Respiratory syncytial virus f protein and use thereof

Abstract

The present invention relates to a respiratory syncytial virus F protein and the use thereof. In particular, the present invention relates to a recombinant respiratory syncytial virus (RSV) F polypeptide. The recombinant RSV F polypeptide is in a stable pre-fusion conformation, and the recombinant RSV F polypeptide comprises an F1 domain and an F2 domain. The present invention also relates to a nucleic acid molecule encoding the recombinant RSV F polypeptide, a vector, an immune composition, and the use thereof.

Description

Respiratory syncytial virus F protein and its application Technical Field

[0001] The present disclosure relates to the field of biotechnology, and in particular to polypeptides, nucleic acid molecules, compositions and methods of use thereof capable of inducing and detecting immune responses against respiratory syncytial virus (RSV). Background Art

[0002] Respiratory syncytial virus (RSV) is an enveloped, non-segmented, negative-strand RNA virus in the genus Pneumovirus, family Paramyxoviridae. RSV infection imposes a significant burden on infants, individuals with impaired heart, lung, or immune function, and the elderly. Almost all children will be infected with RSV before the age of two. RSV is a leading cause of hospitalization in infants and the elderly. Moderate to severe RSV illness may also lead to the subsequent development of asthma and chronic wheezing. This phenomenon may be caused by factors such as RSV immune sensitization, lung development, and neurodevelopment. However, there is no specific treatment for RSV-induced bronchiolitis. Treatment primarily involves symptomatic treatment, such as oxygen support and fluid therapy, anti-infective therapy (including interferon nebulization), and anti-inflammatory and anti-asthmatic therapy (nebulized and medication). Ultimately, recovery relies on the body's own immune system.

[0003] Vaccines are the most cost-effective way to prevent RSV infection. Of the three surface proteins of RSV (F, G, and SH), antibodies specific for the F protein account for the majority of neutralizing activity in infected human sera, making the F protein the focus of many vaccine efforts.

[0004] The F protein is a trimeric type I fusion glycoprotein that is responsible for merging the viral membrane with the cell membrane, and like many other viral fusion glycoproteins, it undergoes a major structural rearrangement when transitioning from the pre-fusion state (Pre-F) to the post-fusion state (Post-F). Studies have found that Post-F cannot stimulate the body to produce sufficient neutralizing antibodies, and the amount of Pre-F-specific antibodies determines the magnitude of RSV neutralizing activity in human serum. Studies have shown that neutralizing antibodies against Pre-F can not only neutralize RSV virus but also effectively avoid the risk of enhanced respiratory disease (ERD). However, the Pre-F conformation is relatively unstable, and how to stabilize the Pre-F conformation has become the focus of RSV vaccine research and development.

[0005] Summary of the Invention

[0006] To address one of the aforementioned technical problems in the prior art, the present invention compares the protein structures of the pre-fusion F (Pre-F) and post-fusion F (Post-F) proteins of respiratory syncytial virus (RSV) and finds that significant structural rearrangements occur in some regions of the two proteins. Based on this, amino acid mutations are introduced into the F protein through genetic engineering. These mutations inhibit conformational rearrangements by forming disulfide bonds, ionic bonds, hydrophobic interactions, and other mechanisms within the amino acid sequence, thereby stabilizing the F protein in its pre-fusion Pre-F conformation.

[0007] According to one aspect of the present disclosure, a recombinant respiratory syncytial virus (RSV) F polypeptide is provided, wherein the recombinant RSV F polypeptide is stably in a prefusion conformation, and the recombinant RSV F polypeptide comprises an F1 domain and an F2 domain.

[0008] In some embodiments, the recombinant RSV F polypeptide is stabilized in a prefusion conformation by introducing a disulfide bond between one or more non-naturally occurring hydrophobic amino acids, at least one pair of non-naturally occurring amino acids with opposing electrostatics, at least one pair of non-naturally occurring proline residues, and / or at least one pair of non-natural cysteines.

[0009] In some embodiments, the recombinant RSV F polypeptide can have an amino acid sequence as set forth in SEQ ID NO: 8 or SEQ ID NO: 23, and the recombinant RSV F polypeptide has an amino acid sequence as shown in SEQ ID NO: 26, 29, 30, 31, 32, 33, 34, 35, 55, 57, 59, 61, 62, 65, 67, 74, 75, 79, 80, 83, 86, 87, 90, 137, 138, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 155, 158, 159, 172, 173, 174, 178, 180, 181, 182, 183, 186, 187, 188, 189, 190, 193 、195、196、207、210、211、213、214、217、227、229、241、253、254、256、279、286、290、291、298、302、332、334、337、338、339、340、353、354、355、356、368、370、371、373、394、396、397、398、399、400、404、406、407、427、443、445、449、458、459、 one or more of positions 460, 461, 462, 463, 465, 466, 467, 468, 469, 470, 471, 473, 474, 475, 480, 482, 483, 484, 485, 486, 487, 488, 489, 491, 494, 499, 502, 505, 506, 508, 509, 512, 513, 515, 516, 520, 522, and 523 have amino acid mutations.

[0010] In some embodiments, the F2 domain includes 8 to 84 amino acid residues corresponding to amino acids 26 to 109 of the wild-type RSV F protein. In some embodiments, the F1 domain includes 14 to 393 amino acid residues corresponding to amino acids 137 to 529 of the wild-type RSV F protein.

[0011] In some embodiments, the F1 domain and the F2 domain may be directly connected or connected via a linker. In a specific embodiment, the F1 domain and the F2 domain may be connected via a linker, for example, via GSGSGR (SEQ ID NO: 2).

[0012] In some embodiments, in order to increase the expression level of the F protein, aa 109 to 136 of the F protein are replaced with a linker.

[0013] In some embodiments, the recombinant RSV F polypeptide includes amino acids 1 to 513 corresponding to wild-type RSV F protein; in some embodiments, the recombinant RSV F polypeptide includes amino acids 1 to 526 corresponding to wild-type RSV F protein;

[0014] In some embodiments, the recombinant RSV F polypeptide can include one or more of the following mutations compared to a wild-type RSV F protein:

[0015] glutamine (Q) to cysteine ​​(C) mutation at position 26 (Q26C);

[0016] mutation of threonine (T) to cysteine ​​(C) at position 29 (T29C);

[0017] mutation of glutamic acid (E) to cysteine ​​(C) at position 30 (E30C);

[0018] Mutation of glutamic acid (E) to cysteine ​​(C) at position 31 (E31C)

[0019] mutation of phenylalanine (F) to cysteine ​​(C) at position 32 (F32C);

[0020] mutation of tyrosine (Y) to cysteine ​​(C) at position 33 (Y33C);

[0021] glutamine (Q) to cysteine ​​(C) mutation at position 34 (Q34C);

[0022] mutation of serine (S) to cysteine ​​(C) at position 35 (S35C);

[0023] mutation of serine (S) to cysteine ​​(C) at position 55 (S55C);

[0024] mutation of isoleucine (I) to cysteine ​​(C) at position 57 (I57C);

[0025] mutation of isoleucine (I) to cysteine ​​(C) at position 59 (I59C);

[0026] mutation of leucine (L) to cysteine ​​(C) at position 61 (L61C);

[0027] a mutation at position 62 from serine (S) to cysteine ​​(C), leucine (L), or proline (P) (S62C, S62L, or S62P);

[0028] lysine (K) to cysteine ​​(C) mutation at position 65 (K65C);

[0029] a mutation at position 67 from asparagine (N) to alanine (A), cysteine ​​(C), leucine (L), or valine (V) (N67A, N67C, N67L, or N67V);

[0030] a mutation at position 74 from alanine (A) to phenylalanine (F), tryptophan (W), tyrosine (Y), lysine (K), or arginine (R) (A74F, A74W, A74Y, A74K, or A74R);

