AAV-mediated suicide gene therapy for the treatment of breast cancer

Abstract

The present invention provides a gene therapy strategy for an effective breast cancer treatment Employing Adeno-associated virus (AAV) vectors, the present invention delivers an inducible Casp9 (iCasp9) suicide transgene, specifically triggering apoptosis in breast cancer cells irrespective of their cell cycle phase. The innovative approach of the present invention presents heightened cytotoxicity within heterogeneous tumor tissues, and its compatibility with combinatorial treatments amplifies its therapeutic potential. Leveraging the inherent safety of AAV vectors, this therapy minimizes the likelihood of drug resistance emergence. Demonstrated efficacy in inhibiting tumor growth and inducing apoptosis in preclinical breast cancer models underscores the promise of this AAV-mediated iCasp9 gene therapy as a transformative solution, poised to revolutionize breast cancer treatment with improved efficacy and reduced systemic toxicity.

Description

[0001] AAV-MEDIATED SUICIDE GENE THERAPY FOR THE TREATMENT OF BREAST CANCER

[0002] EARLIEST PRIORITY DATE:

[0003] This Application claims priority from a Provisional patent application filed in India having Patent Application No. 202311056680, filed on 24th August 2023 and titled “AAV-MEDIATED SUICIDE GENE THERAPY FOR THE TREATMENT OF BREAST CANCER”

[0004] FIELD OF INVENTION

[0005] The present invention relates to the field of gene therapy for the treatment of breast cancer. More specifically, the present invention relates to a novel therapeutic approach that combines the inducible Casp9 (iCasp9) technology with Adeno-associated virus (AAV) vectors to address challenges associated with current breast cancer treatments.

[0006] BACKGROUND

[0007] The most reported malignancy in females that results in significant mortality is breast carcinoma (Harbeck, N. et al., 2019). In 2020, the incidence of breast cancer among all populations, including both sexes, is around 2.2 million, positioning it first among all cancer types (Sung, H. etal., 2021). The global burden of breast cancer is likely to reach 3.19 million by 2040 (Sung, H. et al., 2021). Clinically, breast cancer is heterogenous and divided into three major subtypes: estrogen receptor (ER)-positive and progesterone receptor (PR)-positive, human epidermal growth factor receptor-2 (HER-2) positive, and triple-negative breast cancer (TNBC) (Denkert, C. et al., 2017). Drug resistance is a crucial contributing factor mainly associated with breast cancer recurrence and relapse (Ji, X. et al., 2019). Therefore, there is a high demand for supplementing the currently available therapies for breast cancer. In addition to immunotherapy, an effective therapeutic approach is gene therapy which has shown promise in breast cancer patients at all stages (Ji, X. et al., 2019, Ji Dastjerd, N.T., 2022). Gene therapy involves delivering the potential therapeutic transgene to the cancer cells to trigger apoptosis and a bystander effect in the heterogenous tumor tissue (Belete, T.M. et al., 2021). In addition to several gene therapy-based techniques, such as oncogene inhibition, tumor suppressor gene activation, and anti-angiogenic therapy, one of the effective methods is suicide gene therapy (Zarogoulidis, P. et al., 2013, Singh, V. et al., 2022). Broadly, suicide gene therapy is categorized into: enzymeactivating prodrug therapy and gene-inducing cytotoxicity upon drug treatment (Zarogoulidis, P. etal., 2013). Herpes simplex virus thymidine kinase (HSV-TK) and cytosine deaminase (CD) are the two transgenes in enzyme-activated prodrug treatment that have been most explored (Li, L.Q. et al., 2013, Li, Z.B. et al., 2006, Emamian, M. et al., 2021).

[0008] However, certain limitations, like the immunogenic nature of the viral and bacterial transgenes, along with the dependency of the activated drug on the cell cycle, can impact the phenotypic rescue (Zhang, J. et al., 2015). An alternative strategy of using an inducible Casp9 ( iCasp9) transgene, a cytotoxic synthetic analog to mammalian Casp9 gene, linked with an FK506 binding protein (FKBP) of human origin, has been used to silence genes during T cell therapy (Straathof, K.C. et al., 2005). Chemical inducer of dimerization (CID), AP20187, a biologically non-reactive small molecule, causes dimerization of iCasp9 upon binding to the FKBP domain (Di Stasi, A. et al., 2011).

[0009] Additionally, the cytotoxic effect of the / 'CG.V / ?9 / AP20187 combination is not reliant on the cell cycle phases, which can be useful in a heterogenous tissue like breast cancer tissue. A recent study has demonstrated the effectiveness of the iCasp9l AP20187 combination in inducing cytotoxicity in several breast cancer cell lines (Nakashima, I. et al., 2022). AAV is a highly effective gene delivery vector for treating various monogenic and complex disorders (Wang, D. et al., 2019). It offers excellent potential in current therapeutic- gene-based delivery in cancer studies since it is non-pathogenic and has low immunogenicity (Luo, J. etal., 2015, Balakrishnan, B. etal., 2014). The Applicant has previously demonstrated the utility of AAV-based iCasp9 vector systems in hepatocellular carcinoma (HCC) murine and acute myeloid leukemia (AML) zebrafish models (Khan, N. et al., 2019, Bammidi, S. et al., 2019, Jayandharan, G.R. et al., 2019). Previous reports have highlighted the role of post- translational modifications on AAV capsid and their impact on vector transduction (Yan, Z et al., 2002). Neddylation is a ubiquitin-like modifier of the target proteins (Kamitani, T et al., 1997). A previous study has shown the involvement of Neddylation in the modulation of the Herpes simplex virus type-1 (HSV-1) life cycle (Zhang, X et al., 2016). Several Neddylation post-translational modification sites were predicted in the capsid protein of AAV2 vectors. Further abolition of these sites resulted in an improved therapeutic outcome during retinal and hepatic gene therapy (Maurya, S et al., 2019, Maurya, S et al., 2020).

[0010] However, the rising burden of breast cancer, coupled with the limitations of existing therapies, underscores the urgency for innovative and effective treatment strategies due to its high mortality and drug resistance. Current therapies face limitations in tackling heterogeneity and recurrence.

[0011] Therefore, there is a need for an innovative combination of iCasp9 technology and AAV vectors to create an effective and targeted gene therapy strategy aimed at inducing cytotoxicity in heterogeneous and drug-resistant breast cancer. This approach could improve the overall therapeutic outcomes for patients with breast cancer. Therefore, there is a need for testing and characterization of both the AAV6 wild type (WT) and an AAV6 K3 IQ Neddylation mutant vector based on the iCasp9 system for suicide gene therapy in a murine model of breast cancer.

[0012] SUMMARY

[0013] The present invention relates to a novel treatment strategy against breast cancer with recombinant Adeno-associated virus (AAV) serotype 6 vectors carrying a suicide gene, inducible Casp9 (iCasp9).

[0014] In an embodiment of the present invention, an adeno-associated virus (AAV) vector constructed to carry an inducible Casp9 (iCasp9) transgene is provided. The adeno- associated virus (AAV) vector comprises a recombinant AAV serotype 6 capsid comprising a K31Q mutation configured to increase transduction efficiency, an inducible Caspase 9 (iCasp9) transgene under control of promoter selected from one of a cytomegalovirus (CMV) early enhancer and chicken-P-actin (CAG) promoter, a chemical inducer of dimerization (CID) for activating an iCasp9 protein configured to induce apoptosis in breast cancer cells, and a plurality of regulatory elements selected from a group comprising polyadenylation signals and enhancer elements configured to optimize an expression of the iCasp9 transgene.

