug / mL, and an attachment reaction was performed in a final volume of 700 μl in 100 mM sodium phosphate pH 7.0 buffer. The reaction was performed at 15°C for 45 min at 300 rpm. After the attachment reaction, centrifugation was performed at 13,000 rpm for 1 min, and the amount of unbound protein was analyzed using Bradford reagent at 595 nm. Bovine serum albumin (BSA) was used as a standard. The attachment ability (%) was calculated by converting the amount of added protein to the amount of unbound protein.

[0101] As a result, as shown in Fig. 6, it was confirmed that high adhesion was shown for waste food waste containing a lot of water-soluble starch and mold-contaminated starch, and in particular, it was confirmed that SbpCbpA and CCSbpCbpA, which are amylosomes in which CBM 3 is substituted with Sbp, showed the highest adhesion.

[0102] <Example 5> Comparison of enzyme reactions of single enzyme, enzyme mixture, and amylosomes

[0103] In order to compare the enzymatic activities of various amylosomes bound with four types of starch-degrading enzymes, the four types of starch-degrading enzymes were linked in a 1:1:1:1 ratio according to the number of cohesin sites in the starch-binding scaffold protein of the amylosome as described in Examples 1-4. The binding reaction of the four types of starch-degrading enzymes and amylosomes was carried out in a buffer solution containing 25 mM sodium citrate, pH 6.0, and 15 mM CaCl2 at 4℃ for 18 hours. The linked amylosomes, simple enzyme mixture, and single enzyme were reacted with 0.15% soluble starch, 0.15% amylose, 0.15% amylopectin, 1 mM isomaltose, and 1 mM trehalose at 35℃ for 18 hours.

[0104] As a result, as shown in Fig. 7, it was confirmed that amylosomes combined with starch-decomposing enzymes showed higher glucose production capacity than single enzymes, but similar glucose production to that of simple enzyme mixtures. Regarding reducing sugar production, amylosomes were confirmed to produce more soluble starch and amylose than single enzymes and simple enzyme mixtures, confirming that they produce oligosaccharides better.

[0105] <Example 6> Amylosome modification and optimization to improve saccharification capacity of starch

[0106] The aim was to improve the saccharification ability of starch by adjusting the ratio of four types of starch-degrading enzymes to bind to mCbpA, CCmCbpA, SbpCbpA, and CCSbpCbpA. First, four amylosomes were prepared, each containing twice as much of one enzyme as the other, and the ratio of the amylosomes was also adjusted so that each enzyme could bind to the amylosome in a 1:1 ratio. Finally, amylosomes with changed ratios were prepared through the binding reaction of the starch-degrading enzymes and amylosomes described in Example 4. Amyloses prepared with different ratios of each enzyme were reacted with soluble starch, amylose, amylopectin, isomaltose, and trehalose at 35°C for 18 hours. The reaction solution was measured at 540 nm through DNS reaction, and the generated reducing equivalents were analyzed as relative values.

[0107] As a result, as shown in Fig. 8, in terms of saccharification ability for starch, even if a specific enzyme was included in greater amounts, there was no significant difference compared to amylosomes containing four types of enzymes in the same ratio, but in terms of saccharification ability for amylose, an amylosome containing twice as much alpha amylase as other enzymes showed significantly improved hydrolysis ability compared to other amylosmes, and in terms of saccharification ability for amylopectin, it was confirmed that four amylosmes containing one enzyme in twice the amount of another enzyme showed slightly higher hydrolysis ability compared to amylosomes containing four types of enzymes in the same ratio.

[0108] <Example 7> Confirmation of the thermal stability of various amylosomes

[0109] In order to confirm the thermal stability at high temperatures of the amylosomes bound with the starch-degrading enzymes described in Example 5, a thermal stability reaction analysis experiment was performed on mCbpA, CCmCbpA, SbpCbpA, CCSbpCbpA, and a simple enzyme mixture. Since the general starch saccharification process takes place at 55-65℃, the thermal stability at a slightly higher temperature of 70℃ was tested. The amylosomes were heat-treated at 70℃ for 0, 0.5, 1, 3, and 6 hours, centrifuged, and the supernatant was reacted with 0.15% soluble starch. The reaction with soluble starch was performed under the optimal reaction conditions described in Example 4, and the reaction time was 18 hours. After the reaction, the produced reducing sugar was finally measured at 540 nm using the DNS method. The measured values ​​were calculated as relative values.

[0110] As a result, as shown in Fig. 9, all amylosomes showed higher thermal stability compared to the simple enzyme mixture, and in particular, it was confirmed that Sbp-based amylosomes (SbpCbpA, CCSbpCbpA) maintained significantly higher enzyme activity after 6 hours of heat treatment.