[0031] lysine (K) to cysteine ​​(C) mutation at position 75 (K75C);

[0032] mutation of isoleucine (I) to leucine (L) at position 79 (I79L);

[0033] a mutation at position 80 from lysine (K) to alanine (A), isoleucine (I), leucine (L), valine (V), phenylalanine (F), tryptophan (W), tyrosine (Y), methionine (M), serine (S), proline (P), or cysteine ​​(C) (K80A, K80I, K80L, K80V, K80F, K80W, K80Y, K80M, K80S, K80P, or K80C);

[0034] mutation of leucine (L) to cysteine ​​(C) at position 83 (L83C);

[0035] a tyrosine (Y) to cysteine ​​(C) mutation at position 86 (Y86C);

[0036] a mutation at position 87 from lysine (K) to alanine (A), isoleucine (I), leucine (L), valine (V), phenylalanine (F), tryptophan (W), tyrosine (Y), methionine (M), serine (S), proline (P), or cysteine ​​(C) (K87A, K87I, K87L, K87V, K87F, K87W, K87Y, K87M, K87S, K87P, or K87C);

[0037] mutation of valine (V) to cysteine ​​(C) at position 90 (V90C);

[0038] mutation of phenylalanine (F) to cysteine ​​(C) at position 137 (F137C);

[0039] mutation of leucine (L) to cysteine ​​(C) at position 138 (L138C);

[0040] mutation of phenylalanine (F) to cysteine ​​(C) at position 140 (F140C);

[0041] a mutation at position 141 from leucine (L) to cysteine ​​(C), arginine (R), or lysine (K) (L141C, L141R, or L141K);

[0042] mutation of leucine (L) to cysteine ​​(C) at position 142 (L142C);

[0043] a glycine (G) to cysteine ​​(C) mutation at position 143 (G143C);

[0044] a valine (V) to cysteine ​​(C) mutation at position 144 (V144C);

[0045] mutation of glycine (G) to isoleucine (I) or cysteine ​​(C) at position 145 (G145I or G145C);

[0046] mutation of serine (S) to cysteine ​​(C) at position 146 (S146C);

[0047] mutation of alanine (A) to valine (V) at position 147 (A147V);

[0048] mutation of isoleucine (I) to cysteine ​​(C) at position 148 (I148C);

[0049] alanine (A) to cysteine ​​(C) mutation at position 149 (A149C);

[0050] a mutation at position 150: serine (S) to leucine (L), phenylalanine (F), tryptophan (W), or tyrosine (Y) (S150L, ​​S150F, S150W, or S150Y);

[0051] mutation of glycine (G) to leucine (L) at position 151 (G151L);

[0052] mutation of serine (S) at position 155 to isoleucine (I) or valine (V) (S155I or S155V);

[0053] mutation of leucine (L) to cysteine ​​(C) at position 158 (L158C);

[0054] a histidine (H) to cysteine ​​(C) mutation at position 159 (H159C);

[0055] mutation of leucine (L) to proline (P) at position 172 (L172P);

[0056] mutation of serine (S) to proline (P) at position 173 (S173P);

[0057] mutation of threonine (T) to proline (P) at position 174 (T174P);

[0058] a valine (V) to cysteine ​​(C) mutation at position 178 (V178C);

[0059] mutation of serine (S) to cysteine ​​(C) at position 180 (S180C);

[0060] mutation of leucine (L) to proline (P) at position 181 (L181P);

[0061] mutation of serine (S) to proline (P) at position 182 (S182P);

[0062] mutation of asparagine (N) to proline (P) or aspartic acid (D) at position 183 (N183P or N183D);

[0063] mutation of serine (S) to cysteine ​​(C) at position 186 (S186C);

[0064] a valine (V) to cysteine ​​(C) mutation at position 187 (V187C);

[0065] mutation of leucine (L) to cysteine ​​(C) at position 188 (L188C);

[0066] a mutation from threonine (T) to valine (V) at position 189 (T189V);

[0067] a mutation at position 190 from serine (S) to cysteine ​​(C), phenylalanine (F), or leucine (L) (S190C, S190F, or S190L);

[0068] mutation of leucine (L) to cysteine ​​(C) at position 193 (L193C);

[0069] mutation of leucine (L) to cysteine ​​(C) or lysine (K) at position 195 (L195C or L195K);

[0070] a lysine (K) to cysteine ​​(C) mutation at position 196 (K196C);

[0071] mutation of valine (V) to cysteine ​​(C) or isoleucine (I) at position 207 (V207C or V207I);

[0072] glutamine (Q) to proline (P) mutation at position 210 (Q210P);

[0073] mutation of serine (S) to proline (P) at position 211 (S211P);

[0074] mutation of serine (S) to proline (P) at position 213 (S213P);

[0075] mutation of isoleucine (I) to proline (P) at position 214 (I214P);

[0076] mutation of isoleucine (I) to cysteine ​​(C) at position 217 (I217C);

[0077] an asparagine (N) to glutamic acid (E) mutation at position 227 (N227E);

[0078] mutation of arginine (R) to tyrosine (Y) or tryptophan (W) at position 229 (R229Y or R229W);

[0079] mutation of alanine (A) to cysteine ​​(C) at position 241 (A241C);

[0080] Mutation of threonine (T) to leucine (L) at position 253 (T253L)

[0081] Asparagine (N) to tyrosine (Y) mutation at position 254 (N254Y);

[0082] a glutamic acid (E) to phenylalanine (F) mutation at position 256 (E256F);

[0083] glutamine (Q) to cysteine ​​(C) mutation at position 279 (Q279C);

[0084] a tyrosine (Y) to cysteine ​​(C) mutation at position 286 (Y286C);

[0085] a mutation at position 290 from serine (S) to cysteine ​​(C), proline (P), valine (V), or alanine (A) (S290C, S290P, S290V, or S290A);

[0086] a mutation at position 291 from isoleucine (I) to cysteine ​​(C), glutamic acid (E), or aspartic acid (D) (I291C, I291E, or I291D);

[0087] a mutation at position 298 from alanine (A) to lysine (K), tyrosine (Y), isoleucine (I), leucine (L), or phenylalanine (F) (A298K, A298Y, A298I, A298L, or A298F);

[0088] mutation of glutamine (Q) to leucine (L) or tyrosine (Y) at position 302 (Q302L or Q302V);

[0089] mutation of isoleucine (I) to cysteine ​​(C) at position 332 (I332C);

[0090] mutation of leucine (L) to cysteine ​​(C) at position 334 (L334C);

[0091] a mutation at position 337 from threonine (T) to tryptophan (W), leucine (L), or cysteine ​​(C) (T337W, T337L, or T337C);

[0092] Aspartic acid (D) to cysteine ​​(C) mutation at position 338 (D338C);

[0093] an arginine (R) to cysteine ​​(C) mutation at position 339 (R339C);

[0094] mutation of glycine (G) to phenylalanine (F) or tyrosine (Y) at position 340 (G340F or G340Y);

[0095] mutation of proline (P) to cysteine ​​(C) at position 353 (P353C);

[0096] mutation of glutamine (Q) to cysteine ​​(C) or leucine (L) at position 354 (Q354C or Q354L);

[0097] alanine (A) to leucine (L) mutation at position 355 (A355L);

[0098] a glutamic acid (E) to tryptophan (W) mutation at position 356 (E356W);

[0099] Aspartic acid (D) to leucine (L) mutation at position 368 (D368L);

[0100] mutation of methionine (M) to cysteine ​​(C) at position 370 (M370C);

[0101] a mutation at position 371 from asparagine (N) to cysteine ​​(C), phenylalanine (F), tryptophan (W), tyrosine (Y), leucine (L), or cysteine ​​(C) (N371C, N371F, N371W, N371Y, N371L, or N371C);

