Composition for diagnosis of radioresistance of lung cancer or for prognosis of lung cancer

Abstract

In the present invention, the mRNA of the genes VTN, CXCL5, NEDD4, LCN2, SYTL4, TNFR2, and SERPING1, or the proteins encoded by these genes, exhibit differential expression levels in radioresistant lung cancer cells compared to control lung cancer cells and have a close correlation with a decrease in the survival rate of lung cancer patients. Accordingly, this preparation for measuring the expression levels of the mRNA of the genes selected from the group consisting of VTN, CXCL5, NEDD4, LCN2, SYTL4, TNFR2, and SERPING1 of the present invention or the expression levels of the proteins encoded by the genes can effectively diagnose radiation resistance in lung cancer or prognose radiation therapy for lung cancer, whereby it is possible to determine whether to perform radiation therapy and the optimal dose of radiation therapy, thus improving the efficiency and therapeutic outcomes of radiation therapy for lung cancer.

Description

Composition for diagnosing radioresistance of lung cancer or predicting prognosis of lung cancer

[0001] [Cross-reference with related applications]

[0002] This application claims the benefit of priority from Korean Patent Application No. 10-2023-0112011, filed August 25, 2023, the entire contents of which are incorporated herein by reference.

[0003] [Technical Field]

[0004] The present invention relates to a composition for diagnosing radiation resistance of lung cancer and its application.

[0005]

[0006] Cancer treatment methods include surgery, chemotherapy, and radiation therapy, and the importance of radiation therapy has grown significantly in recent years. In cases where surgery is not feasible, cases have been reported where radiation therapy alone effectively cured tumors. Furthermore, radiation-based cancer treatment methods continue to evolve, establishing radiation therapy as an effective treatment for tumors without significant pain or discomfort for patients. Statistically, approximately 30-50% of cancer patients receive radiation therapy at some point during their treatment. As the number of cancer patients receiving radiation therapy continues to increase, the importance of radiation therapy in cancer treatment is also growing.

[0007] Radiation therapy, either alone or in combination with chemotherapy, is commonly used to treat various types of cancer. However, the effectiveness of radiation therapy varies depending on the nature of the cancer, the patient, and whether radiation is combined with other treatments. Cancers for which radiation therapy is commonly administered include cervical, pharyngeal, lung, brain, and breast cancers. Although these cancers are primary targets of radiation therapy, they frequently have poor responses to radiation therapy, necessitating strategies to enhance treatment effectiveness. Furthermore, even if radiation therapy is successful and initial responses are favorable, recurrence is common, making developing countermeasures to prevent recurrence crucial for enhancing the effectiveness of radiation therapy.

[0008] Furthermore, issues such as cancer cell acquisition of radiation resistance and damage to normal tissue during high-dose radiation therapy have been identified as reducing the effectiveness of radiation therapy, necessitating research to improve its effectiveness. Currently, radiation therapy, along with surgery and chemotherapy, is used as an effective cancer treatment, targeting cancerous tissue to kill cancer cells.

[0009] Although there are differences in the sensitivity of cancer cells to radiation therapy, if we develop a technology that can predict individual radiation sensitivity before radiation therapy, we will be able to provide the most appropriate radiation therapy for each individual by adjusting the radiation dose to treat cancer.

[0010] Meanwhile, research is actively underway on companion diagnostics, which are approved diagnostics that can select appropriate targeted anticancer drugs and treatment methods based on systematic analysis of individual patient factors. Companion diagnostics can provide a clear clinical basis for prescribing based on a physician's diagnosis and suggest appropriate treatment options to patients. This not only enhances cancer treatment effectiveness but also contributes to the soundness of national health insurance finances by reducing the misuse of targeted anticancer drugs. The companion diagnostics market is currently growing in areas such as breast cancer, lung cancer, colon cancer, stomach cancer, and melanoma, with breast and lung cancer in particular expected to drive market growth.

[0011] Korean Patent Application No. 10-2021-0138525 discloses a technique for diagnosing radiotherapy sensitivity or predicting radiotherapy prognosis in cancer patients by measuring the mRNA expression level of miR-151a-3p in exosomes, but no data on lung cancer cell specificity is provided.

[0012] In addition, Korean Patent Application No. 10-2018-0143493 discloses a technique for diagnosing radioresistant lung cancer or pancreatic cancer by measuring the expression level of PMVK protein or mRNA, but does not present a technique for more accurately diagnosing radioresistant lung cancer using multiple markers.

[0013] Against this backdrop, the inventors of the present invention conducted research on radiation resistance biomarkers and discovered a novel diagnostic biomarker for radiation-resistant lung cancer. This biomarker is expected to be useful in lung cancer treatment, as it can predict radiotherapy resistance and prognosis.

[0014] [Prior Art Literature]

[0015] [Patent Document]

[0016] Republic of Korea Patent Application No. 10-2021-0138525

[0017] Republic of Korea Patent Application No. 10-2018-0143493

[0018]

[0019] The purpose of the present invention is to provide a composition for diagnosing radiation resistance of lung cancer.

[0020] In addition, the present invention aims to provide a kit for diagnosing radiation resistance of lung cancer.

[0021] In addition, the present invention aims to provide a method for providing information for diagnosing radioresistance of lung cancer.

[0022] In addition, the present invention aims to provide a composition for predicting the prognosis of radiation therapy for lung cancer.

[0023] In addition, the present invention aims to provide a kit for predicting the prognosis of radiation therapy for lung cancer.

[0024] In addition, the present invention aims to provide a method for providing information for predicting the prognosis of radiation therapy for lung cancer.

[0025] In order to achieve the above object, one aspect of the present invention provides a composition for diagnosing radiation resistance of lung cancer, comprising a preparation for measuring the expression level of mRNA of two or more genes selected from the group consisting of VTN, CXCL5, NEDD4, LCN2, SYTL4, TNFR2, and SERPING1 genes or proteins encoded by two or more genes.

[0026] In addition, another aspect of the present invention provides a kit for diagnosing radiation resistance of lung cancer, comprising the composition for diagnosing radiation resistance of lung cancer.

[0027] In addition, another aspect of the present invention provides a method for providing information for diagnosing radioresistance of lung cancer, comprising the steps of: (a) measuring the expression level of mRNA of two or more genes selected from the group consisting of VTN, CXCL5, NEDD4, LCN2, SYTL4, TNFR2, and SERPING1 genes in a sample isolated from an individual, or proteins encoded by two or more genes; and (b) comparing the expression level of the mRNA or protein with the expression level of the mRNA or protein of a normal control.

[0028] In addition, another aspect of the present invention provides a composition for predicting the prognosis of radiation therapy for lung cancer, comprising an agent for measuring the expression level of mRNA of two or more genes selected from the group consisting of VTN, CXCL5, NEDD4, LCN2, SYTL4, TNFR2 and SERPING1 genes or proteins encoded by two or more genes.

[0029] In addition, another aspect of the present invention provides a kit for predicting the prognosis of radiation therapy for lung cancer, comprising the composition for predicting the prognosis of radiation therapy for lung cancer.