[0111] <Example 8> Direct saccharification ability of amylosomes on mold-contaminated waste food

[0112] In order to prepare a starch saccharification amylosomes that can also be degraded by fungi, in addition to four starch degrading enzymes (alpha amylase, alpha glucosidase, oligo 1,6 glucosidase, and trihalase) linked to type 1 dockerin at the C-terminus, a NAG enzyme (CcGlcNACase, SEQ ID NO: 23) was additionally added and conjugated to mCbpA, CCmCbpA, SbpCbpA, and CCSbpCbpA by the method described in Example 1-4, and the feasibility of application to waste food contaminated with fungi and containing a lot of starch was confirmed by inoculating it. The reaction was applied to 0.06 g of waste food contaminated with fungi and performed at 35°C for 18 hours. The amounts of reducing sugar and glucose produced through this were analyzed by the DNS method (measured at 540 nm) and high-performance liquid chromatography (HPLC) (Detector: refractive index detector / Column: Hi-plex H column), respectively.

[0113] As a result, as shown in Fig. 10, it was shown that amylosomes with additional fungal decomposition enzymes bound produced more reducing sugar and glucose compared to amylosomes without fungal decomposition enzymes bound to reducing sugar production. In particular, CCSbpCbpA showed the highest glucose production compared to other amylosomes, regardless of whether fungal decomposition enzymes were bound, and produced up to 62.44 ± 0.03 mM of glucose when fungal decomposition enzymes were added, showing significantly superior glucose productivity compared to other amylosomes with additional fungal decomposition enzymes bound to it.

Claims

1. A starch binding scaffold protein prepared by modifying a mini cellulose binding protein A comprising carbohydrate binding module family 3 and two type 1 cohesins. The above transformation is, a) the carbohydrate binding module family 3 is replaced with a starch binding protein, or b) modified to include two additional Type 1 cohesins, or c) A starch binding scaffold protein, characterized in that the carbohydrate binding module family 3 is replaced with a starch binding protein and is modified to further include two type 1 cohesins.

2. In paragraph 1, The above type 1 cohesin is a starch binding scaffold protein characterized by binding of a starch decomposing enzyme to which type 1 dockerin is linked.

3. In paragraph 2, A starch binding scaffold protein, characterized in that the starch decomposing enzyme is at least one enzyme selected from the group consisting of α-amylase, α-glucosidase, Oligo 1,6 glucosidase, Trehalase, Glucoamylase, 4-α-Glucanotransferase, Amylopullulanase, Amylomaltase, β-amylase, and Isoamylase.

4. In paragraph 1, The carbohydrate binding module family 3 is a starch binding scaffold protein characterized by having an amino acid sequence represented by sequence number 1.

5. In paragraph 1, The above type 1 cohesin is a starch binding scaffold protein characterized by an amino acid sequence represented by sequence number 2 or sequence number 3.

6. In paragraph 1, The above starch binding protein is a starch binding scaffold protein, characterized by having an amino acid sequence represented by sequence number 4.

7. In paragraph 1, Above a) A starch binding scaffold protein in which the carbohydrate binding module 3 (Carbohydrate binding module family 3) is replaced with a starch binding protein, which is represented by the amino acid sequence of sequence number 5.

8. In paragraph 1, A starch binding scaffold protein, wherein the starch binding scaffold protein is modified to further include two type 1 cohesins, and is represented by the amino acid sequence of SEQ ID NO:

6.

9. In paragraph 1, c) A starch binding scaffold protein, wherein the carbohydrate binding module family 3 is replaced with a starch binding protein and the starch binding scaffold protein is modified to further include two type 1 cohesins, and is represented by the amino acid sequence of SEQ ID NO:

7.

10. Amylosome capable of starch saccharification, comprising a starch decomposing enzyme and a starch binding scaffold protein of any one of claims 1 to 9.

11. In paragraph 10, Amylosome capable of starch saccharification, characterized in that the starch decomposing enzyme is at least one enzyme selected from the group consisting of α-amylase, α-glucosidase, Oligo 1,6 glucosidase, Trehalase, Glucoamylase, 4-α-Glucanotransferase, Amylopullulanase, Amylomaltase, β-amylase, and Isoamylase.

12. In paragraph 10, Amylosome capable of starch saccharification, characterized in that the starch decomposing enzyme has a type 1 dockerin linked to the C-terminal.

13. In paragraph 10, Amylosome capable of starch saccharification, characterized in that the above-mentioned amylosome further contains a fungal decomposition enzyme.

14. In paragraph 13, Amylosome capable of starch saccharification, characterized in that the fungal decomposition enzyme is at least one enzyme selected from the group consisting of N-acetylglucosaminidase (GlcNACase), beta-1,3 glucanase (β-1,3 Glucanase), and chitinase.

15. A composition for treating food waste, comprising an amylosome capable of starch saccharification according to any one of claims 10 to 14.

16. A method for treating waste food, comprising a step of treating waste food with an amylosome capable of starch saccharification according to any one of claims 10 to 14.

Images