Inhibition of PCBP2 to enhance efficacy of immunotherapy

Abstract

The present disclosure provides methods for enhancing the efficacy of immunotherapy (e.g., immune checkpoint blockade or adoptive cell therapeutic composition) in a cancer patient comprising administering an effective amount of at least one agent that inhibits the expression and / or activity of PCBP2.

Description

Atty. Dkt. No.: 115872-3074 INHIBITION OF PCBP2 TO ENHANCE EFFICACY OF IMMUNOTHERAPY CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims the benefit of and priority to U.S. Provisional Patent Application No.63 / 580,232, filed September 1, 2023, the entire contents of which are incorporated herein by reference. TECHNICAL FIELD

[0002] The present disclosure relates to methods for enhancing the efficacy of immunotherapy (e.g., immune checkpoint blockade or adoptive cell therapeutic composition) in a cancer patient comprising administering an effective amount of at least one agent that inhibits the expression and / or activity of PCBP2. BACKGROUND

[0003] The following description of the background of the present technology is provided simply as an aid in understanding the present technology and is not admitted to describe or constitute prior art to the present technology.

[0004] T cell-based immunotherapies, including immune checkpoint inhibitors, have curative potential for the treatment of cancer and have shown clinical success in multiple malignancies. Nevertheless, a significant proportion of patients fail to respond to current immunotherapies or relapse after an initial response either due to defects in the immune cell compartment or due to tumor cell-intrinsic immune escape mechanisms. Among the latter, defects in the human leukocyte antigen (HLA) class I antigen presentation pathway have been described as a frequent tumor cell-intrinsic alteration associated with poor response to immune checkpoint inhibitors (Zaretsky et al.2016).

[0005] Accordingly, there is an urgent unmet medical need to develop therapies that enhance the efficacy of immunotherapy, particularly for cancers with defects in the HLA class I antigen presentation pathway. SUMMARY OF THE PRESENT TECHNOLOGY

[0006] In one aspect, the present disclosure provides a method for sensitizing a cancer patient to immunotherapy comprising administering to the cancer patient an effective amount of a PCBP2 inhibitor separately, sequentially or simultaneously with the -1- 4856-7271-5486.1Atty. Dkt. No.: 115872-3074 immunotherapy. The immunotherapy may comprise immune checkpoint blockade therapy and / or an adoptive cell therapeutic composition comprising T cells. Additionally or alternatively, in certain embodiments, the adoptive cell therapeutic composition comprises one or more of tumor infiltrating T cells, CD8+ T cells, CD4+ T cells, delta-gamma T-cells, and alpha-beta T-cells. The T cells may comprise a native TCR or a heterologous TCR. In certain embodiments, the native TCR or the heterologous TCR is HLA-I restricted or HLA- II restricted. In some embodiments, the adoptive cell therapeutic composition is obtained from an autologous donor or allogeneic donor.

[0007] Additionally or alternatively, in certain embodiments, the cancer patient has previously received immunotherapy. In some embodiments, the cancer patient is resistant or non-responsive to immunotherapy.

[0008] Additionally or alternatively, in some embodiments of the methods disclosed herein, the immune checkpoint blockade therapy comprises one or more of an anti-PD-1 antibody, an anti-PD-L1 antibody, an anti-PD-L2 antibody, an anti-CTLA-4 antibody, an anti-TIM3 antibody, an anti-4-1BB antibody, an anti-CD73 antibody, an anti-GITR antibody, and an anti-LAG-3 antibody. Examples of immune checkpoint blockade therapy include, but are not limited to, pembrolizumab, nivolumab, cemiplimab, atezolizumab, avelumab, durvalumab, ipilimumab, tremelimumab, ticlimumab, JTX-4014, Spartalizumab (PDR001), Camrelizumab (SHR1210), Sintilimab (IBI308), Tislelizumab (BGB-A317), Toripalimab (JS 001), Dostarlimab (TSR-042, WBP-285), INCMGA00012 (MGA012), AMP-224, AMP-514, KN035, CK-301, AUNP12, CA-170, or BMS-986189.

[0009] In any of the preceding embodiments of the methods disclosed herein, the PCBP2 inhibitor reduces the expression and / or activity of PCBP2 mRNA or PCBP2 polypeptides including exon 8 of PCBP2. In some embodiments, the PCBP2 inhibitor is a small molecule, a PCBP2-specific inhibitory nucleic acid, or a PROTAC that specifically targets PCBP2. The PCBP2-specific inhibitory nucleic acid may be a siRNA, a shRNA, an antisense oligonucleotide, or a sgRNA. In other embodiments, the PROTAC that specifically targets PCBP2 comprises an E3 ubiquitin ligase binding moiety (“ULM”) selected from among an IAP E3 ubiquitin ligase binding moiety (an “ILM”), a cereblon E3 ubiquitin ligase binding moiety (a “CLM”), a Von Hippel-Lindae E3 ubiquitin ligase (VHL) binding moiety (VLM), and a mouse double minute 2 homologue (MDM2) E3 ubiquitin ligase binding moiety (MLM). Additionally or alternatively, in some embodiments, the -2- 4856-7271-5486.1Atty. Dkt. No.: 115872-3074 PROTAC that specifically targets PCBP2 comprises a PCBP2 binding moiety (PBM) selected from among HNRPK, PTBP1, and HNRNPL. In certain embodiments of the PROTAC that specifically targets PCBP2, the PBM is coupled to a ULM directly or via a chemical linker.

[0010] In any of the above embodiments of the methods disclosed herein, the PCBP2 inhibitor is administered orally, topically, intranasally, systemically, intravenously, subcutaneously, intraperitoneally, intradermally, intraocularly, iontophoretically, transmucosally, or intramuscularly. Additionally or alternatively, in some embodiments, the immune checkpoint blockade therapy and / or the adoptive cell therapeutic composition is administered pleurally, parenterally, intravenously, subcutaneously, intranodally, intratumorally, intrathecally, intrapleurally or intraperitoneally.

[0011] In any and all embodiments of the methods disclosed herein, the cancer is selected from among an HLA class-II expressing cancer, melanoma, breast cancer, cervical cancer, adrenal cancer, bladder cancer, bone cancer, brain cancer, carcinoma, colon cancer, colorectal cancer, corpus uterine cancer, ear, nose and throat (ENT) cancer, endometrial cancer, esophageal cancer, gastrointestinal cancer, glioblastoma, head and neck cancer, intestinal cancer, kidney cancer, larynx cancer, liver cancer, lung cancer, mesothelioma, nasopharynx cancer, neuroblastoma, oral cancer, ovarian cancer, pancreatic cancer, penile cancer, pharynx cancer, prostate cancer, rectal cancer, sarcoma, seminoma, stomach cancer, teratoma, testicular cancer, thyroid cancer, uterine cancer, vaginal cancer, vascular tumor, and metastases thereof.

[0012] Additionally or alternatively, in some embodiments, the methods of the present technology further comprise administering a cytokine to the cancer patient. The cytokine may be administered prior to, during, or subsequent to administration of the adoptive cell therapeutic composition or the immune checkpoint blockade therapy. In some embodiments, the cytokine is selected from a group consisting of interferon a, interferon β, interferon γ, complement C5a, IL-2, TNF alpha, CD40L, IL12, IL-23, IL15, IL17, CCL1, CCL11, CCL12, CCL13, CCL14-1, CCL14-2, CCL14-3, CCL15-1, CCL15-2, CCL16, CCL17, CCL18, CCL19, CCL19, CCL2, CCL20, CCL21, CCL22, CCL23-1, CCL23-2, CCL24, CCL25-1, CCL25-2, CCL26, CCL27, CCL28, CCL3, CCL3L1, CCL4, CCL4L1, CCL5, CCL6, CCL7, CCL8, CCL9, CCRIO, CCR2, CCR5, CCR6, CCR7, CCR8, CCRLl, CCRL2, CX3CL1, CX3CR, CXCLl, CXCLIO, CXCLl l, CXCLl 2, CXCLl 3, CXCLl 4, -3- 4856-7271-5486.1Atty. Dkt. No.: 115872-3074 CXCLl 5, CXCLl 6, CXCL2, CXCL3, CXCL4, CXCL5, CXCL6, CXCL7, CXCL8, CXCL9, CXCL9, CXCRl, CXCR2, CXCR4, CXCR5, CXCR6, CXCR7 and XCL2. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] FIGs.1A-1B. Whole genome CRISPR knockout screen identifies knockout of PCBP2 as a sensitizer to killing mediated by CD4+ T cells expressing an HLA-II restricted TCR. FIG.1A: Schematic overview of the whole genome CRISPR knockout screen. The melanoma cell line A375 was modified to stably express Cas9. A375 / Cas9 was infected with the whole genome Brunello CRISPR knockout library and subsequently challenged with either control CD4+ T cells or CD4+ T-cells expressing the HLA-II restricted TCR 6F9 recognizing the tumor- associated antigen MAGE-A3 / A6. FIG.1B: Volcano plot depicting depleted and enriched sgRNAs conferring sensitization or resistance to CD4+ T-cell killing, respectively.

[0014] FIG.2. Focused CRISPR knockout screen confirms PCBP2 as a sensitizer to killing mediated by CD4+ T cells expressing an HLA-II restricted TCRs. A custom made CRISPR knockout library (4 sgRNAs per gene) was generated targeting the 200 most significantly depleted and enriched genes discovered in the whole genome screen shown in FIG.1. The melanoma cell lines A375 and SK-MEL-130, the cervical cancer cell line HeLa and the breast cancer cell line MB-468 were modified to stably express Cas9. Cas9- expressing tumor cells were infected with the focused library and subsequently challenged with either control CD4+ T cells or CD4+ T cells expressing the HLA-II restricted TCR 6F9 recognizing the tumor-associated antigen MAGE-A3 / A6 (A375 and SK-MEL-130) or expressing the HLA-II restricted TCR TA10 recognizing the tumor-antigen KK-LC-1 (HeLa and MB-468). Volcano plots depict depleted and enriched sgRNAs conferring sensitization or resistance to CD4+ T-cell killing, respectively.

[0015] FIGs.3A-3B. Genomic deletion of PCBP2 sensitizes tumor cells to killing mediated by CD4+ T cells expressing an HLA-II restricted TCR in in vitro cytotoxicity assays. The indicated melanoma cell lines stably expressing a nuclear localized mCherry reporter were electroporated with CRISPR / Cas9 RNPs targeting either the safer harbor locus AAVS1 or PCBP2. Knockout of PCBP2 was confirmed by ICE analysis (inference of CRISPR edits) and the indel rate is indicated. FIG.3A: Edited tumor cells were exposed to either control CD4+ T cells or CD4+ T cells expressing the HLA-II restricted TCR 6F9 and -4- 4856-7271-5486.1Atty. Dkt. No.: 115872-3074 cell count (corresponding to tumor cell nuclei) was assessed over time using Incucyte. Data points are mean of technical replicates. Error area represents SD. One representative experiment of three with similar results is shown. FIG.3B: Fold sensitization relative to control CD4+ T cell is shown. Data points represent technical replicates of three different T-cell donors. Error bars indicate SD. Statistical analysis was performed by an unpaired t- test.

[0016] FIGs.4A-4B. Disruption of the HLA class I antigen presentation pathway impairs HLA class I but not HLA class II expression. FIG.4A: The indicated sgRNA guide sequences (represented as SEQ ID NOs: 1-12 in order of appearance) targeting components of the HLA class I antigen presentation pathway (B2M, TAP1, TAP2, TAPBP) or targeting the HLA class II master transcription factor CIITA were cloned into the lentiviral plasmid lentiCRISPR v2 (Addgene: #52961). FIG.4B: A375 melanoma knockout cell lines were generated by lentiviral transduction and were selected with puromycin for at least 7 days prior to experiments. Cell lines were stained for HLA class I and HLA class II expression using the monoclonal antibodies W6 / 32-FITC or Tu39-APC, respectively.

[0017] FIGs.5A-5B. Disruption of the HLA class I antigen presentation pathway impairs cytolysis by tumor specific HLA class I-restricted CD8+T cell but not by HLA class II-restricted CD4+T cells. mCherry+A375 melanoma cells were generated by retroviral transduction of a nuclear localized mCherry reporter. CD8+T cells were transduced with the HLA-A*02:01-restricted TCR 1G4 recognizing a peptide processed from NY-ESO-1 and CD4+T cells were transduced with the HLA-DP*04:01-restricted TCR 6F9 recognizing a peptide processed from MAGE-A3 / A6. mCherry+A375 (HLA- A*02:01+, HLA-DP*04:01+) were co-cultured with the indicated T cell populations or without T cells and tumor cell growth was followed over time with Incucyte. FIG.5A: Representative Incucyte data after 48 h of co-culture. FIG.5B: Cytolysis after 48 h averaged across two sgRNAs. Data points represent technical replicates. Error bars indicate SD. Statistical analysis was performed by a one-way ANOVA test.

[0018] FIGs.6A-6D. Multiple PCBP2 splice variants are expressed in cancer cells. FIG.6A: Exon / Intron structure of PCBP2 full length (PCBP2 fl) and PCBP2 lacking coding Exon 8 (PCBP2 ΔE8). FIG.6B: A375 melanoma cells were edited by electroporation with CRISPR / Cas9 RNPs targeting either the safe harbor locus AAVS1 or -5- 4856-7271-5486.1Atty. Dkt. No.: 115872-3074 PCBP2 coding Exon 2. Western Blot showing presence of multiple PCBP2 isoforms in control tumor cells and deletion of both PCBP2 fl and PCBP2 ΔE8 in PCBP2 knockout tumor cells. FIG.6C: Domain structure of PCBP2 fl and PCBP2 ΔE8. GXXG loop, mediating RNA-interaction of KH-domains. NLS, nuclear localization sequence. FIG.6D. Protein structure prediction of PCBP2 fl and PCBP2 ΔE8 using AlphaFold (Jumper J. et al., Nature, 2021).

[0019] FIGs.7A-7B. Genomic deletion of PCBP2 primes tumor cells for apoptosis induced by T cell-derived inflammatory cytokines. Induction of apoptosis was assessed in an Incucyte instrument by measuring green object count (corresponding to tumor cells positive for active Caspase 3 / 7) over time. FIG.7A: Conditioned media (CM) was generated by culturing parental A375 melanoma cells with control CD4+ T cells or CD4+ T cells expressing the HLA-II restricted TCR 6F9. CM was added to A375 melanoma cells edited at the AAVS1 or PCBP2 locus in the presence or absence of TNF- and IFNγ- neutralizing antibodies, and induction of apoptosis was assessed. Left, experimental setup. Right, exemplary Incucyte images. FIG.7A (contd.): Left, Incucyte data over time. Data points show mean of three different T cells donors. Error bars represent SD. FIG.7B: A375 melanoma cells edited at the AAVS1 or PCBP2 locus were exposed to recombinant human TNF (100 ng / ml) and IFNγ (100 ng / ml), and induction of apoptosis was assessed. Left, experimental setup. Right, exemplary Incucyte images. FIG.7B (contd.): Incucyte data over time. Data points show mean of technical replicates. Error bars represent SD. One exemplary experiment of three with similar results is shown. Statistical analysis was performed on the 36 h data points by a one-way ANOVA test.

[0020] FIGs.8A-8D. Cytokine responsiveness is selectively regulated by PCBP2 lacking coding Exon 8. A clonal A375 melanoma cell line lacking expression of endogenous PCBP2 (A375 PCBP2 null) was generated by electroporation with a CRISPR / Cas9 RNP targeting PCBP2 followed by single cell-cloning. N-terminally FLAG- tagged full length (fl) PCBP2 cDNA, PCBP2 cDNA lacking coding Exon 8 (ΔE8), or an empty control vector was retrovirally expressed in A375 PCBP2 null cells. FIG.8A: Expression of the FLAG tag was confirmed by intracellular flow cytometry. FIG.8B: Expression of PCBP2 fl and PCBP2 ΔE8, and lack of PCBP2 expression in A375 null cells was confirmed by Western Blot. FIGs.8C-8D: Induction of apoptosis was assessed in an Incucyte instrument by measuring green object count (corresponding to tumor cells positive -6- 4856-7271-5486.1Atty. Dkt. No.: 115872-3074 for active Caspase 3 / 7) over time. A375 PCBP2 null cells modified as indicated were exposed to recombinant human TNF (100 ng / ml) and IFNγ (100 ng / ml), and induction of apoptosis was assessed. FIG.8C: exemplary Incucyte images. FIG.8D: Incucyte data over time. Data points show mean of technical replicates. Error bars represent SD. Statistical analysis was performed on the 36 h data points by a one-way ANOVA test. One exemplary experiment of two with similar results is shown.

[0021] FIGs.9A-9D. Selective deletion of PCBP2 full length using Cas9 phenocopies re-expression of PCBP2 ΔE8 cDNA in A375 PCBP2 null cells. A375 melanoma cells were edited by electroporation with CRISPR / Cas9 RNPs targeting either the safe harbor locus AAVS1, PCBP2 coding Exon 2 or PCBP2 coding Exon 8. FIG.9A: Schematic overview of the CRISPR / Cas9 knockout strategy. FIG.9B: Western Blot confirming selective deletion of PCBP2 full length by CRISPR / Cas9 targeting of PCBP2 coding exon 8. Edits were confirmed by ICE analysis and the indel rate is indicated. FIG. 9C: qRT-PCR primer were designed that specifically amplify PCBP2 fl or PCBP2 ΔE8. RNA was isolated from edited-tumor cells and transcribed into cDNA. Graphs show fold expression of PCBP2 fl mRNA (left) or PCBP2 ΔE8 mRNA (right) in PCBP2-edited tumor cells relative to AAVS1-edited tumor cells normalized to HPRT1 expression using the 2–∆∆Ctmethod. Data points show mean of technical replicates. Error bars represent SD. Statistical analysis was performed by a one-way ANOVA test. One exemplary experiment of two with similar results is shown. FIG.9D: Induction of apoptosis in edited tumor cells upon exposure to recombinant human TNF (1 ng / ml) and IFNγ (1 ng / ml) was assessed in an Incucyte instrument by measuring green object count (corresponding to tumor cells positive for active Caspase 3 / 7) over time. Data points show mean of technical replicates. Error bars represent SD. Statistical analysis was performed on the 72 h data points by a one-way ANOVA test. One exemplary experiment of two with similar results is shown.

[0022] FIGs.10A-10C. Selective deletion of PCBP2 ΔE8 phenocopies re-expression of PCBP2 full length cDNA in A375 PCBP2 null cells. A375 melanoma cells were transduced with lentiviral constructs expressing RfxCas13d and a non-targeting (NTC) Cas13d guide, Cas13d guides targeting the PCBP2 coding exon 7 / 9 splice junction specific to PCBP2 ΔE8 mRNA or Cas13d guides targeting CD71 as a specificity control. FIG. 10A: Schematic overview of the RfxCas13 knockdown strategy. FIG.10B: qRT-PCR primer were designed that specifically amplify PCBP2 fl or PCBP2 ΔE8. RNA was -7- 4856-7271-5486.1Atty. Dkt. No.: 115872-3074 isolated from edited-tumor cells and transcribed into cDNA. Graphs show fold expression of PCBP2 fl (left) or PCBP2 ΔE8 (right) in PCBP2 ΔE8 and CD71 knockdown tumor cells relative to control tumor cells (NTC RfxCas13d guide) normalized to HPRT1 expression using the 2–∆∆Ctmethod. Data points show mean of technical replicates. Error bars represent SD. Statistical analysis was performed by a one-way ANOVA test using background-editing (CD71 guide) as control. One exemplary experiment of two with similar results is shown. FIG.10C: Induction of apoptosis in RfxCas13d-transduced tumor cells upon exposure to recombinant human TNF (1 ng / ml) and IFNγ (1 ng / ml) was assessed in an Incucyte instrument by measuring green object count (corresponding to tumor cells positive for active Caspase 3 / 7) over time. Data points show mean of technical replicates. Error bars represent SD. Statistical analysis was performed on the 72 h data points by a one-way ANOVA test using background-editing (CD71 guide) as control. One exemplary experiment of two with similar results is shown.

[0023] FIGs.11A-11B. Cytokine responsiveness is selectively regulated by the RNA-binding domain KH3 of PCBP2 ΔE8. A375 melanoma cells stably expressing a nuclear localized mCherry reporter were electroporated with a CRISPR / Cas9 RNP targeting PCBP2 followed by single cell-cloning to generate A375 / mCherry PCBP2 null cells. N- terminally FLAG-tagged PCBP2 cDNA lacking coding Exon 8 (ΔE8) harboring the GXXG -> GDDG mutation in the indicated KH domain(s), or an empty control vector was retrovirally expressed in A375 / mCherry PCBP2 null cells. The GXXG -> GDDG mutation impairs the RNA-binding capacity of the KH-domain (Hollingworth D. et al., Nucleic Acids Res, 2012). FIG.11A: Expression of the FLAG tag was confirmed by intracellular flow cytometry. FIG.11B: Induction of apoptosis upon exposure to recombinant human TNF (100 ng / ml) and IFNγ (100 ng / ml) was assessed after 48 h in an Incucyte instrument by measuring green object count per field (corresponding to tumor cells positive for active Caspase 3 / 7) relative to red object count per field (corresponding to the number of tumor cells per field). Left, relative apoptosis as measured for individual KH-domain mutants. Right, relative apoptosis for KH-domain mutants binned by presence or absence of a functional KH3 domain. Data points show mean of technical replicates. Error bars represent SD. Statistical analysis was performed by a one-way ANOVA test comparing the test group with the empty vector control group. -8- 4856-7271-5486.1Atty. Dkt. No.: 115872-3074 DETAILED DESCRIPTION

[0024] It is to be appreciated that certain aspects, modes, embodiments, variations and features of the present methods are described below in various levels of detail in order to provide a substantial understanding of the present technology.