[0102] mutation of leucine (L) to cysteine ​​(C) at position 373 (L373C);

[0103] a mutation at position 394 from lysine (K) to cysteine ​​(C), tryptophan (W), phenylalanine (F), tyrosine (Y), or leucine (L) (K394C, K394W, K394F, K394Y, or K394L);

[0104] mutation of methionine (M) to cysteine ​​(C) at position 396 (M396C);

[0105] mutation of threonine (T) to cysteine ​​(C) at position 397 (T397C);

[0106] mutation of serine (S) to cysteine ​​(C) or phenylalanine (F) at position 398 (S398C or S398F);

[0107] a lysine (K) to cysteine ​​(C) mutation at position 399 (K399C);

[0108] mutation of threonine (T) to valine (V) at position 400 (T400V);

[0109] a mutation at position 404 from serine (S) to cysteine ​​(C), valine (V), isoleucine (I), leucine (L), or cysteine ​​(C) (S404C, S404V, S404I, S404L, or S404C);

[0110] a valine (V) to cysteine ​​(C) mutation at position 406 (V406C);

[0111] mutation of isoleucine (I) to cysteine ​​(C) at position 407 (I407C);

[0112] Lysine (K) to arginine (R) mutation at position 427 (K427R);

[0113] mutation of serine (S) to cysteine ​​(C) at position 443 (S443C);

[0114] a lysine (K) to cysteine ​​(C) mutation at position 445 (K445C);

[0115] mutation of threonine (T) to cysteine ​​(C) at position 449 (T449C);

[0116] mutation of tyrosine (Y) to cysteine ​​(C) or proline (P) at position 458 (Y458C or Y458P);

[0117] a valine (V) to proline (P) mutation at position 459 (V459P);

[0118] mutation of asparagine (N) to cysteine ​​(C) or proline (P) at position 460 (N460C or N460P);

[0119] Lysine (K) to proline (P) mutation at position 461 (K461P);

[0120] glutamine (Q) to proline (P) mutation at position 462 (Q462P);

[0121] mutation of glutamic acid (E) to cysteine ​​(C) or proline (P) at position 463 (E463C or E463P);

[0122] a lysine (K) to cysteine ​​(C) mutation at position 465 (K465C);

[0123] mutation of serine (S) to cysteine ​​(C) at position 466 (S466C);

[0124] mutation of leucine (L) to cysteine ​​(C) at position 467 (L467C);

[0125] a tyrosine (Y) to cysteine ​​(C) mutation at position 468 (Y468C);

[0126] a valine (V) to cysteine ​​(C) mutation at position 469 (V469C);

[0127] a lysine (K) to cysteine ​​(C) mutation at position 470 (K470C);

[0128] mutation of glycine (G) to cysteine ​​(C) at position 471 (G471C);

[0129] mutation of proline (P) to cysteine ​​(C) at position 473 (P473C);

[0130] Isoleucine (I) to cysteine ​​(C) mutation at position 474 (I474C);

[0131] mutation of isoleucine (I) to cysteine ​​(C) at position 475 (I475C);

[0132] mutation of proline (P) to cysteine ​​(C) at position 480 (P480C);

[0133] mutation of valine (V) to cysteine ​​(C) or proline (P) at position 482 (V482C or V482P);

[0134] mutation of phenylalanine (F) to cysteine ​​(C) or proline (P) at position 483 (F483C or F483P);

[0135] mutation of proline (P) to cysteine ​​(C) at position 484 (P484C);

[0136] mutation of serine (S) to cysteine ​​(C) at position 485 (S485C);

[0137] Aspartic acid (D) to cysteine ​​(C) mutation at position 486 (D486C);

[0138] mutation of glutamic acid (E) to cysteine ​​(C) at position 487 (E487C);

[0139] a phenylalanine (F) to cysteine ​​(C) mutation at position 488 (F488C);

[0140] a mutation at position 489 from aspartic acid (D) to cysteine ​​(C), phenylalanine (F), or leucine (L) (D489C, D489F, or D489L);

[0141] mutation of serine (S) to cysteine ​​(C) at position 491 (S491C);

[0142] glutamine (Q) to cysteine ​​(C) mutation at position 494 (Q494C);

[0143] Isoleucine (I) to cysteine ​​(C) mutation at position 499 (I499C);

[0144] a mutation at position 502 from serine (S) to cysteine ​​(C), phenylalanine (F), tryptophan (W), or tyrosine (Y) (S502C, S502F, S502W, or S502Y);

[0145] phenylalanine (F) to histidine (H) or lysine (K) at position 505 (F505H or F505K);

[0146] mutation of isoleucine (I) to aspartic acid (D) or glutamic acid (E) at position 506 (I506D or I506E);

[0147] a lysine (K) to cysteine ​​(C) mutation at position 508 (K508C);

[0148] mutation of serine (S) to cysteine ​​(C) at position 509 (S509C);

[0149] mutation of leucine (L) to cysteine ​​(C) at position 512 (L512C);

[0150] mutation of leucine (L) to cysteine ​​(C) at position 513 (L513C);

[0151] mutation of asparagine (N) to cysteine ​​(C) or aspartic acid (D) at position 515 (N515C or N515D);

[0152] a valine (V) to cysteine ​​(C) mutation at position 516 (V516C);

[0153] lysine (K) to arginine (R) mutation at position 520 (K520R);

[0154] a mutation of threonine (T) to cysteine ​​(C) at position 522 (T522C); and

[0155] Mutation of threonine (T) to cysteine ​​(C) at position 523 (T523C).

[0156] In some embodiments, the recombinant RSV F protein is The F polypeptide may include any one or more of the following mutations: (1) P484C and I499C; (2) V482C and I499C; (3) V482C and S502C; (4) M396C and F488C; (5) S398C and S485C; (6) S398C and D486C; (7) I148C and Y286C; (8) H159C and S290C; (9) H159C and I291C; (10) L158C and S290C; (11) Q494C and K399C; (12) D489C and S398C; (13) D489C and D486C; (14) D489C and S485C; (15) N460C and S146C; (16) A149C and Y458C; (17) I64C and K87C; (18) K65C and K87C; (19) L61C and Y86C; (20) S62C and Y86C; (21) L61C and V90C; (22) N67C and L83C; (23) N67C and K80C; (24) S62C and K196C; (25) N67C and V207C; (26) L61C and L195C; and, (27) V144C and M370C.

[0157] In some embodiments, compared to a wild-type RSV F protein, the recombinant RSV F polypeptide can include mutations in: (1) S398C; and, (2) S485C, D486C, or D489C.

[0158] In some embodiments, compared to a wild-type RSV F protein, the recombinant RSV F polypeptide can include mutations in: (1) H159C; and, (2) S290C or I291C.

[0159] In some embodiments, compared to a wild-type RSV F protein, the recombinant RSV F polypeptide can include mutations in: (1) H159C or L158C; and, (2) S290C.

[0160] In some embodiments, compared to a wild-type RSV F protein, the recombinant RSV F polypeptide can include mutations in: (1) D489C; and, (2) S398C, S485C, or D486C.

[0161] In some embodiments, compared to a wild-type RSV F protein, the recombinant RSV F polypeptide can include mutations at amino acid residues 67 and 80. In some embodiments, compared to a wild-type RSV F protein, the recombinant RSV F polypeptide can include mutations at amino acid residues 67 and 80. In some embodiments, compared to a wild-type RSV F protein, the recombinant RSV F polypeptide can include mutations at: (1) N67A; and, (2) K80A, K80I, K80L, K80V, K80F, K80W, K80Y, K80M, K80S, K80P, K87A, K87I, K87L, K87V, K87F, K87W, K87Y, K87M, K87S, or K87P.

[0162] In some embodiments, compared to a wild-type RSV F protein, the recombinant RSV F polypeptide can include mutations in: (1) L61C; and, (2) Y86C, V90C, or L195C.