[0030] In addition, another aspect of the present invention provides a method for providing information for predicting the prognosis of radiation therapy for lung cancer, comprising the steps of: (a) measuring the expression level of mRNA of two or more genes selected from the group consisting of VTN, CXCL5, NEDD4, LCN2, SYTL4, TNFR2, and SERPING1 genes in a sample isolated from an individual, or proteins encoded by two or more genes; and (b) comparing the expression level of the mRNA or protein with the expression level of the mRNA or protein of a normal control.

[0031]

[0032] Hereinafter, the present invention will be described in detail.

[0033]

[0034] 1. Composition for diagnosing radiation resistance of lung cancer or predicting prognosis of radiation therapy of lung cancer

[0035] One aspect of the present invention provides a composition for diagnosing radiation resistance of lung cancer.

[0036] In addition, another aspect of the present invention provides a composition for predicting the prognosis of radiation therapy for lung cancer.

[0037] The composition for diagnosing radiation resistance of lung cancer of the present invention comprises, as an active ingredient, a preparation for measuring the expression level of mRNA of two or more genes selected from the group consisting of VTN, CXCL5, NEDD4, LCN2, SYTL4, TNFR2, and SERPING1 genes or proteins encoded by two or more genes.

[0038] In addition, the composition for predicting the prognosis of radiation therapy for lung cancer of the present invention comprises, as an active ingredient, a preparation for measuring the expression level of mRNA of two or more genes selected from the group consisting of VTN, CXCL5, NEDD4, LCN2, SYTL4, TNFR2, and SERPING1 genes or proteins encoded by two or more genes.

[0039] VTN (Vitronectin, NCBI gene ID: 7448) protein is a glycoprotein of the hemopexin family synthesized in the liver. It is known to promote cell adhesion and migration by binding to integrin alpha-V beta-3 and connecting cells to the extracellular matrix, and to be involved in hemostasis as a component of platelets.

[0040] In the present invention, the VTN protein refers to not only a wild-type VTN protein having an amino acid sequence of SEQ ID NO: 1, but also an equivalent that has a different sequence from the wild-type VTN protein but has the same or similar function or activity as the wild-type VTN protein, and the equivalent may include an amino acid sequence having a sequence homology of about 70% or more, about 75% or more, about 80% or more, about 85% or more, about 90% or more, about 92% or more, about 95% or more, about 97% or more, about 98% or more, or about 99% or more to the amino acid sequence of SEQ ID NO: 1.

[0041] CXCL5 (CXC motif chemokine ligand 5, NCBI gene ID: 6374) protein is a small cytokine belonging to the CXC chemokine family. It is produced by stimulation with the inflammatory cytokines interleukin-1 and tumor necrosis factor-alpha, and is known to regulate neutrophil homeostasis by inhibiting type II interferon-gamma.

[0042] In the present invention, the CXCL5 protein refers to not only the wild-type CXCL5 protein consisting of the amino acid sequence of SEQ ID NO: 2, but also an equivalent that has a function or activity identical or similar to the wild-type CXCL5 protein but differs in some sequences, and the equivalent may include an amino acid sequence having a sequence homology of about 70% or more, about 75% or more, about 80% or more, about 85% or more, about 90% or more, about 92% or more, about 95% or more, about 97% or more, about 98% or more, or about 99% or more to the amino acid sequence of SEQ ID NO: 2.

[0043] NEDD4 (Neural precursor cell expressed developmentally down-regulated protein 4, NCBI gene ID: 4734) protein is an E3 ubiquitin ligase known to regulate the activity of membrane proteins such as ion channels and membrane receptors through ubiquitination and endocytosis.

[0044] In the present invention, the NEDD4 protein refers to not only the wild-type NEDD4 protein consisting of the amino acid sequence of SEQ ID NO: 3, but also an equivalent that has a function or activity identical or similar to the wild-type NEDD4 protein but has a different sequence from the wild-type NEDD4 protein, and the equivalent may include an amino acid sequence having a sequence homology of about 70% or more, about 75% or more, about 80% or more, about 85% or more, about 90% or more, about 92% or more, about 95% or more, about 97% or more, about 98% or more, or about 99% or more to the amino acid sequence of SEQ ID NO: 3.

[0045] The LCN2 (Lipocalin 2, NCBI gene ID: 3934) protein, also known as NGAL (neutrophil gelatinase-associated lipocalin), is known to be involved in innate immunity by sequestering iron and preventing its use by bacteria, thereby restricting their growth.

[0046] In the present invention, the LCN2 protein refers to not only the wild-type LCN2 protein consisting of the amino acid sequence of SEQ ID NO: 4, but also an equivalent that has a function or activity identical or similar to the wild-type LCN2 protein but differs in some sequences, and the equivalent may include an amino acid sequence having a sequence homology of about 70% or more, about 75% or more, about 80% or more, about 85% or more, about 90% or more, about 92% or more, about 95% or more, about 97% or more, about 98% or more, or about 99% or more to the amino acid sequence of SEQ ID NO: 4.

[0047] SYTL4 (Synaptotagmin like 4, NCBI gene ID: 94121) protein has an N-terminal Rab27 binding domain and a C-terminal tandem C2 domain, which allows it to bind to Rab GTPases and participate in intracellular membrane trafficking, and is known to regulate the release of nucleolar granules into cells or the secretion of pancreatic and pituitary hormones.

[0048] In the present invention, the SYTL4 protein refers to not only the wild-type SYTL4 protein consisting of the amino acid sequence of SEQ ID NO: 5, but also an equivalent that has a function or activity identical or similar to the wild-type SYTL4 protein but differs in some sequences, and the equivalent may include an amino acid sequence having a sequence homology of about 70% or more, about 75% or more, about 80% or more, about 85% or more, about 90% or more, about 92% or more, about 95% or more, about 97% or more, about 98% or more, or about 99% or more to the amino acid sequence of SEQ ID NO: 5.

[0049] TNFR2 (Tumor necrosis factor receptor 2, NCBI gene ID: 7133) protein, also called TNFRSF1B (Tumor necrosis factor receptor superfamily member 1B), is one of the membrane receptors that binds to TNFα and is known to induce transcription of genes related to cell survival, growth, and differentiation.

[0050] In the present invention, the TNFR2 protein refers to not only the wild-type TNFR2 protein consisting of the amino acid sequence of SEQ ID NO: 6, but also an equivalent that has a function or activity identical or similar to the wild-type TNFR2 protein but differs in some sequences, and the equivalent may include an amino acid sequence having a sequence homology of about 70% or more, about 75% or more, about 80% or more, about 85% or more, about 90% or more, about 92% or more, about 95% or more, about 97% or more, about 98% or more, or about 99% or more to the amino acid sequence of SEQ ID NO: 6.