[0025] In practicing the present methods, many conventional techniques in molecular biology, protein biochemistry, cell biology, immunology, microbiology and recombinant DNA are used. See, e.g., Sambrook and Russell eds. (2001) Molecular Cloning: A Laboratory Manual, 3rd edition; the series Ausubel et al. eds. (2007) Current Protocols in Molecular Biology; the series Methods in Enzymology (Academic Press, Inc., N.Y.); MacPherson et al. (1991) PCR 1: A Practical Approach (IRL Press at Oxford University Press); MacPherson et al. (1995) PCR 2: A Practical Approach; Harlow and Lane eds. (1999) Antibodies, A Laboratory Manual; Freshney (2005) Culture of Animal Cells: A Manual of Basic Technique, 5th edition; Gait ed. (1984) Oligonucleotide Synthesis; U.S. Patent No.4,683,195; Hames and Higgins eds. (1984) Nucleic Acid Hybridization; Anderson (1999) Nucleic Acid Hybridization; Hames and Higgins eds. (1984) Transcription and Translation; Immobilized Cells and Enzymes (IRL Press (1986)); Perbal (1984) A Practical Guide to Molecular Cloning; Miller and Calos eds. (1987) Gene Transfer Vectors for Mammalian Cells (Cold Spring Harbor Laboratory); Makrides ed. (2003) Gene Transfer and Expression in Mammalian Cells; Mayer and Walker eds. (1987) Immunochemical Methods in Cell and Molecular Biology (Academic Press, London); and Herzenberg et al. eds (1996) Weir’s Handbook of Experimental Immunology. Methods to detect and measure levels of polypeptide gene expression products (i.e., gene translation level) are well-known in the art and include the use of polypeptide detection methods such as antibody detection and quantification techniques. (See also, Strachan & Read, Human Molecular Genetics, Second Edition. (John Wiley and Sons, Inc., NY, 1999)).

[0026] While a functional HLA class-I antigen presentation pathway is a prerequisite for direct tumor cell recognition by CD8+ T cells, tumor reactive CD4+ T cells can directly recognize and kill tumor cells in an HLA class-II restricted but HLA class-I independent manner. HLA class-II expression is found in diverse cancer types, including ~30% of melanomas (Johnson et al.2016), and its expression is differently regulated than HLA class- I. These observations highlight the importance of understanding the determinants of CD4+ -9- 4856-7271-5486.1Atty. Dkt. No.: 115872-3074 T cell-mediated response to cancer as this may uncover new therapeutic avenues, particularly for cancers with defects in the HLA class-I presentation pathway.

[0027] The presently disclosed subject matter provides methods for enhancing the efficacy of immunotherapy in cancers, wherein inhibition of the RNA-binding protein PCBP2 is combined with immunotherapy (e.g., with immune checkpoint blockade or adoptive cell therapeutic composition) to treat HLA expressing cancers, including but not limited to melanoma, breast cancer, and cervical cancer. Definitions

[0028] Unless defined otherwise, all technical and scientific terms used herein generally have the same meaning as commonly understood by one of ordinary skill in the art to which this technology belongs. As used in this specification and the appended claims, the singular forms “a”, “an” and “the” include plural referents unless the content clearly dictates otherwise. For example, reference to “a cell” includes a combination of two or more cells, and the like. Generally, the nomenclature used herein and the laboratory procedures in cell culture, molecular genetics, organic chemistry, analytical chemistry and nucleic acid chemistry and hybridization described below are those well-known and commonly employed in the art.

[0029] As used herein, the term “about” in reference to a number is generally taken to include numbers that fall within a range of 1%, 5%, or 10% in either direction (greater than or less than) of the number unless otherwise stated or otherwise evident from the context (except where such number would be less than 0% or exceed 100% of a possible value).

[0030] As used herein, the “administration” of an agent or drug to a subject includes any route of introducing or delivering to a subject a compound to perform its intended function. Administration can be carried out by any suitable route, including but not limited to, orally, intranasally, parenterally (intravenously, intramuscularly, intraperitoneally, or subcutaneously), rectally, intrathecally, or topically. Administration includes self- administration and the administration by another.

[0031] As used herein “adoptive cell therapeutic composition” refers to any composition comprising cells suitable for adoptive cell transfer. In exemplary embodiments, the adoptive cell therapeutic composition comprises a cell type selected from a group -10- 4856-7271-5486.1Atty. Dkt. No.: 115872-3074 consisting of a tumor infiltrating lymphocyte (TIL), TCR (i.e. heterologous T-cell receptor) modified lymphocytes and CAR (i.e. chimeric antigen receptor) modified lymphocytes (e.g., CAR T cells). In another embodiment, the adoptive cell therapeutic composition comprises a cell type selected from a group consisting of T-cells, CD8+ cells, CD4+ cells, NK-cells, delta-gamma T-cells, regulatory T-cells and peripheral blood mononuclear cells. In another embodiment, TILs, T-cells, CD8+ cells, CD4+ cells, NK-cells, delta-gamma T- cells, regulatory T-cells or peripheral blood mononuclear cells form the adoptive cell therapeutic composition. In one embodiment, the adoptive cell therapeutic composition comprises T cells.

[0032] The terms “complementary” or “complementarity” as used herein with reference to polynucleotides (i.e., a sequence of nucleotides such as an oligonucleotide or a target nucleic acid) refer to the base-pairing rules. The complement of a nucleic acid sequence as used herein refers to an oligonucleotide which, when aligned with the nucleic acid sequence such that the 5' end of one sequence is paired with the 3' end of the other, is in “antiparallel association.” For example, the sequence “5'-A-G-T-3'” is complementary to the sequence “3'-T-C-A-5.” Certain bases not commonly found in naturally-occurring nucleic acids may be included in the nucleic acids described herein. These include, for example, inosine, 7- deazaguanine, Locked Nucleic Acids (LNA), and Peptide Nucleic Acids (PNA). Complementarity need not be perfect; stable duplexes may contain mismatched base pairs, degenerative, or unmatched bases. Those skilled in the art of nucleic acid technology can determine duplex stability empirically considering a number of variables including, for example, the length of the oligonucleotide, base composition and sequence of the oligonucleotide, ionic strength and incidence of mismatched base pairs. A complementary sequence can also be an RNA sequence complementary to the DNA sequence or its complementary sequence, and can also be a cDNA.

[0033] As used herein, a “control” is an alternative sample used in an experiment for comparison purpose. A control can be “positive” or “negative.” For example, where the purpose of the experiment is to determine a correlation of the efficacy of a therapeutic agent for the treatment for a particular type of disease, a positive control (a compound or composition known to exhibit the desired therapeutic effect) and a negative control (a subject or a sample that does not receive the therapy or receives a placebo) are typically employed. -11- 4856-7271-5486.1Atty. Dkt. No.: 115872-3074

[0034] As used herein, the term “effective amount” refers to a quantity sufficient to achieve a desired therapeutic and / or prophylactic effect, e.g., an amount which results in the prevention of, or a decrease in a disease or condition described herein or one or more signs or symptoms associated with a disease or condition described herein. In the context of therapeutic or prophylactic applications, the amount of a composition administered to the subject will vary depending on the composition, the degree, type, and severity of the disease and on the characteristics of the individual, such as general health, age, sex, body weight and tolerance to drugs. The skilled artisan will be able to determine appropriate dosages depending on these and other factors. The compositions can also be administered in combination with one or more additional therapeutic compounds. In the methods described herein, the therapeutic compositions may be administered to a subject having one or more signs or symptoms of a disease or condition described herein. As used herein, a “therapeutically effective amount” of a composition refers to composition levels in which the physiological effects of a disease or condition are ameliorated or eliminated. A therapeutically effective amount can be given in one or more administrations.

[0035] As used herein, “expression” includes one or more of the following: transcription of the gene into precursor mRNA; splicing and other processing of the precursor mRNA to produce mature mRNA; mRNA stability; translation of the mature mRNA into protein (including codon usage and tRNA availability); and glycosylation and / or other modifications of the translation product, if required for proper expression and function.

[0036] As used herein, the term “gene” means a segment of DNA that contains all the information for the regulated biosynthesis of an RNA product, including promoters, exons, introns, and other untranslated regions that control expression.

[0037] “Homology” or “identity” or “similarity” refers to sequence similarity between two peptides or between two nucleic acid molecules. Homology can be determined by comparing a position in each sequence which may be aligned for purposes of comparison. When a position in the compared sequence is occupied by the same nucleobase or amino acid, then the molecules are homologous at that position. A degree of homology between sequences is a function of the number of matching or homologous positions shared by the sequences. A polynucleotide or polynucleotide region (or a polypeptide or polypeptide region) has a certain percentage (for example, at least 60%, 65%, 70%, 75%, 80%, 85%, -12- 4856-7271-5486.1Atty. Dkt. No.: 115872-3074 90%, 95%, 98% or 99%) of “sequence identity” to another sequence means that, when aligned, that percentage of bases (or amino acids) are the same in comparing the two sequences. This alignment and the percent homology or sequence identity can be determined using software programs known in the art. In some embodiments, default parameters are used for alignment. One alignment program is BLAST, using default parameters. In particular, programs are BLASTN and BLASTP, using the following default parameters: Genetic code=standard; filter=none; strand=both; cutoff=60; expect=10; Matrix=BLOSUM62; Descriptions=50 sequences; sort by ═HIGH SCORE; Databases=non-redundant, GenBank+EMBL+DDBJ+PDB+GenBank CDS translations+SwissProtein+SPupdate+PIR. Details of these programs can be found at the National Center for Biotechnology Information. Biologically equivalent polynucleotides are those having the specified percent homology and encoding a polypeptide having the same or similar biological activity. Two sequences are deemed “unrelated” or “non- homologous” if they share less than 40% identity, or less than 25% identity, with each other.

[0038] The term “hybridize” as used herein refers to a process where two substantially complementary nucleic acid strands (at least about 65% complementary over a stretch of at least 14 to 25 nucleotides, at least about 75%, or at least about 90% complementary) anneal to each other under appropriately stringent conditions to form a duplex or heteroduplex through formation of hydrogen bonds between complementary base pairs. Nucleic acid hybridization techniques are well known in the art. See, e.g., Sambrook, et al., 1989, Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Press, Plainview, N.Y. Hybridization and the strength of hybridization (i.e., the strength of the association between the nucleic acids) is influenced by such factors as the degree of complementarity between the nucleic acids, stringency of the conditions involved, and the thermal melting point (Tm) of the formed hybrid. Those skilled in the art understand how to estimate and adjust the stringency of hybridization conditions such that sequences having at least a desired level of complementarity will stably hybridize, while those having lower complementarity will not. For examples of hybridization conditions and parameters, see, e.g., Sambrook, et al., 1989, Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Press, Plainview, N.Y.; Ausubel, F. M. et al.1994, Current Protocols in Molecular Biology, John Wiley & Sons, Secaucus, N.J. In some embodiments, specific -13- 4856-7271-5486.1Atty. Dkt. No.: 115872-3074 hybridization occurs under stringent hybridization conditions. An oligonucleotide or polynucleotide (e.g., a probe or a primer) that is specific for a target nucleic acid will “hybridize” to the target nucleic acid under suitable conditions.

[0039] As used herein, the terms “individual”, “patient”, or “subject” can be an individual organism, a vertebrate, a mammal, or a human. In some embodiments, the individual, patient or subject is a human.

[0040] As used herein, “oligonucleotide” refers to a molecule that has a sequence of nucleic acid bases on a backbone comprised mainly of identical monomer units at defined intervals. The bases are arranged on the backbone in such a way that they can bind with a nucleic acid having a sequence of bases that are complementary to the bases of the oligonucleotide. The most common oligonucleotides have a backbone of sugar phosphate units. A distinction may be made between oligodeoxyribonucleotides that do not have a hydroxyl group at the 2' position and oligoribonucleotides that have a hydroxyl group at the 2' position. Oligonucleotides may also include derivatives, in which the hydrogen of the hydroxyl group is replaced with organic groups, e.g., an allyl group. One or more bases of the oligonucleotide may also be modified to include a phosphorothioate bond (e.g., one of the two oxygen atoms in the phosphate backbone which is not involved in the internucleotide bridge, is replaced by a sulfur atom) to increase resistance to nuclease degradation. The exact size of the oligonucleotide will depend on many factors, which in turn depend on the ultimate function or use of the oligonucleotide. The oligonucleotide may be generated in any manner, including, for example, chemical synthesis, DNA replication, restriction endonuclease digestion of plasmids or phage DNA, reverse transcription, PCR, or a combination thereof. The oligonucleotide may be modified e.g., by addition of a methyl group, a biotin or digoxigenin moiety, a fluorescent tag or by using radioactive nucleotides.

[0041] As used herein, the term “pharmaceutically-acceptable carrier” is intended to include any and all solvents, dispersion media, coatings, antibacterial and antifungal compounds, isotonic and absorption delaying compounds, and the like, compatible with pharmaceutical administration. Pharmaceutically-acceptable carriers and their formulations are known to one skilled in the art and are described, for example, in Remington's Pharmaceutical Sciences (20thedition, ed. A. Gennaro, 2000, Lippincott, Williams & Wilkins, Philadelphia, Pa.). -14- 4856-7271-5486.1Atty. Dkt. No.: 115872-3074

[0042] As used herein, the term “polynucleotide” or “nucleic acid” means any RNA or DNA, which may be unmodified or modified RNA or DNA. Polynucleotides include, without limitation, single- and double-stranded DNA, DNA that is a mixture of single- and double-stranded regions, single- and double-stranded RNA, RNA that is mixture of single- and double-stranded regions, and hybrid molecules comprising DNA and RNA that may be single-stranded or, more typically, double-stranded or a mixture of single- and double- stranded regions. In addition, polynucleotide refers to triple-stranded regions comprising RNA or DNA or both RNA and DNA. The term polynucleotide also includes DNAs or RNAs containing one or more modified bases and DNAs or RNAs with backbones modified for stability or for other reasons.

[0043] As used herein, the terms “polypeptide,” “peptide” and “protein” are used interchangeably herein to mean a polymer comprising two or more amino acids joined to each other by peptide bonds or modified peptide bonds, i.e., peptide isosteres. Polypeptide refers to both short chains, commonly referred to as peptides, glycopeptides or oligomers, and to longer chains, generally referred to as proteins. Polypeptides may contain amino acids other than the 20 gene-encoded amino acids. Polypeptides include amino acid sequences modified either by natural processes, such as post-translational processing, or by chemical modification techniques that are well known in the art. Such modifications are well described in basic texts and in more detailed monographs, as well as in a voluminous research literature.

[0044] As used herein, “prevention,” “prevent,” or “preventing” of a disorder or condition refers to one or more compounds that, in a statistical sample, reduces the occurrence of the disorder or condition in the treated sample relative to an untreated control sample, or delays the onset of one or more symptoms of the disorder or condition relative to the untreated control sample.

[0045] As used herein, the term “sample” refers to clinical samples obtained from a subject. Biological samples may include tissues, cells, protein or membrane extracts of cells, mucus, sputum, bone marrow, bronchial alveolar lavage (BAL), bronchial wash (BW), and biological fluids (e.g., ascites fluid or cerebrospinal fluid (CSF)) isolated from a subject, as well as tissues, cells and fluids (blood, plasma, saliva, urine, serum etc.) present within a subject. -15- 4856-7271-5486.1Atty. Dkt. No.: 115872-3074

[0046] The term “specific” as used herein in reference to an oligonucleotide means that the nucleotide sequence of the oligonucleotide has at least 12 bases of sequence identity with a portion of a target nucleic acid when the oligonucleotide and the target nucleic acid are aligned. An oligonucleotide that is specific for a target nucleic acid is one that, under the stringent hybridization or washing conditions, is capable of hybridizing to the target nucleic acid of interest and not substantially hybridizing to nucleic acids which are not of interest. Higher levels of sequence identity are desirable and include at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or at least 98% sequence identity.

[0047] The term “stringent hybridization conditions” as used herein refers to hybridization conditions at least as stringent as the following: hybridization in 50% formamide, 5xSSC, 50 mM NaH2PO4, pH 6.8, 0.5% SDS, 0.1 mg / mL sonicated salmon sperm DNA, and 5x Denhart's solution at 42oC. overnight; washing with 2x SSC, 0.1% SDS at 45oC; and washing with 0.2x SSC, 0.1% SDS at 45oC. In another example, stringent hybridization conditions should not allow for hybridization of two nucleic acids which differ over a stretch of 20 contiguous nucleotides by more than two bases.

[0048] As used herein, the terms “target sequence” and “target nucleic acid sequence” refer to a specific nucleic acid sequence to be modulated (e.g., inhibited or downregulated).

[0049] As used herein, the term “therapeutic agent” is intended to mean a compound that, when present in an effective amount, produces a desired therapeutic effect on a subject in need thereof.

[0050] “Treating”, “treat”, or “treatment” as used herein covers the treatment of a disease or disorder described herein, in a subject, such as a human, and includes: (i) inhibiting a disease or disorder, i.e., arresting its development; (ii) relieving a disease or disorder, i.e., causing regression of the disorder; (iii) slowing progression of the disorder; and / or (iv) inhibiting, relieving, or slowing progression of one or more symptoms of the disease or disorder. In some embodiments, treatment means that the symptoms associated with the disease are, e.g., alleviated, reduced, cured, or placed in a state of remission.

[0051] It is also to be appreciated that the various modes of treatment or prevention of medical diseases and conditions as described are intended to mean “substantial,” which includes total but also less than total treatment or prevention, and wherein some biologically or medically relevant result is achieved. The treatment may be a continuous prolonged -16- 4856-7271-5486.1Atty. Dkt. No.: 115872-3074 treatment for a chronic disease or a single, or few time administrations for the treatment of an acute condition.

[0052] The term “ubiquitin ligase” refers to a family of proteins that facilitate the transfer of ubiquitin to a specific substrate protein, targeting the substrate protein for degradation. For example, IAP an E3 ubiquitin ligase protein that alone or in combination with an E2 ubiquitin-conjugating enzyme causes the attachment of ubiquitin to a lysine on a target protein, and subsequently targets the specific protein substrates for degradation by the proteasome. Thus, E3 ubiquitin ligase alone or in complex with an E2 ubiquitin conjugating enzyme is responsible for the transfer of ubiquitin to targeted proteins. In general, the ubiquitin ligase is involved in polyubiquitination such that a second ubiquitin is attached to the first; a third is attached to the second, and so forth. Polyubiquitination marks proteins for degradation by the proteasome. However, there are some ubiquitination events that are limited to mono-ubiquitination, in which only a single ubiquitin is added by the ubiquitin ligase to a substrate molecule. Mono-ubiquitinated proteins are not targeted to the proteasome for degradation, but may instead be altered in their cellular location or function, for example, via binding other proteins that have domains capable of binding ubiquitin. Further complicating matters, different lysines on ubiquitin can be targeted by an E3 to make chains. The most common lysine is Lys48 on the ubiquitin chain. This is the lysine used to make polyubiquitin, which is recognized by the proteasome. PCBP2 Inhibitors of the Present Technology

[0053] The present disclosure provides therapeutic agents that inhibit the activity or expression of PCBP2. In some embodiments, the PCBP2 inhibitor is a small molecule, an inhibitory nucleic acid (e.g., siRNA, antisense nucleic acid, shRNA, sgRNA, ribozymes), an antibody (e.g., a neutralizing antibody) or a PROTAC that specifically targets PCBP2.

[0001] Exemplary mRNA sequences of PCBP2 are provided below, represented by SEQ ID NOs: 13-19.

[0054] NM_001098620.3 Homo sapiens poly(rC) binding protein 2 (PCBP2), transcript variant 3, mRNA (SEQ ID NO: 13) CCCAGACCAGCAGAGGCAGCAGCCGGAGCAGCCGCAGCCTGCGCCCTCTCCCGCCCGCCCGCCCTCCGCC CGCCCGCCCGCCCTCCGCCGCCCTCCACCCGCCCCGGGGTCTCTTTCCCCCTTCCTCCTCCTCCTCCTCC ACCCCCCCTTCCTCCTCCGCCCGCCCGCGGGGCCCCCCTCGCCTTCCCGCCCGCCCCTATTGTTCCGCCC CCGGCCTCCCGCCCTTCCCCTTCCCGCCCGCTCCCCTTTTCCCCTCAGTCGCCTCGCGCCTGCAGTTTTT GGCTTTCACCCCCAACCAGTGACCAAAGACTTGACCACTCAAAGTCCAGCTCCCCAGAACACTGCTCGAC -17- 4856-7271-5486.1Atty. Dkt. No.: 115872-3074 ATGGACACCGGTGTGATTGAAGGTGGATTAAATGTCACTCTCACCATCCGGCTACTTATGCATGGAAAGG AAGTTGGCAGTATCATCGGAAAGAAAGGAGAATCAGTTAAGAAGATGCGCGAGGAGAGTGGTGCACGTAT CAACATCTCAGAAGGGAATTGTCCTGAGAGAATTATCACTTTGGCTGGACCCACTAATGCCATCTTCAAA GCCTTTGCTATGATCATTGACAAACTGGAAGAGGACATAAGCAGCTCTATGACCAATAGCACAGCTGCCA GTAGACCCCCGGTCACCCTGAGGCTGGTGGTCCCTGCTAGTCAGTGTGGCTCTCTCATTGGAAAAGGTGG ATGCAAGATCAAGGAAATACGAGAGAGTACAGGGGCTCAGGTCCAGGTGGCAGGGGATATGCTACCCAAC TCAACTGAGCGGGCCATCACTATTGCTGGCATTCCACAATCCATCATTGAGTGTGTCAAACAGATCTGCG TGGTCATGTTGGAGTCCCCCCCGAAGGGCGTGACCATCCCGTACCGGCCCAAGCCGTCCAGCTCTCCGGT CATCTTTGCAGGTGGTCAGGCCTATACCATTCAAGGACAGTATGCCATTCCACAGCCAGATTTGACCAAG CTGCACCAGTTGGCAATGCAACAGTCTCATTTTCCCATGACGCATGGCAACACCGGATTCAGTGGCATTG AATCCAGCTCTCCAGAGGTGAAAGGCTATTGGGCAGGTTTGGATGCATCTGCTCAGACTACTTCTCATGA ACTCACCATTCCAAACGATTTGATTGGCTGCATAATCGGGCGTCAAGGCGCCAAAATCAATGAGATCCGT CAGATGTCTGGGGCGCAGATCAAAATTGCGAACCCAGTGGAAGGATCTACTGATAGGCAGGTTACCATCA CTGGATCTGCTGCCAGCATTAGCCTGGCTCAATATCTAATCAATGTCAGGCTTTCCTCGGAGACGGGTGG CATGGGGAGCAGCTAGAACAATGCAGATTCATCCATAATCCCTTTCTGCTGTTCACCACCACCCATGATC CATCTGTGTAGTTTCTGAACAGTCAGCGATTCCAGGTTTTAAATAGTTTGTAAATTTTCAGTTTCTACAC ACTTTATCATCCACTCGTGATTTTTTAATTAAAGCGTTTTAATTCCTTTCTCTGTTCAGCTGTTGATGCT GAGATCCATATTTAGTTTTATAAGCTTCTCCCTGGTTTTTTTTTTTTGGCTCATGAATTTTTCTGTTTGT CATGGAAATGTAAGAGTGGAATATTAATACATTTCAGTTTAGTTCTGTAATGTCAGGAATTTTTCAAAAA AATTAAAAGATGGACTGGAGCTTTTTCTTTGTGAATAGAAACTGGATGCCACAGTGATTCATGTGGGTTT TATTCCTCTTGTCTTGCTGTTATTTTTGTACCTTTTATCCCTCAAAGGACCCTTCTTGGGTTTTGAATGG AAGCCTTTATTCCGGTTAAGATGTTTTCTTCTATTTTACCACTTCCATCTTTTTTTGTGGCCCTCGATCC TATTTTTCCCTGACTCCATGCTTGGTTGGCCCTTATAAAACTTGTGCCCAAAAGATTGAGGATTAGACTT TCCGAGGACTTACCTGTCCTAGGGGAGTAGGCAAGCACTTCCACTAGGGAGGGGGTGGGGGAAAGGAATG ACACATGACATACATGGCATACACATTAAGCAGTTGATCATATGTCTGACTGGGTTCCAGTTTCTTGGGA ATGTTGGTCCCCTTGTTCAGGCTTGCATATTTTAAACTAAAAATTTCAGTCTATTGTTTTTAGTAACTTC ATTTATAGTCCTCCATAACAAGTTAGAAGGATGTATCTGCTACCATTTATTCCTATAATTTTAGAAAGTT GGGGCTTGACATTATACTCATTTAGTGAGAGTAGATGCAAAAAAGTGGAGGGGCAGGAGAACTTCTCCAG ACACCTCAGATAAAGTCCGGAGCCCAAGGCTTTATCTTAACCATGTATGGTACCCCATTCATTCATCAAG AAAACCCTCAACAGCTGGGCCTGCATGGAGTGTTATATTTCAAGGTTTTTCACAGGGGTTACAGTAGGAC AGTCCCCACCCCAATCAGGCACCAGGATAAAAGCAGGGACTTAAACAGCACCCCGGTTCTTCAGCCTGAG CCATCACATGCTATCAGTCTCCTAACCTCCCCCTGGGCCTTAAGACAGGGCTTGGGCAGAGAAGATAAAT GGTGGGACAAAAAAATGAGTTACATTGCCACCTGAGAAACCTCAGAGGGGAGGACCCAGCCTTAGCCTCC CTCCTCCCAAGTGCAAAATGTGTAAACAGAGTAAACGGAACAGAAAAGTGCAGTCTAAGTGGTTTTCTCT CCTGCCCCTCCCACCGCCCCTCCCCCCACCCCCTATTATTTGGGGATAAAGAATATAAAGACAACCCTGG CTTTTCTATTGCCTTGTTGCTTGCTGAATATAAGGAATGGGGTGGGGCAGGAAGGGGCTTGCCCTTAGCC ACAGCTCTACGGCTGTGCCTCATTCATTTCCACAGCTGCCAGTGTCCCTAGAGTTTATCAGGTGAATTGG TCAGGGGATCAGTCTCCCTCGAGCCTGACTTACGGCTGGGACAGCCCCATCTTTCTGTTGATTATGTGGC GCATATATATATATATATGTATATATATATAATTTATATAAATATTTCTCTATGTA