[0163] In some embodiments, compared to a wild-type RSV F protein, the recombinant RSV F polypeptide can include mutations in: (1) S62C; and, (2) Y86C or K196C.

[0164] In some embodiments, compared to the wild-type RSV F protein, the recombinant RSV F polypeptide can include amino acid mutations at amino acid residues 65 and 87. In some embodiments, compared to the wild-type RSV F protein, the recombinant RSV F polypeptide can include K65C and K87C.

[0165] In some embodiments, the recombinant RSV F polypeptide can include mutations in: (1) N67C; and, (2) K80C, L83C, or V207C, compared to a wild-type RSV F protein.

[0166] In some embodiments, the recombinant RSV F polypeptide can include mutations of the following, compared to the wild-type RSV F protein: (1) F505H or F505K; and, (2) I506D or I506E. In some embodiments, the recombinant RSV F polypeptide can include mutations at position 506, compared to the wild-type RSV F protein, preferably including mutations of the following: (1) I506D; (2) I506E; (3) F505H and I506D; (4) F505H and I506E; (5) F505K and I506D; and, (6) F505K and I506E.

[0167] In some embodiments, the recombinant RSV F polypeptide can include S213P and I214P compared to the wild-type RSV F protein.

[0168] In some embodiments, the recombinant RSV F polypeptide can include Q210P and S211P compared to the wild-type RSV F protein.

[0169] In some embodiments, compared to a wild-type RSV F protein, the recombinant RSV F polypeptide can include mutations in: (1) S173P; and, (2) L172P or T174P.

[0170] In some embodiments, compared to the wild-type RSV F protein, the recombinant RSV F polypeptide can include mutations in: (1) S182P; and, (2) L181P or N183P.

[0171] In some embodiments, compared to the wild-type RSV F protein, the recombinant RSV F polypeptide can include amino acid mutations at amino acid residues 144 and 370. In some embodiments, compared to the wild-type RSV F protein, the recombinant RSV F polypeptide can include V144C and M370C.

[0172] In some embodiments, the recombinant RSV F polypeptide can include mutations in: (1) N67A; (2) K80A; and, (3) K87A, K87I, K87L, K87V, K87F, K87W, K87Y, K87M, K87S, or K87P, compared to a wild-type RSV F protein.

[0173] In some embodiments, the recombinant RSV F polypeptide can include mutations in: (1) I57C; (2) S190C; (3) V178C or S180C; and, (4) S186C, V187C, or L188C, compared to a wild-type RSV F protein.

[0174] In some embodiments, the recombinant RSV F polypeptide can include I59C, L193C, S180C, and S186C, compared to a wild-type RSV F protein.

[0175] In some embodiments, compared to wild-type RSV F protein, the recombinant RSV F polypeptide can include mutations in: (1) I59C; (2) S190C; (3) V178C; and, (4) V187C or L188C.

[0176] In some embodiments, except K65C and K87C mutations, the recombinant RSV F polypeptide can also have one or more mutations at other amino acid positions. In some embodiments, except K65C and K87C mutations, the recombinant RSV F polypeptide can also have a mutation at one or more amino acid residues in positions 62, 74, 141, 145, 150, 151, 155, 211, 254, 290, 291, 298, 337, 340, 458, 459, 460, 461, 462, 463, 482, 483, 489 and 502.

[0177] In some embodiments, in addition to the K65C and K87C mutations, the recombinant RSV The F polypeptide may also include mutations in any of the following: S62L or S62P; A74F, A74W, A74Y, A74K or A74R; L141R or L141K; G145I; S150L; G151L; S155I; S211P; N254Y; S290P; I291E or I291D; A298K, A298Y, A298I or A298L; T337W; G340F or G340Y; Y458P; V459P; N460P; K461P; Q462P; E463P; V482P; F483P; D489F; and / or, S502F, S502W or S502Y.

[0178] In some embodiments, in addition to the K65C and K87C mutations, the recombinant RSV F polypeptide can also be found at 26, 29, 30, 31, 32, 33, 34, 35, 55, 57, 62, 67, 74, 75, 79, 80, 87, 137, 138, 140, 141, 142, 143, 144, 145, 146, 147, 149, 150, 151, 155, 159, 183, 188, 189, 190, 195, 207, 211, 217, 227, 229, 241, 253, 254, 256, 279, 290, 291, 298, 302, 332, 334, 337, 338, 339, 340, 353, 354, 355, 3 505, 506, 508, 509, 512, 513, 515, 516, 520, 522, 523, 527, 530, 531, 532, 533, 534, 536, 537, 538, 539, 540, 541, 542, 543, 544, 545, 546, 547, 548, 549, 550, 551, 552, 553, 554, 555

[0179] In some embodiments, in addition to the K65C and K87C mutations, the recombinant RSV F polypeptide can also include any of the following mutations:

[0180] (1) F505H or F505K; and, I506D or I506E,

[0181] (2) L141C, L141R, or L141K; and N371C or L373C,

[0182] (3) V144C, G145C, or S146C; and, M370C,

[0183] (4) L138C; and, Q354C or D338C,

[0184] (5) L334C; and I475C,

[0185] (6) F137C; and, T337C, D338C, R339C, or P353C,

[0186] (7) I57C; and S190C,

[0187] (8) S55C; and L188C,

[0188] (9) H159C; and I291C, I291E, or I291D,

[0189] (10) Q34C; and K470C or G471C,

[0190] (11) S35C; and, P473C or I474C,

[0191] (12) I332C; and P480C or F483C,

[0192] (13) M396C; and, F488C,

[0193] (14) K394C, K394W, K394F, K394Y or K394L; and S491C,

[0194] (15) T397C; and S485C, D486C or E487C,

[0195] (16) F32C; and, Y468C,

[0196] (17) E30C or S443C; and, S466C,

[0197] (18)Y33C; and, V469C,

[0198] (19) E31C; and, L467C,

[0199] (20) T29C; and K465C,

[0200] (21) Q26C or K445C; and, E463C or E463P,

[0201] (22) T449C; and, Y458C or Y458P,

[0202] (23) Q354C or Q354L; and N371C, N371F, N371W, N371Y, N371L or N371C,

[0203] (24) G151L; and, Q302L or Q302V,

[0204] (25) K75C; and I217C,

[0205] (26) G143C; and, V406C, N371C, N371F, N371W, N371Y, N371L or N371C,

[0206] (27) G145I or G145C; and I407C or M370C,

[0207] (28) F140C; and S404C,

[0208] (29)A241C; and, Q279C,

[0209] (30) T189V; and A298K, A298Y, A298I, A298L or A298F,

[0210] (31) L195C or L195K; and N227E,

[0211] (32) S398C or S398F; and, D489C, D489F or D489L,

[0212] (33) L142C; and, P353C, N371C, N371F, N371W, N371Y, N371L or N371C,

[0213] (34) K508C; and S509C, or

[0214] (35) L512C; and, L513C,

[0215] (36)A149C; and, Y458C,

[0216] (37)V144C; and, N371C.

[0217] In some embodiments, in addition to the K65C and K87C mutations, the recombinant RSV F polypeptide may also include one or more amino acid mutations. In some embodiments, in addition to the K65C and K87C mutations, the recombinant RSV F polypeptide may also include 1 to 10 amino acid mutations. In some embodiments, in addition to the K65C and K87C mutations, the recombinant RSV F polypeptide may also include 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 amino acid mutations. In some embodiments, in addition to the K65C and K87C mutations, the recombinant RSV F polypeptide may also include 1 to 7 amino acid mutations.