[0015] In another embodiment of the present invention, a pharmaceutical composition is provided. The pharmaceutical composition comprises 1 x IO10to 1 x 1013vgs / animal of a recombinant AAV serotype 6 capsid comprising a K31Q mutation configured to increase transduction efficiency, 1 x IO10to 1 x 1013vgs / animal of an inducible Caspase 9 (iCasp9) transgene under control of promoter selected from one of a cytomegalovirus (CMV) early enhancer / chicken-P-actin (CAG) promoter, 0.1-10 mg / kg of animal of a chemical inducer of dimerization (CID; AP20187) for activating an iCasp9 protein configured to induce apoptosis in breast cancer cells, 1 x IO10to 1 x 1013vgs / animal of a plurality of regulatory elements selected from a group comprising polyadenylation signals and enhancer elements configured to optimize an expression of the iCasp9 transgene, and up to 1600 mL of a pharmacologically acceptable excipient. The pharmacologically acceptable excipient used during the process of AAV production comprises a spent media collected from AAV293 cells. Previous studies showed the harvesting of exosome associated AAV vectors (Exo- AAV) has potential roles in gene therapy (Khan et al., 2020).

[0016] The present invention provides an inducible iCasp9, a suicide transgene with Adeno- associated virus (AAV) vectors and demonstrates the induction of cancer cell cytotoxicity along with the reduction of tumor growth in a murine model of breast cancer. Upon treatment with AAV6-iCasp9 vectors and the chemical inducer of dimerizer (CID or AP20187), the viability of murine breast cancer cells (4T1) was significantly reduced to ~40%-60% (mock control 100%, p <0.001). Furthermore, an administration of AAV6-iCasp9 in an orthotopic breast cancer model showed a significant increase in iCasp9 transgene expression and a significant reduction in tumor growth rate. The present invention is first to report a breast cancer model demonstrating cellular apoptosis by direct activation of Caspase 9 and 3. The present invention highlights potential of AAV-iCasp9-based suicide gene therapy for aggressive breast cancer in patients.

[0017] To further clarify the advantages and features of the present invention, a more particular description of the invention will follow by reference to specific embodiments thereof, which are illustrated in the appended figures. It is to be appreciated that these figures depict only typical embodiments of the invention and are therefore not to be considered limiting in scope. The invention will be described and explained with additional specificity and detail with the appended figures.

[0018] BRIEF DESCRIPTION OF THE DRAWINGS

[0019] The disclosure will be described and explained with additional specificity and detail with the accompanying figures in which:

[0020] FIG. 1 depicts cytotoxic efficiency of AAV6-iCasp9 in vitro, in accordance with an embodiment of the present disclosure;

[0021] FIG. 2 depicts an antitumorigenic effect of AAV6-iCasp9 vectors (wildtype and K31Q mutant) with AP20187 dimerizer drug in an orthotopic model of breast cancer, in accordance with an embodiment of the present disclosure;

[0022] FIG. 3 depicts morphology of breast cancer tumors after suicide gene therapy with AAV6-iCasp9 vectors, in accordance with an embodiment of the present disclosure;

[0023] FIG. 4 depicts a histological analysis of tumors in breast cancer allograft tissue, in accordance with an embodiment of the present disclosure;

[0024] FIG. 5 depicts levels of iCasp9 after AAV vector administration in breast cancer tissue, in accordance with an embodiment of the present disclosure;

[0025] FIG. 6 depicts detection of AAV particles in breast cancer tissue, in accordance with an embodiment of the present disclosure;

[0026] FIG. 7 depicts detection of activated Caspase 3 in breast cancer tissue, in accordance with an embodiment of the present disclosure;

[0027] FIG. 8 depicts detection of apoptosis by DNA damage in breast cancer tissue, in accordance with an embodiment of the present disclosure;

[0028] FIG. 9 depicts an evaluation of off-target Caspase 9 protein expression in the liver tissue, in accordance with an embodiment of the present disclosure; and

[0029] FIG. 10 depicts a schematic representation of AAV6 mediated delivery of suicide transgene iCasp9 resulting in reduced viability of 4T1 breast cancer cells and decreased growth of murine allograft mammary tumor with enhanced apoptosis, in accordance with an embodiment of the present disclosure.

[0030] Further, those skilled in the art will appreciate that elements in the figures are illustrated for simplicity and may not have necessarily been drawn to scale. Furthermore, in terms of the method steps, chemical compounds, and parameters used herein may have been represented in the figures by conventional symbols, and the figures may show only those specific details that are pertinent to understanding the embodiments of the present disclosure so as not to obscure the figures with details that will be readily apparent to those skilled in the art having the benefit of the description herein.

[0031] DETAILED DESCRIPTION

[0032] For the purpose of promoting an understanding of the principles of the disclosure, reference will now be made to the embodiment illustrated in the figures and specific language will be used to describe them. It will nevertheless be understood that no limitation of the scope of the disclosure is thereby intended. Such alterations and further modifications in the illustrated system, and such further applications of the principles of the disclosure as would normally occur to those skilled in the art are to be construed as being within the scope of the present disclosure.

[0033] The terms "comprises", "comprising", or any other variations thereof, are intended to cover a non-exclusive inclusion, such that a process or method that comprises a list of steps does not include only those steps but may include other steps not expressly listed or inherent to such a process or method. Similarly, one or more components, compounds, and ingredients preceded by "comprises... a" does not, without more constraints, preclude the existence of other components or compounds or ingredients or additional components. Appearances of the phrase "in an embodiment", "in another embodiment" and similar language throughout this specification may, but not necessarily do, all refer to the same embodiment.

[0034] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which this disclosure belongs. The system, methods, and examples provided herein are only illustrative and not intended to be limiting. In the following specification and the claims, reference will be made to a number of terms, which shall be defined to have the following meanings. The singular forms “a”, “an”, and “the” include plural references unless the context clearly dictates otherwise.

[0035] Embodiments of the present invention relate to a novel treatment strategy against breast cancer with recombinant Adeno-associated virus (AAV) serotype 6 vectors carrying a suicide gene, inducible Casp9 (iCasp9). Upon treatment with AAV6- iCasp9 vectors and the chemical inducer of dimerizer (CID or AP20187), the viability of murine breast cancer cells (4T1) was significantly reduced to ~40%-60% (mock control 100%, p <0.001). Furthermore, an administration of AAV6-iCasp9 in an orthotopic breast cancer model showed a significant reduction in tumor growth rate.

[0036] In an embodiment of the present invention, an adeno-associated virus (AAV) vector constructed to carry an inducible Casp9 (iCasp9) transgene is provided. The adeno- associated virus (AAV) vector comprises a recombinant AAV serotype 6 capsid comprising a K31Q mutation configured to increase transduction efficiency, an inducible Caspase 9 (iCasp9) transgene under control of promoter selected from one of a cytomegalovirus (CMV) early enhancer and chicken-P-actin (CAG) promoter, a chemical inducer of dimerization (CID) for activating an iCasp9 protein configured to induce apoptosis in breast cancer cells, and a plurality of regulatory elements selected from a group comprising polyadenylation signals and enhancer elements configured to optimize an expression of the iCasp9 transgene. The iCasp9 transgene is placed under the control of a strong ubiquitous promoter, such as the cytomegalovirus (CMV) early enhancer / chicken-P-actin (CAG) promoter. This promoter ensures robust and consistent expression of the iCasp9 transgene upon vector delivery to the target cells.