[0055] NM_001128911.2 Homo sapiens poly(rC) binding protein 2 (PCBP2), transcript variant 4, mRNA (SEQ ID NO: 14) CCCAGACCAGCAGAGGCAGCAGCCGGAGCAGCCGCAGCCTGCGCCCTCTCCCGCCCGCCCGCCCTCCGCC CGCCCGCCCGCCCTCCGCCGCCCTCCACCCGCCCCGGGGTCTCTTTCCCCCTTCCTCCTCCTCCTCCTCC ACCCCCCCTTCCTCCTCCGCCCGCCCGCGGGGCCCCCCTCGCCTTCCCGCCCGCCCCTATTGTTCCGCCC CCGGCCTCCCGCCCTTCCCCTTCCCGCCCGCTCCCCTTTTCCCCTCAGTCGCCTCGCGCCTGCAGTTTTT GGCTTTCACCCCCAACCAGTGACCAAAGACTTGACCACTCAAAGTCCAGCTCCCCAGAACACTGCTCGAC ATGGACACCGGTGTGATTGAAGGTGGATTAAATGTCACTCTCACCATCCGGCTACTTATGCATGGAAAGG AAGTTGGCAGTATCATCGGAAAGAAAGGAGAATCAGTTAAGAAGATGCGCGAGGAGAGTGGTGCACGTAT CAACATCTCAGAAGGGAATTGTCCTGAGAGAATTATCACTTTGGCTGGACCCACTAATGCCATCTTCAAA GCCTTTGCTATGATCATTGACAAACTGGAAGAGGACATAAGCAGCTCTATGACCAATAGCACAGCTGCCA GTAGACCCCCGGTCACCCTGAGGCTGGTGGTCCCTGCTAGTCAGTGTGGCTCTCTCATTGGAAAAGGTGG ATGCAAGATCAAGGAAATACGAGAGAGTACAGGGGCTCAGGTCCAGGTGGCAGGGGATATGCTACCCAAC TCAACTGAGCGGGCCATCACTATTGCTGGCATTCCACAATCCATCATTGAGTGTGTCAAACAGATCTGCG TGGTCATGTTGGAGACTCTCTCCCAGTCCCCCCCGAAGGGCGTGACCATCCCGTACCGGCCCAAGCCGTC CAGCTCTCCGGTCATCTTTGCAGGTGGTCAGGACAGGTACAGCACAGGCAGCGACAGTGCGAGCTTTCCC -18- 4856-7271-5486.1Atty. Dkt. No.: 115872-3074 CACACCACCCCGTCCATGTGCCTCAACCCTGACCTGGAGGGACCACCTCTAGAGGCCTATACCATTCAAG GACAGTATGCCATTCCACAGCCAGATTTGACCAAGCTGCACCAGTTGGCAATGCAACAGTCTCATTTTCC CATGACGCATGGCAACACCGGATTCAGTGGCATTGAATCCAGCTCTCCAGAGGTGAAAGGCTATTGGGGT TTGGATGCATCTGCTCAGACTACTTCTCATGAACTCACCATTCCAAACGATTTGATTGGCTGCATAATCG GGCGTCAAGGCGCCAAAATCAATGAGATCCGTCAGATGTCTGGGGCGCAGATCAAAATTGCGAACCCAGT GGAAGGATCTACTGATAGGCAGGTTACCATCACTGGATCTGCTGCCAGCATTAGCCTGGCTCAATATCTA ATCAATGTCAGGCTTTCCTCGGAGACGGGTGGCATGGGGAGCAGCTAGAACAATGCAGATTCATCCATAA TCCCTTTCTGCTGTTCACCACCACCCATGATCCATCTGTGTAGTTTCTGAACAGTCAGCGATTCCAGGTT TTAAATAGTTTGTAAATTTTCAGTTTCTACACACTTTATCATCCACTCGTGATTTTTTAATTAAAGCGTT TTAATTCCTTTCTCTGTTCAGCTGTTGATGCTGAGATCCATATTTAGTTTTATAAGCTTCTCCCTGGTTT TTTTTTTTTGGCTCATGAATTTTTCTGTTTGTCATGGAAATGTAAGAGTGGAATATTAATACATTTCAGT TTAGTTCTGTAATGTCAGGAATTTTTCAAAAAAATTAAAAGATGGACTGGAGCTTTTTCTTTGTGAATAG AAACTGGATGCCACAGTGATTCATGTGGGTTTTATTCCTCTTGTCTTGCTGTTATTTTTGTACCTTTTAT CCCTCAAAGGACCCTTCTTGGGTTTTGAATGGAAGCCTTTATTCCGGTTAAGATGTTTTCTTCTATTTTA CCACTTCCATCTTTTTTTGTGGCCCTCGATCCTATTTTTCCCTGACTCCATGCTTGGTTGGCCCTTATAA AACTTGTGCCCAAAAGATTGAGGATTAGACTTTCCGAGGACTTACCTGTCCTAGGGGAGTAGGCAAGCAC TTCCACTAGGGAGGGGGTGGGGGAAAGGAATGACACATGACATACATGGCATACACATTAAGCAGTTGAT CATATGTCTGACTGGGTTCCAGTTTCTTGGGAATGTTGGTCCCCTTGTTCAGGCTTGCATATTTTAAACT AAAAATTTCAGTCTATTGTTTTTAGTAACTTCATTTATAGTCCTCCATAACAAGTTAGAAGGATGTATCT GCTACCATTTATTCCTATAATTTTAGAAAGTTGGGGCTTGACATTATACTCATTTAGTGAGAGTAGATGC AAAAAAGTGGAGGGGCAGGAGAACTTCTCCAGACACCTCAGATAAAGTCCGGAGCCCAAGGCTTTATCTT AACCATGTATGGTACCCCATTCATTCATCAAGAAAACCCTCAACAGCTGGGCCTGCATGGAGTGTTATAT TTCAAGGTTTTTCACAGGGGTTACAGTAGGACAGTCCCCACCCCAATCAGGCACCAGGATAAAAGCAGGG ACTTAAACAGCACCCCGGTTCTTCAGCCTGAGCCATCACATGCTATCAGTCTCCTAACCTCCCCCTGGGC CTTAAGACAGGGCTTGGGCAGAGAAGATAAATGGTGGGACAAAAAAATGAGTTACATTGCCACCTGAGAA ACCTCAGAGGGGAGGACCCAGCCTTAGCCTCCCTCCTCCCAAGTGCAAAATGTGTAAACAGAGTAAACGG AACAGAAAAGTGCAGTCTAAGTGGTTTTCTCTCCTGCCCCTCCCACCGCCCCTCCCCCCACCCCCTATTA TTTGGGGATAAAGAATATAAAGACAACCCTGGCTTTTCTATTGCCTTGTTGCTTGCTGAATATAAGGAAT GGGGTGGGGCAGGAAGGGGCTTGCCCTTAGCCACAGCTCTACGGCTGTGCCTCATTCATTTCCACAGCTG CCAGTGTCCCTAGAGTTTATCAGGTGAATTGGTCAGGGGATCAGTCTCCCTCGAGCCTGACTTACGGCTG GGACAGCCCCATCTTTCTGTTGATTATGTGGCGCATATATATATATATATGTATATATATATAATTTATA TAAATATTTCTCTATGTA

[0056] NM_001128912.2 Homo sapiens poly(rC) binding protein 2 (PCBP2), transcript variant 5, mRNA (SEQ ID NO: 15) CCCAGACCAGCAGAGGCAGCAGCCGGAGCAGCCGCAGCCTGCGCCCTCTCCCGCCCGCCCGCCCTCCGCC CGCCCGCCCGCCCTCCGCCGCCCTCCACCCGCCCCGGGGTCTCTTTCCCCCTTCCTCCTCCTCCTCCTCC ACCCCCCCTTCCTCCTCCGCCCGCCCGCGGGGCCCCCCTCGCCTTCCCGCCCGCCCCTATTGTTCCGCCC CCGGCCTCCCGCCCTTCCCCTTCCCGCCCGCTCCCCTTTTCCCCTCAGTCGCCTCGCGCCTGCAGTTTTT GGCTTTCACCCCCAACCAGTGACCAAAGACTTGACCACTCAAAGTCCAGCTCCCCAGAACACTGCTCGAC ATGGACACCGGTGTGATTGAAGGTGGATTAAATGTCACTCTCACCATCCGGCTACTTATGCATGGAAAGG AAGTTGGCAGTATCATCGGAAAGAAAGGAGAATCAGTTAAGAAGATGCGCGAGGAGAGTGGTGCACGTAT CAACATCTCAGAAGGGAATTGTCCTGAGAGAATTATCACTTTGGCTGGACCCACTAATGCCATCTTCAAA GCCTTTGCTATGATCATTGACAAACTGGAAGAGGACATAAGCAGCTCTATGACCAATAGCACAGCTGCCA GTAGACCCCCGGTCACCCTGAGGCTGGTGGTCCCTGCTAGTCAGTGTGGCTCTCTCATTGGAAAAGGTGG ATGCAAGATCAAGGAAATACGAGAGAGTACAGGGGCTCAGGTCCAGGTGGCAGGGGATATGCTACCCAAC TCAACTGAGCGGGCCATCACTATTGCTGGCATTCCACAATCCATCATTGAGTGTGTCAAACAGATCTGCG TGGTCATGTTGGAGTCCCCCCCGAAGGGCGTGACCATCCCGTACCGGCCCAAGCCGTCCAGCTCTCCGGT CATCTTTGCAGGTGGTCAGGACAGGTACAGCACAGGCAGCGACAGTGCGAGCTTTCCCCACACCACCCCG TCCATGTGCCTCAACCCTGACCTGGAGGGACCACCTCTAGAGGCCTATACCATTCAAGGACAGTATGCCA TTCCACAGCCAGATTTGACCAAGCTGCACCAGTTGGCAATGCAACAGTCTCATTTTCCCATGACGCATGG CAACACCGGATTCAGTGGCATTGAATCCAGCTCTCCAGAGGTGAAAGGCTATTGGGGTTTGGATGCATCT GCTCAGACTACTTCTCATGAACTCACCATTCCAAACGATTTGATTGGCTGCATAATCGGGCGTCAAGGCG CCAAAATCAATGAGATCCGTCAGATGTCTGGGGCGCAGATCAAAATTGCGAACCCAGTGGAAGGATCTAC TGATAGGCAGGTTACCATCACTGGATCTGCTGCCAGCATTAGCCTGGCTCAATATCTAATCAATGTCAGG CTTTCCTCGGAGACGGGTGGCATGGGGAGCAGCTAGAACAATGCAGATTCATCCATAATCCCTTTCTGCT -19- 4856-7271-5486.1Atty. Dkt. No.: 115872-3074 GTTCACCACCACCCATGATCCATCTGTGTAGTTTCTGAACAGTCAGCGATTCCAGGTTTTAAATAGTTTG TAAATTTTCAGTTTCTACACACTTTATCATCCACTCGTGATTTTTTAATTAAAGCGTTTTAATTCCTTTC TCTGTTCAGCTGTTGATGCTGAGATCCATATTTAGTTTTATAAGCTTCTCCCTGGTTTTTTTTTTTTGGC TCATGAATTTTTCTGTTTGTCATGGAAATGTAAGAGTGGAATATTAATACATTTCAGTTTAGTTCTGTAA TGTCAGGAATTTTTCAAAAAAATTAAAAGATGGACTGGAGCTTTTTCTTTGTGAATAGAAACTGGATGCC ACAGTGATTCATGTGGGTTTTATTCCTCTTGTCTTGCTGTTATTTTTGTACCTTTTATCCCTCAAAGGAC CCTTCTTGGGTTTTGAATGGAAGCCTTTATTCCGGTTAAGATGTTTTCTTCTATTTTACCACTTCCATCT TTTTTTGTGGCCCTCGATCCTATTTTTCCCTGACTCCATGCTTGGTTGGCCCTTATAAAACTTGTGCCCA AAAGATTGAGGATTAGACTTTCCGAGGACTTACCTGTCCTAGGGGAGTAGGCAAGCACTTCCACTAGGGA GGGGGTGGGGGAAAGGAATGACACATGACATACATGGCATACACATTAAGCAGTTGATCATATGTCTGAC TGGGTTCCAGTTTCTTGGGAATGTTGGTCCCCTTGTTCAGGCTTGCATATTTTAAACTAAAAATTTCAGT CTATTGTTTTTAGTAACTTCATTTATAGTCCTCCATAACAAGTTAGAAGGATGTATCTGCTACCATTTAT TCCTATAATTTTAGAAAGTTGGGGCTTGACATTATACTCATTTAGTGAGAGTAGATGCAAAAAAGTGGAG GGGCAGGAGAACTTCTCCAGACACCTCAGATAAAGTCCGGAGCCCAAGGCTTTATCTTAACCATGTATGG TACCCCATTCATTCATCAAGAAAACCCTCAACAGCTGGGCCTGCATGGAGTGTTATATTTCAAGGTTTTT CACAGGGGTTACAGTAGGACAGTCCCCACCCCAATCAGGCACCAGGATAAAAGCAGGGACTTAAACAGCA CCCCGGTTCTTCAGCCTGAGCCATCACATGCTATCAGTCTCCTAACCTCCCCCTGGGCCTTAAGACAGGG CTTGGGCAGAGAAGATAAATGGTGGGACAAAAAAATGAGTTACATTGCCACCTGAGAAACCTCAGAGGGG AGGACCCAGCCTTAGCCTCCCTCCTCCCAAGTGCAAAATGTGTAAACAGAGTAAACGGAACAGAAAAGTG CAGTCTAAGTGGTTTTCTCTCCTGCCCCTCCCACCGCCCCTCCCCCCACCCCCTATTATTTGGGGATAAA GAATATAAAGACAACCCTGGCTTTTCTATTGCCTTGTTGCTTGCTGAATATAAGGAATGGGGTGGGGCAG GAAGGGGCTTGCCCTTAGCCACAGCTCTACGGCTGTGCCTCATTCATTTCCACAGCTGCCAGTGTCCCTA GAGTTTATCAGGTGAATTGGTCAGGGGATCAGTCTCCCTCGAGCCTGACTTACGGCTGGGACAGCCCCAT CTTTCTGTTGATTATGTGGCGCATATATATATATATATGTATATATATATAATTTATATAAATATTTCTC TATGTA

[0057] NM_001128913.2 Homo sapiens poly(rC) binding protein 2 (PCBP2), transcript variant 6, mRNA (SEQ ID NO: 16) CCCAGACCAGCAGAGGCAGCAGCCGGAGCAGCCGCAGCCTGCGCCCTCTCCCGCCCGCCCGCCCTCCGCC CGCCCGCCCGCCCTCCGCCGCCCTCCACCCGCCCCGGGGTCTCTTTCCCCCTTCCTCCTCCTCCTCCTCC ACCCCCCCTTCCTCCTCCGCCCGCCCGCGGGGCCCCCCTCGCCTTCCCGCCCGCCCCTATTGTTCCGCCC CCGGCCTCCCGCCCTTCCCCTTCCCGCCCGCTCCCCTTTTCCCCTCAGTCGCCTCGCGCCTGCAGTTTTT GGCTTTCACCCCCAACCAGTGACCAAAGACTTGACCACTCAAAGTCCAGCTCCCCAGAACACTGCTCGAC ATGGACACCGGTGTGATTGAAGGTGGATTAAATGTCACTCTCACCATCCGGCTACTTATGCATGGAAAGG AAGTTGGCAGTATCATCGGAAAGAAAGGAGAATCAGTTAAGAAGATGCGCGAGGAGAGTGGTGCACGTAT CAACATCTCAGAAGGGAATTGTCCTGAGAGAATTATCACTTTGGCTGGACCCACTAATGCCATCTTCAAA GCCTTTGCTATGATCATTGACAAACTGGAAGAGGACATAAGCAGCTCTATGACCAATAGCACAGCTGCCA GTAGACCCCCGGTCACCCTGAGGCTGGTGGTCCCTGCTAGTCAGTGTGGCTCTCTCATTGGAAAAGGTGG ATGCAAGATCAAGGAAATACGAGAGAGTACAGGGGCTCAGGTCCAGGTGGCAGGGGATATGCTACCCAAC TCAACTGAGCGGGCCATCACTATTGCTGGCATTCCACAATCCATCATTGAGTGTGTCAAACAGATCTGCG TGGTCATGTTGGAGACTCTCTCCCAGTCCCCCCCGAAGGGCGTGACCATCCCGTACCGGCCCAAGCCGTC CAGCTCTCCGGTCATCTTTGCAGGTGGTCAGGCCTATACCATTCAAGGACAGTATGCCATTCCACAGCCA GATTTGACCAAGCTGCACCAGTTGGCAATGCAACAGTCTCATTTTCCCATGACGCATGGCAACACCGGAT TCAGTGGCATTGAATCCAGCTCTCCAGAGGTGAAAGGCTATTGGGCAGGTTTGGATGCATCTGCTCAGAC TACTTCTCATGAACTCACCATTCCAAACGATTTGATTGGCTGCATAATCGGGCGTCAAGGCGCCAAAATC AATGAGATCCGTCAGATGTCTGGGGCGCAGATCAAAATTGCGAACCCAGTGGAAGGATCTACTGATAGGC AGGTTACCATCACTGGATCTGCTGCCAGCATTAGCCTGGCTCAATATCTAATCAATGTCAGGCTTTCCTC GGAGACGGGTGGCATGGGGAGCAGCTAGAACAATGCAGATTCATCCATAATCCCTTTCTGCTGTTCACCA CCACCCATGATCCATCTGTGTAGTTTCTGAACAGTCAGCGATTCCAGGTTTTAAATAGTTTGTAAATTTT CAGTTTCTACACACTTTATCATCCACTCGTGATTTTTTAATTAAAGCGTTTTAATTCCTTTCTCTGTTCA GCTGTTGATGCTGAGATCCATATTTAGTTTTATAAGCTTCTCCCTGGTTTTTTTTTTTTGGCTCATGAAT TTTTCTGTTTGTCATGGAAATGTAAGAGTGGAATATTAATACATTTCAGTTTAGTTCTGTAATGTCAGGA ATTTTTCAAAAAAATTAAAAGATGGACTGGAGCTTTTTCTTTGTGAATAGAAACTGGATGCCACAGTGAT TCATGTGGGTTTTATTCCTCTTGTCTTGCTGTTATTTTTGTACCTTTTATCCCTCAAAGGACCCTTCTTG GGTTTTGAATGGAAGCCTTTATTCCGGTTAAGATGTTTTCTTCTATTTTACCACTTCCATCTTTTTTTGT GGCCCTCGATCCTATTTTTCCCTGACTCCATGCTTGGTTGGCCCTTATAAAACTTGTGCCCAAAAGATTG -20- 4856-7271-5486.1Atty. Dkt. No.: 115872-3074 AGGATTAGACTTTCCGAGGACTTACCTGTCCTAGGGGAGTAGGCAAGCACTTCCACTAGGGAGGGGGTGG GGGAAAGGAATGACACATGACATACATGGCATACACATTAAGCAGTTGATCATATGTCTGACTGGGTTCC AGTTTCTTGGGAATGTTGGTCCCCTTGTTCAGGCTTGCATATTTTAAACTAAAAATTTCAGTCTATTGTT TTTAGTAACTTCATTTATAGTCCTCCATAACAAGTTAGAAGGATGTATCTGCTACCATTTATTCCTATAA TTTTAGAAAGTTGGGGCTTGACATTATACTCATTTAGTGAGAGTAGATGCAAAAAAGTGGAGGGGCAGGA GAACTTCTCCAGACACCTCAGATAAAGTCCGGAGCCCAAGGCTTTATCTTAACCATGTATGGTACCCCAT TCATTCATCAAGAAAACCCTCAACAGCTGGGCCTGCATGGAGTGTTATATTTCAAGGTTTTTCACAGGGG TTACAGTAGGACAGTCCCCACCCCAATCAGGCACCAGGATAAAAGCAGGGACTTAAACAGCACCCCGGTT CTTCAGCCTGAGCCATCACATGCTATCAGTCTCCTAACCTCCCCCTGGGCCTTAAGACAGGGCTTGGGCA GAGAAGATAAATGGTGGGACAAAAAAATGAGTTACATTGCCACCTGAGAAACCTCAGAGGGGAGGACCCA GCCTTAGCCTCCCTCCTCCCAAGTGCAAAATGTGTAAACAGAGTAAACGGAACAGAAAAGTGCAGTCTAA GTGGTTTTCTCTCCTGCCCCTCCCACCGCCCCTCCCCCCACCCCCTATTATTTGGGGATAAAGAATATAA AGACAACCCTGGCTTTTCTATTGCCTTGTTGCTTGCTGAATATAAGGAATGGGGTGGGGCAGGAAGGGGC TTGCCCTTAGCCACAGCTCTACGGCTGTGCCTCATTCATTTCCACAGCTGCCAGTGTCCCTAGAGTTTAT CAGGTGAATTGGTCAGGGGATCAGTCTCCCTCGAGCCTGACTTACGGCTGGGACAGCCCCATCTTTCTGT TGATTATGTGGCGCATATATATATATATATGTATATATATATAATTTATATAAATATTTCTCTATGTA