[0051] SERPING1 (Serpin family G member 1, NCBI gene ID: 710) protein is a protease inhibitor belonging to the serpin superfamily, also known as a C1 esterase inhibitor, and is known to regulate physiological pathways including complement activation, blood coagulation, fibrinolysis, and kinin production by inhibiting the activation of the C1 complex.

[0052] In the present invention, the SERPING1 protein refers to not only the wild-type SERPING1 protein consisting of the amino acid sequence of SEQ ID NO: 7, but also an equivalent that has a function or activity identical or similar to the wild-type SERPING1 protein but has a different sequence from it, and the equivalent may include an amino acid sequence having a sequence homology of about 70% or more, about 75% or more, about 80% or more, about 85% or more, about 90% or more, about 92% or more, about 95% or more, about 97% or more, about 98% or more, or about 99% or more to the amino acid sequence of SEQ ID NO: 7.

[0053] The composition for diagnosing radiation resistance of lung cancer according to the present invention may include, as an active ingredient, an agent for measuring the expression level of mRNA of two genes, three genes, four genes, five genes, six genes, or seven genes selected from the group consisting of VTN, CXCL5, NEDD4, LCN2, SYTL4, TNFR2, and SERPING1 genes, or proteins encoded by the genes.

[0054] In addition, the composition for predicting the prognosis of radiation therapy for lung cancer according to the present invention may include, as an active ingredient, an agent for measuring the expression level of mRNA of two genes, three genes, four genes, five genes, six genes, or seven genes selected from the group consisting of VTN, CXCL5, NEDD4, LCN2, SYTL4, TNFR2, and SERPING1 genes, or proteins encoded by the genes.

[0055] In a specific embodiment of the present invention, it was confirmed that mRNA of a gene selected from the group consisting of the VTN, CXCL5, NEDD4, LCN2, SYTL4, TNFR2 and SERPING1 genes or proteins encoded by the genes have differential expression levels in radiation-resistant lung cancer cells compared to control lung cancer cells, and have a close correlation with a decrease in the survival rate of lung cancer patients.

[0056] Therefore, a formulation for measuring the expression level of mRNA of one or more genes selected from the group consisting of the VTN, CXCL5, NEDD4, LCN2, SYTL4, TNFR2 and SERPING1 genes or a protein encoded by one or more genes can diagnose the radioresistance of lung cancer more effectively than mRNA of other genes and / or proteins encoded by the genes and combinations thereof, and can predict the prognosis of radiotherapy for lung cancer, thereby determining whether to perform radiotherapy and the optimal dose of radiotherapy, thereby improving the efficiency and treatment results of radiotherapy for lung cancer.

[0057] Specifically, in the present invention, the VTN, NEDD4, CXCL5, LCN2, SYTL4, TNFR2 and SERPING1 genes may be genes whose expression is upregulated when lung cancer has radiation resistance, whose expression is upregulated by radiation exposure, and whose expression is upregulated when the survival rate of lung cancer patients is reduced.

[0058] Therefore, if the expression level of mRNA of two or more genes selected from the group consisting of VTN, NEDD4, CXCL5, LCN2, SYTL4, TNFR2, and SERPING1 genes or the protein encoded by two or more genes is high compared to the normal control group, it can be determined that radioresistance is present, and if it is low, it can be determined that radioresistance is low or radiosensitivity is present. For example, if the mRNA of two to seven genes selected from the group and / or the two to seven proteins encoded by the genes are all highly expressed, radioresistance can be determined to be high, and if the mRNA of two to seven genes and / or the two to seven proteins encoded by the genes are all low expressed, radioresistance can be determined to be low.

[0059] In addition, when the expression level of mRNA of two or more genes selected from the group consisting of VTN, NEDD4, CXCL5, LCN2, SYTL4, TNFR2, and SERPING1 genes or the protein encoded by two or more genes is high compared to the normal control group, the prognosis of radiotherapy for lung cancer can be judged to be negative, and when it is low, the prognosis of radiotherapy for lung cancer can be judged to be positive. For example, when the mRNA of two to seven genes selected from the group and / or the two to seven proteins encoded by the genes are all highly expressed, the prognosis of radiotherapy for lung cancer can be judged to be negative, and when the mRNA of two to seven genes and / or the two to seven proteins encoded by the genes are all lowly expressed, the prognosis of radiotherapy for lung cancer can be judged to be positive.

[0060] Meanwhile, the composition for diagnosing radiation resistance of lung cancer and the composition for predicting the prognosis of radiation therapy for lung cancer of the present invention may include an agent for measuring the expression level of mRNA of the VTN or NEDD4 gene or a protein encoded by the gene.

[0061] In the present invention, "radio-resistance" refers to a state in which cells are not easily affected by radiation exposure and show little change in cell repair or proliferation when exposed to radiation. As the opposite term to radiation resistance, "radio-sensitive" refers to a state in which cells are easily affected by radiation exposure and show changes in cell repair or proliferation when exposed to radiation.

[0062] In the present invention, "radiotherapy" refers to the treatment of cancer through a mechanism that induces cancer cell death by inhibiting cell division through DNA damage by irradiating the cancer cells. The radiation therapy may be performed alone or in combination with surgical treatment, or with anticancer chemotherapy or a radiation sensitizer, for curative, adjuvant, or palliative purposes in solid tumors.

[0063] In the present invention, lung cancer may include small cell lung cancer, non-small cell lung cancer, lung adenocarcinoma, squamous cell carcinoma, large cell carcinoma, etc.

[0064] In the present invention, “diagnosis” includes determining the susceptibility of an individual to a specific disease or condition, determining whether an individual currently has a specific disease or condition, determining the prognosis of an individual with a specific disease or condition, or therametrics (e.g., monitoring the condition of an individual to provide information about the efficacy of a treatment).

[0065] In the present invention, "prognosis" refers to a prospective or preliminary assessment of the medical outcome of a disease, and includes a positive prognosis (positive prognosis) or a negative prognosis (negative prognosis). The positive prognosis includes improvement or stabilization of the disease, such as a state of no disease, tumor regression, long-term survival possibility, or disease-free survival rate, while the negative prognosis includes progression or mortality of the disease, such as decreased survival rate, recurrence, tumor growth, metastasis, and drug resistance.

[0066] Additionally, in the present invention, “prediction” means to guess in advance about the medical outcome, such as the course of a disease (progression, improvement, recurrence, tumor growth, likelihood of death or survival after drug resistance treatment, etc.) or responsiveness to treatment such as chemotherapy or radiation therapy.

[0067] Specifically, in the present invention, the diagnosis may be a diagnosis of radiation resistance of lung cancer, and the prognosis prediction may be a prognosis prediction of radiation treatment of lung cancer.

[0068] In the present invention, measurement of mRNA expression level means a process of confirming the presence and expression level of mRNA of the gene in a biological sample for the purpose of diagnosing radiation resistance of lung cancer and / or predicting the prognosis of radiation treatment of lung cancer, and a primer, probe, or antisense nucleotide that specifically binds to the gene or mRNA may be used as an agent for measuring the expression level of the mRNA, and the measurement of the expression level of the mRNA may be performed by one or more methods selected from the group consisting of RT-PCR, competitive RT-PCR, real-time RT-PCR, RNase protection assay (RPA), Northern blotting, and DNA chip, but is not limited thereto.