[0037] In another embodiment of the present invention, the chemical inducer of dimerization (CID) is AP20187. The poly adenylation signals comprise bovine growth hormone (BGH) polyA signal and enhancer elements comprise cytomegalovirus (CMV) early enhancer / chicken-P-actin (CAG) promoter, which can be incorporated.

[0038] In another embodiment of the present invention, the AAV vector carrying the iCasp9 transgene is further engineered to include a mutated AAV6 capsid, specifically a K31Q mutation. This mutated capsid variant has been shown to enhance the transduction efficiency of the AAV vector. The use of the mutated capsid increases the delivery of the iCasp9 transgene to target breast cancer cells, thereby enhancing the therapeutic effect of the inducible Caspase 9-mediated suicide gene therapy.

[0039] In another embodiment, the present invention demonstrates the mechanism of action of the iCasp9-based suicide gene therapy. Upon administration of the AAV vector carrying the iCasp9 transgene to breast cancer cells, the cells are subsequently treated with a chemical inducer of dimerization (CID), such as AP20187. The CID induces dimerization of the iCasp9 protein, leading to its activation. The activated iCasp9 protein initiates the apoptosis pathway, triggering a cascade of events that ultimately results in programmed cell death. This mechanism ensures that only the targeted breast cancer cells undergo apoptosis, sparing healthy surrounding tissue.

[0040] In another embodiment of the present invention, a pharmaceutical composition is provided. The pharmaceutical composition comprises 1 x IO10to 1 x 1013vgs / animal of a recombinant AAV serotype 6 capsid comprising a K31Q mutation configured to increase transduction efficiency, 1 x IO10to 1 x 1013vgs / animal of an inducible Caspase 9 (iCasp9) transgene under control of promoter selected from one of a cytomegalovirus (CMV) early enhancer / chicken-P-actin (CAG) promoter, 0.1-10 mg / kg of animal of a chemical inducer of dimerization (CID; AP20187) for activating an iCasp9 protein configured to induce apoptosis in breast cancer cells, 1 x IO10to 1 x 1013vgs / animal of a plurality of regulatory elements selected from a group comprising polyadenylation signals and enhancer elements configured to optimize an expression of the iCasp9 transgene, and up to 1600 mL of a pharmacologically acceptable excipient. The pharmacologically acceptable excipient used during the process of AAV production comprises a spent media collected from AAV293 cells. Previous studies showed the harvesting of exosome associated AAV vectors (Exo-AAV) has potential roles in gene therapy (Khan et al., 2020). The chemical inducer of dimerization (CID) is AP20187. The poly adenylation signals comprise bovine growth hormone (BGH) poly A signal and enhancer elements comprise the cytomegalovirus (CMV) early enhancer / chicken-P-actin (CAG) promoter, breast cancer- specific promoters [protein regulator of cytokinesis 1 (PRC1) and ribonuclease reductase 2 (RRM2) (Yun et al., 2008), LALBA promoter (Li et al., 2005)], tumor- specific promoters [hypoxia inducible promoter (Javan et al., 2017); hTERT, HER-2, COX-2 (Chen et al., 2018), can be incorporated. Further, the pharmacologically acceptable excipient is selected from the group comprising one of binders, diluents, disintegrants, lubricants, glidants, fillers, colouring agents, flavouring agents, and combinations thereof. The composition is administered by one of routes selected from oral, rectal, cutaneous, pulmonary, nasal, sublingual, the parenteral route, in particular intradermic, subcutaneous, intramuscular, intravenous, intra-arterial, intra-rachidial, intra- articular, intra-pleural, intraperitoneal, ocular, inhalation, transdermic, epidural, intrabronchial, intramural, intracardiac, intracerebral, intracerebroventricular, intragastric, intratympanic, intraspinal, intrathecal, intratracheal, intraduodenal, intra-uterine, intravaginal, intravesical, intravitreal, rectal, subconjunctival, and intertumoral administration. The composition is present in one of form as a tablet, capsule, pill, syrup, suspension, powder, granule, emulsion, microsphere, injectable solution, and solid-liquid nanoparticles. The composition is configured for one of internal use, and external applications.

[0041] In a specific embodiment, the present invention is applied to the treatment of triplenegative breast cancer (TNBC), a highly aggressive and heterogeneous form of breast cancer that lacks targeted therapy options. The inducible caspase 9-mediated suicide gene therapy utilizing AAV vectors offers a novel and promising approach for treating TNBC. By directly inducing apoptosis in the tumor cells, this therapy addresses the high metastatic rate and drug resistance associated with TNBC.

[0042] In another embodiment, the present invention involves an in vivo evaluation of therapy using a murine breast cancer model. In this embodiment, an orthotopic murine breast cancer model is established by injecting murine breast cancer cells into the mammary fat pad of female athymicnu / numice. Subsequent administration of the AAV vector carrying the iCasp9 transgene, along with CID, results in a significant reduction in tumor growth rate.

[0043] The present invention is explained further in the following specific examples, which are only by way of illustration and are not to be construed as limiting the scope of the invention. Examples

[0044] FIG. 1 depicts cytotoxic efficiency of AAV6-iCasp9 in vitro, in accordance with an embodiment of the present disclosure. AAV6 vectors encoding the iCasp9 gene were used to infect breast cancer cells (4T1) at MOI of 5 x 103, 5 x 104and 1 x 105(three replicates each). The cytotoxicity of the vector-transduced cells was subsequently measured by MTT assay. Triton-X-100 was used as a positive control. Data are represented as mean ± SD. * p <0.05, ** p <0.01, *** p <0.001, ns vs mock and#p <0.05 vs AAV6-CAG-iCasp9 + AP20187. No significant difference in cell viability was observed when cells were treated with increasing MOI of the same vector.