[0058] NM_001128914.2 Homo sapiens poly(rC) binding protein 2 (PCBP2), transcript variant 7, mRNA (SEQ ID NO: 17) CCCAGACCAGCAGAGGCAGCAGCCGGAGCAGCCGCAGCCTGCGCCCTCTCCCGCCCGCCCGCCCTCCGCC CGCCCGCCCGCCCTCCGCCGCCCTCCACCCGCCCCGGGGTCTCTTTCCCCCTTCCTCCTCCTCCTCCTCC ACCCCCCCTTCCTCCTCCGCCCGCCCGCGGGGCCCCCCTCGCCTTCCCGCCCGCCCCTATTGTTCCGCCC CCGGCCTCCCGCCCTTCCCCTTCCCGCCCGCTCCCCTTTTCCCCTCAGTCGCCTCGCGCCTGCAGTTTTT GGCTTTCACCCCCAACCAGTGACCAAAGACTTGACCACTCAAAGTCCAGCTCCCCAGAACACTGCTCGAC ATGGACACCGGTGTGATTGAAGGTGGATTAAATGTCACTCTCACCATCCGGCTACTTATGCATGGAAAGG AAGTTGGCAGTATCATCGGAAAGAAAGGAGAATCAGTTAAGAAGATGCGCGAGGAGAGTGGTGCACGTAT CAACATCTCAGAAGGGAATTGTCCTGAGAGAATTATCACTTTGGCTGGACCCACTAATGCCATCTTCAAA GCCTTTGCTATGATCATTGACAAACTGGAAGAGGACATAAGCAGCTCTATGACCAATAGCACAGCTGCCA GTAGACCCCCGGTCACCCTGAGGCTGGTGGTCCCTGCTAGTCAGTGTGGCTCTCTCATTGGAAAAGGTGG ATGCAAGATCAAGGAAATACGAGAGAGTACAGGGGCTCAGGTCCAGGTGGCAGGGGATATGCTACCCAAC TCAACTGAGCGGGCCATCACTATTGCTGGCATTCCACAATCCATCATTGAGTGTGTCAAACAGATCTGCG TGGTCATGTTGGAGTCCCCCCCGAAGGGCGTGACCATCCCGTACCGGCCCAAGCCGTCCAGCTCTCCGGT CATCTTTGCAGGTGGTCAGGCCTATACCATTCAAGGACAGTATGCCATTCCACAGCCAGATTTGACCAAG CTGCACCAGTTGGCAATGCAACAGTCTCATTTTCCCATGACGCATGGCAACACCGGATTCAGTGCAGGTT TGGATGCATCTGCTCAGACTACTTCTCATGAACTCACCATTCCAAACGATTTGATTGGCTGCATAATCGG GCGTCAAGGCGCCAAAATCAATGAGATCCGTCAGATGTCTGGGGCGCAGATCAAAATTGCGAACCCAGTG GAAGGATCTACTGATAGGCAGGTTACCATCACTGGATCTGCTGCCAGCATTAGCCTGGCTCAATATCTAA TCAATGTCAGGCTTTCCTCGGAGACGGGTGGCATGGGGAGCAGCTAGAACAATGCAGATTCATCCATAAT CCCTTTCTGCTGTTCACCACCACCCATGATCCATCTGTGTAGTTTCTGAACAGTCAGCGATTCCAGGTTT TAAATAGTTTGTAAATTTTCAGTTTCTACACACTTTATCATCCACTCGTGATTTTTTAATTAAAGCGTTT TAATTCCTTTCTCTGTTCAGCTGTTGATGCTGAGATCCATATTTAGTTTTATAAGCTTCTCCCTGGTTTT TTTTTTTTGGCTCATGAATTTTTCTGTTTGTCATGGAAATGTAAGAGTGGAATATTAATACATTTCAGTT TAGTTCTGTAATGTCAGGAATTTTTCAAAAAAATTAAAAGATGGACTGGAGCTTTTTCTTTGTGAATAGA AACTGGATGCCACAGTGATTCATGTGGGTTTTATTCCTCTTGTCTTGCTGTTATTTTTGTACCTTTTATC CCTCAAAGGACCCTTCTTGGGTTTTGAATGGAAGCCTTTATTCCGGTTAAGATGTTTTCTTCTATTTTAC CACTTCCATCTTTTTTTGTGGCCCTCGATCCTATTTTTCCCTGACTCCATGCTTGGTTGGCCCTTATAAA ACTTGTGCCCAAAAGATTGAGGATTAGACTTTCCGAGGACTTACCTGTCCTAGGGGAGTAGGCAAGCACT TCCACTAGGGAGGGGGTGGGGGAAAGGAATGACACATGACATACATGGCATACACATTAAGCAGTTGATC ATATGTCTGACTGGGTTCCAGTTTCTTGGGAATGTTGGTCCCCTTGTTCAGGCTTGCATATTTTAAACTA AAAATTTCAGTCTATTGTTTTTAGTAACTTCATTTATAGTCCTCCATAACAAGTTAGAAGGATGTATCTG CTACCATTTATTCCTATAATTTTAGAAAGTTGGGGCTTGACATTATACTCATTTAGTGAGAGTAGATGCA AAAAAGTGGAGGGGCAGGAGAACTTCTCCAGACACCTCAGATAAAGTCCGGAGCCCAAGGCTTTATCTTA ACCATGTATGGTACCCCATTCATTCATCAAGAAAACCCTCAACAGCTGGGCCTGCATGGAGTGTTATATT TCAAGGTTTTTCACAGGGGTTACAGTAGGACAGTCCCCACCCCAATCAGGCACCAGGATAAAAGCAGGGA CTTAAACAGCACCCCGGTTCTTCAGCCTGAGCCATCACATGCTATCAGTCTCCTAACCTCCCCCTGGGCC TTAAGACAGGGCTTGGGCAGAGAAGATAAATGGTGGGACAAAAAAATGAGTTACATTGCCACCTGAGAAA CCTCAGAGGGGAGGACCCAGCCTTAGCCTCCCTCCTCCCAAGTGCAAAATGTGTAAACAGAGTAAACGGA -21- 4856-7271-5486.1Atty. Dkt. No.: 115872-3074 ACAGAAAAGTGCAGTCTAAGTGGTTTTCTCTCCTGCCCCTCCCACCGCCCCTCCCCCCACCCCCTATTAT TTGGGGATAAAGAATATAAAGACAACCCTGGCTTTTCTATTGCCTTGTTGCTTGCTGAATATAAGGAATG GGGTGGGGCAGGAAGGGGCTTGCCCTTAGCCACAGCTCTACGGCTGTGCCTCATTCATTTCCACAGCTGC CAGTGTCCCTAGAGTTTATCAGGTGAATTGGTCAGGGGATCAGTCTCCCTCGAGCCTGACTTACGGCTGG GACAGCCCCATCTTTCTGTTGATTATGTGGCGCATATATATATATATATGTATATATATATAATTTATAT AAATATTTCTCTATGTA

[0059] NM_005016.6 Homo sapiens poly(rC) binding protein 2 (PCBP2), transcript variant 1, mRNA (SEQ ID NO: 18) CCCAGACCAGCAGAGGCAGCAGCCGGAGCAGCCGCAGCCTGCGCCCTCTCCCGCCCGCCCGCCCTCCGCC CGCCCGCCCGCCCTCCGCCGCCCTCCACCCGCCCCGGGGTCTCTTTCCCCCTTCCTCCTCCTCCTCCTCC ACCCCCCCTTCCTCCTCCGCCCGCCCGCGGGGCCCCCCTCGCCTTCCCGCCCGCCCCTATTGTTCCGCCC CCGGCCTCCCGCCCTTCCCCTTCCCGCCCGCTCCCCTTTTCCCCTCAGTCGCCTCGCGCCTGCAGTTTTT GGCTTTCACCCCCAACCAGTGACCAAAGACTTGACCACTCAAAGTCCAGCTCCCCAGAACACTGCTCGAC ATGGACACCGGTGTGATTGAAGGTGGATTAAATGTCACTCTCACCATCCGGCTACTTATGCATGGAAAGG AAGTTGGCAGTATCATCGGAAAGAAAGGAGAATCAGTTAAGAAGATGCGCGAGGAGAGTGGTGCACGTAT CAACATCTCAGAAGGGAATTGTCCTGAGAGAATTATCACTTTGGCTGGACCCACTAATGCCATCTTCAAA GCCTTTGCTATGATCATTGACAAACTGGAAGAGGACATAAGCAGCTCTATGACCAATAGCACAGCTGCCA GTAGACCCCCGGTCACCCTGAGGCTGGTGGTCCCTGCTAGTCAGTGTGGCTCTCTCATTGGAAAAGGTGG ATGCAAGATCAAGGAAATACGAGAGAGTACAGGGGCTCAGGTCCAGGTGGCAGGGGATATGCTACCCAAC TCAACTGAGCGGGCCATCACTATTGCTGGCATTCCACAATCCATCATTGAGTGTGTCAAACAGATCTGCG TGGTCATGTTGGAGACTCTCTCCCAGTCCCCCCCGAAGGGCGTGACCATCCCGTACCGGCCCAAGCCGTC CAGCTCTCCGGTCATCTTTGCAGGTGGTCAGGACAGGTACAGCACAGGCAGCGACAGTGCGAGCTTTCCC CACACCACCCCGTCCATGTGCCTCAACCCTGACCTGGAGGGACCACCTCTAGAGGCCTATACCATTCAAG GACAGTATGCCATTCCACAGCCAGATTTGACCAAGCTGCACCAGTTGGCAATGCAACAGTCTCATTTTCC CATGACGCATGGCAACACCGGATTCAGTGGCATTGAATCCAGCTCTCCAGAGGTGAAAGGCTATTGGGCA GGTTTGGATGCATCTGCTCAGACTACTTCTCATGAACTCACCATTCCAAACGATTTGATTGGCTGCATAA TCGGGCGTCAAGGCGCCAAAATCAATGAGATCCGTCAGATGTCTGGGGCGCAGATCAAAATTGCGAACCC AGTGGAAGGATCTACTGATAGGCAGGTTACCATCACTGGATCTGCTGCCAGCATTAGCCTGGCTCAATAT CTAATCAATGTCAGGCTTTCCTCGGAGACGGGTGGCATGGGGAGCAGCTAGAACAATGCAGATTCATCCA TAATCCCTTTCTGCTGTTCACCACCACCCATGATCCATCTGTGTAGTTTCTGAACAGTCAGCGATTCCAG GTTTTAAATAGTTTGTAAATTTTCAGTTTCTACACACTTTATCATCCACTCGTGATTTTTTAATTAAAGC GTTTTAATTCCTTTCTCTGTTCAGCTGTTGATGCTGAGATCCATATTTAGTTTTATAAGCTTCTCCCTGG TTTTTTTTTTTTGGCTCATGAATTTTTCTGTTTGTCATGGAAATGTAAGAGTGGAATATTAATACATTTC AGTTTAGTTCTGTAATGTCAGGAATTTTTCAAAAAAATTAAAAGATGGACTGGAGCTTTTTCTTTGTGAA TAGAAACTGGATGCCACAGTGATTCATGTGGGTTTTATTCCTCTTGTCTTGCTGTTATTTTTGTACCTTT TATCCCTCAAAGGACCCTTCTTGGGTTTTGAATGGAAGCCTTTATTCCGGTTAAGATGTTTTCTTCTATT TTACCACTTCCATCTTTTTTTGTGGCCCTCGATCCTATTTTTCCCTGACTCCATGCTTGGTTGGCCCTTA TAAAACTTGTGCCCAAAAGATTGAGGATTAGACTTTCCGAGGACTTACCTGTCCTAGGGGAGTAGGCAAG CACTTCCACTAGGGAGGGGGTGGGGGAAAGGAATGACACATGACATACATGGCATACACATTAAGCAGTT GATCATATGTCTGACTGGGTTCCAGTTTCTTGGGAATGTTGGTCCCCTTGTTCAGGCTTGCATATTTTAA ACTAAAAATTTCAGTCTATTGTTTTTAGTAACTTCATTTATAGTCCTCCATAACAAGTTAGAAGGATGTA TCTGCTACCATTTATTCCTATAATTTTAGAAAGTTGGGGCTTGACATTATACTCATTTAGTGAGAGTAGA TGCAAAAAAGTGGAGGGGCAGGAGAACTTCTCCAGACACCTCAGATAAAGTCCGGAGCCCAAGGCTTTAT CTTAACCATGTATGGTACCCCATTCATTCATCAAGAAAACCCTCAACAGCTGGGCCTGCATGGAGTGTTA TATTTCAAGGTTTTTCACAGGGGTTACAGTAGGACAGTCCCCACCCCAATCAGGCACCAGGATAAAAGCA GGGACTTAAACAGCACCCCGGTTCTTCAGCCTGAGCCATCACATGCTATCAGTCTCCTAACCTCCCCCTG GGCCTTAAGACAGGGCTTGGGCAGAGAAGATAAATGGTGGGACAAAAAAATGAGTTACATTGCCACCTGA GAAACCTCAGAGGGGAGGACCCAGCCTTAGCCTCCCTCCTCCCAAGTGCAAAATGTGTAAACAGAGTAAA CGGAACAGAAAAGTGCAGTCTAAGTGGTTTTCTCTCCTGCCCCTCCCACCGCCCCTCCCCCCACCCCCTA TTATTTGGGGATAAAGAATATAAAGACAACCCTGGCTTTTCTATTGCCTTGTTGCTTGCTGAATATAAGG AATGGGGTGGGGCAGGAAGGGGCTTGCCCTTAGCCACAGCTCTACGGCTGTGCCTCATTCATTTCCACAG CTGCCAGTGTCCCTAGAGTTTATCAGGTGAATTGGTCAGGGGATCAGTCTCCCTCGAGCCTGACTTACGG CTGGGACAGCCCCATCTTTCTGTTGATTATGTGGCGCATATATATATATATATGTATATATATATAATTT ATATAAATATTTCTCTATGTA -22- 4856-7271-5486.1Atty. Dkt. No.: 115872-3074

[0060] NM_031989.5 Homo sapiens poly(rC) binding protein 2 (PCBP2), transcript variant 2, mRNA (SEQ ID NO: 19) CCCAGACCAGCAGAGGCAGCAGCCGGAGCAGCCGCAGCCTGCGCCCTCTCCCGCCCGCCCGCCCTCCGCC CGCCCGCCCGCCCTCCGCCGCCCTCCACCCGCCCCGGGGTCTCTTTCCCCCTTCCTCCTCCTCCTCCTCC ACCCCCCCTTCCTCCTCCGCCCGCCCGCGGGGCCCCCCTCGCCTTCCCGCCCGCCCCTATTGTTCCGCCC CCGGCCTCCCGCCCTTCCCCTTCCCGCCCGCTCCCCTTTTCCCCTCAGTCGCCTCGCGCCTGCAGTTTTT GGCTTTCACCCCCAACCAGTGACCAAAGACTTGACCACTCAAAGTCCAGCTCCCCAGAACACTGCTCGAC ATGGACACCGGTGTGATTGAAGGTGGATTAAATGTCACTCTCACCATCCGGCTACTTATGCATGGAAAGG AAGTTGGCAGTATCATCGGAAAGAAAGGAGAATCAGTTAAGAAGATGCGCGAGGAGAGTGGTGCACGTAT CAACATCTCAGAAGGGAATTGTCCTGAGAGAATTATCACTTTGGCTGGACCCACTAATGCCATCTTCAAA GCCTTTGCTATGATCATTGACAAACTGGAAGAGGACATAAGCAGCTCTATGACCAATAGCACAGCTGCCA GTAGACCCCCGGTCACCCTGAGGCTGGTGGTCCCTGCTAGTCAGTGTGGCTCTCTCATTGGAAAAGGTGG ATGCAAGATCAAGGAAATACGAGAGAGTACAGGGGCTCAGGTCCAGGTGGCAGGGGATATGCTACCCAAC TCAACTGAGCGGGCCATCACTATTGCTGGCATTCCACAATCCATCATTGAGTGTGTCAAACAGATCTGCG TGGTCATGTTGGAGTCCCCCCCGAAGGGCGTGACCATCCCGTACCGGCCCAAGCCGTCCAGCTCTCCGGT CATCTTTGCAGGTGGTCAGGACAGGTACAGCACAGGCAGCGACAGTGCGAGCTTTCCCCACACCACCCCG TCCATGTGCCTCAACCCTGACCTGGAGGGACCACCTCTAGAGGCCTATACCATTCAAGGACAGTATGCCA TTCCACAGCCAGATTTGACCAAGCTGCACCAGTTGGCAATGCAACAGTCTCATTTTCCCATGACGCATGG CAACACCGGATTCAGTGGCATTGAATCCAGCTCTCCAGAGGTGAAAGGCTATTGGGCAGGTTTGGATGCA TCTGCTCAGACTACTTCTCATGAACTCACCATTCCAAACGATTTGATTGGCTGCATAATCGGGCGTCAAG GCGCCAAAATCAATGAGATCCGTCAGATGTCTGGGGCGCAGATCAAAATTGCGAACCCAGTGGAAGGATC TACTGATAGGCAGGTTACCATCACTGGATCTGCTGCCAGCATTAGCCTGGCTCAATATCTAATCAATGTC AGGCTTTCCTCGGAGACGGGTGGCATGGGGAGCAGCTAGAACAATGCAGATTCATCCATAATCCCTTTCT GCTGTTCACCACCACCCATGATCCATCTGTGTAGTTTCTGAACAGTCAGCGATTCCAGGTTTTAAATAGT TTGTAAATTTTCAGTTTCTACACACTTTATCATCCACTCGTGATTTTTTAATTAAAGCGTTTTAATTCCT TTCTCTGTTCAGCTGTTGATGCTGAGATCCATATTTAGTTTTATAAGCTTCTCCCTGGTTTTTTTTTTTT GGCTCATGAATTTTTCTGTTTGTCATGGAAATGTAAGAGTGGAATATTAATACATTTCAGTTTAGTTCTG TAATGTCAGGAATTTTTCAAAAAAATTAAAAGATGGACTGGAGCTTTTTCTTTGTGAATAGAAACTGGAT GCCACAGTGATTCATGTGGGTTTTATTCCTCTTGTCTTGCTGTTATTTTTGTACCTTTTATCCCTCAAAG GACCCTTCTTGGGTTTTGAATGGAAGCCTTTATTCCGGTTAAGATGTTTTCTTCTATTTTACCACTTCCA TCTTTTTTTGTGGCCCTCGATCCTATTTTTCCCTGACTCCATGCTTGGTTGGCCCTTATAAAACTTGTGC CCAAAAGATTGAGGATTAGACTTTCCGAGGACTTACCTGTCCTAGGGGAGTAGGCAAGCACTTCCACTAG GGAGGGGGTGGGGGAAAGGAATGACACATGACATACATGGCATACACATTAAGCAGTTGATCATATGTCT GACTGGGTTCCAGTTTCTTGGGAATGTTGGTCCCCTTGTTCAGGCTTGCATATTTTAAACTAAAAATTTC AGTCTATTGTTTTTAGTAACTTCATTTATAGTCCTCCATAACAAGTTAGAAGGATGTATCTGCTACCATT TATTCCTATAATTTTAGAAAGTTGGGGCTTGACATTATACTCATTTAGTGAGAGTAGATGCAAAAAAGTG GAGGGGCAGGAGAACTTCTCCAGACACCTCAGATAAAGTCCGGAGCCCAAGGCTTTATCTTAACCATGTA TGGTACCCCATTCATTCATCAAGAAAACCCTCAACAGCTGGGCCTGCATGGAGTGTTATATTTCAAGGTT TTTCACAGGGGTTACAGTAGGACAGTCCCCACCCCAATCAGGCACCAGGATAAAAGCAGGGACTTAAACA GCACCCCGGTTCTTCAGCCTGAGCCATCACATGCTATCAGTCTCCTAACCTCCCCCTGGGCCTTAAGACA GGGCTTGGGCAGAGAAGATAAATGGTGGGACAAAAAAATGAGTTACATTGCCACCTGAGAAACCTCAGAG GGGAGGACCCAGCCTTAGCCTCCCTCCTCCCAAGTGCAAAATGTGTAAACAGAGTAAACGGAACAGAAAA GTGCAGTCTAAGTGGTTTTCTCTCCTGCCCCTCCCACCGCCCCTCCCCCCACCCCCTATTATTTGGGGAT AAAGAATATAAAGACAACCCTGGCTTTTCTATTGCCTTGTTGCTTGCTGAATATAAGGAATGGGGTGGGG CAGGAAGGGGCTTGCCCTTAGCCACAGCTCTACGGCTGTGCCTCATTCATTTCCACAGCTGCCAGTGTCC CTAGAGTTTATCAGGTGAATTGGTCAGGGGATCAGTCTCCCTCGAGCCTGACTTACGGCTGGGACAGCCC CATCTTTCTGTTGATTATGTGGCGCATATATATATATATATGTATATATATATAATTTATATAAATATTT CTCTATGTA

[0061] In one aspect, the present disclosure provides PCBP2-specific inhibitory nucleic acids comprising a nucleic acid molecule, which is complementary to a portion of a PCBP2 nucleic acid sequence selected from the group consisting of SEQ ID NOs: 13-19. -23- 4856-7271-5486.1Atty. Dkt. No.: 115872-3074

[0062] The present disclosure also provides an antisense nucleic acid comprising a nucleic acid sequence that is complementary to and specifically hybridizes with a portion of any one of SEQ ID NOs: 13-19 (PCBP2 mRNA), thereby reducing or inhibiting expression of PCBP2. The antisense nucleic acid may be antisense RNA, or antisense DNA. Antisense nucleic acids based on the known PCBP2 gene sequence can be readily designed and engineered using methods known in the art. In some embodiments, the antisense nucleic acid comprises a nucleic acid sequence that binds to exon 8 of any one of SEQ ID NOs: 13-19 or a complement thereof.