[0218] In some embodiments, in addition to the K65C and K87C mutations, the recombinant RSV F polypeptide can also include any of the following mutations:

[0219] (1) K394C, K394W, K394F, K394Y, or K394L; D489C, D489F, or D489L; and T337W, T337L, or T337C,

[0220] (2) S150L, ​​S150F, S150W or S150Y; G151L; and Q302L or Q302V,

[0221] (3) S155I or S155V; S290C, S290P, S290V or S290A; and A298K, A298Y, A298I, A298L or A298F,

[0222] (4) N67A, N67C, N67L or N67V; I79L; and V207C or V207I,

[0223] (5) A74F, A74W, A74Y, A74K, or A74R; K508C; and S509C.

[0224] (6) V144C; M370C; and, A74F, A74W, A74Y, A74K, A74R, K80A, K80I, K80L, K80V, K80F, K80W, K80Y, K80M, K80S, K80P, K80C, I291C, I291E, I291D, S211P, A298K, A298Y, A298I, A298L, or A298F,

[0225] (7) S190C, S190F, or S190L; R229Y or R229W; T253L; and E256F

[0226] (8) V144C; M370C; F505H or F505K; and I506D or I506E,

[0227] (9) V144C; M370C; A74F, A74W, A74Y, A74K, or A74R; and S404C, S404V, S404I, S404L, or S404C,

[0228] (10) V144C; M370C; A74F, A74W, A74Y, A74K, or A74R; and S150L, ​​S150F, S150W, or S150Y,

[0229] (11) V144C; M370C; N67A, N67C, N67L, or N67V; and A74F, A74W, A74Y, A74K, or A74R,

[0230] (12) V144C; M370C; T189V; and A298K, A298Y, A298I, A298L, or A298F,

[0231] (13) V144C; M370C; K508C; and S509C,

[0232] (14) V144C; M370C; L512C; and L513C,

[0233] (15) V144C; M370C; A74F, A74W, A74Y, A74K, or A74R; and N183P, N183D, N515C, N515D, or K520R,

[0234] (16) V144C; M370C; N67A, N67C, N67L or N67V; I79L; and V207C or V207I;

[0235] (17) A147V; Q354C or Q354L; A355L; D368L; and N371F, N371W, N371Y, N371L, or N371C,

[0236] (18) V144C; M370C; A74F, A74W, A74Y, A74K, or A74R; K508C; and S509C.

[0237] (19) V144C; M370C; A74F, A74W, A74Y, A74K, or A74R; L512C; and L513C.

[0238] (20) V144C; M370C; A74F, A74W, A74Y, A74K, or A74R; T522C; and T523C.

[0239] (21) V144C; M370C; A74F, A74W, A74Y, A74K, or A74R; N515C or N515D; and V516C or K520R,

[0240] (22) V144C; M370C; A74F, A74W, A74Y, A74K, or A74R; N183P or N183D; and K427R,

[0241] (23) V144C; M370C; A74F, A74W, A74Y, A74K, or A74R; G143C; and V406C

[0242] (24) V144C; M370C; A74F, A74W, A74Y, A74K, or A74R; G145I or G145C; and I407C

[0243] (25) V144C; M370C; A74F, A74W, A74Y, A74K, or A74R; F140C; and S404C, S404V, S404I, S404L, or S404C,

[0244] (26) V144C; M370C; N67A, N67C, N67L, or N67V; A74F, A74W, A74Y, A74K, or A74R; and K80A, K80I, K80L, K80V, K80F, K80W, K80Y, K80M, K80S, K80P, or K80C,

[0245] (27)A355L; E356W; D368L; N371F, N371W, N371Y, N371L, or N371C; K394C, K394W, K394F, K394Y, or K394L; T400V; D489C, D489F, or D489L.

[0246] In some embodiments, in addition to the V144C and M370C mutations, the recombinant RSV F polypeptide can also include one or more amino acid mutations. In some embodiments, in addition to the V144C and M370C mutations, the recombinant RSV F polypeptide can also include 1 to 10 amino acid mutations. In some embodiments, in addition to the V144C and M370C mutations, the recombinant RSV F polypeptide can also include 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 amino acid mutations. In some embodiments, in addition to the V144C and M370C mutations, the recombinant RSV F polypeptide can also include 1 to 5 amino acid mutations. In some embodiments, the recombinant RSV F polypeptide can include one or more amino acid mutations at positions 65, 67, 74, 79, 80, 87, 140, 143, 145, 150, 183, 189, 207, 211, 291, 298, 404, 406, 407, 427, 505, 506, 508, 509, 512, 513, 515, 516, 520, 522, or 523 in addition to the V144C and M370C mutations.

[0247] In some embodiments, in addition to the V144C and M370C mutations, the recombinant RSV F polypeptide can also include any of the following mutations:

[0248] (1) N67A, N67C, N67L, or N67V; and K87A, K87I, K87L, K87V, K87F, K87W, K87Y, K87M, K87S, K87P, or K87C,

[0249] (2) K65C; and, K87A, K87I, K87L, K87V, K87F, K87W, K87Y, K87M, K87S, K87P, or K87C.

[0250] In some embodiments, in addition to the V144C and M370C mutations, the recombinant RSV F polypeptide can also include any of the following mutations:

[0251] (1) N67A, N67C, N67L, or N67V; A74F, A74W, A74Y, A74K, or A74R; and K87A, K87I, K87L, K87V, K87F, K87W, K87Y, K87M, K87S, K87P, or K87C,

[0252] (2) K65C; K87A, K87I, K87L, K87V, K87F, K87W, K87Y, K87M, K87S, K87P, or K87C; and I291C, I291E, or I291D,

[0253] (3) K65C; K87A, K87I, K87L, K87V, K87F, K87W, K87Y, K87M, K87S, K87P, or K87C; and A74F, A74W, A74Y, A74K, or A74R,

[0254] (4) K65C; K87A, K87I, K87L, K87V, K87F, K87W, K87Y, K87M, K87S, K87P, or K87C; and K80A, K80I, K80L, K80V, K80F, K80W, K80Y, K80M, K80S, K80P, or K80C,

[0255] (5) K65C; K87A, K87I, K87L, K87V, K87F, K87W, K87Y, K87M, K87S, K87P, or K87C; and S211P

[0256] (6) K65C; K87A, K87I, K87L, K87V, K87F, K87W, K87Y, K87M, K87S, K87P or K87C; and, A298K, A298Y, A298I, A298L or A298F.

[0257] In some embodiments, in addition to the V144C and M370C mutations, the recombinant RSV F polypeptide can also include any of the following mutations:

[0258] (1) N67A, N67C, N67L, or N67V; A74F, A74W, A74Y, A74K, or A74R; K80A, K80I, K80L, K80V, K80F, K80W, K80Y, K80M, K80S, K80P, or K80C; and K87A, K87I, K87L, K87V, K87F, K87W, K87Y, K87M, K87S, K87P, or K87C,

[0259] (2) K65C; K87A, K87I, K87L, K87V, K87F, K87W, K87Y, K87M, K87S, K87P, or K87C; F505H or F505K; and I506D or I506E,

[0260] (3) K65C; K87A, K87I, K87L, K87V, K87F, K87W, K87Y, K87M, K87S, K87P, or K87C; A74F, A74W, A74Y, A74K, or A74R; and S404C, S404V, S404I, S404L, or S404C,

[0261] (4) K65C; K87A, K87I, K87L, K87V, K87F, K87W, K87Y, K87M, K87S, K87P, or K87C; A74F, A74W, A74Y, A74K, or A74R; and S150L, ​​S150F, S150W, or S150Y,

[0262] (5) K65C; N67A, N67C, N67L, or N67V; K87A, K87I, K87L, K87V, K87F, K87W, K87Y, K87M, K87S, K87P, or K87C; and A74F, A74W, A74Y, A74K, or A74R,

[0263] (6) K65C; K87A, K87I, K87L, K87V, K87F, K87W, K87Y, K87M, K87S, K87P, or K87C; A74F, A74W, A74Y, A74K, or A74R; and N183P or N183D,

[0264] (7) K65C; K87A, K87I, K87L, K87V, K87F, K87W, K87Y, K87M, K87S, K87P, or K87C; A74F, A74W, A74Y, A74K, or A74R; and K520R,

[0265] (8) K65C; K87A, K87I, K87L, K87V, K87F, K87W, K87Y, K87M, K87S, K87P, or K87C; T189V; and A298K, A298Y, A298I, A298L, or A298F,

[0266] (9) K65C; K87A, K87I, K87L, K87V, K87F, K87W, K87Y, K87M, K87S, K87P, or K87C; K508C; and S509C.