[0069] In addition, in the present invention, the measurement of the protein expression level means a process of confirming the presence and expression level of the protein in a biological sample for the purpose of diagnosing the radiation resistance of lung cancer and / or predicting the prognosis of radiation treatment of lung cancer, and a polypeptide, compound, antibody or aptamer that can specifically bind to the protein can be used as an agent for measuring the expression level of the protein, and the measurement of the expression level of the protein can be performed by Western blotting, enzyme linked immunosorbent assay (ELISA), radioimmunoassay (RIA), radioimmunodiffusion, Ouchterlony immunodiffusion, rocket immunoelectrophoresis, tissue immunostaining, dual luciferase reporter assay, immunoprecipitation assay, complement fixation assay, FACS (Fluorescence activated cell sorter) and protein It may be performed by one or more methods selected from, but not limited to, a group consisting of chips.

[0070] In the present invention, a "sample" may refer to a sample derived from an individual receiving radiation therapy (radiation irradiation) or for which a decision on whether to receive radiation therapy is required. For example, it refers to a sample capable of specifying the expression level of mRNA of two or more genes selected from the group consisting of the VTN, NEDD4, CXCL5, LCN2, SYTL4, TNFR2, and SERPING1 genes, or a protein encoded by two or more genes, and may include, but is not limited to, cells, tissues, whole blood, serum, plasma, saliva, sputum, cerebrospinal fluid, or urine of the individual.

[0071] In the present invention, "subject" refers to a subject for which the radioresistance or progression potential of lung cancer is to be determined, or the prognosis of radiation therapy is to be predicted. The subject may be any animal susceptible to lung cancer, but is not limited to any species. Specifically, the subject may be a mammal, for example, a human (Homo sapiens).

[0072] In the present invention, the term "expression level" may be used interchangeably with the terms "expression signature" and "expression profile," and may include the expression level of mRNA of two or more genes selected from the group consisting of the VTN, NEDD4, CXCL5, LCN2, SYTL4, TNFR2, and SERPING1 genes, or the expression level of proteins encoded by two or more genes. The expression level may include an increase in expression or a decrease in expression, and the expression level may be measured from cancer cells isolated from a subject before and / or after radiation treatment. Meanwhile, the expression level may be confirmed by measuring the amount of mRNA and / or protein of the gene within the sample.

[0073] In the present invention, the term "primer" refers to a short nucleic acid sequence having a short free 3'-terminal hydroxyl group, which can form base pairs with a complementary template and serves as a starting point for copying the template strand. The primer can initiate DNA synthesis in the presence of a reagent for polymerization (i.e., DNA polymerase or reverse transcriptase) and four different nucleoside triphosphates in an appropriate buffer and temperature. The primer of the present invention can bind complementarily to the biomarker gene or mRNA of the present invention, and can be a sense and antisense nucleic acid having a sequence of 7 to 50 nucleotides, and can incorporate additional features that do not change the basic properties of the primer that acts as a starting point for DNA synthesis. Meanwhile, the primer of the present invention can be chemically synthesized using a phosphoramidite solid support method or other well-known methods, and can be modified using many means known in the art. Non-limiting examples of such modifications include methylation, capping, substitution of one or more natural nucleotides with their analogs, and modifications between nucleotides, such as modification with uncharged linkers (e.g., methyl phosphonate, phosphotriester, phosphoroamidate, carbamate, etc.) or charged linkers (e.g., phosphorothioate, phosphorodithioate, etc.). The nucleic acids may contain one or more additional covalently linked moieties, such as proteins (e.g., nucleases, toxins, antibodies, signal peptides, poly-L-lysine, etc.), intercalating agents (e.g., acridine, psoralen, etc.), chelating agents (e.g., metals, radioactive metals, iron, oxidizing metals, etc.), and alkylating agents. In addition, the primers of the present invention may be modified with labels capable of directly or indirectly providing a detectable signal, such as radioisotopes, fluorescent molecules, biotin, etc.

[0074] In the present invention, "probe" refers to a nucleic acid capable of complementary binding to mRNA of several to several hundred bases in length, produced through an enzymatic chemical separation and purification process or synthesis. The probe of the present invention is a probe capable of complementary binding to the biomarker gene or mRNA of the present invention, and can be used by labeling with a radioactive isotope or enzyme to confirm the presence or absence of mRNA. The probe can be designed and modified using a known method.

[0075] In the present invention, the term "antisense nucleotide" refers to DNA, RNA, or a derivative thereof containing a nucleic acid sequence complementary to the sequence of a specific mRNA, which binds to the complementary sequence within the mRNA and inhibits the translation of the mRNA into a protein. The sequence of the antisense nucleotide refers to a DNA or RNA sequence that is complementary to the mRNA of the biomarker gene of the present invention and can bind to the mRNA. This can inhibit essential activities for translation, translocation into the cytoplasm, maturation, or any other overall biological function of the mRNA. The antisense nucleotide can be synthesized in vitro by a conventional method and administered in vivo, or the antisense nucleotide can be synthesized in vivo. The antisense nucleotide that can be used in the present invention can be produced by a method known in the art with reference to the base sequence and / or amino acid sequence of the biomarker gene and / or protein of the present invention.

[0076] In the present invention, "antibody" refers to a globulin-based protein that reacts when a foreign substance, an antigen, invades while circulating in the blood or lymph of the body's immune system, and means a protein that specifically binds to an antigen. For the purpose of the present invention, the antibody means an antibody that specifically binds to the biomarker protein of the present invention, and may include all of polyclonal antibodies, monoclonal antibodies, and recombinant antibodies, and includes not only a complete form having two full-length light chains and two full-length heavy chains, but also a functional fragment of an antibody molecule. A functional fragment of an antibody molecule means a fragment that has at least an antigen-binding function, and includes Fab, F(ab'), F(ab') 2, and Fv, etc. The antibody that specifically binds to the biomarker protein of the present invention may be produced by a known method known to those skilled in the art, and may be produced, for example, by injecting the biomarker protein, which is an immunogen, into an external host. External hosts include mammals such as mice, rats, sheep, and rabbits. The immunogen can be administered intramuscularly, intraperitoneally, or subcutaneously, typically with an adjuvant to enhance antigenicity. Blood is then periodically drawn from the external host to collect serum specific for the antigen, allowing antibodies to be isolated.

[0077] In the present invention, "aptamer" refers to a nucleic acid molecule that is a single-stranded oligonucleotide, about 20 to 60 nucleotides in size, and has binding activity to a predetermined target molecule. The aptamer has various three-dimensional structures depending on the sequence, can have high affinity for a specific substance like an antigen-antibody reaction, and can inhibit the activity of a predetermined target molecule by binding to the predetermined target molecule. The aptamer may be RNA, DNA, a modified nucleic acid, or a mixture thereof, and may be linear or cyclic. In the present invention, the aptamer can specifically bind to a protein encoded by the biomarker gene of the present invention, and can be prepared by a person skilled in the art from the base sequence of the biomarker gene of the present invention by a method known in the art.