[0063] Antisense nucleic acids are molecules which are complementary to a sense nucleic acid strand, e.g., complementary to the coding strand of a double-stranded DNA molecule (or cDNA) or complementary to an mRNA sequence. Accordingly, an antisense nucleic acid can form hydrogen bonds with a sense nucleic acid. The antisense nucleic acid can be complementary to an entire PCBP2 coding strand, or to a portion thereof, e.g., all or part of the protein coding region (or open reading frame). In some embodiments, the antisense nucleic acid is an oligonucleotide which is complementary to only a portion of the mRNA coding region of PCBP2. In certain embodiments, an antisense nucleic acid molecule can be complementary to a noncoding region of the PCBP2 coding strand. In some embodiments, the noncoding region refers to the 5′ and 3′ untranslated regions that flank the coding region and are not translated into amino acids. For example, the antisense oligonucleotide can be complementary to the region surrounding the translation start site of PCBP2. An antisense oligonucleotide can be, for example, about 5, 10, 15, 20, 25, 30, 35, 40, 45 or 50 nucleotides in length.

[0064] An antisense nucleic acid can be constructed using chemical synthesis and enzymatic ligation reactions using procedures known in the art. For example, an antisense nucleic acid (e.g., an antisense oligonucleotide) can be chemically synthesized using naturally occurring nucleotides or modified nucleotides designed to increase the biological stability of the molecules or to increase the physical stability of the duplex formed between the antisense and sense nucleic acids, e.g., phosphorothioate derivatives and acridine substituted nucleotides. Examples of modified nucleotides which can be used to generate the antisense nucleic acid include 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5- hodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 5-(carboxyhydroxylmethyl)uracil, 5- carboxymethylaminomethyl-2-thouridine, 5-carboxymethylaminometh-yluracil, -24- 4856-7271-5486.1Atty. Dkt. No.: 115872-3074 dihydrouracil, beta-D-galactosylqueosine, inosine, N6-isopentenyladenine, 1- methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-metnylcytosine, N6-adenine, 7-methylguanine, 5- methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, beta-D-mannosylqueosine, 5′-methoxycarboxymethyluracil, 5-methoxyuracil, 2-methylthio-N6-isopenten-yladenine, uracil-5-oxyacetic acid (v), wybutosine, pseudouracil, queosine, 2-thiocytosine, 5-methyl-2- thiouracil, 2-thlouracil, 4-thiouracil, 5-methyluracil, uracil-5-oxyacetic acid methylester, uracil-5-cxyacetic acid (v), 5-methyl-2-thiouracil, 3-(3-amino-3-N-2-carboxypropyl) uracil, (acp3)w, and 2,6-diaminopurine. Alternatively, the antisense nucleic acid can be produced biologically using an expression vector into which a nucleic acid has been subcloned in an antisense orientation (i.e., RNA transcribed from the inserted nucleic acid will be of an antisense orientation to a target nucleic acid of interest).

[0065] The antisense nucleic acid molecules may be administered to a subject or generated in situ such that they hybridize with or bind to cellular mRNA and / or genomic DNA encoding the protein of interest to thereby inhibit expression of the protein, e.g., by inhibiting transcription and / or translation. The hybridization can occur via Watson-Crick base pairing to form a stable duplex, or in the case of an antisense nucleic acid molecule which binds to DNA duplexes, through specific interactions in the major groove of the double helix.

[0066] In some embodiments, the antisense nucleic acid molecules are modified such that they specifically bind to receptors or antigens expressed on a selected cell surface, e.g., by linking the antisense nucleic acid molecules to peptides or antibodies which bind to cell surface receptors or antigens. In some embodiments, the antisense nucleic acid molecule is an alpha-anomeric nucleic acid molecule. An alpha-anomeric nucleic acid molecule forms specific double-stranded hybrids with complementary RNA in which, contrary to the usual β-units, the strands run parallel to each other (Gaultier et al., Nucleic Acids. Res.15:6625- 6641(1987)). The antisense nucleic acid molecule can also comprise a 2′-O - methylribonucleotide (Inoue et al., Nucleic Acids Res.15:6131-6148 (1987)) or a chimeric RNA-DNA analogue (Inoue et al., FEBS Lett.215:327-330 (1987)).

[0067] The present disclosure also provides a short hairpin RNA (shRNA) or small interfering RNA (siRNA) comprising a nucleic acid sequence that is complementary to and specifically hybridizes with a portion of any one of SEQ ID NOs: 13-19 (mRNA of -25- 4856-7271-5486.1Atty. Dkt. No.: 115872-3074 PCBP2), thereby reducing or inhibiting expression of PCBP2. In some embodiments, the shRNA or siRNA is about 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28 or 29 base pairs in length. Double-stranded RNA (dsRNA) can induce sequence-specific post-transcriptional gene silencing (e.g., RNA interference (RNAi)) in many organisms such as C. elegans, Drosophila, plants, mammals, oocytes and early embryos. RNAi is a process that interferes with or significantly reduces the number of protein copies made by an mRNA. For example, a double-stranded siRNA or shRNA molecule is engineered to complement and hybridize to a mRNA of a target gene. Following intracellular delivery, the siRNA or shRNA molecule associates with an RNA-induced silencing complex (RISC), which then binds and degrades a complementary target mRNA (such as mRNA of PCBP2). In some embodiments, the shRNA or siRNA comprises a nucleic acid sequence that binds to exon 8 of any one of SEQ ID NOs: 13-19 or a complement thereof.

[0068] The present disclosure also provides a ribozyme comprising a nucleic acid sequence that is complementary to and specifically hybridizes with a portion of any one of SEQ ID NOs: 13-19 (PCBP2 mRNA), thereby reducing or inhibiting expression of PCBP2. Ribozymes are catalytic RNA molecules with ribonuclease activity which are capable of cleaving a complementary single-stranded nucleic acid, such as an mRNA. Thus, ribozymes (e.g., hammerhead ribozymes (described in Haselhoff and Gerlach, Nature 334:585-591 (1988))) can be used to catalytically cleave PCBP2 transcripts, thereby inhibiting translation of PCBP2.

[0069] A ribozyme having specificity for a nucleic acid encoding PCBP2 can be designed based upon a nucleic acid sequence of PCBP2. For example, a derivative of a Tetrahymena L-19 IVS RNA can be constructed in which the nucleotide sequence of the active site is complementary to the nucleotide sequence to be cleaved in a mRNA encoding PCBP2. See, e.g., U.S. Pat. No.4,987,071 and U.S. Pat. No.5,116,742. Alternatively, mRNA of a PCBP2 can be used to select a catalytic RNA having a specific ribonuclease activity from a pool of RNA molecules. See, e.g., Bartel and Szostak (1993) Science 261:1411-1418, incorporated herein by reference.

[0070] The present disclosure also provides a synthetic guide RNA (sgRNA) comprising a nucleic acid sequence that is complementary to and specifically hybridizes with a portion of any one of SEQ ID NOs: 13-19 (mRNA of PCBP2). Guide RNAs for use in CRISPR-Cas systems are typically generated as a single guide RNA comprising a crRNA -26- 4856-7271-5486.1Atty. Dkt. No.: 115872-3074 segment and a tracrRNA segment. The crRNA segment and a tracrRNA segment can also be generated as separate RNA molecules. The crRNA segment comprises the targeting sequence that binds to a portion of any one of SEQ ID NOs: 13-19, and a stem portion that hybridizes to a tracrRNA. The tracrRNA segment comprises a nucleotide sequence that is partially or completely complementary to the stem sequence of the crRNA and a nucleotide sequence that binds to the CRISPR enzyme. In some embodiments, the crRNA segment and the tracrRNA segment are provided as a single guide RNA. In some embodiments, the crRNA segment and the tracrRNA segment are provided as separate RNAs. The combination of the CRISPR enzyme with the crRNA and tracrRNA make up a functional CRISPR-Cas system. Exemplary CRISPR-Cas systems for targeting nucleic acids, are described, for example, in WO2015 / 089465.

[0071] In some embodiments, a synthetic guide RNA is a single RNA represented as comprising the following elements: 5ʹ-X1-X2-Y-Z-3ʹ

[0072] where X1 and X2 represent the crRNA segment, where X1 is the targeting sequence that binds to a portion of any one of SEQ ID NOs: 13-19, X2 is a stem sequence the hybridizes to a tracrRNA, Z represents a tracrRNA segment comprising a nucleotide sequence that is partially or completely complementary to X2, and Y represents a linker sequence. In some embodiments, the linker sequence comprises two or more nucleotides and links the crRNA and tracrRNA segments. In some embodiments, the linker sequence comprises 2, 3, 4, 5, 6, 7, 8, 9, 10 or more nucleotides. In some embodiments, the linker is the loop of the hairpin structure formed when the stem sequence hybridized with the tracrRNA.

[0073] In some embodiments, a synthetic guide RNA is provided as two separate RNAs where one RNA represents a crRNA segment: 5ʹ-X1-X2-3ʹ where X1 is the targeting sequence that binds to a portion of any one of SEQ ID NOs: 13-19, X2 is a stem sequence the hybridizes to a tracrRNA, and one RNA represents a tracrRNA segment, Z, that is a separate RNA from the crRNA segment and comprises a nucleotide sequence that is partially or completely complementary to X2 of the crRNA.

[0074] Exemplary crRNA stem sequences and tracrRNA sequences are provided, for example, in WO / 2015 / 089465, which is incorporated by reference herein. In general, a -27- 4856-7271-5486.1Atty. Dkt. No.: 115872-3074 stem sequence includes any sequence that has sufficient complementarity with a complementary sequence in the tracrRNA to promote formation of a CRISPR complex at a target sequence, wherein the CRISPR complex comprises the stem sequence hybridized to the tracrRNA. In general, degree of complementarity is with reference to the optimal alignment of the stem and complementary sequence in the tracrRNA, along the length of the shorter of the two sequences. Optimal alignment may be determined by any suitable alignment algorithm, and may further account for secondary structures, such as self- complementarity within either the stem sequence or the complementary sequence in the tracrRNA. In some embodiments, the degree of complementarity between the stem sequence and the complementary sequence in the tracrRNA along the length of the shorter of the two when optimally aligned is about or more than about 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 97.5%, 99%, or higher. In some embodiments, the stem sequence is about or more than about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 40, 50, or more nucleotides in length. In some embodiments, the stem sequence and complementary sequence in the tracrRNA are contained within a single RNA, such that hybridization between the two produces a transcript having a secondary structure, such as a hairpin. In some embodiments, the tracrRNA has additional complementary sequences that form hairpins. In some embodiments, the tracrRNA has at least two or more hairpins. In some embodiments, the tracrRNA has two, three, four or five hairpins. In some embodiments, the tracrRNA has at most five hairpins.

[0075] In a hairpin structure, the portion of the sequence 5ʹ of the final “N” and upstream of the loop corresponds to the crRNA stem sequence, and the portion of the sequence 3ʹ of the loop corresponds to the tracrRNA sequence. Further non-limiting examples of single polynucleotides comprising a guide sequence, a stem sequence, and a tracr sequence are as follows (listed 5ʹ to 3ʹ), where “N” represents a base of a guide sequence (e.g. a modified oligonucleotide provided herein), the first block of lower case letters represent stem sequence, and the second block of lower case letters represent the tracrRNA sequence, and the final poly-T sequence represents the transcription terminator: (a) NNNNNNNNNNNNNNNNNNNNgtttttgtactctcaagatttaGAAAtaaatcttgcagaagctacaaagataa ggcttcatgccgaaatcaacaccctgtcattttatggcagggtgttttcgttatttaaTTTTTT (SEQ ID NO: 20); (b) NNNNNNNNNNNNNNNNNNNNgtttttgtactctcaGAAAtgcagaagctacaaagataaggcttcatgccg -28- 4856-7271-5486.1Atty. Dkt. No.: 115872-3074 aaatcaacaccctgtcattttatggcagggtgttttcgttatttaaTTTTTT (SEQ ID NO: 21); (c) NNNNNNNNNNNNNNNNNNNNgtttttgtactctcaGAAAtgcagaagctacaaagataaggcttcatgccg aaatcaacaccctgtcattttatggcagggtgtTTTTTT (SEQ ID NO: 22); (d) NNNNNNNNNNNNNNNNNNNNgttttagagctaGAAAtagcaagttaaaataaggctagtccgttatcaactt gaaaaagtggcaccgagtcggtgcTTTTTT (SEQ ID NO: 23); (e) NNNNNNNNNNNNNNNNNNNNgttttagagctaGAAATAGcaagttaaaataaggctagtccgttatcaac ttgaaaaagtgTTTTTTT (SEQ ID NO: 24); and (f) NNNNNNNNNNNNNNNNNNNNgttttagagctagAAATAGcaagttaaaataaggctagtccgttatcaTT TTTTTT (SEQ ID NO: 25).

[0076] In some embodiments, the sgRNA comprises a nucleic acid sequence that binds to exon 8 of any one of SEQ ID NOs: 13-19 or a complement thereof.

[0077] Selection of suitable oligonucleotides for use in as a targeting sequence in a CRISPR Cas system depends on several factors including the particular CRISPR enzyme to be used and the presence of corresponding proto-spacer adjacent motifs (PAMs) downstream of the target sequence in the target nucleic acid. The PAM sequences direct the cleavage of the target nucleic acid by the CRISPR enzyme. In some embodiments, a suitable PAM is 5'- NRG or 5'-NNGRR (where N is any Nucleotide) for SpCas9 or SaCas9 enzymes (or derived enzymes), respectively. Generally the PAM sequences should be present between about 1 to about 10 nucleotides of the target sequence to generate efficient cleavage of the target nucleic acid. Thus, when the guide RNA forms a complex with the CRISPR enzyme, the complex locates the target and PAM sequence, unwinds the DNA duplex, and the guide RNA anneals to the complementary sequence on the opposite strand. This enables the Cas9 nuclease to create a double-strand break.

[0078] A variety of CRISPR enzymes are available for use in conjunction with the disclosed guide RNAs of the present disclosure. In some embodiments, the CRISPR enzyme is a Type II CRISPR enzyme. In some embodiments, the CRISPR enzyme catalyzes DNA cleavage. In some embodiments, the CRISPR enzyme catalyzes RNA cleavage. In some embodiments, the CRISPR enzyme is any Cas9 protein, for instance any naturally-occurring bacterial Cas9 as well as any chimeras, mutants, homologs or orthologs. Non-limiting examples of Cas proteins include Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csn1 and Csx12), Cas10, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, -29- 4856-7271-5486.1Atty. Dkt. No.: 115872-3074 Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4, homologues thereof, or modified variants thereof. In some embodiments, the CRISPR enzyme cleaves both strands of the target nucleic acid at the Protospacer Adjacent Motif (PAM) site. In some embodiments, the CRISPR enzyme is a nickase, which cleaves only one strand of the target nucleic acid.

[0079] In one aspect, the present disclosure provides PCBP2 inhibitors comprising an E3 ubiquitin ligase binding moiety (“ULM”) that is an IAP E3 ubiquitin ligase binding moiety (an “ILM”), a cereblon E3 ubiquitin ligase binding moiety (a “CLM”), a Von Hippel-Lindae E3 ubiquitin ligase (VHL) binding moiety (VLM), and / or a mouse double minute 2 homologue (MDM2) E3 ubiquitin ligase binding moiety (MLM). Exemplary ULMs useful in the bifunctional or multifunctional PCBP2 inhibitors (e.g., PROTACs) of the present technology are disclosed in US Patent No.11707452, the contents of which are incorporated herein in their entirety.

[0080] In an exemplary embodiment, the ULM is coupled to a target protein binding moiety via a chemical linker (L) according to the structure:

[0081] PBM-L-ULM (A),

[0082] wherein L is a bond or a chemical linker group, ULM is a E3 ubiquitin ligase binding moiety, and PBM is a PCBP2 binding moiety. Exemplary linkers useful in the bifunctional or multifunctional PCBP2 inhibitors (e.g., PROTACs) of the present technology are disclosed in US Patent No.11707452, the contents of which are incorporated herein in their entirety.

[0083] The terms ULM, ILM, VLM, MLM, and CLM are used in their inclusive sense unless the context indicates otherwise. For example, the term ULM is inclusive of all ULMs, including those that bind IAP (i.e., ILMs), MDM2 (i.e., MLM), cereblon (i.e., CLM), and VHL (i.e., VLM). Further, the term ILM is inclusive of all possible IAP E3 ubiquitin ligase binding moieties, the term MLM is inclusive of all possible MDM2 E3 ubiquitin ligase binding moieties, the term VLM is inclusive of all possible VHL binding moieties, and the term CLM is inclusive of all cereblon binding moieties.

[0084] In another aspect, the present disclosure provides bifunctional or multifunctional PCBP2 inhibitors (e.g., PROTACs) useful for regulating protein activity by inducing the degradation of PCBP2 protein. In certain embodiments, the PCBP2 inhibitor comprises an -30- 4856-7271-5486.1Atty. Dkt. No.: 115872-3074 ILM or a VLM or a CLM or a MLM coupled, e.g., linked covalently, directly or indirectly, to a moiety that binds a PCBP2 protein (i.e., a PCBP2 targeting moiety or a “PBM”). In certain embodiments, the ILM / VLM / CLM / MLM and PBM are joined or coupled via a chemical linker (L). The ILM binds the IAP E3 ubiquitin ligase, the VLM binds VHL. CLM binds the cereblon E3 ubiquitin ligase, and MLM binds the MDM2 E3 ubiquitin ligase, and the PBM recognizes PCBP2 protein and the interaction of the respective moieties with their targets facilitates the degradation of the PCBP2 protein by placing the PCBP2 protein in proximity to the ubiquitin ligase protein. An exemplary bifunctional PCBP2 inhibitor can be depicted as:

[0085] PBM-ILM (B)

[0086] PBM-CLM (C)

[0087] PBM-VLM (D)

[0088] PBM-MLM (E)

[0089] In certain embodiments, the bifunctional PCBP2 inhibitor further comprises a chemical linker (“L”). For example, the bifunctional PCBP2 inhibitor can be depicted as:

[0090] PBM-L-ILM (F)

[0091] PBM-L-CLM (G)

[0092] PBM-L-VLM (H)

[0093] PBM-L-MLM (I),

[0094] wherein the PBM is a PCBP2 protein / polypeptide targeting moiety, the L is a chemical linker, the ILM is a IAP E3 ubiquitin ligase binding moiety, the CLM is a cereblon E3 ubiquitin ligase binding moiety, the VLM is a VHL binding moiety, and the MLM is a MDM2 E3 ubiquitin ligase binding moiety.

[0095] In certain embodiments, the ULM (e.g., a ILM, a CLM, a VLM, or a MLM) shows activity or binds to the E3 ubiquitin ligase (e.g., IAP E3 ubiquitin ligase, cereblon E3 ubiquitin ligase. VHL, or MDM2 E3 ubiquitin ligase) with an IC50 of less than about 200 μM. The IC50can be determined according to any method known in the art, e.g., a fluorescent polarization assay. -31- 4856-7271-5486.1Atty. Dkt. No.: 115872-3074

[0096] In certain additional embodiments, the bifunctional PCBP2 inhibitors described herein demonstrate an activity with an IC50 of less than about 100, 50, 10, 1, 0.5, 0.1, 0.05, 0.01, 0.005, 0.001 mM, or less than about 100, 50, 10, 1, 0.5, 0.1, 0.05, 0.01, 0.005, 0.001 μM, or less than about 100, 50, 10, 1, 0.5, 0.1, 0.05, 0.01, 0.005, 0.001 nM, or less than about 100, 50, 10, 1, 0.5, 0.1, 0.05, 0.01, 0.005, 0.001 μM.

[0097] In certain embodiments, the PCBP2 inhibitors as described herein comprise multiple PBMs, one or more ULMs (i.e., moieties that bind specifically to multiple / different E3 ubiquitin ligase, e.g., VHL, IAP, cereblon, and / or MDM2) or a combination thereof. In any of the aspects or embodiments described herein, the PBMs and ULMs (e.g., ILM. VLM, CLM, and / or MLM) can be coupled directly or via one or more chemical linkers or a combination thereof. In additional embodiments, where a PCBP2 inhibitor has multiple ULMs, the ULMs can be for the same E3 ubiquintin ligase or each respective ULM can bind specifically to a different E3 ubiquitin ligase. In still further embodiments, where a PCBP2 inhibitor has multiple PBMs. Examples of PBMs useful in the bifunctional or multifunctional PCBP2 inhibitors (e.g., PROTACs) of the present technology include HNRPK, PTBP1, and HNRNPL.

[0098] In certain embodiments, where the PCBP2 inhibitor comprises multiple ULMs, the ULMs are identical. In additional embodiments, the PCBP2 inhibitor comprising a plurality of ULMs (e.g., ULM, ULM′, etc.), at least one PBM coupled to a ULM directly or via a chemical linker (L) or both. In certain additional embodiments, the PCBP2 inhibitor comprising a plurality of ULMs further comprises multiple PBMs. In still additional embodiments, the PBMs are the same or, optionally, different.