[0267] (10) K65C; K87A, K87I, K87L, K87V, K87F, K87W, K87Y, K87M, K87S, K87P, or K87C; L512C; and L513C.

[0268] (11) K65C; K87A, K87I, K87L, K87V, K87F, K87W, K87Y, K87M, K87S, K87P or K87C; A74F, A74W, A74Y, A74K or A74R; and, N515C or N515D.

[0269] In some embodiments, in addition to the V144C and M370C mutations, the recombinant RSV F polypeptide can also include any of the following mutations:

[0270] (1) K65C; N67A, N67C, N67L, or N67V; I79L; K87A, K87I, K87L, K87V, K87F, K87W, K87Y, K87M, K87S, K87P, or K87C; and V207C or V207I,

[0271] (2) K65C; N67A, N67C, N67L, or N67V; A74F, A74W, A74Y, A74K, or A74R; K80A, K80I, K80L, K80V, K80F, K80W, K80Y, K80M, K80S, K80P, or K80C; and K87A, K87I, K87L, K87V, K87F, K87W, K87Y, K87M, K87S, K87P, or K87C,

[0272] (3) K65C; A74F, A74W, A74Y, A74K, or A74R; K87A, K87I, K87L, K87V, K87F, K87W, K87Y, K87M, K87S, K87P, or K87C; K508C; and S509C.

[0273] (4) K65C; A74F, A74W, A74Y, A74K, or A74R; K87A, K87I, K87L, K87V, K87F, K87W, K87Y, K87M, K87S, K87P, or K87C; L512C; and L513C.

[0274] (5) K65C; A74F, A74W, A74Y, A74K, or A74R; K87A, K87I, K87L, K87V, K87F, K87W, K87Y, K87M, K87S, K87P, or K87C; T522C; and, T523C,

[0275] (6) K65C; A74F, A74W, A74Y, A74K, or A74R; K87A, K87I, K87L, K87V, K87F, K87W, K87Y, K87M, K87S, K87P, or K87C; N515C or N515D; and V516C,

[0276] (7) K65C; A74F, A74W, A74Y, A74K, or A74R; K87A, K87I, K87L, K87V, K87F, K87W, K87Y, K87M, K87S, K87P, or K87C; N515C or N515D; and K520R,

[0277] (8) K65C; A74F, A74W, A74Y, A74K, or A74R; K87A, K87I, K87L, K87V, K87F, K87W, K87Y, K87M, K87S, K87P, or K87C; N183P or N183D; and K427R,

[0278] (9) K65C; A74F, A74W, A74Y, A74K, or A74R; K87A, K87I, K87L, K87V, K87F, K87W, K87Y, K87M, K87S, K87P, or K87C; G143C; and V406C.

[0279] (10) K65C; A74F, A74W, A74Y, A74K, or A74R; K87A, K87I, K87L, K87V, K87F, K87W, K87Y, K87M, K87S, K87P, or K87C; G145I or G145C; and I407C,

[0280] (11) K65C; A74F, A74W, A74Y, A74K, or A74R; K87A, K87I, K87L, K87V, K87F, K87W, K87Y, K87M, K87S, K87P, or K87C; F140C; and, S404C, S404V, S404I, S404L, or S404C.

[0281] In a preferred embodiment, the recombinant RSV F polypeptide can have an amino acid sequence as shown in SEQ ID NO:8 or SEQ ID NO:23, and include one or more of the following mutations: (1) K65C and K87C; (2) K65C, K87C, F505H and I506D; (3) K65C, K87C, F505K and I506E; (4) K65C, K87C, S211P; (5) K65C, K87C and A74F; (6) K65C, K87C and A74W; (7) K65C, K87C and A74Y; (8) K65C, K87C and N254Y; (9) K65C, K87C and A298Y; (10) K65C, K87C and D489F; (11) K65C, K87C and S502F; (12) K65C, K87C and S502Y; (13) S62L, K65C and K87C; (14) S62P, K65C and K87C; (15) K65C, K87C and A298I; (16) K65C, K87C and A298L; (17) K65C, K87C, L141C and N371C; (18) K65C, K87C, V144C and M370C; (19) K65C, K87C, S55C and L188C; (20) K65C, K87C, H159C and I291C; (21) K65C, K87C, I332C and F483C; (22 )K65C, K87C, I332C, and P480C; (23) K65C, K87C, M396C, and F488C; (24) K65C, K87C, T397C, and D486C; (25) K65C, K87C, T397C, and S485C; (26) K65C, K87C, Q26C, and E463C; (27) K65C, K87C, K445C, and E463C; (28) K65C, K87C, S443C, and S466C; (29) K65C, K87C, K394W, D489F, and T337L; (30) K65C, K87C, K394W, D489L, and T337L; (31) K65C, K87C and L141R; (32) K65C, K87C and L141K; (33) K65C, K87C, Q354L and N371F; (34) K65C, K87C, Q354L and N371W; (35) K65C, K87C, Q354L and N371Y; (36) K65C, K87C and I291D; (37) K65C, K87C, S155V, S290A and A298L; (38) K65C, K87C and Y458P; (39) K65C, K87C and V459P; (40) K65C, K87C and N460P;(41) K65C, K87C, and K461P; (42) K65C, K87C, and E463P; (43) K65C, K87C, K75C, and I217C; (44) K65C, K87C, and A74K; (45) K65C, K87C, and A74R; (46) K65C, K87C, T189V, and A298F; (47) K65C, K87C, S398F, and D489L; (48) K65C, K87C, N67L, I79L, and V207I; (49) K65C, K87C, L142C, and N371C; (50) K65C, K87C, V144C, and N371C; (51) K 65C, K87C, G145C and M370C; (52) K65C, K87C, K508C and S509C; (53) K65C, K87C, L512C and L513C; (54) K65C, K87C, V144C, M370C and A74F; (55) K65C, K87C, V144C, M370C and A74W; (56) K65C, K87C, V144C, M370C and A74Y; (57) K65C, K87C, V144C, M370C, F505K and I506E; (58) K65C, K87C, V144C, M370C and S211P; (59) K6 5C, K87C, V144C, M370C, and A298Y; (60) K65C, K87C, V144C, M370C, T189V, and A298Y; (61) K65C, K87C, V144C, M370C, N67L, I79L, and V207I; (62) N67A, K87V, V144C, and M370C; (63) K65C, K87C, V144C, M370C, and K80W; (64) K65C, K87C, V144C, M370C, K508C, and S509C; (65) K65C, K87C, V144C, M370C, L512C, and L513C; (66 )K65C, K87C, V144C, M370C, A74Y, K508C, and S509C; (67) K65C, K87C, V144C, M370C, A74Y, L512C, and L513C; (68) K65C, K87C, V144C, M370C, A74Y, T522C, and T523C; (69) K65C, K87C, V144C, M370C, A74Y, N515C, and V516C; (70) K65C, K87C, V144C, M370C, A74Y, and N515D; (71) K65C, K87C, V144C, M370C, A74Y, and K520R;(72) K65C, K87C, V144C, M370C, A74Y, N515D, and K520R; (73) K65C, K87C, V144C, M370C, A74Y, and N183D; (74) K65C, K87C, V144C, M370C, A74Y, N183D, and K427R; (75) K65C, K87C, V144C, M370C, A74Y, and S404V; (76) K65C, K87C, V144C, M370C, A74Y, and S404I; (77) K65C , K87C, V144C, M370C, A74Y and S404L; (78) K65C, K87C, V144C, M370C, A74Y, G143C and V406C; (79) K65C, K87C, V144C, M370C, A74Y, F140C and S404C; (80) K65C, K87C, V144C, M370C, A74Y and S150L; (81) K65C, K87C, V144C, M370C, A74Y and S150F; (82) K65C, K87 C, V144C, M370C, A74Y and S150W; (83) K65C, K87C, V144C, M370C, A74Y and S150Y; (84) K65C, K87C, V144C, M370C and A74Y; (85) K65C, K87C, A74Y, K508C and S509C; (86) K65C, K87C, V144C, M370C, N67A and A74Y; (87) K65C, K87C, V144C, M370C, N67V and A74Y; (88) K 65C, K87C, V144C, M370C, N67V, A74Y, and K80V; (89) K65C, K87C, V144C, M370C, N67V, A74Y, and K80F; (90) K65C, K87C, V144C, M370C, N67V, A74Y, and K80W; (91) K65C, K87C, V144C, M370C, N67V, A74Y, and K80L; and, (92) K65C, K87C, V144C, M370C, N67V, A74Y, and K80Y. ;