[0078]

[0079] 2. Kit for diagnosing radioresistance of lung cancer and kit for predicting prognosis of radiotherapy of lung cancer

[0080] Another aspect of the present invention provides a kit for diagnosing radioresistance of lung cancer.

[0081] In addition, another aspect of the present invention provides a kit for predicting the prognosis of radiation therapy for lung cancer.

[0082] The kit for diagnosing radiation resistance of lung cancer of the present invention comprises, as an active ingredient, a preparation for measuring the expression level of mRNA of two or more genes selected from the group consisting of VTN, CXCL5, NEDD4, LCN2, SYTL4, TNFR2, and SERPING1 genes or proteins encoded by two or more genes.

[0083] In addition, the kit for predicting the prognosis of radiation therapy for lung cancer of the present invention includes, as an active ingredient, a preparation for measuring the expression level of mRNA of two or more genes selected from the group consisting of VTN, CXCL5, NEDD4, LCN2, SYTL4, TNFR2, and SERPING1 genes or proteins encoded by two or more genes.

[0084] Since the overlapping description is the same as that described above in '1. Composition for diagnosing radiation resistance of lung cancer or predicting prognosis of radiation therapy of lung cancer', the description is omitted.

[0085] In the present invention, the term "kit" refers to a tool that can diagnose radioresistance of lung cancer or predict the prognosis of radiotherapy of lung cancer by confirming the expression level of mRNA of two or more genes selected from the group consisting of VTN, CXCL5, NEDD4, LCN2, SYTL4, TNFR2, and SERPING1 genes, or proteins encoded by two or more genes. The kit of the present invention may include an agent for measuring the expression level of mRNA of two or more genes selected from the group consisting of VTN, CXCL5, NEDD4, LCN2, SYTL4, TNFR2, and SERPING1 genes, or proteins encoded by two or more genes, specifically, a primer, a probe, and an antisense nucleotide that specifically bind to the mRNA of the genes, or a polypeptide, a compound, an antibody, and an aptamer that specifically bind to the protein, and may include one or more other component compositions, solutions, or devices suitable for an analysis method.

[0086] Additionally, the kit may further include a user manual describing optimal reaction performance conditions. The manual may include instructions in the form of a pamphlet or leaflet, a label attached to the kit, and a description on the surface of the package containing the kit, and may include information disclosed or provided through electronic media such as the Internet.

[0087] In the present invention, the kit may be an RT-PCR kit, a microarray chip kit, a DNA kit, an ELISA kit, a protein chip kit, or a rapid kit.

[0088]

[0089] 3. Method for providing information for diagnosing radiation resistance of lung cancer and method for providing information for predicting the prognosis of radiation therapy for lung cancer.

[0090] Another aspect of the present invention provides a method for providing information for diagnosing radiation resistance of lung cancer.

[0091] In addition, another aspect of the present invention provides a method for providing information for predicting the prognosis of radiation therapy for lung cancer.

[0092] The method for providing information for diagnosing radiation resistance of lung cancer of the present invention comprises: (a) a step of measuring the expression level of mRNA of two or more genes selected from the group consisting of VTN, CXCL5, NEDD4, LCN2, SYTL4, TNFR2, and SERPING1 genes or proteins encoded by two or more genes in a sample isolated from an individual; and (b) a step of comparing the expression level of the mRNA or protein with the expression level of the mRNA or protein of a normal control group.

[0093] In addition, the method for providing information for predicting the prognosis of radiation therapy for lung cancer of the present invention comprises (a) a step of measuring the expression level of mRNA of two or more genes selected from the group consisting of VTN, CXCL5, NEDD4, LCN2, SYTL4, TNFR2, and SERPING1 genes or proteins encoded by two or more genes in a sample isolated from an individual; and (b) a step of comparing the expression level of the mRNA or protein with the expression level of the mRNA or protein of a normal control group.

[0094] Since the overlapping description is the same as that described above in '1. Composition for diagnosing radiation resistance of lung cancer or predicting prognosis of radiation therapy of lung cancer', the description is omitted.

[0095] In the information providing method for diagnosing radiation resistance of lung cancer of the present invention, step (a) may include a step of measuring the expression level of mRNA of the VTN or NEDD4 gene or a protein encoded by the gene.

[0096] In addition, in the method for providing information for predicting the prognosis of radiation therapy for lung cancer of the present invention, step (a) may include a step of measuring the expression level of mRNA of the VTN or NEDD4 gene or a protein encoded by the gene.

[0097] In the information providing method for diagnosing radiation resistance of lung cancer of the present invention, if the expression level of mRNA or protein in step (b) is compared with the expression level of mRNA or protein of a normal control group and is higher than the expression level of the normal control group, the lung cancer can be determined to have radiation resistance. The high expression level may include an expression level of the subject being similar to the expression level of the normal control group or increasing by 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 200%, 300%, 400%, 500%, 600%, 700%, 800%, 900%, and 1000% or more.

[0098] In addition, in the method for providing information for predicting the prognosis of radiation therapy for lung cancer of the present invention, if the expression level of mRNA or protein is compared with the expression level of mRNA or protein of a normal control group in step (b) and is higher than the expression level of the normal control group, the prognosis of radiation therapy for lung cancer can be determined to be negative. The high expression level may include an expression level of the subject being similar to the expression level of the normal control group or increasing by 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 200%, 300%, 400%, 500%, 600%, 700%, 800%, 900%, and 1000% or more.

[0099] Meanwhile, the information providing method for diagnosing radiation resistance of lung cancer of the present invention may further include (c) a step of determining that lung cancer has radiation resistance when the measured mRNA or protein expression level is higher than that of a normal control group.

[0100] In addition, the method for providing information for predicting the prognosis of radiation therapy for lung cancer of the present invention may further include (c) a step of determining that the prognosis of radiation therapy for lung cancer is negative when the measured mRNA or protein expression level is high compared to a normal control group.

[0101] In a specific embodiment of the present invention, the overall survival (OS) period was analyzed in TCGA LUAD (Lung Adenocarcinoma) and LUSC (Lung Squamous Cell Carcinoma) data, and genes or combinations with a P-value of 0.05 or less were identified, and the HR (Hazard Ratio) value according to each gene or combination was confirmed. The HR represents the risk, and a higher HR value in a group with high expression means a lower survival rate of the individual. When the HR is 1.2 or more, 1.3 or more, 1.4 or more, or 1.5 or more, the prognosis of the individual's lung cancer after radiation therapy can be determined to be negative.

[0102]

[0103] Another aspect of the present invention provides a method for diagnosing radioresistance of lung cancer, comprising the steps of: (a) measuring the expression level of mRNA of two or more genes selected from the group consisting of VTN, CXCL5, NEDD4, LCN2, SYTL4, TNFR2, and SERPING1 genes or proteins encoded by two or more genes in a sample isolated from an individual; and (b) comparing the expression level of the mRNA or protein with the expression level of the mRNA or protein of a normal control.