[0045] Recombinant AAV vector induces cytotoxicity in breast cancer cells

[0046] The iCasp9 transgene is first packaged under the regulation of strong ubiquitous promoter cytomegalovirus (CMV) early enhancer / chicken-P-actin (CAG) promoter into AAV serotype 6 wild type (WT) [AAV6-CAG-iCasp9] and AAV6 K31Q Neddylation mutant [AAV6K31Q-CAG-iCasp9] vectors to evaluate their cytotoxic potential. A quantitative polymerase chain reaction (PCR) approach was used to estimate the physical particle titres of the vectors [vector genomes (vgs) / mL] (Aumhammer, C. et al., 2012). To ascertain cytotoxicity, a highly invasive and tumorigenic mouse mammary carcinoma cell line, 4T1, was chosen (Pulaski, B.A. et al., 2001). The 4T1 cells were infected at a range of multiplicity of infection (MOI) of 5 x 103, 5 x 104and 1 x 105with AAV6-CAG-iCasp9 or AAV6K31Q-CAG-iCasp9 vectors. The next day, the vector-infected 4T1 cells were treated with 10 nM of AP20187. Cell survivability was determined 24h later, using an absorbance-based MTT assay kit. Our data (Figure 1) revealed that the cell survivability in AAV6-CAG- iCasp9 infected cells was ~64-78% at different MOI, whereas AAV6K31Q-CAG- iCasp9 treated cells had ~40-58% viability. It is evident that in all AAV6-iCasp9 vector treated groups, cell viability was significantly [AAV6-CAG-iCasp9: p <0.05 (all MOIs); AAV6K31Q-CAG-iCasp9: p <0.05 (MOI 5 x 103),p <0.01 (MOI 5 x 104), p <0.001 (MOI 1xio5)] decreased compared to mock-treated cells (cell viability 100%). Further, we also observed that the AAV6K31Q Neddylation mutant vector treated group had very high cell kill (~20%, p <0.05) when compared to the AAV6 WT vector at different MOI. These results suggested that the AAV6-iCasp9 vectors are able to induce cytotoxicity in 4T1 cells and that the AAV6K31Q Neddylation mutant vector has higher transduction efficiency in vitro when compared to the AAV6 WT vector, as observed in other AAV Neddylation mutant vectors in our previous studies (Maurya, S et al., 2019, Maurya, S et al., 2020). However, it was observed that cell cytotoxicity did not exhibit a proportional increase with increasing vector MOI, which could be a result of the potential saturation dose effect. Once the virus successfully infiltrates the host cell, the subsequent cell death, due to the expression of the suicide gene, becomes independent of the quantity of entering viruses. This implies that only a minimum threshold level of vector presence is required within the cell to trigger the cytotoxic response; any increase in MOI beyond this critical point does not alter the phenotype (Cell death). Similar observations were made in a study by Li et al., where almost no difference was found between MCF-7 cell survival as AAV-2 / TRE / HSVtk / Tet-On infection reached a plateau when rAAV titres ranged from 104to 106vp / cell (Li, Z.B et al., 2006).

[0047] FIG. 2 depicts antitumorigenic effect of AAV6-iCasp9 vectors (wildtype and K31Q mutant) with AP20187 dimerizer drug in an orthotopic model of breast cancer, in accordance with an embodiment of the present disclosure. (A) An orthotopic allograft breast cancer model was developed by administering the 4T1 cell line into the mammary fat pad of female athymicnu / numice. When tumor size reached a volume of ~ 100-150 mm3, AAV vectors were administered intratumorally. On days 2, 4, and 6 of post- vector administration, AP20187 (CID) was administered intraperitoneally. Tumors were harvested at day 10 post-vector administration for further molecular and biochemical assays. (B) Animals from the AAV6-CAG-iCasp9 and AAV6K31Q- CAG-iCasp9 groups with AP20187 treatment had attenuated tumor growth rate than mock-injected and AAV6-iCasp9 vector-only animals (p <0.001). Data are represented as mean ± SD. (** p <0.01, *** p <0.001 vs mock group;#p <0.05,mp <0.001 vs AAV6-CAG-iCasp9;&&&p <0.001 vs AAV6K31Q-CAG-iCasp9). (C) Representative animals at day 10 from each experimental group are depicted.

[0048] FIG. 3 depicts morphology of breast cancer tumors after suicide gene therapy with AAV6-iCasp9 vectors, in accordance with an embodiment of the present disclosure. Allografted mice with an average tumor volume of ~100-150 mm3were administered with AAV6-iCasp9 vectors (5 x 1010vgs / animal) with or without AP20187 and PBS (mock-treated group). Representative tumor tissues harvested from animals ten days after suicide gene transfer are shown. AAV6 vector-mediated suicide gene therapy reduces tumor growth in murine model of breast cancer

[0049] An orthotopic model of breast cancer in female athymicnu / numice is established. Subsequently, the cytotoxic effect of AAV6-CAG-iCasp9 and AAV6K31Q-CAG- iCasp9 vectors was assessed in these murine models in vivo. After administration of 4T1 cells, the transplanted animals developed visible tumor nodules within the mammary fat pad starting from day 4. After 7 days, when the tumors reached 100 - 150 mm3in volume, ~5 xlO10vgs of AAV6-iCasp9 vectors or phosphate buffer saline (PBS) in a 100 pL volume was injected intratumorally (FIG. 2A). Intraperitoneal injection of AP20187 (1 mg / kg) was given to each mice next day (Yagyu, S. et al., 2015). Mice injected with the AAV6-CAG-iCasp9 and AAV6K31Q-CAG-iCasp9 vectors, without AP20187 intervention, were monitored to assess the exclusive impact of the vectors on tumor growth.

[0050] Further, the tumor growth rate and volume up to day 10 is periodically assessed, as recommended earlier (Sapi, J. etal., 2015). FIG. 2B depicts the relative tumor growth pattern of the experimental mice. At day 10, the relative tumor volume (RTV) was significantly (~ 1.35-fold) reduced in AAV6 vector-treated groups when compared to mock-treated animals. The representative data from each experimental group are shown in FIG. 2C. The harvested tumors from all three groups are presented in FIG. 3. However, no significant difference was observed between AAV6 WT and AAV6K3 IQ neddylation mutant groups (AP20187 administered) in vivo, possibly due to the saturation of transgene expression as has been observed in other studies earlier (Wu, T. et al., 2012, Petrs-Silva, H. et al., 2009). There was a significant difference in RTV observed (p <0.001) between AP20187 injected vs non-injected groups. Taken together, the AAV6-iCasp9 vector- mediated suicide gene therapy was well-tolerated and significantly reduced breast cancer tumor growth in vivo. However, further increased dose of AAV6-iCasp9 vectors, via a dose-finding study will be required to completely ablate the breast cancer tumor.

[0051] FIG. 4 depicts histological analysis of tumors in breast cancer allograft tissue, in accordance with an embodiment of the present disclosure. Histological comparison among all the groups depicted that AAV6-iCasp9 + AP20187 treated groups had focal areas of necrosis, pyknosis, karyorrhexis (marked by a yellow circle), and apoptotic bodies (shown by red arrow) than the mock-treated group (magnification 100X objective, scale bar 25 pm). Whereas, more number of pleomorphic nuclei (marked by brown arrow) and mitotic cells (marked by black arrow) were observed in mock- treated and AAV6-iCasp9 vector-only groups. The data was generated from two representative tumors from each group and a total of six sections from each group.

[0052] Histological analysis of AAV treated breast tumor tissue correlates with formation of apoptotic bodies

[0053] Breast tumors were harvested from the orthotropic mice ten days after vector administration. For morphological analysis, the collected tumors were fixed, paraffin sections were taken for hematoxylin and eosin (H&E) staining. Under 100X magnification objective, critical comparison of cellular morphology was done. Compared to the control group, the AAV6-iCasp9 treated tumors had an increased number of apoptotic cells with condensed nuclei (shown by red arrow, FIG. 4). Furthermore, the treated animals also showed focal areas of necrosis. In contrast, the mock-treated tumors had a higher distribution of pleomorphic nuclei (marked by brown arrow), mitotic cells (marked by black arrow), and dense nuclei with higher cell density (FIG. 4). Moreover, well-defined features like cellular debris, shrunken cells, karyorrhectic (marked by yellow circle), and pyknotic nuclei were identified in the AAV6-iCasp9 treated groups (AP20187 administered) but not in the other experimental groups (Elmore, S.A. et al., 2016). Similar findings have been reported for the iCasp9-based suicide gene therapy in an HCC murine model (Khan, N. et al., 2020).