[0282] In a preferred embodiment, the recombinant RSV F polypeptide can have an amino acid sequence as shown in SEQ ID NO:8 or SEQ ID NO:23, and include one or more of the following mutations: (1) V144C and M370C; (2) K65C, K87C, V144C, M370C, and A74F; (3) K65C, K87C, V144C, M370C, and A74W; (4) K65C, K87C, V144C, M370C, and A74Y; (5) K65C, K87C, V144C, M370C, F505K, and I506E; (6) K65C, K87C, V144C, M370C, and S211P; (7) K65C, K87C, V144C, M370C, and A298Y ;(8)K65C, K87C, V144C, M370C, T189V and A298Y;(9)K65C, K87C, V144C, M370C, N67L, I79L and V207I;(10)N67A, K87V, V144C and M370C;(11)K65C, K87C, V144C, M370C and K80W;(12)K65C, K87C, V144C, M370C, K508C and S509C;(13)K65C, K87C, V144C, M370C, L512C and L513C;(14)K65C, K87C, V144C , M370C, A74Y, K508C and S509C; (15) K65C, K87C, V144C, M370C, A74Y, L512C and L513C; (16) K65C, K87C, V144C, M370C, A74Y, T522C and T523C; (17) K65C, K87C, V144C, M370C, A74Y, N515C and V516C; (18) K65C, K87C, V144C, M370C, A74Y and N515D; (19) K65C, K87C, V144C, M370C, A74Y and K520R; (20 )K65C, K87C, V144C, M370C, A74Y, N515D and K520R; (21) K65C, K87C, V144C, M370C, A74Y and N183D; (22) K65C, K87C, V144C, M370C, A74Y, N183D and K427R; (23) K65C, K87C, V144C, M370C, A74Y and S404V; (24) K65C, K87C, V144C, M370C, A74Y and S404I; (25) K65C, K87C, V144C, M370C, A74Y and S404L;(26) K65C, K87C, V144C, M370C, A74Y, G143C, and V406C; (27) K65C, K87C, V144C, M370C, A74Y, F140C, and S404C; (28) K65C, K87C, V144C, M370C, A74Y, and S150L; (29) K65C, K87C, V144C, M370C, A74Y, and S150F; (30) K65C, K87C, V144C, M370C, A74Y, and S150W ; (31) K65C, K87C, V144C, M370C, A74Y, and S150Y; (32) K65C, K87C, V144C, M370C, and A74Y; (33) N67A, A74Y, K87V, V144C, and M370C; (34) K65C, K87C, V144C, M370C, N67A, and A74Y; (35) N67V, A74Y, K87V, V144C, and M370C; (36) N67V, A74Y, K80V, K87V, V144C, and M370C; (37) N67V, A74Y, K80F, K87V, V144C and M370C; (38) N67V, A74Y, K80W, K87V, V144C and M370C; (39) N67V, A74Y, K80L, K87V, V144C and M370C; (40) N67V, A74Y, K80Y, K87L, V144C and M370C; (41) K65C, K87C, V144C, M370C, N67V and A74Y; (42) K65C, K 87C, V144C, M370C, N67V, A74Y, and K80V; (43) K65C, K87C, V144C, M370C, N67V, A74Y, and K80F; (44) K65C, K87C, V144C, M370C, N67V, A74Y, and K80W; (45) K65C, K87C, V144C, M370C, N67V, A74Y, and K80L; and, (46) K65C, K87C, V144C, M370C, N67V, A74Y, and K80Y. ;

[0283] In a preferred embodiment, the recombinant RSV F polypeptide can have an amino acid sequence as shown in SEQ ID NO:8 or SEQ ID NO:23, and include one or more of the following mutations: (1) K65C and K87C; (2) K65C, K87C, F505K and I506E; (3) K65C, K87C and S211P; (4) K65C, K87C and A74F; (5) K65C, K87C and A74W; (6) K65C, K87C and A74Y; (7) K65C, K87C and A298Y; (8) K65C, K87C, V144C and M370C; (9) K65C, K87C, T189V and A298F; (10) K65C, K87C, N67L, I74Y 9L and V207I; (11) K65C, K87C, K508C and S509C; (12) K65C, K87C, L512C and L513C; (13) V144C and M370C; (14) K65C, K87C, V144C, M370C and A74F; (15) K65C, K87C, V144C, M370C and A74Y; (16) K65C, K87C, V144C, M370C, N67L, I79L and V207I; (17) N67A, K87V, V144C and M370C; (18) K65C, K87C, V144C, M370C, A74Y and N515D; (19) K65C, K87C, V144C, M370C, A74Y and S404V; (20) K65C, K87C, V144C, M370C, A74Y and V207I; (21) N67A, A74Y, K87V, V144C and M370C; ( 22) N67V, A74Y, K87V, V144C, and M370C; (23) N67V, A74Y, K80V, K87V, V144C, and M370C; (24) N67V, A74Y, K80W, K87V, V144C, and M370C; (25) N67V, A74Y, K80L, K87V, V144C, and M370C; and, (26) K65C, K87C, V144C, M370C, N67V, and A74Y.

[0284] The above-mentioned mutation sites are numbered based on the amino acid sequence shown in SEQ ID NO:22. In addition, it will be appreciated by those skilled in the art that the above-mentioned site mutations corresponding to the F protein of human RSV subtype A, human RSV subtype B or bovine RSV can also prevent the conformation of these F proteins from being rearranged, thereby being stabilized in the pre-fusion conformation. In some embodiments, the recombinant RSV F polypeptide can include 1 to 10 amino acid mutations. In some embodiments, the recombinant RSV F polypeptide can include 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 amino acid mutations.

[0285] In some embodiments, the recombinant RSV F polypeptide may further include a trimerization domain. The trimerization domain may be located in the C-terminal region of the recombinant RSV F polypeptide. In some embodiments, the trimerization domain may be derived from the bacteriophage T4 minor fibrin foldon. In some embodiments, the trimerization domain may include the amino acid sequence GYIPEAPRDGQAYVRKDGEWVLLSTFL (SEQ ID NO: 7) or an amino acid sequence having at least 85% sequence identity thereto.

[0286] In some embodiments, the recombinant RSV F polypeptide can be linked to the trimerization domain directly or through a linker.

[0287] In some embodiments, the recombinant RSV F polypeptide can be displayed on nanoparticles or virus-like particles.

[0288] According to another aspect of the present disclosure, a recombinant protein is provided, which includes the above-mentioned recombinant RSV F polypeptide of the present disclosure.