[0104] Another aspect of the present invention provides a method for predicting the prognosis of radiation therapy for lung cancer, comprising the steps of: (a) measuring the expression level of mRNA of two or more genes selected from the group consisting of VTN, CXCL5, NEDD4, LCN2, SYTL4, TNFR2, and SERPING1 genes or proteins encoded by two or more genes in a sample isolated from an individual; and (b) comparing the expression level of the mRNA or protein with the expression level of the mRNA or protein of a normal control.

[0105] Another aspect of the present invention provides a use of a formulation for diagnosing radioresistance of lung cancer, the formulation comprising measuring the expression level of mRNA of two or more genes selected from the group consisting of VTN, CXCL5, NEDD4, LCN2, SYTL4, TNFR2 and SERPING1 genes or proteins encoded by two or more genes.

[0106] Another aspect of the present invention provides a use of a formulation for predicting the prognosis of radiotherapy of lung cancer, the formulation comprising measuring the expression level of mRNA of two or more genes selected from the group consisting of VTN, CXCL5, NEDD4, LCN2, SYTL4, TNFR2 and SERPING1 genes or proteins encoded by two or more genes.

[0107]

[0108] In the present invention, mRNA of the VTN, CXCL5, NEDD4, LCN2, SYTL4, TNFR2 and SERPING1 genes or the proteins encoded by the genes have differential expression levels in radioresistant lung cancer cells compared to control lung cancer cells, and are closely correlated with a decrease in the survival rate of lung cancer patients. Therefore, the agent for measuring the expression level of mRNA of a gene selected from the group consisting of the VTN, CXCL5, NEDD4, LCN2, SYTL4, TNFR2 and SERPING1 genes of the present invention or the protein encoded by the gene can effectively diagnose radioresistance of lung cancer or predict the prognosis of radiotherapy of lung cancer, and thereby determine whether to perform radiotherapy and the optimal dose of radiotherapy, thereby improving the efficiency and treatment results of radiotherapy for lung cancer.

[0109] However, the effects of the present invention are not limited to the effects mentioned above, and other effects not mentioned will be clearly understood by those skilled in the art from the description below.

[0110]

[0111] Figure 1a shows the results of radiosensitivity measurements for human lung cancer cell lines H1975, H2126, and H1650 (Parental) and their respective radioresistant cell lines (RR).

[0112] Figure 1b shows the results of cell viability measurements for human lung cancer cell lines H1975, H2126, and H1650 (Parental) and their respective radioresistant cell lines (RR).

[0113] Figure 2 shows the results of analyzing genes whose expression increased or decreased after irradiation with a dose of 8 Gy in human lung cancer cell lines H1975, H2126, and H1650 (Par) and each radiation-resistant cell line (RR).

[0114] Figure 3 shows the results of analyzing the changes in expression of the protein of the radioresistance gene in the human lung cancer cell lines H1975 and H2126 (Parent) and each radioresistant cell line (RR).

[0115] Figure 4 shows the results of analyzing the expression level of LCN2 using the DESeq2 program on RNAseq results of 218 non-small cell lung cancer patients (GSE81089).

[0116] Figure 5a shows Kaplan-Meier survival curves for the survival rate of lung cancer patients according to VTN, NEDD4, CXCL5, or LCN2 expression.

[0117] Figure 5b shows Kaplan-Meier survival curves for the survival rate of lung cancer patients according to the expression of VTN and NEDD4, or the expression of CXCL5 and LCN2.

[0118] Figure 5c shows Kaplan-Meier survival curves for the survival rate of lung cancer patients according to the expression of CXCL5, LCN2, and SEPRING1, or the expression of CXCL5, LCN2, VTN, and SYTL4.

[0119] Figure 6 shows the change in cell viability measured by knocking down the expression of radiation resistance genes with siRNA in the human radiation resistant lung cancer cell line H1975-RR and then irradiating it.

[0120]

[0121] Hereinafter, the present invention will be described in detail by examples.

[0122] However, the following examples specifically illustrate the present invention, and the content of the present invention is not limited by the following examples.

[0123]

[0124] Example 1. Production of a radiation-resistant lung cancer cell line and measurement of radiation sensitivity.

[0125] Human lung cancer cell lines H1975, H2126, and H1650 were purchased from the American Type Culture Collection (ATCC, USA) and maintained in RPMI-1640 medium supplemented with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin (10,000 U / ml) at 5% CO2 and 37°C. The cell lines were then irradiated with 2 Gy per dose, once or twice per week, for a total of 60 Gy, to establish radiation-resistant cell lines.

[0126] After irradiation, cells were irradiated with different doses of radiation to measure radiosensitivity, and then cultured for 10-14 days to evaluate colony-forming ability (clonogenic assay). Specifically, each cell line was seeded in an appropriate number of cells in a 60 mm dish, and after 24 hours, irradiated with different doses of radiation and cultured for 10-14 days under conditions of 5% CO2 and 37°C. Afterwards, the formed cell colonies were washed with phosphate-buffered saline (PBS) and stained with a 100% methanol mixture containing 1% methylene blue. The stained cell colonies (colonies with 50 or more cells) were dried at room temperature and then visually counted for each dish.

[0127] As a result, it was confirmed that the radiation-resistant cell line (RR) showed higher colony-forming ability than the parental cell line, indicating resistance to radiation-induced cell death (Fig. 1a). In addition, when the cell lines were cultured for 24 to 96 hours and cell viability was measured using the MTT assay, it was confirmed that the cell growth rate was increased in the radiation-resistant cell line compared to the parental cell line (Fig. 1b).

[0128]

[0129] Example 2. Discovery of genes associated with radiation resistance in lung cancer.

[0130] To identify genes associated with lung cancer radiation resistance, genes were selected based on transcriptome analysis of radiation-resistant cell lines and their parental cell lines. The radiation responsiveness of each gene was measured using real-time reverse transcription polymerase chain reaction (RT-PCR). The primer information used in this example is provided in Table 1.