[0099] In certain embodiments, the PCBP2 inhibitor may comprise a plurality of ULMs. In further embodiments, the PCBP2 inhibitor comprising at least two different ULMs, and / or a plurality of ULMs further comprises at least one PBM coupled to a ULM directly or via a chemical linker or both. In any of the embodiments described herein, a PCBP2 inhibitor comprising at least two different ULMs can further comprise multiple PBMs. In still additional embodiments, the PBMs are the same or, optionally, different. Adoptive Cell Therapy

[0100] The presently disclosed subject matter provides methods of using adoptive cell therapeutic compositions for the treatment of an HLA expressing cancer. The adoptive cell -32- 4856-7271-5486.1Atty. Dkt. No.: 115872-3074 therapeutic compositions of the presently disclosed subject matter can be cells of the lymphoid lineage or myeloid lineage. Examples of myeloid cells include but are not limited to, mast cells, monocytes, macrophages, dendritic cells, eosinophils, neutrophils, basophils. The lymphoid lineage, comprising B, T, and natural killer (NK) cells, provides for the production of antibodies, regulation of the cellular immune system, detection of foreign agents in the blood, detection of cells foreign to the host, and the like. Non-limiting examples of immune cells of the lymphoid lineage include T cells, Natural Killer (NK) cells, embryonic stem cells, and pluripotent stem cells (e.g., those from which lymphoid cells can be differentiated). T cells can be lymphocytes that mature in the thymus and are chiefly responsible for cell-mediated immunity. T cells are involved in the adaptive immune system. The T cells of the presently disclosed subject matter can be any type of T cells, including, but not limited to, T helper cells, cytotoxic T cells, memory T cells (including central memory T cells, stem-cell-like memory T cells (or stem-like memory T cells), and two types of effector memory T cells: e.g., TEMcells and TEMRA cells, Regulatory T cells (also known as suppressor T cells), Natural killer T cells, Mucosal associated invariant T cells, and γδ T cells. Cytotoxic T cells (CTL or killer T cells) are a subset of T lymphocytes capable of inducing the death of infected somatic or tumor cells.

[0101] Natural killer (NK) cells can be lymphocytes that are part of cell-mediated immunity and act during the innate immune response. NK cells do not require prior activation in order to perform their cytotoxic effect on target cells.

[0102] The adoptive cell therapeutic compositions of the presently disclosed subject matter can be administered to a subject (e.g., a human subject) in need thereof for the treatment of an HLA expressing cancer. In some embodiments, the immune cell is a lymphocyte, such as a T cell, a B cell or a natural killer (NK) cell. In certain embodiments, the adoptive cell therapeutic composition comprises T cells. The T cell can be a CD4+T cell or a CD8+T cell. In certain embodiments, the T cell is a CD4+T cell. In certain embodiments, the T cell is a CD8+T cell.

[0103] The presently disclosed adoptive cell therapeutic compositions of the present technology may further include at least one recombinant or exogenous co-stimulatory ligand. For example, the presently disclosed adoptive cell therapeutic compositions can be further transduced with at least one co- stimulatory ligand, such that the immune cells co- express or are induced to co-express the at least one co-stimulatory ligand. Co-stimulatory -33- 4856-7271-5486.1Atty. Dkt. No.: 115872-3074 ligands include, but are not limited to, members of the tumor necrosis factor (TNF) superfamily, and immunoglobulin (Ig) superfamily ligands. TNF is a cytokine involved in systemic inflammation and stimulates the acute phase reaction. Its primary role is in the regulation of immune cells. Members of TNF superfamily share a number of common features. The majority of TNF superfamily members are synthesized as type II transmembrane proteins (extracellular C-terminus) containing a short cytoplasmic segment and a relatively long extracellular region. TNF superfamily members include, without limitation, nerve growth factor (NGF), CD40L (CD40L) / CD 154, CD137L / 4-1BBL, TNF-a, CD134L / OX40L / CD252, CD27L / CD70, Fas ligand (FasL), CD30L / CD153, tumor necrosis factor beta (TNFP) / lymphotoxin-alpha (LTa), lymphotoxin-beta Ο-Τβ), CD257 / B cell- activating factor (B AFF) / Bly s / THANK / Tall- 1, glucocorticoid-induced TNF Receptor ligand (GITRL), and TNF-related apoptosis-inducing ligand (TRAIL), LIGHT (TNFSF14). The immunoglobulin (Ig) superfamily is a large group of cell surface and soluble proteins that are involved in the recognition, binding, or adhesion processes of cells. These proteins share structural features with immunoglobulins — they possess an immunoglobulin domain (fold). Immunoglobulin superfamily ligands include, but are not limited to, CD80 and CD86, both ligands for CD28, PD-L1 / (B7-H1) that ligands for PD-1. In certain embodiments, the at least one co-stimulatory ligand is selected from the group consisting of 4-1BBL, CD80, CD86, CD70, OX40L, CD48, TNFRSF14, PD-L1, and combinations thereof.

[0104] Furthermore, the presently disclosed adoptive cell therapeutic compositions can further comprise at least one exogenous cytokine. For example, a presently disclosed adoptive cell therapeutic composition can be further transduced with at least one cytokine, such that the adoptive cell therapeutic compositions secrete the at least one cytokine. In certain embodiments, the at least one cytokine is selected from the group consisting of IL-2, IL- 3, IL-6, IL-7, IL-11, IL-12, IL-15, IL-17, and IL-21. In certain embodiments, the cytokine is IL-12.

[0105] The adoptive cell therapeutic compositions can be generated from peripheral donor lymphocytes, e.g., those disclosed in Sadelain, M., et al., Nat Rev Cancer 3 :35-45 (2003), in Morgan, R.A. et al. (2006) Science 314: 126-129, in Panelli et al. (2000) J Immunol 164:495-504; Panelli et al. (2000) J Immunol 164:4382-4392 (2000), and in Dupont et al. (2005) Cancer Res 65:5417-5427; Papanicolaou et al. (2003) Blood -34- 4856-7271-5486.1Atty. Dkt. No.: 115872-3074 102:2498-2505. The adoptive cell therapeutic compositions (e.g., T cells) can be autologous, non-autologous (e.g., allogeneic), or derived in vitro from engineered progenitor or stem cells.

[0106] The unpurified source of immune cells can be any known in the art, such as the bone marrow, fetal, neonate or adult or other hematopoietic cell source, e.g., fetal liver, peripheral blood or umbilical cord blood. Various techniques can be employed to separate the cells. For instance, negative selection methods can remove non-immune cell initially. Monoclonal antibodies are particularly useful for identifying markers associated with particular cell lineages and / or stages of differentiation for both positive and negative selections.

[0107] A large proportion of terminally differentiated cells can be initially removed by a relatively crude separation. For example, magnetic bead separations can be used initially to remove large numbers of irrelevant cells. In some embodiments, at least about 80%, usually at least 70% of the total hematopoietic cells will be removed prior to cell isolation.

[0108] Procedures for separation include, but are not limited to, density gradient centrifugation; resetting; coupling to particles that modify cell density; magnetic separation with antibody-coated magnetic beads; affinity chromatography; cytotoxic agents joined to or used in conjunction with a mAb, including, but not limited to, complement and cytotoxins; and panning with antibody attached to a solid matrix, e.g., plate, chip, elutriation or any other convenient technique.

[0109] Techniques for separation and analysis include, but are not limited to, flow cytometry, which can have varying degrees of sophistication, e.g., a plurality of color channels, low angle and obtuse light scattering detecting channels, impedance channels.

[0110] The cells can be selected against dead cells, by employing dyes associated with dead cells such as propidium iodide (PI). In some embodiments, the cells are collected in a medium comprising 2% fetal calf serum (FCS) or 0.2% bovine serum albumin (BSA) or any other suitable, preferably sterile, isotonic medium.

[0111] In some embodiments, the adoptive cell therapeutic compositions comprise one or more additional modifications. For example, in some embodiments, the adoptive cell therapeutic compositions comprise and express (is transduced to express) a chimeric co- stimulatory receptor (CCR). CCR is described in Krause et al. (1998) J. Exp. Med. -35- 4856-7271-5486.1Atty. Dkt. No.: 115872-3074 188(4):619-626, and US20020018783, the contents of which are incorporated by reference in their entireties. CCRs mimic co-stimulatory signals, but unlike, engineered receptors, do not provide a T-cell activation signal, e.g., CCRs lack a CD3ζ polypeptide. CCRs provide co-stimulation, e.g., a CD28-like signal, in the absence of the natural co-stimulatory ligand on the antigen-presenting cell. A combinatorial antigen recognition, i.e., use of a CCR in combination with an engineered receptor, can augment T-cell reactivity against the dual- antigen expressing T cells, thereby improving selective tumor targeting.

[0112] In some embodiments, the adoptive cell therapeutic compositions are further modified to suppress expression of one or more genes. In some embodiments, the adoptive cell therapeutic compositions are further modified via genome editing. Various methods and compositions for targeted cleavage of genomic DNA have been described. Such targeted cleavage events can be used, for example, to induce targeted mutagenesis, induce targeted deletions of cellular DNA sequences, and facilitate targeted recombination at a predetermined chromosomal locus. See, for example, U.S. Patent Nos.7,888,121; 7,972,854; 7,914,796; 7,951,925; 8,110,379; 8,409,861; 8,586,526; U.S. Patent Publications 20030232410; 20050208489; 20050026157; 20050064474; 20060063231; 201000218264; 20120017290; 20110265198; 20130137104; 20130122591; 20130177983 and 20130177960, the disclosures of which are incorporated by reference in their entireties. These methods often involve the use of engineered cleavage systems to induce a double strand break (DSB) or a nick in a target DNA sequence such that repair of the break by an error born process such as non-homologous end joining (NHEJ) or repair using a repair template (homology directed repair or HDR) can result in the knock out of a gene or the insertion of a sequence of interest (targeted integration). Cleavage can occur through the use of specific nucleases such as engineered zinc finger nucleases (ZFN), transcription- activator like effector nucleases (TALENs), or using the CRISPR / Cas system with an engineered crRNA / tracr RNA ('single guide RNA') to guide specific cleavage. In some embodiments, the adoptive cell therapeutic compositions are modified to disrupt or reduce expression of an endogenous T-cell receptor gene (see, e.g. WO 2014153470, which is incorporated by reference in its entirety). In some embodiments, the adoptive cell therapeutic compositions are modified to result in disruption or inhibition of PD1, PDL-1 or CTLA-4 (see, e.g. U.S. Patent Publication 20140120622), or other immunosuppressive -36- 4856-7271-5486.1Atty. Dkt. No.: 115872-3074 factors known in the art (Wu et al. (2015) Oncoimmunology 4(7): e1016700, Mahoney et al. (2015) Nature Reviews Drug Discovery 14, 561–584).

[0113] In some embodiments, the adoptive cell therapeutic compositions provided herein express a T-cell receptor (TCR) or other cell-surface ligand that binds to a target antigen, such as a tumor antigen. In some embodiments, the T cell receptor is a wild-type or native T-cell receptor. In some embodiments, the TCR is an engineered receptor or a non-native receptor. In some embodiments, the engineered receptor is an engineered TCR (eTCR). In some embodiments, the engineered receptor is a chimeric antibody TCR (caTCR). In some embodiments, the engineered receptor is a chimeric antigen receptor (CAR).

[0114] In exemplary embodiments, the adoptive cell therapeutic compositions provided herein express a native receptor, a non-native receptor, or an engineered receptor (e.g., a CAR, caTCR, or eTCR) or other cell-surface ligand that binds to a tumor antigen. In some embodiments, the adoptive cell therapeutic compositions provided herein express a native receptor, a non-native receptor, or an engineered receptor (e.g., a CAR, caTCR, or eTCR) or other cell-surface ligand that binds to a tumor antigen presented in the context of an MHC molecule. In some embodiments, the adoptive cell therapeutic compositions provided herein express a native receptor, a non-native receptor or an engineered receptor (e.g., a CAR, caTCR, or eTCR) or other cell-surface ligand that binds to a tumor antigen presented in the context of an HLA-A2 molecule. In exemplary embodiments, the adoptive cell therapeutic compositions provided herein express a native receptor, a non-native receptor or an engineered receptor (e.g., a CAR, caTCR, or eTCR) or other cell-surface ligand that binds to a tumor antigen. Examples of tumor antigens bound by the native receptor, non- native receptor or engineered receptor (e.g., a CAR, caTCR, or eTCR) or other cell-surface ligand include, but is not limited to, carbonic anhydrase 9 (CAIX), CD19, prominin-1 (CD133), CD38 antigen (CD38), CD3, GPA33, HER2 / neu, GD2, MAGE-1, MAGE-3, BAGE, GAGE-1, GAGE-2, MUM-1, CDK4, N-acetylglucosaminyltransferase, p15, gp75, beta-catenin, ErbB2, cancer antigen 125 (CA-125), carcinoembryonic antigen (CEA), RAGE, MART (melanoma antigen), MUC-1, MUC-2, MUC-3, MUC-4, MUC-5ac, MUC- 16, MUC-17, tyrosinase, Pmel 17 (gp100), GnT-V intron V sequence (N- acetylglucoaminyltransferase V intron V sequence), Prostate cancer psm, PRAME (melanoma antigen), β-catenin, EBNA (Epstein-Barr Virus nuclear antigen) 1-6, LMP2, -37- 4856-7271-5486.1Atty. Dkt. No.: 115872-3074 p53, lung resistance protein (LRP), Bcl-2, prostate specific antigen (PSA), Ki-67, CEACAM6, colon-specific antigen-p (CSAp), HLA-DR, CD40, CD74, CD138, EGFR, EGP-1, EGP-2, VEGF, PlGF, insulin-like growth factor (ILGF), tenascin, platelet-derived growth factor, IL-6, CD20, CD19, PSMA, CD33, CD123, MET, DLL4, Ang-2, HER3, IGF-1R, CD30, TAG-72, SPEAP, CD45, L1-CAM, Lewis Y (Ley) antigen, E-cadherin, V- cadherin, GPC3, EpCAM, CD4, CD8, CD21, CD23, CD46, CD80, HLA-DR, CD74, CD22, CD14, CD15, CD16, CD123, TCR gamma / delta, NKp46, KIR, CD56, DLL3, PD-1, PD-L1, CD28, CD137, CD99, GloboH, CD24, STEAP1, B7H3, Polysialic Acid, OX40, OX40- ligand, and peptide MHC complexes (with peptides derived from TP53, KRAS, MYC, EBNA1-6, PRAME, MART, tyronsinase, MAGEA1-A6, pmel17, LMP2, or WT1). Exemplary engineered receptors that bind to CD19 are described in International Publication No. WO2017070608, which is incorporated by reference in its entirety. Pharmaceutical Compositions

[0115] In one aspect, the present disclosure provides pharmaceutical compositions comprising a PCBP2 inhibitor as described herein.

[0116] The pharmaceutical compositions of the present disclosure may be prepared by any of the methods known in the pharmaceutical arts. The amount of active ingredient that can be combined with a carrier material to produce a single dosage form will vary depending upon the host being treated and the particular mode of administration. The amount of active ingredient that can be combined with a carrier material to produce a single dosage form will generally be that amount of the compound that produces a therapeutic effect. Generally, the amount of active compound will be in the range of about 0.1 to 99 percent, more typically, about 5 to 70 percent, and more typically, about 10 to 30 percent.

[0117] In some embodiments, pharmaceutical compositions of the present technology may contain one or more pharmaceutically-acceptable carriers, which as used herein, generally refers to a pharmaceutically-acceptable composition, such as a liquid or solid filler, diluent, excipient, manufacturing aid (e.g., lubricant, talc magnesium, calcium or zinc stearate, or steric acid), or solvent encapsulating material, useful for introducing the active agent into the body.

[0118] Examples of suitable aqueous and non-aqueous carriers that may be employed in the pharmaceutical compositions of the present technology include, for example, water, -38- 4856-7271-5486.1Atty. Dkt. No.: 115872-3074 ethanol, polyols (such as glycerol, propylene glycol, polyethylene glycol, and the like), vegetable oils (such as olive oil), and injectable organic esters (such as ethyl oleate), and suitable mixtures thereof. Proper fluidity can be maintained, for example, by the use of coating materials, such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants.

[0119] In some embodiments, the formulations may include one or more of sugars, such as lactose, glucose and sucrose; starches, such as corn starch and potato starch; cellulose, and its derivatives, such as sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate; powdered tragacanth; malt; gelatin; talc; excipients, such as cocoa butter and suppository waxes; oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil and soybean oil; glycols, such as propylene glycol; polyols, such as glycerin, sorbitol, mannitol and polyethylene glycol; esters, such as ethyl oleate and ethyl laurate; agar; alginic acid; buffering agents, such as magnesium hydroxide and aluminum hydroxide; pyrogen-free water; isotonic saline; Ringer's solution; ethyl alcohol; pH buffered solutions; polyesters, polycarbonates and / or polyanhydrides; preservatives; glidants; fillers; and other non-toxic compatible substances employed in pharmaceutical formulations.

[0120] Various auxiliary agents, such as wetting agents, emulsifiers, lubricants (e.g., sodium lauryl sulfate and magnesium stearate), coloring agents, release agents, coating agents, sweetening agents, flavoring agents, preservative agents, and antioxidants can also be included in the pharmaceutical composition of the present technology. Some examples of pharmaceutically-acceptable antioxidants include: water soluble antioxidants, such as ascorbic acid, cysteine hydrochloride, sodium bisulfate, sodium metabisulfite, sodium sulfite, and the like; oil-soluble antioxidants, such as ascorbyl palmitate, butylated hydroxyanisole (BHA), butylated hydroxytoluene (BHT), lecithin, propyl gallate, alpha- tocopherol, and the like; and metal chelating agents, such as citric acid, ethylenediamine tetraacetic acid (EDTA), sorbitol, tartaric acid, phosphoric acid, and the like. In some embodiments, the pharmaceutical formulation includes an excipient selected from, for example, celluloses, liposomes, micelle-forming agents (e.g., bile acids), and polymeric carriers, e.g., polyesters and polyanhydrides. Suspensions, in addition to the active compounds, may contain suspending agents, such as, for example, ethoxylated isostearyl alcohols, polyoxyethylene sorbitol and sorbitan esters, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar-agar and tragacanth, and mixtures thereof. Prevention of the -39- 4856-7271-5486.1Atty. Dkt. No.: 115872-3074 action of microorganisms on the active compounds may be ensured by the inclusion of various antibacterial and antifungal agents, such as, for example, paraben, chlorobutanol, phenol sorbic acid, and the like. It may also be desirable to include isotonic agents, such as sugars, sodium chloride, and the like into the compositions. In addition, prolonged absorption of the injectable pharmaceutical form may be brought about by the inclusion of agents that delay absorption, such as aluminum monostearate and gelatin. Modes of Administration and Effective Dosages

[0121] Any method known to those in the art for contacting a cell, organ or tissue with one or more PCBP2 inhibitors and / or immunotherapeutic agents (e.g., immune checkpoint blockade or adoptive cell therapeutic compositions) disclosed herein may be employed. Suitable methods include in vitro, ex vivo, or in vivo methods. In vivo methods typically include the administration of one or more PCBP2 inhibitors and / or immunotherapeutic agents (e.g., immune checkpoint blockade or adoptive cell therapeutic compositions) to a mammal, suitably a human. When used in vivo for therapy, the one or more PCBP2 inhibitors and / or immunotherapeutic agents (e.g., immune checkpoint blockade or adoptive cell therapeutic compositions) described herein are administered to the subject in effective amounts (i.e., amounts that have desired therapeutic effect). The dose and dosage regimen will depend upon the degree of the disease state of the subject, the characteristics of the particular PCBP2 inhibitor and / or immunotherapeutic agent (e.g., immune checkpoint blockade or adoptive cell therapeutic composition) used, e.g., its therapeutic index, and the subject’s history.

[0122] The effective amount may be determined during pre-clinical trials and clinical trials by methods familiar to physicians and clinicians. An effective amount of one or more PCBP2 inhibitors and / or immunotherapeutic agents (e.g., immune checkpoint blockade or adoptive cell therapeutic compositions) useful in the methods may be administered to a mammal in need thereof by any of a number of well-known methods for administering pharmaceutical compounds. The PCBP2 inhibitor and / or immunotherapeutic agent (e.g., immune checkpoint blockade or adoptive cell therapeutic composition) may be administered systemically or locally.

[0123] The one or more PCBP2 inhibitors and / or immunotherapeutic agents (e.g., immune checkpoint blockade or adoptive cell therapeutic compositions) described herein can be incorporated into pharmaceutical compositions for administration, singly or in -40- 4856-7271-5486.1Atty. Dkt. No.: 115872-3074 combination, to a subject. Such compositions typically include the active agent and a pharmaceutically acceptable carrier. As used herein the term “pharmaceutically acceptable carrier” includes saline, solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, compatible with pharmaceutical administration. Supplementary active compounds can also be incorporated into the compositions.

[0124] Pharmaceutical compositions are typically formulated to be compatible with its intended route of administration. Examples of routes of administration include parenteral (e.g., intravenous, intradermal, intraperitoneal or subcutaneous), oral, inhalation, transdermal (topical), intraocular, iontophoretic, and transmucosal administration. Solutions or suspensions used for parenteral, intradermal, or subcutaneous application can include the following components: a sterile diluent such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerine, propylene glycol or other synthetic solvents; antibacterial agents such as benzyl alcohol or methyl parabens; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid; buffers such as acetates, citrates or phosphates and agents for the adjustment of tonicity such as sodium chloride or dextrose. pH can be adjusted with acids or bases, such as hydrochloric acid or sodium hydroxide. The parenteral preparation can be enclosed in ampoules, disposable syringes or multiple dose vials made of glass or plastic. For convenience of the patient or treating physician, the dosing formulation can be provided in a kit containing all necessary equipment (e.g., vials of drug, vials of diluent, syringes and needles) for a treatment course (e.g., 7 days of treatment).