[0054] FIG. 5 depicts levels of iCasp9 after AAV vector administration in breast cancer tissue, in accordance with an embodiment of the present disclosure. An increase in iCasp9 mRNA levels was observed in breast tumor tissues after administration with AAV6-iCasp9 vectors. Data are from 3-6 technical replicates per group and represented as mean ± SEM. *** p <0.001 vs mock;#p <0.05 vs AAV6-CAG-iCasp9 + AP20187.

[0055] FIG. 6 depicts detection of AAV particles in breast cancer tissue, in accordance with an embodiment of the present disclosure. Tumors from each treatment group were analyzed by immunohistochemistry with A20 antibody specific to detect AAV capsid. (A) Micrographs from the AAV-treated groups with or without AP20187 had a clear distribution of AAV-positive cells within the tumors when compared to mock-treated animals (panel III, magnification 63X, scale bar 50 pm). The magnified regions of panel III are represented in panel IV (scale bar 25 pm). AAV-positive cells are marked with a green arrow. (B) Quantification using ImageJ showed that the number of AAV- positive cells was higher in the AAV6K31Q-CAG-iCasp9 treated group compared to the AAV6-CAG-iCasp9 treated group (*** p <0.001 vs mock group;#p <0.05 vs AAV6-CAG-iCasp9 + AP20187). Data are represented as mean ± SD. The data are generated from 5 sections from each treatment group.

[0056] FIG. 7 depicts detection of activated Caspase 3 in breast cancer tissue, in accordance with an embodiment of the present disclosure. After receiving AAV6-iCasp9 gene therapy, breast tumors were harvested and IHC was performed after fixation and sectioning of tumors. (A) Micrographs representing the treatment groups (AAV6- CAG-iCasp9 and AAV6K31Q-CAG-iCasp9) with AP20187 showed enhanced association of cleaved Caspase 3 in the nuclei compared to control animals (represented by a green arrow; magnification 63X objective, scale bar 50 pm). AAV6- CAG-iCasp9 and AAV6K31Q-CAG-iCasp9 without AP20187 failed to activate the Caspase 3 protein downstream of Caspase 9; (B) The number of cleaved Caspase 3 positive cells was quantified using ImageJ software (*** p <0.001, ns vs mock group;###p <0.001 vs AAV6-CAG-iCasp9;&&&p <0.001 vs AAV6K31Q-CAG-iCasp9). Data are represented as mean ± SD. The data were generated from 7-13 sections from each treatment group.

[0057] AAV-iCasp9 gene transfer activates the effector caspase in apoptosis pathway

[0058] The major goal of the iCasp9 gene therapy with AAV6 vectors is to trigger the apoptosis pathway. Breast tumors were explanted from all five groups and further homogenized; total RNA was isolated, and cDNA was synthesized. The induction of apoptosis was further confirmed by quantifying the iCasp9 mRNA expression from the cDNA. A quantitative PCR showed that the relative expression of iCasp9 was significantly increased by -6-37X (p <0.001) in all AAV6-iCasp9 treated groups (with or without AP20187) when compared to mock-treated group (FIG. 5). Further analysis showed that iCasp9 expression was significantly (p <0.01) high in the AAV6- iCasp9 capsid mutant, treated group when compared to the AAV6-wild type vector treated group. Additionally, tumor sections of all AAV6 treated groups were stained with A20 antibody for the detection of intact AAV capsid, and number of AAV- positive cells was quantified (FIG. 6A). FIG. 6B showed significantly ( / ? <0.05) high number of AAV transduced cells in AAV6K31Q-CAG-iCasp9 treated group (39.6+3.3) compared to AAV6-CAG-iCasp9 treated group (28.8+4.6). In addition, we found no detectable AAV-positive cells in the mock-treated group.

[0059] The activation of cleaved Caspase 3 protein level in the breast tumor sections was then verified by immunohistochemistry. The cleaved Caspase 3 expression in both cytoplasm and nucleus, but the association of cleaved Caspase 3 in the nuclei (represented by green arrow) of AAV6-iCasp9 + AP20187 treated groups was higher compared to mock-treated group (FIG. 7A). It must be noted that the cleavage and activation of Caspase 3 is mediated by induced Caspase 9 (Riedl, S.J. et al., 2004) and further nuclear translocation of cleaved Caspase 3 initiates the apoptosis, as observed in our data (FIG. 4) (Kamada, S. et al., 2005). Further quantification of the activation of cleaved Caspase 3 positive cells showed that AAV6-iCasp9 vector- treated groups with AP20187 had significantly (p <0.001) higher cleaved Caspase 3 expression when compared to mock-treated group (AAV6: 21.8+7.5 vs AAV6K31Q: 31.6+15.2 when compared to the mock-treated and AAV6-iCasp9 vector only groups (FIG. 7B). This signifies that AAV6-iCasp9 vectors failed to activate the Caspase 3 in absence of AP20187, and overexpressed iCasp9 showed functional activity only in the presence of this prodrug.

[0060] FIG. 8 depicts detection of apoptosis by DNA damage in breast cancer tissue, in accordance with an embodiment of the present disclosure. Ten days after receiving the gene therapy, female athymicnu / numice with 4T1 tumors were euthanized. TUNEL assay was performed after surgical removal, fixation, and sectioning of tumors. (A) Micrographs representing the treatment group (AAV6-CAG-iCasp9 and AAV6K31Q- CAG-iCasp9) with AP20187 showed a clear distribution of apoptotic cells within the tumors when compared to control animals (magnification 40X objective, scale bar 50 pm). In AAV6-CAG-iCasp9 and AAV6K31Q-CAG-iCasp9 vector-only administered mice, the absence of AP20187 failed to induce apoptosis. (B) The number of TUNEL- positive cells between the experimental and control groups was quantified using ImageJ software (* p <0.05 and *** p <0.001, ns vs mock group;##p <0.01 vs AAV6- CAG-iCasp9;&&&p <0.001 vs AAV6K31Q-CAG-iCasp9). Data are represented as mean + SD. The data are generated from 6-12 sections from each treatment group. FIG. 9 depicts evaluation of off-target Caspase 9 protein expression in the liver tissue, in accordance with an embodiment of the present disclosure. Liver tissues were harvested from all the treatment groups, and immunohistochemistry was performed as discussed in the methods section. The micrographs of the liver sections demonstrate no activation of Caspase 9 protein in any of the treatment groups (magnification 63X, scale bar 50 pm).