[0131] Target SequenceOfficial Gene NameProductlengthDir.Sequence (5'->3')NM_000638.4VTN154ForwardTGG CTG TCC TTG TTC TCC AGT G(SEQ ID NO: 8)ReverseGTG TGC GAA GAT TGA CTC GGT AG(SEQ ID NO: 9)NM_002994.5CXCL5111ForwardCAG ACC ACG CAA GGA GTT CAT C(SEQ ID NO: 10)ReverseTTC CTT CCC GTT CTT CAG GGA G(SEQ ID NO: 11)NM_001284338.2NEDD495ForwardCAG AAG AGG CAG CTT ACA AGC C(SEQ ID NO: 12)ReverseCTT CCC AAC CTG GTG GTA ATC C(SEQ ID NO: 13)NM_005564.5LCN2112ForwardGTG AGC ACC AAC TAC AAC CAG C(SEQ ID NO: 14)ReverseGTT CCG AAG TCA GCT CCT TGG T(SEQ ID NO: 15)NM_001129896.3SYTL494ForwardGGA GAC AGA AGC AAA TCC GTC C(SEQ ID NO: 16)ReverseGGC GAT GTA ACT TCA CTA GGT GG(SEQ ID NO: 17)NM_001066.3TNFRSF1B102ForwardCGT TCT CCA ACA CGA CTT CAT CC(SEQ ID NO: 18)ReverseACG TGC AGA CTG CAT CCA TGC T(SEQ ID NO: 19)NM_000062.3SERPING1157ForwardGCA TCA AAG TGA CGA CCA GCC A(SEQ ID NO: 20)ReverseGTC TCT GTC AGT TCC AGC ACT G (SEQ ID NO: 21)NM_022551.3RPS18107ForwardCAC GCC AGT ACA AGA TCC CA (SEQ ID NO: 22)

[0132] Afterwards, three types of lung cancer parental cell lines (Par) (H1975, H2126, and H1650) and their radioresistant lung cancer cell lines (RR) were irradiated with 0 or 8 Gy of radiation, and the gene expression of each was measured 24 hours later. As a result, the expression of VTN, CXCL5, NEDD4, LCN2, SYTL4, TNFR2, and SERPING1 was increased in radiation-resistant cells compared to parental cells, and it was shown that expression was increased by radiation irradiation not only in parental cells but also in radiation-resistant cells (Fig. 2).

[0133]

[0134] Example 3. Confirmation of changes in protein expression of radiation-responsive factors.

[0135] In order to confirm the change in protein expression level according to radiation exposure for the radiation resistance genes derived in Example 2, H1975 lung cancer cell line, H2126 lung cancer cell line, and their radiation resistant cell lines were irradiated with 8 Gy of radiation, and then proteins were extracted 24 hours later and Western blotting assay was performed. Information on antibodies used in this example is as follows in Table 2.

[0136] Primary Antibody Manufacturer Cat. No Host Size (kD) VTNSanta Cruzsc-74484 Mouse 75 CXCL5 Invitrogen 700656 Rabbit 8 NEDD4 Santa Cruzsc-14428 Goat 120 LCN2 Invitrogen PA5-79589 Rabbit 22 SYTL4 Invitrogen PA5-35992 Rabbit 80-90 TNFR2 Invitrogen MA5-32618 Rabbit 60 SERPING1 Invitrogen PA5-31541 Rabbit 100 ACTBSigmaA5316 Mouse 42

[0137] As a result of the analysis, CXCL5, NEDD4, LCN2, SYTL4, and SERPING1 were significantly increased in the radiation-resistant cell line of the H1975 lung cancer cell line, and VTN, NEDD4, LCN2, SYTL4, TNFR2, and SERPING1 were significantly increased in the radiation-resistant cell line of the H2126 lung cancer cell line. In addition, the expression of CXCL5, LCN2, and TNFR2 was significantly increased by radiation exposure in parental cells and radiation-resistant cell lines (Fig. 3).

[0138]

[0139] Example 4. Analysis of risk and survival curves according to the expression of a panel of radiation resistance genes in lung cancer patients.

[0140] To confirm the expression patterns of the radiation resistance genes derived in Example 2 in actual lung cancer patients, RNAseq results (GSE81089) from 218 non-small cell lung cancer patients, which account for 80% of all lung cancer patients, were downloaded and analyzed using the DESeq2 program. As a result, LCN2 was found to be 2.8-fold increased compared to the normal group (Fig. 4).

[0141] Hereafter, in order to analyze the effect of the expression of the radiation resistance genes derived from Example 2 on the survival rate of lung cancer patients, the publicly available genome database data, The Cancer Genome Atlas (TCGA), was used for analysis with GEPIA2. At this time, in order to secure genes significantly related to the survival rate of lung cancer patients, the overall survival (OS) period was analyzed in the TCGA LUAD (Lung Adenocarcinoma) and LUSC (Lung Squamous Cell Carcinoma) data, and genes or combinations with a P-value of 0.05 or less were identified, and the results are shown in Table 3 below. In Table 3 below, HR (Hazard Ratio) represents the risk level, and a higher HR value in a group with high gene expression means a worse survival rate for the patient. In addition, the survival rate of lung cancer patients according to the expression of the genes or combinations was analyzed and visualized through a Kaplan-Meier survival curve (Figs. 5a to 5c).

[0142] combinationHRP-valueVTNSerpinG11.20.033VTN 1.30.021VTNNEDD4TNFR21.30.0099VTNNEDD4CXCL51.30.0083VTNNEDD4CXCL5LCN21.40.0031VTNNEDD4Ser pinG11.40.0027VTNNEDD4SerpinG1SYTL41.40.00098NEDD4CXCL51.30.016NEDD4SerpinG11.30.015NEDD4 1.40.0012NEDD4VTN1.40.00065NEDD4SYTL41.40.00018CXCL5LCN21.30.027CXCL5LCN2SYTL41.30.0099CXCL5LCN2NEDD41.30.0053CXCL5LCN2VTN 1.30.0041CXCL5LCN2SerpinG1 1.30.0041CXCL5LCN2SerpinG1TNFR21.30.0034CXCL5LCN2VTNNEDD41.40.0031CXCL5LCN2VTTNFR21.40.00 29CXCL5LCN2VTNSerpinG11.40.0017CXCL5LCN2VTNSYTL41.40.00081CXCL5LCN2SerpinG1NEDD41.40.00044

[0143] As a result of the analysis, the risk of lung cancer patient survival according to increased VTN expression was 1.3, the risk according to increased NEDD4 expression was 1.4, and the risk according to increased simultaneous expression of VTN and NEDD4 genes was 1.4. Meanwhile, the risk according to increased CXCL5 or LCN2 expression was 1.1, but it was not statistically significant, and the increased simultaneous expression of CXCL5 and LCN2 genes showed a significant decrease in overall survival with a risk of 1.3. In the case of a triple combination of CXCL5 / LCN2 / SERPING1 genes, or a quadruple combination of CXCL5 / LCN2 / VTN / SYTL4, or CXCL5 / LCN2 / SERPING1 / NEDD4 genes, the risk increased to 1.3, 1.4, and 1.4, respectively.

[0144]

[0145] Example 5. Analysis of cell viability by knockdown of radiation-responsive genes in human lung cancer radioresistant cells.

[0146] In order to confirm the change in survival rate of radiation-resistant lung cancer cells when the expression of the radiation-resistant genes derived from Example 2 above is knocked down, the expression of the radiation-resistant genes was knocked down with siRNA, and then the change in survival rate of the radiation-resistant H1975 lung cancer cell line (H1975-RR) was measured after radiation exposure.