[0125] Pharmaceutical compositions suitable for injectable use can include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, CREMOPHOR EL™ (BASF, Parsippany, N.J.) or phosphate buffered saline (PBS). In all cases, a composition for parenteral administration must be sterile and should be fluid to the extent that easy syringability exists. It should be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi. -41- 4856-7271-5486.1Atty. Dkt. No.: 115872-3074

[0126] The pharmaceutical compositions having one or more PCBP2 inhibitors and / or immunotherapeutic agents (e.g., immune checkpoint blockade or adoptive cell therapeutic compositions) disclosed herein can include a carrier, which can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (e.g., glycerol, propylene glycol, and liquid polyethylene glycol, and the like), and suitable mixtures thereof. The proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thiomerasol, and the like. Glutathione and other antioxidants can be included to prevent oxidation. In many cases, it will be advantageous to include isotonic agents, for example, sugars, polyalcohols such as mannitol, sorbitol, or sodium chloride in the composition. Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent that delays absorption, for example, aluminum monostearate or gelatin.

[0127] Sterile injectable solutions can be prepared by incorporating the active compound in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle, which contains a basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, typical methods of preparation include vacuum drying and freeze drying, which can yield a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.

[0128] Oral compositions generally include an inert diluent or an edible carrier. For the purpose of oral therapeutic administration, the active compound can be incorporated with excipients and used in the form of tablets, troches, or capsules, e.g., gelatin capsules. Oral compositions can also be prepared using a fluid carrier for use as a mouthwash. Pharmaceutically compatible binding agents, and / or adjuvant materials can be included as part of the composition. The tablets, pills, capsules, troches and the like can contain any of the following ingredients, or compounds of a similar nature: a binder such as microcrystalline cellulose, gum tragacanth or gelatin; an excipient such as starch or lactose, -42- 4856-7271-5486.1Atty. Dkt. No.: 115872-3074 a disintegrating agent such as alginic acid, Primogel, or corn starch; a lubricant such as magnesium stearate or Sterotes; a glidant such as colloidal silicon dioxide; a sweetening agent such as sucrose or saccharin; or a flavoring agent such as peppermint, methyl salicylate, or orange flavoring.

[0129] For administration by inhalation, the compounds can be delivered in the form of an aerosol spray from a pressurized container or dispenser, which contains a suitable propellant, e.g., a gas such as carbon dioxide, or a nebulizer. Such methods include those described in U.S. Pat. No.6,468,798.

[0130] Systemic administration of a therapeutic compound as described herein can also be by transmucosal or transdermal means. For transmucosal or transdermal administration, penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art, and include, for example, for transmucosal administration, detergents, bile salts, and fusidic acid derivatives. Transmucosal administration can be accomplished through the use of nasal sprays. For transdermal administration, the active compounds are formulated into ointments, salves, gels, or creams as generally known in the art. In one embodiment, transdermal administration may be performed by iontophoresis.

[0131] A therapeutic agent can be formulated in a carrier system. The carrier can be a colloidal system. The colloidal system can be a liposome, a phospholipid bilayer vehicle. In one embodiment, the therapeutic agent is encapsulated in a liposome while maintaining the agent’s structural integrity. One skilled in the art would appreciate that there are a variety of methods to prepare liposomes. (See Lichtenberg, et al., Methods Biochem. Anal., 33:337-462 (1988); Anselem, et al., Liposome Technology, CRC Press (1993)). Liposomal formulations can delay clearance and increase cellular uptake (See Reddy, Ann. Pharmacother., 34(7-8):915-923 (2000)). An active agent can also be loaded into a particle prepared from pharmaceutically acceptable ingredients including, but not limited to, soluble, insoluble, permeable, impermeable, biodegradable or gastroretentive polymers or liposomes. Such particles include, but are not limited to, nanoparticles, biodegradable nanoparticles, microparticles, biodegradable microparticles, nanospheres, biodegradable nanospheres, microspheres, biodegradable microspheres, capsules, emulsions, liposomes, micelles and viral vector systems. -43- 4856-7271-5486.1Atty. Dkt. No.: 115872-3074

[0132] The carrier can also be a polymer, e.g., a biodegradable, biocompatible polymer matrix. In one embodiment, the therapeutic agent can be embedded in the polymer matrix, while maintaining the agent’s structural integrity. The polymer may be natural, such as polypeptides, proteins or polysaccharides, or synthetic, such as poly α-hydroxy acids. Examples include carriers made of, e.g., collagen, fibronectin, elastin, cellulose acetate, cellulose nitrate, polysaccharide, fibrin, gelatin, and combinations thereof. In one embodiment, the polymer is poly-lactic acid (PLA) or copoly lactic / glycolic acid (PGLA). The polymeric matrices can be prepared and isolated in a variety of forms and sizes, including microspheres and nanospheres. Polymer formulations can lead to prolonged duration of therapeutic effect. (See Reddy, Ann. Pharmacother., 34(7-8):915-923 (2000)). A polymer formulation for human growth hormone (hGH) has been used in clinical trials. (See Kozarich and Rich, Chemical Biology, 2:548-552 (1998)).

[0133] Examples of polymer microsphere sustained release formulations are described in PCT publication WO 99 / 15154 (Tracy, et al.), U.S. Pat. Nos.5,674,534 and 5,716,644 (both to Zale, et al.), PCT publication WO 96 / 40073 (Zale, et al.), and PCT publication WO 00 / 38651 (Shah, et al.). U.S. Pat. Nos.5,674,534 and 5,716,644 and PCT publication WO 96 / 40073 describe a polymeric matrix containing particles of erythropoietin that are stabilized against aggregation with a salt.

[0134] In some embodiments, the therapeutic compounds are prepared with carriers that will protect the therapeutic compounds against rapid elimination from the body, such as a controlled release formulation, including implants and microencapsulated delivery systems. Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. Such formulations can be prepared using known techniques. The materials can also be obtained commercially, e.g., from Alza Corporation and Nova Pharmaceuticals, Inc. Liposomal suspensions (including liposomes targeted to specific cells with monoclonal antibodies to cell-specific antigens) can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art, for example, as described in U.S. Pat. No.4,522,811.

[0135] The therapeutic compounds can also be formulated to enhance intracellular delivery. For example, liposomal delivery systems are known in the art, see, e.g., Chonn and Cullis, “Recent Advances in Liposome Drug Delivery Systems,” Current Opinion in -44- 4856-7271-5486.1Atty. Dkt. No.: 115872-3074 Biotechnology 6:698-708 (1995); Weiner, “Liposomes for Protein Delivery: Selecting Manufacture and Development Processes,” Immunomethods, 4(3):201-9 (1994); and Gregoriadis, “Engineering Liposomes for Drug Delivery: Progress and Problems,” Trends Biotechnol., 13(12):527-37 (1995). Mizguchi, et al., Cancer Lett., 100:63-69 (1996), describes the use of fusogenic liposomes to deliver a protein to cells both in vivo and in vitro.

[0136] Dosage, toxicity and therapeutic efficacy of any therapeutic agent can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., for determining the LD50 (the dose lethal to 50% of the population) and the ED50 (the dose therapeutically effective in 50% of the population). The dose ratio between toxic and therapeutic effects is the therapeutic index and it can be expressed as the ratio LD50 / ED50. Compounds that exhibit high therapeutic indices are advantageous. While compounds that exhibit toxic side effects may be used, care should be taken to design a delivery system that targets such compounds to the site of affected tissue in order to minimize potential damage to uninfected cells and, thereby, reduce side effects.

[0137] The data obtained from the cell culture assays and animal studies can be used in formulating a range of dosage for use in humans. The dosage of such compounds may be within a range of circulating concentrations that include the ED50 with little or no toxicity. The dosage may vary within this range depending upon the dosage form employed and the route of administration utilized. For any compound used in the methods, the therapeutically effective dose can be estimated initially from cell culture assays. A dose can be formulated in animal models to achieve a circulating plasma concentration range that includes the IC50 (i.e., the concentration of the test compound which achieves a half-maximal inhibition of symptoms) as determined in cell culture. Such information can be used to determine useful doses in humans accurately. Levels in plasma may be measured, for example, by high performance liquid chromatography.

[0138] Typically, an effective amount of the one or more PCBP2 inhibitors and / or immunotherapeutic agents (e.g., immune checkpoint blockade or adoptive cell therapeutic compositions) disclosed herein sufficient for achieving a therapeutic or prophylactic effect, range from about 0.000001 mg per kilogram body weight per day to about 10,000 mg per kilogram body weight per day. Suitably, the dosage ranges are from about 0.0001 mg per kilogram body weight per day to about 100 mg per kilogram body weight per day. For -45- 4856-7271-5486.1Atty. Dkt. No.: 115872-3074 example, dosages can be 1 mg / kg body weight or 10 mg / kg body weight every day, every two days or every three days or within the range of 1-10 mg / kg every week, every two weeks or every three weeks. In one embodiment, a single dosage of the therapeutic compound ranges from 0.001-10,000 micrograms per kg body weight. In one embodiment, PCBP2 inhibitor and / or immunotherapeutic agent (e.g., immune checkpoint blockade or adoptive cell therapeutic composition) concentrations in a carrier range from 0.2 to 2000 micrograms per delivered milliliter. An exemplary treatment regime entails administration once per day or once a week. In therapeutic applications, a relatively high dosage at relatively short intervals is sometimes required until progression of the disease is reduced or terminated, or until the subject shows partial or complete amelioration of symptoms of disease. Thereafter, the patient can be administered a prophylactic regime.

[0139] In some embodiments, a therapeutically effective amount of one or more PCBP2 inhibitors and / or immunotherapeutic agents (e.g., immune checkpoint blockade or adoptive cell therapeutic compositions) may be defined as a concentration of inhibitor at the target tissue of 10-32to 10-6molar, e.g., approximately 10-7molar. This concentration may be delivered by systemic doses of 0.001 to 100 mg / kg or equivalent dose by body surface area. The schedule of doses would be optimized to maintain the therapeutic concentration at the target tissue, such as by single daily or weekly administration, but also including continuous administration (e.g., parenteral infusion or transdermal application).

[0140] The skilled artisan will appreciate that certain factors may influence the dosage and timing required to effectively treat a subject, including but not limited to, the severity of the disease or disorder, previous treatments, the general health and / or age of the subject, and other diseases present. Moreover, treatment of a subject with a therapeutically effective amount of the therapeutic compositions described herein can include a single treatment or a series of treatments.

[0141] The mammal treated in accordance with the present methods can be any mammal, including, for example, farm animals, such as sheep, pigs, cows, and horses; pet animals, such as dogs and cats; laboratory animals, such as rats, mice and rabbits. In some embodiments, the mammal is a human.

[0142] For therapeutic applications, a composition comprising a PCBP2 inhibitor and / or immunotherapeutic agent (e.g., immune checkpoint blockade or adoptive cell therapeutic composition) disclosed herein, is administered to the subject. -46- 4856-7271-5486.1Atty. Dkt. No.: 115872-3074

[0143] In some embodiments, the PCBP2 inhibitor and / or immunotherapeutic agent (e.g., immune checkpoint blockade or adoptive cell therapeutic composition) is administered one, two, three, four, or five times per day. In some embodiments, the PCBP2 inhibitor and / or immunotherapeutic agent (e.g., immune checkpoint blockade or adoptive cell therapeutic composition) is administered more than five times per day. Additionally or alternatively, in some embodiments, the PCBP2 inhibitor and / or immunotherapeutic agent (e.g., immune checkpoint blockade or adoptive cell therapeutic composition) is administered every day, every other day, every third day, every fourth day, every fifth day, or every sixth day. In some embodiments, the PCBP2 inhibitor and / or immunotherapeutic agent (e.g., immune checkpoint blockade or adoptive cell therapeutic composition) is administered weekly, bi-weekly, tri-weekly, or monthly. In some embodiments, the PCBP2 inhibitor and / or immunotherapeutic agent (e.g., immune checkpoint blockade or adoptive cell therapeutic composition) is administered for a period of one, two, three, four, or five weeks. In some embodiments, the PCBP2 inhibitor and / or immunotherapeutic agent (e.g., immune checkpoint blockade or adoptive cell therapeutic composition) is administered for six weeks or more. In some embodiments, the PCBP2 inhibitor and / or immunotherapeutic agent (e.g., immune checkpoint blockade or adoptive cell therapeutic composition) is administered for twelve weeks or more. In some embodiments, the PCBP2 inhibitor and / or immunotherapeutic agent (e.g., immune checkpoint blockade or adoptive cell therapeutic composition) is administered for a period of less than one year. In some embodiments, the PCBP2 inhibitor and / or immunotherapeutic agent (e.g., immune checkpoint blockade or adoptive cell therapeutic composition) is administered for a period of more than one year. In some embodiments, the PCBP2 inhibitor and / or immunotherapeutic agent (e.g., immune checkpoint blockade or adoptive cell therapeutic composition) is administered throughout the subject’s life.

[0144] In some embodiments of the methods of the present technology, the PCBP2 inhibitor and / or immunotherapeutic agent (e.g., immune checkpoint blockade or adoptive cell therapeutic composition) is administered daily for 1 week or more. In some embodiments of the methods of the present technology, the PCBP2 inhibitor and / or immunotherapeutic agent (e.g., immune checkpoint blockade or adoptive cell therapeutic composition) is administered daily for 2 weeks or more. In some embodiments of the methods of the present technology, the PCBP2 inhibitor and / or immunotherapeutic agent -47- 4856-7271-5486.1Atty. Dkt. No.: 115872-3074 (e.g., immune checkpoint blockade or adoptive cell therapeutic composition) is administered daily for 3 weeks or more. In some embodiments of the methods of the present technology, the PCBP2 inhibitor and / or immunotherapeutic agent (e.g., immune checkpoint blockade or adoptive cell therapeutic composition) is administered daily for 4 weeks or more. In some embodiments of the methods of the present technology, the PCBP2 inhibitor and / or immunotherapeutic agent (e.g., immune checkpoint blockade or adoptive cell therapeutic composition) is administered daily for 6 weeks or more. In some embodiments of the methods of the present technology, the PCBP2 inhibitor and / or immunotherapeutic agent (e.g., immune checkpoint blockade or adoptive cell therapeutic composition) is administered daily for 12 weeks or more. In some embodiments, the PCBP2 inhibitor and / or immunotherapeutic agent (e.g., immune checkpoint blockade or adoptive cell therapeutic composition) is administered daily throughout the subject’s life. Therapeutic Methods of the Present Technology

[0145] In one aspect, the present disclosure provides a method for sensitizing a cancer patient to immunotherapy comprising administering to the cancer patient an effective amount of a PCBP2 inhibitor separately, sequentially or simultaneously with the immunotherapy. The immunotherapy may comprise immune checkpoint blockade therapy and / or an adoptive cell therapeutic composition comprising T cells. Additionally or alternatively, in certain embodiments, the adoptive cell therapeutic composition comprises one or more of tumor infiltrating T cells, CD8+ T cells, CD4+ T cells, delta-gamma T-cells, and alpha-beta T-cells. The T cells may comprise a native TCR or a heterologous TCR. In certain embodiments, the native TCR or the heterologous TCR is HLA-I restricted or HLA- II restricted. In some embodiments, the adoptive cell therapeutic composition is obtained from an autologous donor or allogeneic donor.

[0146] Additionally or alternatively, in certain embodiments, the cancer patient has previously received immunotherapy. In some embodiments, the cancer patient is resistant or non-responsive to immunotherapy.

[0147] Additionally or alternatively, in some embodiments of the methods disclosed herein, the immune checkpoint blockade therapy comprises one or more of an anti-PD-1 antibody, an anti-PD-L1 antibody, an anti-PD-L2 antibody, an anti-CTLA-4 antibody, an anti-TIM3 antibody, an anti-4-1BB antibody, an anti-CD73 antibody, an anti-GITR antibody, and an anti-LAG-3 antibody. Examples of immune checkpoint blockade therapy -48- 4856-7271-5486.1Atty. Dkt. No.: 115872-3074 include, but are not limited to, pembrolizumab, nivolumab, cemiplimab, atezolizumab, avelumab, durvalumab, ipilimumab, tremelimumab, ticlimumab, JTX-4014, Spartalizumab (PDR001), Camrelizumab (SHR1210), Sintilimab (IBI308), Tislelizumab (BGB-A317), Toripalimab (JS 001), Dostarlimab (TSR-042, WBP-285), INCMGA00012 (MGA012), AMP-224, AMP-514, KN035, CK-301, AUNP12, CA-170, or BMS-986189.

[0148] In any of the preceding embodiments of the methods disclosed herein, the PCBP2 inhibitor reduces the expression and / or activity of PCBP2 mRNA or PCBP2 polypeptides including exon 8 of PCBP2. In some embodiments, the PCBP2 inhibitor is a small molecule, a PCBP2-specific inhibitory nucleic acid, or a PROTAC that specifically targets PCBP2. The PCBP2-specific inhibitory nucleic acid may be a siRNA, a shRNA, an antisense oligonucleotide, or a sgRNA. In other embodiments, the PROTAC that specifically targets PCBP2 comprises an E3 ubiquitin ligase binding moiety (“ULM”) selected from among an IAP E3 ubiquitin ligase binding moiety (an “ILM”), a cereblon E3 ubiquitin ligase binding moiety (a “CLM”), a Von Hippel-Lindae E3 ubiquitin ligase (VHL) binding moiety (VLM), and a mouse double minute 2 homologue (MDM2) E3 ubiquitin ligase binding moiety (MLM). Additionally or alternatively, in some embodiments, the PROTAC that specifically targets PCBP2 comprises a PCBP2 binding moiety (PBM) selected from among HNRPK, PTBP1, and HNRNPL. In certain embodiments of the PROTAC that specifically targets PCBP2, the PBM is coupled to a ULM directly or via a chemical linker.

[0149] In any of the above embodiments of the methods disclosed herein, the PCBP2 inhibitor is administered orally, topically, intranasally, systemically, intravenously, subcutaneously, intraperitoneally, intradermally, intraocularly, iontophoretically, transmucosally, or intramuscularly. Additionally or alternatively, in some embodiments, the immune checkpoint blockade therapy and / or the adoptive cell therapeutic composition is administered pleurally, parenterally, intravenously, subcutaneously, intranodally, intratumorally, intrathecally, intrapleurally or intraperitoneally.

[0150] In any and all embodiments of the methods disclosed herein, the cancer is selected from among an HLA class-II expressing cancer, melanoma, breast cancer, cervical cancer, adrenal cancer, bladder cancer, bone cancer, brain cancer, carcinoma, colon cancer, colorectal cancer, corpus uterine cancer, ear, nose and throat (ENT) cancer, endometrial cancer, esophageal cancer, gastrointestinal cancer, glioblastoma, head and neck cancer, -49- 4856-7271-5486.1Atty. Dkt. No.: 115872-3074 intestinal cancer, kidney cancer, larynx cancer, liver cancer, lung cancer, mesothelioma, nasopharynx cancer, neuroblastoma, oral cancer, ovarian cancer, pancreatic cancer, penile cancer, pharynx cancer, prostate cancer, rectal cancer, sarcoma, seminoma, stomach cancer, teratoma, testicular cancer, thyroid cancer, uterine cancer, vaginal cancer, vascular tumor, and metastases thereof.

[0151] Additionally or alternatively, in some embodiments, the methods of the present technology further comprise administering a cytokine to the cancer patient. The cytokine may be administered prior to, during, or subsequent to administration of the adoptive cell therapeutic composition or the immune checkpoint blockade therapy. In some embodiments, the cytokine is selected from a group consisting of interferon a, interferon β, interferon γ, complement C5a, IL-2, TNF alpha, CD40L, IL12, IL-23, IL15, IL17, CCL1, CCL11, CCL12, CCL13, CCL14-1, CCL14-2, CCL14-3, CCL15-1, CCL15-2, CCL16, CCL17, CCL18, CCL19, CCL19, CCL2, CCL20, CCL21, CCL22, CCL23-1, CCL23-2, CCL24, CCL25-1, CCL25-2, CCL26, CCL27, CCL28, CCL3, CCL3L1, CCL4, CCL4L1, CCL5, CCL6, CCL7, CCL8, CCL9, CCRIO, CCR2, CCR5, CCR6, CCR7, CCR8, CCRLl, CCRL2, CX3CL1, CX3CR, CXCLl, CXCLIO, CXCLl l, CXCLl 2, CXCLl 3, CXCLl 4, CXCLl 5, CXCLl 6, CXCL2, CXCL3, CXCL4, CXCL5, CXCL6, CXCL7, CXCL8, CXCL9, CXCL9, CXCRl, CXCR2, CXCR4, CXCR5, CXCR6, CXCR7 and XCL2.

[0152] Additionally or alternatively, in some embodiments of the methods disclosed herein, the PCBP2 inhibitor can be administered prior to (e.g., 5 minutes, 15 minutes, 30 minutes, 45 minutes, 1 hour, 2 hours, 4 hours, 6 hours, 12 hours, 24 hours, 48 hours, 72 hours, 96 hours, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 8 weeks, or 12 weeks before), simultaneously with, or subsequent to (e.g., 5 minutes, 15 minutes, 30 minutes, 45 minutes, 1 hour, 2 hours, 4 hours, 6 hours, 12 hours, 24 hours, 48 hours, 72 hours, 96 hours, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 8 weeks, or 12 weeks after) the administration of an immunotherapy (e.g., immune checkpoint blockade or adoptive cell therapeutic composition) to a cancer patient.

[0153] In some embodiments, the PCBP2 inhibitor and immunotherapy (e.g., immune checkpoint blockade or adoptive cell therapeutic composition) are administered to a patient, for example, a mammal, such as a human, in a sequence and within a time interval such that the inhibitor that is administered first acts together with the inhibitor that is administered second to provide greater benefit than if each inhibitor were administered alone. For -50- 4856-7271-5486.1Atty. Dkt. No.: 115872-3074 example, the PCBP2 inhibitor and immunotherapy (e.g., immune checkpoint blockade or adoptive cell therapeutic composition) can be administered at the same time or sequentially in any order at different points in time; however, if not administered at the same time, the PCBP2 inhibitor and immunotherapy (e.g., immune checkpoint blockade or adoptive cell therapeutic composition) are administered sufficiently close in time so as to provide the desired therapeutic or prophylactic effect of the combination of the at least two therapeutic agents. In one embodiment, the PCBP2 inhibitor and immunotherapy (e.g., immune checkpoint blockade or adoptive cell therapeutic composition) exert their effects at times which overlap. In some embodiments, the PCBP2 inhibitor and immunotherapy (e.g., immune checkpoint blockade or adoptive cell therapeutic composition) are each administered as separate dosage forms, in any appropriate form and by any suitable route. In other embodiments, the PCBP2 inhibitor and immunotherapy (e.g., immune checkpoint blockade or adoptive cell therapeutic composition) are administered simultaneously in a single dosage form.