[0061] DNA damage correlates with treatment outcomes in breast tumors

[0062] To evaluate the molecular effects of iCasp9, we performed a terminal deoxynucleotidyl transferase-mediated dUTP nick-end labeling test (TUNEL). TUNEL assay can detect double-strand breaks in DNA of apoptotic cells and thus, is used as a biomarker for the diagnosis of cell death (Kyrylkova, K. et al., 2012). Tissues from both AAV6-iCasp9 treated groups in the presence of AP20187 were strikingly positive for TUNEL-positive cells, indicating widespread cell death, which is absent in the AAV6-iCasp9 vector-only group (FIG. 8A). To quantify DNA damage, we assessed the fluorescence-integrated density of TUNEL-positive cells. Data depicted in FIG. 8B reveals TUNEL-positive cells with higher fluorescence- integrated density in tumors, that received suicide gene therapy (AAV6-CAG-iCasp9: 1.7 x 105and AAV6K31Q-CAG-iCasp9: 2 x 105per unit area, p <0.05 andp <0.001, respectively) when compared to the mock-treated group. These data highlight that the AAV6K3 IQ mutant is more effective in triggering apoptosis in the breast cancer cells in the presence of AP20187. However, a number of factors, including vector saturation dose, where a dose of ~5 x IO10vgs / animal may be close to the saturation levels and which may have contributed to the similar regression pattern found in the wild-type and mutant vector-treated animals (Petrs-Silva, H. et al., 2009, Aronson, S.J. et al., 2020, Hakim, C.H. et al., 2020, Welles, H.C. et al., 2018). Although we noticed high AAV transduction in the mutant group, the same does not get reflected in terms of RTV, and we speculate this discrepancy may stem from the limited availability of the dimerizer drug AP20187, which is integral to the ultimate cell kill effect. Future investigations focussing on dose optimization of AP20187 could help elucidate its impact on RTV. To assess the off-target effect of iCasp9 activation in normal organs (e.g., liver) of AAV6-iCasp9 treated animals, immunohistochemistry of Caspase 9 protein was performed. FIG. 9 demonstrated the absence of Caspase 9 expression in the liver of AAV vector-administered groups. This implies that this direct intra- tumoral suicide gene therapy had a negligible effect on normal tissues.

[0063] FIG. 10 depicts a schematic representation of AAV6 mediated delivery of suicide transgene iCasp9 resulting in reduced viability of 4T1 breast cancer cells and decreased growth of murine allograft mammary tumor with enhanced apoptosis, in accordance with an embodiment of the present disclosure.

[0064] TNBC has an increased resistance against available chemotherapies such as taxane and anthracycline -based drugs, emphasizing the critical need for research into novel strategies to slow disease progression (Bai, X. et al., 2021, Nedeljkovic, M. et al., 2019). Gene therapy by virtue of its direct mechanism of triggering apoptosis in the target cell, is an effective approach for cancer treatment (Sun, W. et al., 2019). In particular, gene therapy using an AAV vector in breast cancer has shown encouraging results. A study was conducted in the NeuT breast cancer model with a septuplet- tyrosine mutant form of AAV2 vector-mediated delivery of siRNAs against proteins involved in unfolded protein response (Ruan, Q. et al., 2013). The outcome data showed that treated xenograft tumors had decreased growth and angiogenesis. In another study, suicide gene therapy by intratumoral administration of doxycycline- inducible AAV2-HSV-TK resulted in substantial suppression of tumor growth in a mouse model of breast cancer (MCF-7) (Li, Z.B. et al., 2006). In a study of immunomodulation of neu-expressing Turin-Bologna (TUBO) breast cancer tumors, AAV5-neu or AAV6-neu expression increased the survival (80% vs 100%, up to day 300) of the animal model by inducing long-term immunity against tumor (Steel, J.C. et al., 2013). Pinto et al. showed that transduction of MDA-MB-468 cells with an AAV2-shRNA vector directed against proteasome subunit alpha-2 (PSMA2) caused a dramatic reduction in cell survivability (from 100% to 30%) and an increase in the induction of apoptosis, by a factor of two (Pinto, C. et al., 2019). AAV2-mediated overexpression of high-affinity vascular endothelial growth factor (VEGF) blocker and paclitaxel improved therapeutic response in a murine model of TNBC (Lu, L. et al., 2012). Here, for the first time, we have demonstrated the therapeutic potency of the iCasp9 transgene in the murine TNBC model (Kaur, P. et al., 2012).

[0065] The inducible Caspase 9 based system offers several benefits compared to enzyme- activated prodrug therapies, as highlighted earlier (Khan, N. et al., 2019). Firstly, z’Cas / ?9 / AP20187-based suicide gene effects have an acute onset of activity and functional rescue in terms of days (6-10 days vs 30 days) in animal models compared to other enzyme-activated prodrug therapies (Li, L.Q. et al., 2013, Khan, N. et al., 2019, Khan, N. et al., 2020, Wang, Y.G. et al., 2016, Torimura, T. et al., 2012, Kanazawa, T. etal., 2003). Secondly, the cell-cycle dependency of enzyme-activated prodrug therapies limits their cytotoxic effects to the actively dividing cells only, which may decrease their therapeutic potential in a heterogenous tumor tissue consisting of senescence cancer stem cells (CTCs) (Kawashita, Y. et al., 1999, Walcher, L. et al., 2020). Upon administration of the AAV6-iCasp9 vector, Caspase 3 and other components of the intrinsic apoptotic pathway get activated after dimerization of iCasp9 protein by AP20187 (Rossignoli, F. et al., 2019, Rossignoli, F. et al., 2009). This activation of the pro-apoptotic pathway occurs directly and is not dependent on the cell-cycle phase (Su, H. et al., 2000). Our in vivo study has demonstrated that after administering the AAV6-iCasp9 vector / AP20187 combination, the breast tumors had a lesser tumor volume and growth rate within 6- 10 days of vector administration. In comparison, previous studies in breast cancer models showed retarded tumor growth after 30 days of administration of HSV- TK / GCV-based gene therapy (Li, Z.B. et al., 2006). The induction of apoptosis was also further validated by ex vivo analysis of breast tumor tissue. While we have observed the therapeutic potential of our iCasp9 gene at the cellular level, despite having breast tumor growth retardation, tumors were not completely eradicated. This suggests that monotherapy may not be sufficient and further enhancement by using an adjunct or combinatorial treatment with chemotherapeutic or immunotherapeutic drugs are required.

[0066] Our study has the following limitations. We have utilized a strong ubiquitous CAG promoter for the expression of iCasp9 transgene. The therapy will be more beneficial if some tumor-targeting strategies at the transcription or vector transduction levels can be applied. Instead of this ubiquitous promoter, the use of a cancer- specific or tumorspecific promoter is desirable (Gray, S.J. et al., 2011, Montano-Samaniego, M. et al., 2020). Yun et al. have shown that promoters of protein regulator of cytokinesis 1 (PRC1) and ribonuclease reductase 2 (RRM2) genes can be utilized in targeting breast cancer cells as these promoters exhibit strong gene expression similar to that driven by CMV promoter (Yun, H.J. etal., 2008). At the transduction level, the AAV vector can be modified by peptide insertion and targeted toward specific cancer cells. A previous study from our lab had shown a modified AAV6 vector carrying CD33 targeting peptide against human myeloid leukemia cells (U937) (Khan, N. et al., 2019). Another strategy to augment the effectivity of / Co.v d-bascd gene therapy could be the modulation of hallmark parameters of the tumor microenvironment, such as hypoxia, known to confer resistance to other forms of therapy (Jing, X. et al., 2019). Therefore, enhancing the iCasp9 system by altering the transgenic construct's regulatory components, increasing the effective vector dose from the currently used ~5 x IO10vgs by a log fold, or combining it with other adjunct therapies may pave the way for its clinical translation in patients with breast cancer.