[0147] Specifically, H1975-RR cells were transfected with each siRNA using Lipofectamine™ RNAiMAX transfection reagent (ThermoFisher scientific, USA) in a 96-well plate, and then irradiated with 8 Gy of radiation. After 48 hours, the cells were treated with CCK-8 (DOJINDO, Japan) reagent to measure cell viability. Information on the siRNAs used in this example is shown in Table 4 below.

[0148] OfficialGene NameNCBI Gene IDDirectionSequence (5'->3')Scramble RNASenseCCUCGUGCCGUUCCAUCAGGUAG(SEQ ID NO: 23)Anti-senseCUACCUGAUGGAACGGCACGAGG(SEQ ID NO: 24)VTN7448SenseGUAGUCAGUACUGGCGCUUUG(SEQ ID NO: 25)Anti-senseCAAAGCGCCAGUACUGACUAC(SEQ ID NO: 26)NEDD44734SenseAGUGCUACUCGCAGCUAUUUA(SEQ ID NO: 27)Anti-senseUAAAUAGCUGCGAGUAGCACU(SEQ ID NO: 28)CXCL56374SenseUGAAUUGUAGGUGACUAUUAU(SEQ ID NO: 29)Anti-senseAUAAUAGUCACCUACAAUUCA(SEQ ID NO: 30) LCN23934 Sense UGUCCCAAUCGACCAGUGUAU (SEQ ID NO: 31) Anti-sense AUACACUGGUCGAUUGGGACA (SEQ ID NO: 32) SERPING1710 Sense GCCAAGUGGAAGACAACAUUU (SEQ ID NO: 33) Anti-sense AAAUGUUGUCUUCCACUUGGC (SEQ ID NO: 34)

[0149] As a result, it was shown that in radioresistant lung cancer cell lines, cell death induced by radiation was significantly increased by single gene knockdown of LCN2 or CXCL5 compared to the control group treated with scrambled RNA (scRNA) with a nonspecific sequence. In addition, cell death by single gene knockdown of VTN or NEDD4 was not significant compared to the control group, but simultaneous knockdown of VTN and NEDD4 genes induced a significant decrease in lung cancer cell viability due to radiation. Furthermore, simultaneous gene knockdown of LCN2 / CXCL5 or LCN2 / CXCL5 / SERPING1 showed more significant cell death induced by radiation compared to LCN2 knockdown alone (Fig. 6). Through this, it was confirmed that the knockdown of various gene combinations can overcome radioresistance of lung cancer and increase lung cancer cell death.

[0150]

[0151] Through these experiments, we confirmed that measuring the expression of VTN, CXCL5, NEDD4, LCN2, SYTL4, TNFR2, and SERPING1 can effectively predict radiotherapy resistance and prognosis. Therefore, confirming the activity of this panel of radioresistance genes and combining it with radiotherapy is expected to lead to more effective cancer treatment.

[0152]

[0153] Although representative embodiments of the present invention have been described above as examples, the scope of the present invention is not limited to the specific embodiments described above, and those skilled in the art will be able to make appropriate changes within the scope described in the claims of the present application.

Claims

1. A composition for diagnosing radiation resistance of lung cancer, comprising a preparation for measuring the expression level of mRNA of two or more genes selected from the group consisting of VTN, CXCL5, NEDD4, LCN2, SYTL4, TNFR2, and SERPING1 genes or proteins encoded by two or more genes.

2. In claim 1, A composition for diagnosing radioresistance of lung cancer, comprising a preparation for measuring the expression level of mRNA of the CXCL5, LCN2, VTN or NEDD4 gene or a protein encoded by the gene.

3. In claim 1, A composition for diagnosing radiation resistance of lung cancer, wherein the agent for measuring the expression level of mRNA of the gene is at least one selected from the group consisting of a primer, a probe, and an antisense nucleotide that specifically bind to mRNA of the gene.

4. In claim 1, A composition for diagnosing radiation resistance of lung cancer, wherein the agent for measuring the expression level of the protein is at least one selected from the group consisting of a polypeptide, a compound, an antibody, and an aptamer that specifically binds to the protein.

5. A kit for diagnosing radiation resistance of lung cancer, comprising a composition according to any one of claims 1 to 4.

6. In claim 5, The above kit is a kit for diagnosing radioresistance of lung cancer, which is an RT-PCR kit, a microarray chip kit, a DNA kit, an ELISA kit, a protein chip kit, or a rapid kit. 7.(a) a step of measuring the expression level of mRNA of two or more genes selected from the group consisting of VTN, CXCL5, NEDD4, LCN2, SYTL4, TNFR2 and SERPING1 genes or proteins encoded by two or more genes in a sample isolated from an individual; and (b) A method for providing information for diagnosing radioresistance of lung cancer, comprising the step of comparing the expression level of the mRNA or protein with the expression level of the mRNA or protein of a normal control group.

8. In claim 7, A method for providing information for diagnosing radiation resistance of lung cancer, wherein the step (a) comprises a step of measuring the expression level of mRNA of the CXCL5, LCN2, VTN or NEDD4 gene or a protein encoded by the gene.

9. A composition for predicting the prognosis of radiation therapy for lung cancer, comprising a preparation for measuring the expression level of mRNA of two or more genes selected from the group consisting of VTN, CXCL5, NEDD4, LCN2, SYTL4, TNFR2, and SERPING1 genes or proteins encoded by two or more genes.

10. A composition for predicting the prognosis of radiation therapy for lung cancer, comprising a preparation for measuring the expression level of mRNA of the CXCL5, LCN2, VTN or NEDD4 gene or a protein encoded by the gene according to claim 9.

11. In claim 9, A composition for predicting the prognosis of radiation therapy for lung cancer, wherein the agent for measuring the expression level of mRNA of the gene is at least one selected from the group consisting of a primer, a probe, and an antisense nucleotide that specifically bind to the mRNA of the gene.

12. In claim 9, A composition for predicting the prognosis of radiation therapy for lung cancer, wherein the agent for measuring the expression level of the protein is at least one selected from the group consisting of antibodies and aptamers that specifically bind to the protein.

13. A kit for predicting the prognosis of radiation therapy for lung cancer, comprising a composition according to any one of claims 9 to 12.

14. In claim 13, The above kit is a kit for predicting the prognosis of radiation therapy for lung cancer, which is an RT-PCR kit, a microarray chip kit, a DNA kit, an ELISA kit, a protein chip kit, or a rapid kit. 15.(a) a step of measuring the expression level of mRNA of two or more genes selected from the group consisting of VTN, CXCL5, NEDD4, LCN2, SYTL4, TNFR2 and SERPING1 genes or proteins encoded by two or more genes in a sample isolated from an individual; and (b) A method for providing information for predicting the prognosis of radiation therapy for lung cancer, comprising the step of comparing the expression level of the mRNA or protein with the expression level of the mRNA or protein of a normal control group.

16. In claim 15, A method for providing information for predicting the prognosis of radiation therapy for lung cancer, wherein the step (a) comprises a step of measuring the expression level of mRNA of the CXCL5, LCN2, VTN or NEDD4 gene or a protein encoded by the gene.

Images