[0154] It will be appreciated that the frequency with which any of these therapeutic agents can be administered can be once or more than once over a period of about 2 days, about 3 days, about 4 days, about 5 days, about 6 days, about 7 days, about 8 days, about 9 days, about 10 days, about 11 days, about 12 days, about 13 days, about 14 days, about 20 days, about 28 days, about a week, about 2 weeks, about 3 weeks, about 4 weeks, about a month, about every 2 months, about every 3 months, about every 4 months, about every 5 months, about every 6 months, about every 7 months, about every 8 months, about every 9 months, about every 10 months, about every 11 months, about every year, about every 2 years, about every 3 years, about every 4 years, or about every 5 years. Articles of Manufacture and Kits

[0155] The presently disclosed subject matter provides kits for the treatment of an HLA expressing cancer. In certain embodiments, the kit comprises a therapeutic composition containing an effective amount of any and all embodiments of the PCBP2 inhibitor disclosed herein. In some embodiments, the kits further comprise at least one of an immune checkpoint inhibitor, and / or reagents for an adoptive cell therapeutic composition. Examples of reagents for an adoptive cell therapeutic composition include polynucleotides and vectors comprising TCR (i.e. heterologous T-cell receptor) constructs or CAR (i.e. chimeric antigen receptor) constructs. In some embodiments, the kit comprises a sterile -51- 4856-7271-5486.1Atty. Dkt. No.: 115872-3074 container which contains the therapeutic PCBP2 inhibitor; such containers can be boxes, ampules, bottles, vials, tubes, bags, pouches, blister-packs, or other suitable container forms known in the art. Such containers can be made of plastic, glass, laminated paper, metal foil, or other materials suitable for holding medicaments.

[0156] Examples of immune checkpoint inhibitor may include an anti-PD-1 antibody, an anti-PD-L1 antibody, an anti-PD-L2 antibody, an anti-CTLA-4 antibody, an anti-TIM3 antibody, an anti-4-1BB antibody, an anti-CD73 antibody, an anti-GITR antibody, and an anti-LAG-3 antibody. In some embodiments, the immune checkpoint inhibitor comprises one or more of pembrolizumab, nivolumab, cemiplimab, atezolizumab, avelumab, durvalumab, ipilimumab, tremelimumab, ticlimumab, JTX-4014, Spartalizumab (PDR001), Camrelizumab (SHR1210), Sintilimab (IBI308), Tislelizumab (BGB-A317), Toripalimab (JS 001), Dostarlimab (TSR-042, WBP-285), INCMGA00012 (MGA012), AMP-224, AMP-514, KN035, CK-301, AUNP12, CA-170, or BMS-986189.

[0157] Additionally or alternatively, in some embodiments of the kits, the PCBP2 inhibitor, the immune checkpoint inhibitor, and / or the adoptive cell therapeutic composition is formulated for intravenous, intramuscular, intraarterial, intrathecal, intracapsular, intraorbital, intradermal, intraperitoneal, transtracheal, subcutaneous, intracerebroventricular, oral or intranasal administration.

[0158] Optionally, the above described components of the kits of the present technology are packed in suitable containers and labeled for treatment of an HLA expressing cancer in a subject. The above-mentioned components may be stored in unit or multi-dose containers, for example, sealed ampoules, vials, bottles, syringes, and test tubes, as an aqueous, preferably sterile, solution or as a lyophilized, preferably sterile, formulation for reconstitution. The kit may further comprise a second container which holds a diluent suitable for diluting the pharmaceutical composition towards a higher volume. Suitable diluents include, but are not limited to, the pharmaceutically acceptable excipient of the pharmaceutical composition. Furthermore, the kit may comprise instructions for diluting the pharmaceutical composition and / or instructions for administering the pharmaceutical composition, whether diluted or not. The containers may be formed from a variety of materials such as glass or plastic and may have a sterile access port (for example, the container may be an intravenous solution bag or a vial having a stopper which may be pierced by a hypodermic injection needle). The kit may further comprise more containers -52- 4856-7271-5486.1Atty. Dkt. No.: 115872-3074 comprising a pharmaceutically acceptable buffer, such as phosphate-buffered saline, Ringer's solution and dextrose solution. It may further include other materials desirable from a commercial and user standpoint, including other buffers, diluents, filters, needles, syringes, etc.

[0159] The instructions will generally include information about the use of the composition for the treatment of cancer. In other embodiments, the instructions include at least one of the following: description of the therapeutic agent; dosage schedule and administration for treatment or prevention of cancer or symptoms thereof; precautions; warnings; indications; counter-indications; overdose information; adverse reactions; animal pharmacology; clinical studies; and / or references. The instructions may be printed directly on the container (when present), or as a label applied to the container, or as a separate sheet, pamphlet, card, or folder supplied in or with the container. EXAMPLES

[0160] The present technology is further illustrated by the following Examples, which should not be construed as limiting in any way. The examples herein are provided to illustrate advantages of the present technology and to further assist a person of ordinary skill in the art with preparing or using the compositions and systems of the present technology. The examples should in no way be construed as limiting the scope of the present technology, as defined by the appended claims. The examples can include or incorporate any of the variations, aspects, or embodiments of the present technology described above. The variations, aspects, or embodiments described above may also further each include or incorporate the variations of any or all other variations, aspects or embodiments of the present technology. Example 1: Identification of PCBP2 as a Sensitizer to CD4+ T cell-mediated Killing in Cancer Cells

[0161] The melanoma cell line A375 was modified to stably express Cas9. The Cas9 expressing A375 cells were infected with the whole genome Brunello CRISPR knockout library and subsequently challenged with either control CD4+ T cells or CD4+ T-cells expressing the HLA-II restricted TCR 6F9 (FIG.1A), which recognizes the tumor- associated antigen MAGE-A3 / A6. FIG.1B shows a volcano plot depicting the depleted -53- 4856-7271-5486.1Atty. Dkt. No.: 115872-3074 and enriched sgRNAs conferring sensitization or resistance to CD4+ T-cell killing, respectively. As shown in FIG.1B, PCBP2 depletion in HLA-II expressing A375 cells were significantly sensitized to killing mediated by CD4+ T cells expressing the HLA-II restricted TCR.

[0162] A custom made CRISPR knockout library (4 sgRNAs per gene) was generated targeting the 200 most significantly depleted and enriched genes discovered in the whole genome screen shown in FIG.1. The melanoma cell lines A375 and SK-MEL-130, the cervical cancer cell line HeLa, and the breast cancer cell line MB-468 were modified to stably express Cas9. Cas9-expressing tumor cells were infected with the focused library and subsequently challenged with either control CD4+ T cells or CD4+ T cells expressing the HLA-II restricted TCR 6F9 recognizing the tumor-associated antigen MAGE-A3 / A6 (A375 and SK-MEL-130) or expressing the HLA-II restricted TCR TA10 recognizing the tumor-antigen KK-LC-1 (HeLa and MB-468). PCBP2 depletion in HLA-II expressing cancers (melanoma cells, cervical cancer cells, and breast cancer cells) were significantly sensitized to killing mediated by CD4+ T cells expressing the HLA-II restricted TCR. See FIG.2.

[0163] The indicated melanoma cell lines stably expressing a nuclear localized mCherry reporter were electroporated with CRISPR / Cas9 RNPs targeting either the safer harbor locus AAVS1 or PCBP2. Knockout of PCBP2 was confirmed by ICE analysis (inference of CRISPR edits) and the indel rate is indicated. Genomic deletion of PCBP2 was also found to sensitize tumor cells to killing mediated by CD4+ T cells expressing an HLA-II restricted TCR in in vitro cytotoxicity assays (FIGs.3A-3B).

[0164] The indicated sgRNA guide sequences (FIG.4A) targeting components of the HLA class I antigen presentation pathway (B2M, TAP1, TAP2, TAPBP) or targeting the HLA class II master transcription factor CIITA were cloned into the lentiviral plasmid lentiCRISPR v2 (Addgene: #52961). A375 melanoma knockout cell lines were generated by lentiviral transduction and were selected with puromycin for at least 7 days prior to experiments. Cell lines were stained for HLA class I and HLA class II expression using the monoclonal antibodies W6 / 32-FITC or Tu39-APC, respectively. As shown in FIG.4B, disruption of the HLA class I antigen presentation pathway impairs HLA class I but not HLA class II expression. -54- 4856-7271-5486.1Atty. Dkt. No.: 115872-3074

[0165] mCherry+A375 melanoma cells were generated by retroviral transduction of a nuclear localized mCherry reporter. CD8+T cells were transduced with the HLA-A*02:01- restricted TCR 1G4 recognizing a peptide processed from NY-ESO-1 and CD4+T cells were transduced with the HLA-DP*04:01-restricted TCR 6F9 recognizing a peptide processed from MAGE-A3 / A6. mCherry+A375 (HLA-A*02:01+, HLA-DP*04:01+) were co-cultured with the indicated T cell populations or without T cells and tumor cell growth was followed over time with Incucyte. As shown in FIGs.5A-5B, disruption of the HLA class I antigen presentation pathway impaired cytolysis by tumor specific HLA class I- restricted CD8+ T cells but not by HLA class II-restricted CD4+ T cells. Further, ablation of HLA class II antigen presentation pathway inhibited cytolysis by HLA class II-restricted CD4+ T cells but not by HLA class I-restricted CD8+ T cells.

[0166] Cancer cells express multiple PCBP2 splice variants (FIGs.6A-6D). Conditioned media (CM) was generated by culturing parental A375 melanoma cells with control CD4+ T cells or CD4+ T cells expressing the HLA-II restricted TCR 6F9. CM was added to A375 melanoma cells edited at the AAVS1 or PCBP2 locus in the presence or absence of TNF- and IFNγ-neutralizing antibodies, and induction of apoptosis was assessed in an Incucyte instrument by measuring green object count (corresponding to tumor cells positive for active Caspase 3 / 7) over time. As shown in FIGs.7A-7B, genomic deletion of PCBP2 primes tumor cells for apoptosis induced by T cell-derived inflammatory cytokines.

[0167] A clonal A375 melanoma cell line lacking expression of endogenous PCBP2 (A375 PCBP2 null) was generated by electroporation with a CRISPR / Cas9 RNP targeting PCBP2 followed by single cell-cloning. N-terminally FLAG-tagged full length (fl) PCBP2 cDNA, PCBP2 cDNA lacking coding Exon 8 (ΔE8), or an empty control vector was retrovirally expressed in A375 PCBP2 null cells. A375 PCBP2 null cells modified as indicated were exposed to recombinant human TNF (100 ng / ml) and IFNγ (100 ng / ml), and induction of apoptosis was assessed in an Incucyte instrument by measuring green object count (corresponding to tumor cells positive for active Caspase 3 / 7) over time. Cytokine responsiveness was selectively regulated by PCBP2 lacking coding Exon 8 (FIGs.8A-8D.)

[0168] A375 melanoma cells were edited by electroporation with CRISPR / Cas9 RNPs targeting either the safe harbor locus AAVS1, PCBP2 coding Exon 2 or PCBP2 coding Exon 8. qRT-PCR primer were designed that specifically amplify PCBP2 fl or PCBP2 ΔE8. RNA was isolated from edited-tumor cells and transcribed into cDNA. Induction of -55- 4856-7271-5486.1Atty. Dkt. No.: 115872-3074 apoptosis in edited tumor cells upon exposure to recombinant human TNF (1 ng / ml) and IFNγ (1 ng / ml) was assessed in an Incucyte instrument by measuring green object count (corresponding to tumor cells positive for active Caspase 3 / 7) over time. As shown in FIGs.9A-9D, selective deletion of PCBP2 full length using Cas9 phenocopies re- expression of PCBP2 ΔE8 cDNA in A375 PCBP2 null cells.

[0169] A375 melanoma cells were transduced with lentiviral constructs expressing RfxCas13d and a non-targeting (NTC) Cas13d guide, Cas13d guides targeting the PCBP2 coding exon 7 / 9 splice junction specific to PCBP2 ΔE8 mRNA or Cas13d guides targeting CD71 as a specificity control. qRT-PCR primer were designed that specifically amplify PCBP2 fl or PCBP2 ΔE8. RNA was isolated from edited-tumor cells and transcribed into cDNA. Induction of apoptosis in RfxCas13d-transduced tumor cells upon exposure to recombinant human TNF (1 ng / ml) and IFNγ (1 ng / ml) was assessed in an Incucyte instrument by measuring green object count (corresponding to tumor cells positive for active Caspase 3 / 7) over time. These results demonstrate that selective deletion of PCBP2 ΔE8 phenocopies re-expression of PCBP2 full length cDNA in A375 PCBP2 null cells (FIGs.10A-10C).

[0170] A375 melanoma cells stably expressing a nuclear localized mCherry reporter were electroporated with a CRISPR / Cas9 RNP targeting PCBP2 followed by single cell- cloning to generate A375 / mCherry PCBP2 null cells. N-terminally FLAG-tagged PCBP2 cDNA lacking coding Exon 8 (ΔE8) harboring the GXXG -> GDDG mutation in the indicated KH domain(s), or an empty control vector was retrovirally expressed in A375 / mCherry PCBP2 null cells. The GXXG -> GDDG mutation impairs the RNA- binding capacity of the KH-domain (Hollingworth D. et al., Nucleic Acids Res, 2012). Induction of apoptosis upon exposure to recombinant human TNF (100 ng / ml) and IFNγ (100 ng / ml) was assessed after 48 h in an Incucyte instrument by measuring green object count per field (corresponding to tumor cells positive for active Caspase 3 / 7) relative to red object count per field (corresponding to the number of tumor cells per field). As shown in FIGs.11A-11B, cytokine responsiveness is selectively regulated by the RNA-binding domain KH3 of PCBP2 ΔE8.

[0171] Taken together, these results demonstrate that agents that inhibit the expression and / or activity of PCBP2 in cancer cells are useful in enhancing the efficacy of -56- 4856-7271-5486.1Atty. Dkt. No.: 115872-3074 immunotherapy (e.g., immune checkpoint blockade or adoptive cell therapeutic composition) in cancer patients. EQUIVALENTS

[0172] The present technology is not to be limited in terms of the particular embodiments described in this application, which are intended as single illustrations of individual aspects of the present technology. Many modifications and variations of this present technology can be made without departing from its spirit and scope, as will be apparent to those skilled in the art. Functionally equivalent methods and apparatuses within the scope of the present technology, in addition to those enumerated herein, will be apparent to those skilled in the art from the foregoing descriptions. Such modifications and variations are intended to fall within the scope of the present technology. It is to be understood that this present technology is not limited to particular methods, reagents, compounds compositions or biological systems, which can, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting.

[0173] In addition, where features or aspects of the disclosure are described in terms of Markush groups, those skilled in the art will recognize that the disclosure is also thereby described in terms of any individual member or subgroup of members of the Markush group.

[0174] As will be understood by one skilled in the art, for any and all purposes, particularly in terms of providing a written description, all ranges disclosed herein also encompass any and all possible subranges and combinations of subranges thereof. Any listed range can be easily recognized as sufficiently describing and enabling the same range being broken down into at least equal halves, thirds, quarters, fifths, tenths, etc. As a non- limiting example, each range discussed herein can be readily broken down into a lower third, middle third and upper third, etc. As will also be understood by one skilled in the art all language such as “up to,” “at least,” “greater than,” “less than,” and the like, include the number recited and refer to ranges which can be subsequently broken down into subranges as discussed above. Finally, as will be understood by one skilled in the art, a range includes each individual member. Thus, for example, a group having 1-3 cells refers to groups -57- 4856-7271-5486.1Atty. Dkt. No.: 115872-3074 having 1, 2, or 3 cells. Similarly, a group having 1-5 cells refers to groups having 1, 2, 3, 4, or 5 cells, and so forth.

[0175] All patents, patent applications, provisional applications, and publications referred to or cited herein are incorporated by reference in their entirety, including all figures and tables, to the extent they are not inconsistent with the explicit teachings of this specification. -58- 4856-7271-5486.1

Claims

Atty. Dkt. No.: 115872-3074 WHAT IS CLAIMED IS 1. A method for sensitizing a cancer patient to immunotherapy comprising administering to the cancer patient an effective amount of a PCBP2 inhibitor separately, sequentially or simultaneously with the immunotherapy.

2. The method of claim 1, wherein the immunotherapy comprises immune checkpoint blockade therapy or an adoptive cell therapeutic composition comprising T cells.

3. The method of claim 2, wherein the immune checkpoint blockade therapy comprises one or more of an anti-PD-1 antibody, an anti-PD-L1 antibody, an anti-PD-L2 antibody, an anti-CTLA-4 antibody, an anti-TIM3 antibody, an anti-4-1BB antibody, an anti-CD73 antibody, an anti-GITR antibody, and an anti-LAG-3 antibody.

4. The method of claim 2 or 3, wherein the immune checkpoint blockade therapy comprises one or more of pembrolizumab, nivolumab, cemiplimab, atezolizumab, avelumab, durvalumab, ipilimumab, tremelimumab, ticlimumab, JTX-4014, Spartalizumab (PDR001), Camrelizumab (SHR1210), Sintilimab (IBI308), Tislelizumab (BGB-A317), Toripalimab (JS 001), Dostarlimab (TSR-042, WBP-285), INCMGA00012 (MGA012), AMP-224, AMP-514, KN035, CK-301, AUNP12, CA-170, or BMS-986189.

5. The method of claim 2, wherein the adoptive cell therapeutic composition is obtained from an autologous donor or allogeneic donor.

6. The method of claim 2 or 5, wherein the T cells comprise a native TCR or a heterologous TCR.

7. The method of claim 6, wherein the native TCR or the heterologous TCR is HLA-I restricted or HLA-II restricted.

8. The method of any one of claims 2 or 5-7, wherein the adoptive cell therapeutic composition comprises one or more of tumor infiltrating T cells, CD8+ T cells, CD4+ T cells, delta-gamma T-cells, and alpha-beta T-cells.

9. The method of any one of claims 1-8, wherein the PCBP2 inhibitor reduces the expression and / or activity of PCBP2 mRNA including exon 8 of PCBP2.

10. The method of any one of claims 1-8, wherein the PCBP2 inhibitor reduces the expression and / or activity of PCBP2 polypeptides comprising exon 8 of PCBP2. -59- 4856-7271-5486.1Atty. Dkt. No.: 115872-3074 11. The method of any one of claims 1-10, wherein the PCBP2 inhibitor is a small molecule, a PCBP2-specific inhibitory nucleic acid, or a PROTAC that specifically targets PCBP2.

12. The method of claim 11, wherein the PCBP2-specific inhibitory nucleic acid is a siRNA, a shRNA, an antisense oligonucleotide, or a sgRNA.

13. The method of claim 11, wherein the PROTAC that specifically targets PCBP2 comprises an E3 ubiquitin ligase binding moiety (“ULM”) selected from among an IAP E3 ubiquitin ligase binding moiety (an “ILM”), a cereblon E3 ubiquitin ligase binding moiety (a “CLM”), a Von Hippel-Lindae E3 ubiquitin ligase (VHL) binding moiety (VLM), and a mouse double minute 2 homologue (MDM2) E3 ubiquitin ligase binding moiety (MLM).

14. The method of claim 11 or 13, wherein the PROTAC that specifically targets PCBP2 comprises a PCBP2 binding moiety (PBM) selected from among HNRPK, PTBP1, and HNRNPL.

15. The method of any one of claims 1-14, wherein the PCBP2 inhibitor is administered orally, topically, intranasally, systemically, intravenously, subcutaneously, intraperitoneally, intradermally, intraocularly, iontophoretically, transmucosally, or intramuscularly.

16. The method of any one of claims 1-15, wherein the immune checkpoint blockade therapy or the adoptive cell therapeutic composition is administered pleurally, parenterally, intravenously, subcutaneously, intranodally, intratumorally, intrathecally, intrapleurally or intraperitoneally.

17. The method of any one of claims 1-16, wherein the cancer is selected from among an HLA class-II expressing cancer, melanoma, breast cancer, cervical cancer, adrenal cancer, bladder cancer, bone cancer, brain cancer, carcinoma, colon cancer, colorectal cancer, corpus uterine cancer, ear, nose and throat (ENT) cancer, endometrial cancer, esophageal cancer, gastrointestinal cancer, glioblastoma, head and neck cancer, intestinal cancer, kidney cancer, larynx cancer, liver cancer, lung cancer, mesothelioma, nasopharynx cancer, neuroblastoma, oral cancer, ovarian cancer, pancreatic cancer, penile cancer, pharynx cancer, prostate cancer, rectal cancer, sarcoma, seminoma, stomach cancer, -60- 4856-7271-5486.1Atty. Dkt. No.: 115872-3074 teratoma, testicular cancer, thyroid cancer, uterine cancer, vaginal cancer, vascular tumor, and metastases thereof.

18. The method of any one of claims 1-17, further comprising administering a cytokine to the cancer patient.

19. The method of claim 18, wherein the cytokine is administered prior to, during, or subsequent to administration of the adoptive cell therapeutic composition or the immune checkpoint blockade therapy.

20. The method of claim 18 or 19, wherein the cytokine is selected from a group consisting of interferon a, interferon β, interferon γ, complement C5a, IL-2, TNF alpha, CD40L, IL12, IL-23, IL15, IL17, CCL1, CCL11, CCL12, CCL13, CCL14-1, CCL14-2, CCL14-3, CCL15-1, CCL15-2, CCL16, CCL17, CCL18, CCL19, CCL19, CCL2, CCL20, CCL21, CCL22, CCL23-1, CCL23-2, CCL24, CCL25-1, CCL25-2, CCL26, CCL27, CCL28, CCL3, CCL3L1, CCL4, CCL4L1, CCL5, CCL6, CCL7, CCL8, CCL9, CCRIO, CCR2, CCR5, CCR6, CCR7, CCR8, CCRLl, CCRL2, CX3CL1, CX3CR, CXCLl, CXCLIO, CXCLl l, CXCLl 2, CXCLl 3, CXCLl 4, CXCLl 5, CXCLl 6, CXCL2, CXCL3, CXCL4, CXCL5, CXCL6, CXCL7, CXCL8, CXCL9, CXCL9, CXCRl, CXCR2, CXCR4, CXCR5, CXCR6, CXCR7 and XCL2.

21. The method of any one of claims 1-20, wherein the cancer patient has previously received immunotherapy.

22. The method of any one of claims 1-21, wherein the cancer patient is resistant or non-responsive to immunotherapy. -61- 4856-7271-5486.1

Images