[0067] MATERIALS AND METHODS

[0068] Cell culture

[0069] The mouse mammary carcinoma (4T1) cell line was gifted by Dr. Dipak Datta, CDRI, Lucknow, India. AAV-293 cell line was purchased from Stratagene (San Diego, CA, USA). Cell lines were maintained at 37 °C and 5% CO2 in a growth medium containing Iscove’s Modified Dulbecco’s Medium (IMDM) supplemented with 10% fetal bovine serum, FBS (Gibco, MT, USA), 10 pg / mL each of Ciprofloxacin (HiMedia Laboratories, Mumbai, India) and Piperacillin (MP Biomedicals, Santa Ana, CA, USA). B / B homo-dimerizer or AP20187, also known as a chemical inducer of dimerization (CID), was purchased from ARIAD Pharmaceuticals (Cambridge, MA, USA) and was reconstituted in 100% ethanol at ImM concentration and kept at 20°C.

[0070] Prediction of Neddylation sites on AAV6 capsid

[0071] Amino acids for Neddylation were predicted in the VP1 protein of AAV6 using the VP1 protein's sequence (Protein ID: AAB95450.1). NeddyPreddy, a web-based bioinformatics tool, was used to predict potential sites for Neddylation (Yavuz, A.S. et al., 2015). The output was used to determine the medium and high threshold levels for this tool. The AAV6 K31Q target was selected based on the high threshold score of 0.9 out of 1. The Neddylation mutation (K31Q) in the AAV6 wild-type rep / cap plasmid (p.AAVR2 / C6) was further generated by site-directed mutagenesis using specific primers.

[0072] Generation of recombinant AAV vector The AAV6 capsid K31 residue was changed to glutamine (K>Q) using a QuikChange II XL Site-Directed Mutagenesis Kit (Agilent Technologies, Santa Clara, CA, USA) according to the manufacturer's instructions. Triple transfection was performed to generate recombinant Adeno-associated virus (AAV) vectors in the AAV-293 cell line. 15 cm2dishes were used to grow AAV-293 cells until they reached 80% confluency. The AAV6 WT or Neddylation mutant (K31Q) rep / cap plasmid (p.AAVR2 / C6), iCasp9 transgene under CAG promoter (p.AAV-CAG-iCasp9), and adenoviral helper plasmids (p.Helper) were co-transfected into the AAV-293 cells in the presence of serum-free IMDM media using equimolar polyethyleneimine (Polysciences Inc, PA, USA) (Xiao, X. etal., 1998). Cells were harvested after 68-72 hours, lysed followed by benzonase (25 units / mL; Sigma-Aldrich, St. Louis, MO, USA) treatment. For the purification of vectors, the following steps were followed: iodixanol gradient ultracentrifugation (OptiPrep, Sigma- Aldrich) and column chromatography (Cytiva, MA, USA). Finally, the concentration of the purified vectors up to 500 pL was done by using an Amicon Ultra- 15 centrifugal filtration device (Millipore, Bedford, MA, USA).

[0073] Titration for quantification of AAV vector genome

[0074] The physical particle titre of AAV vectors was measured. The sample was treated with DNase to remove free DNA. A quantitative PCR with SYBR Green (Promega, Madison, WI, USA) and poly adenylation (Poly A) signal specific primer, was carried out in CFX96 (Bio-Rad, Hercules, CA, USA). AAV2-RSS (ATCC, VA, USA) was used as a standard for titration. Titres were measured in vgs / mL and calculated from two independent analyses.

[0075] In vitro cytotoxicity assay

[0076] For the comparison of cytotoxicity by AAV6-CAG-iCasp9 and AAV6K31Q-CAG- iCasp9 vectors, ~1.5 x 1O44T1 cells were seeded in triplicate and transduced at an MOI of 5 x 103, 5 xlO4, and 1 x 105. Vector- transduced cells were treated with lOnM AP20187 the next day. An absorbance-based EZcountTM MTT Cell Assay Kit (HiMedia, Mumbai, India) was used to evaluate cell cytotoxicity 24 hours after drug treatment. The percentage of cell survivability was calculated as described by the manufacturer protocol (Li, Z.B. et al., 2006).

[0077] Inducible Casp9 gene therapy in breast cancer murine model

[0078] Female athymicnu / numice (National Institute of Nutrition, Hyderabad, India) were used for this study. Animal experimentations were conducted following the approval of the IIT-Kanpur institutional animal ethics committee (IAEC). For orthotopic injection in 6-8-week-old female athymicnu / numice, ~1 x 1064T1 cells were resuspended in 100 pL filtered PBS and administered in the sixth mammary fat pad region. Upon reaching a tumor volume of -100-150 mm3, mice received ~5 x 1010vgs of AAV6-CAG- iCasp9 or AAV6K31Q-CAG-iCasp9 vectors intratumorally. About 0.1 mL of PBS was injected to mimic the injection process in the mock group. After administering the vector, the animals received intraperitoneal AP20187 (1 mg / kg) injections at 48-hour intervals starting from the next day of vector administration. The control groups included two treatment groups that only received the AAV6-CAG-iCasp9 or AAV6K31Q-CAG-iCasp9 vectors and a third group receiving the sham intraperitoneal injection to observe the AAV6-iCasp9 vector-only effect in the tumor development. Tumor diameter was measured every alternate day using a Vernier caliper, at two perpendicular diameters in the experimental mice. The animals were examined visually for any other gross changes daily. Tumor volume was calculated using the equation 0.5 x L x W2, where L and W are the longest and the smallest diameter (in mm), respectively (Tomayko, M.M. etal., 1989). Relative tumor volume (RTV) was calculated by dividing tumor volume at a particular day (Tx) by tumor volume at day 0 (To), where RTVT = RTV of the treated group and RTVM = RTV of the mock group (Tsukihara, H. et al., 2015).

[0079] Gene expression quantification

[0080] Total RNA was isolated from the breast tumor tissue of each group. Approximately 50mg of tissue was first homogenized using IG-L13K Mini Handheld Homogenizer (iGene Labserve, New Delhi, India) and further RNA isolation was done with Trizol (Invitrogen, MA, USA) reagent. Isolated RNA was run in a 1.5% agarose gel (with 1% Sodium hypochlorite), and the integrity of 28S, 18S, and 5S rRNA was checked. For analysis of iCasp9 mRNA expression, quantitative PCR with SYBR Green (Promega, Madison, WI, USA) was used. The primer sequence was 5’- GAAGGGGTTGCCCAGATGAG -3’ (forward) and 5’- GCACCGACATCACCAAATCC -3’ (reverse). Relative normalized expression of iCasp9 was plotted using 18S rRNA expression as a reference for each sample.

[0081] Histopathological studies

[0082] Tumors from mock and AAV-treated groups were harvested after 10 days of AAV vector administration, washed in PBS, and fixed in 10% neutral buffered formalin at room temperature for 24 hours. Tumor tissues were further processed by paraffin embedding, tissue sectioning and hematoxylin-eosin (H&E) staining. Thereafter, stained sections were analysed by microscopic examination (Fischer, A.H. et al., 2008). Images were acquired under an inverted microscope (Leica DMi8, Leica Microsystems, Wetzlar, Germany) at 100X magnification objective.

[0083] In situ cell death detection

[0084] Paraffin blocks containing tumor tissue were cut using a microtome (Leica Biosystems, Wetzlar, Germany) at 8 pm. Following this, sections (n = 6-8) were processed through a TUNEL assay following the manufacturer's protocol (Roche, Basel, Switzerland) to detect cells undergoing DNA damage and apoptosis (Kyrylkova, K. etal., 2012). Additional washing was followed by nuclei staining with DAPI (1: 1000; Thermo Fischer, Waltham, MA, USA) and mounting in mounting media (FluorSave Reagent; Millipore, Merck). Thereafter, imaging was performed using a confocal microscope (LSM780NLO, Carl Zeiss GmbH, Wein, Austria). Micrographs were acquired at a 40X magnification objective. The fluorescence- integrated density was measured using ImageJ software (Choi, H.K. et al., 2005).

[0085] Immunohistochemistry

[0086] For the immunohistochemistry (IHC) assay to evaluate the level of AAV and cleaved Caspase 3, the tumor tissue was fixed and processed according to standard protocols. Further, tumor and liver tissues were sectioned at 6 and 8 pm thickness using Cryostat (Leica CM1250, Leica Biosystems, Germany), respectively. Thereafter, tissue sections were again fixed in 4% paraformaldehyde and staining was carried out with mouse anti-AAV [A20; 1: 100, Fitzgerald (10R-A110A), Biosynth, Staad, Switzerland] or rabbit anti-cleaved Caspase 3 antibody [1:200, Cell Signaling (9664S), Danvers, MA, USA] to indicate the activation of the apoptotic pathway downstream of activated Caspase 9 (Porter, A.G. et al., 1999). Alexa Fluor 568 goat anti-mouse IgG (l;250, Thermo Fisher Scientific, Waltham, MA, USA) was used as the secondary antibody for A20. Cy™3 AffiniPure goat anti-rabbit IgG (1:200, Jackson ImmunoResearch, PA, USA) was used as the secondary antibody for anti-cleaved Caspase 3. Finally, after washing, sections were counterstained with DAPI (1:1000, Thermo Fischer, Waltham, MA, USA) and mounted with mounting media (FluorSave Reagent; Millipore, Merck). Micrographs were acquired in a confocal microscope (LSM780NLO, Carl Zeiss GmbH, Wein, Austria) and further, fluorescence-integrated density was measured using ImageJ software.

[0087] Statistical analysis

[0088] Statistical significance was evaluated by an unpaired t-test with Welch's correction or a two-way ANOVA with Bonferroni correction, as appropriate (GraphPad Prism 8.0 Software, La Jolla, CA, USA).

[0089] Therefore, the present invention provides an inducible Casp9, a suicide transgene with Adeno-associated virus (AAV) vectors and demonstrates the induction of cancer cell cytotoxicity along with the reduction of tumor growth in a murine model of breast cancer. Upon treatment with AAV6-iCasp9 vectors and the chemical inducer of dimerizer (CID or AP20187), the viability of murine breast cancer cells (4T1) was significantly reduced to ~40%-60% (mock control 100%, p <0.001). Furthermore, the administration of AAV6-iCasp9 in an orthotopic breast cancer model showed a significant reduction in tumor growth rate. The present invention is first to report a breast cancer model demonstrating cellular apoptosis by direct activation of Caspase 9 and 3. The present invention highlights the potential of AAV-iCasp9-based suicide gene therapy for aggressive breast cancer in patients.

[0090] The AAV-mediated iCasp9 gene therapy of the present invention offers a targeted and effective approach to breast cancer treatment. It uniquely triggers apoptosis in cancer cells through non-reliance on cell cycle phases, ensuring cytotoxicity in heterogeneous tumor tissue. This therapy can be combined with other treatments, leverages the safety and low immunogenicity of AAV vectors, minimizes drug resistance risks, and can be tailored for personalized treatment strategies. The approach holds promise for early and advanced stages, demonstrates significant tumor growth inhibition and apoptosis induction in preclinical models, and introduces a novel therapeutic avenue to address the complexities of breast cancer treatment with minimal systemic toxicity.

[0091] The figures and the foregoing description give examples of embodiments. Those skilled in the art will appreciate that one or more of the described elements may well be combined into a single functional element. Alternatively, certain elements may be split into multiple functional elements. Elements from one embodiment may be added to another embodiment. For example, the order of processes described herein may be changed and is not limited to the manner described herein. Moreover, the actions of any flow diagram need not be implemented in the order shown; nor do all of the acts need to be necessarily performed. Also, those acts that are not dependent on other acts may be performed in parallel with the other acts. The scope of embodiments is by no means limited by these specific examples.

Claims

WE CLAIM:

1. An adeno-associated virus (AAV) vector, comprising: a recombinant AAV serotype 6 capsid comprising a K31Q mutation configured to increase transduction efficiency; an inducible Caspase 9 (iCasp9) transgene under control of promoter selected from one of a cytomegalovirus (CMV) early enhancer / chicken-P-actin (CAG) promoter; a chemical inducer of dimerization (CID) for activating an iCasp9 protein configured to induce apoptosis in breast cancer cells; and a plurality of regulatory elements selected from a group comprising polyadenylation signals and enhancer elements configured to optimize an expression of the iCasp9 transgene.

2. The AAV vector as claimed in claim 1, wherein the chemical inducer of dimerization (CID) is AP20187.

3. The AAV vector as claimed in claim 1, wherein the poly adenylation signals comprise bovine growth hormone (BGH) poly A signal and enhancer elements comprises cytomegalovirus (CMV) early enhancer / chicken-P-actin (CAG) promoter.

4. The AAV vector as claimed in claim 1, wherein the promoter is the cytomegalovirus (CMV) early enhancer.

5. The AAV vector as claimed in claim 1, wherein the promoter is the CMV early enhancer / chicken-P-actin (CAG) promoter.

6. A pharmaceutical composition comprising:1 x IO10to 1 x 1013vgs / animal of a recombinant AAV serotype 6 capsid comprising a K31Q mutation configured to increase transduction efficiency;1 x IO10to 1 x 1013vgs / animal of an inducible Caspase 9 (iCasp9) transgene under control of promoter selected from one of a cytomegalovirus (CMV) early enhancer / chicken-P-actin (CAG) promoter;0.1-10 mg / kg of animal of a chemical inducer of dimerization (CID) for activating an iCasp9 protein configured to induce apoptosis in breast cancer cells;1 x IO10to 1 x 1013vgs / animal of a plurality of regulatory elements selected from a group comprising polyadenylation signals and enhancer elements configured to optimize an expression of the iCasp9 transgene; and up to 1600 mL of a pharmacologically acceptable excipient.

7. The pharmaceutical composition as claimed in claim 6, wherein the chemical inducer of dimerization (CID) is AP20187.

8. The pharmaceutical composition as claimed in claim 6, wherein the poly adenylation signals comprise bovine growth hormone (BGH) poly A signal and enhancer elements comprises cytomegalovirus (CMV) early enhancer / chicken-P- actin (CAG) promoter.

9. The pharmaceutical composition as claimed in claim 6, wherein the promoter is the cytomegalovirus (CMV) early enhancer.

10. The pharmaceutical composition as claimed in claim 6, wherein the promoter is the chicken-P-actin (CAG) promoter.

11. The pharmaceutical composition as claimed in claim 6, wherein the pharmacologically acceptable excipient is selected from the group comprising one of binders, diluents, disintegrants, lubricants, glidants, fillers, colouring agents, flavouring agents, and combinations thereof.

12. The pharmaceutical composition as claimed in claim 6, wherein the pharmacologically acceptable excipient comprises a spent media collected from AAV293 cells.

Images