[0289] In some embodiments, the recombinant protein comprises the above-mentioned recombinant RSV F polypeptide and scaffold protein of the present disclosure. In some embodiments, the scaffold protein can form nanoparticles. In some embodiments, the recombinant RSV F polypeptide can be displayed on the surface of nanoparticles. According to another aspect of the present disclosure, a kind of nucleic acid molecule is provided, which encodes the above-mentioned recombinant RSV F polypeptide or the above-mentioned recombinant protein.

[0290] In some embodiments, the nucleic acid molecule can be a DNA molecule or an RNA molecule.

[0291] In some embodiments, the nucleic acid molecule can be an RNA molecule. In a preferred embodiment, the nucleic acid molecule can be an mRNA molecule.

[0292] In some embodiments, the nucleic acid molecule may include at least one chemical modification. In a preferred embodiment, the nucleic acid molecule may include a chemical modification selected from the group consisting of pseudouridine, N1-methylpseudouridine, N1-ethylpseudouridine, 2-thiouridine, 4′-thiouridine, 5-methylcytosine, 2-thiol-1-methyl-1-deaza-pseudouridine, 2-thiol-1-methyl-pseudouridine, 2-thiol-5-aza-uridine, 2-thiol-dihydropseudouridine, 2-thiol-dihydrouridine, 2-thiol-pseudouridine, 4-methoxy-2-thiol-pseudouridine, 4-methoxy-pseudouridine, 4-thiol-1-methyl-pseudouridine, 4-thiol-pseudouridine, 5-aza-uridine, dihydropseudouridine, 5-methoxyuridine, and 2′-O-methyluridine.

[0293] In some embodiments, the nucleic acid molecule includes at least one 5' end cap or cap analog. 5' end caps or cap analogs suitable for use in the present disclosure may be known in the art and / or described herein. In preferred embodiments, the 5' end cap or cap analog may include, for example, N7-(4-chlorophenoxyethyl) substituted dinucleotide form cap analogs, N7-(4-chlorophenoxyethyl)-G(5')ppp(5')G and N7-(4-chlorophenoxyethyl)-m 3 ' -O G(5')ppp(5')G cap analogs, 7mG(5')ppp(5')N,pN2p, 7mG(5')ppp(5')NlmpNp, N7,2'-O-dimethyl-guanosine-5'-triphosphate-5'-guanosine, m7Gm-ppp-G, and 7mG(5')-ppp(5')NlmpN2mp, wherein N is selected from any nucleobase (A, G, C, T).

[0294] In some embodiments, the nucleic acid molecule can be codon-optimized for expression in a subject or a cell of a subject, such as a human or bovine cell.

[0295] According to another aspect of the present disclosure, a vector is provided, which includes the above-mentioned nucleic acid molecule of the present disclosure. In some embodiments, the vector can be a viral vector, which can be used to express the above-mentioned recombinant RSV F polypeptide in a host cell, or for immunization in a subject.

[0296] In some embodiments, the vector of the present disclosure can have replication ability and encode the above-mentioned recombinant RSV F polypeptide of the present disclosure. In some embodiments, the vector of the present disclosure has replication defect in host cell. In some embodiments, the viral vector can be delivered via respiratory tract. In some embodiments, the viral vector can be selected from, for example, paramyxovirus (PIV) vector such as bovine parainfluenza virus (BPIV) vector (for example, BPIV-1, BPIV-2 or BPV-3 vector) or human PIV vector, metapneumovirus (MPV)) vector, Newcastle disease virus vector, Sendai virus vector, measles virus vector, Newcastle disease virus vector etc. Other viral vectors, for example, adenovirus, polyomavirus (such as SV40), vaccinia virus, adeno-associated virus, herpes virus etc. can also be used to deliver the nucleic acid molecules encoding the above-mentioned recombinant RSV F polypeptide of the present disclosure.

[0297] According to another aspect of the present disclosure, a host cell is provided, which includes the above-mentioned nucleic acid molecules of the present disclosure. In some embodiments, the host cell may include mammalian cells, fungal cells, yeast cells, insect cells and prokaryotic cells. In some embodiments, the host cell may include, but is not limited to, Chinese hamster ovary (CHO) cells, tumor cell lines, hamster kidney (BHK) cells, HEK293 cells, PER.C6 cells, COS cells, mouse NSO thymoma cells, mouse myeloma SP2 / 0 cells, adult African green monkey kidney (Vero) cells, etc.

[0298] According to another aspect of the present disclosure, an immunogenic composition is provided, comprising the recombinant RSV F polypeptide or the recombinant protein of the present disclosure, and a pharmaceutically acceptable carrier.

[0299] In some embodiments, the immunogenic composition may further include an adjuvant. In some embodiments, the adjuvant may include, for example, alum, a mineral salt (e.g., an aluminum or calcium salt), an oil-in-water composition, AS01B, AS01E, MF59, AS01, AS03, AS04, MPL, QS21, a CpG oligonucleotide, a TLR7 agonist, a TLR4 agonist, a TLR3 agonist, or a combination of two or more thereof. The adjuvant may promote a Th1 immune response.

[0300] In some embodiments, the carrier is a lipid nanoparticle. In some embodiments, the carrier can be selected from cationic lipids, PEG-modified lipids, sterols and phospholipids.

[0301] In some embodiments, the immunogenic composition can be administered by various means well known in the art, such as nasal, pulmonary, intramuscular, subcutaneous, intravenous, intraperitoneal, or parenteral administration.

[0302] According to another aspect of the present disclosure, a method for producing an immune response in a subject is provided, the method employing the above-mentioned recombinant RSV F polypeptide, the above-mentioned recombinant protein or its encoding nucleic acid molecule of the present disclosure. In some embodiments, the method comprises administering the above-mentioned recombinant RSV F polypeptide, the above-mentioned recombinant protein or its encoding nucleic acid molecule of a therapeutically effective amount to the subject. In some embodiments, the immune response can be used to treat, suppress or prevent RSV infection. In some embodiments, the method can comprise utilizing the above-mentioned recombinant RSV F polypeptide or the above-mentioned recombinant protein of the present disclosure to carry out primary immunity and / or booster immunity.

[0303] According to another aspect of the present disclosure, provided is a use of the recombinant RSV F polypeptide, the recombinant protein, or the nucleic acid molecule encoding the same in the preparation of a medicament for generating an immune response in a subject.

[0304] According to another aspect of the present disclosure, there is provided the use of the above-mentioned recombinant RSV F polypeptide or the above-mentioned recombinant protein of the present disclosure for detecting or isolating RSV antibodies in a subject infected with RSV. In some embodiments, the recombinant RSV F polypeptide or the recombinant protein can be used to detect and / or quantify RSV antibodies in a sample.

[0305] In some embodiments, the RSV infection may include infection with human RSV subtype A, human RSV subtype B, or bovine RSV.

[0306] In some embodiments, the subject can be, for example, a mammal. In some embodiments, the mammal can be a human mammal, or a non-human mammal, such as a cat, dog, cow, horse, pig, sheep, goat, mouse, rat, rabbit, gerbil, guinea pig, and non-human primate. BRIEF DESCRIPTION OF THE DRAWINGS

[0307] FIG1 exemplarily shows a schematic diagram of the construction of the RSV F protein of the present disclosure.

[0308] FIG2 exemplarily shows the chromatographic purification results of a mutant according to the present disclosure.

[0309] FIG3 shows the Tm detection values ​​of each mutant.

[0310] FIG4 shows the results of ELISA test of each mutant after treatment at 50° C. for 1 h with AM14 and D25 antibodies.

[0311] FIG5 shows the results of ELISA test of each mutant after treatment at 60° C. for 1 h and using AM14 and D25 antibodies.

[0312] FIG6 shows the expression levels of various mutant proteins.

[0313] FIG7 shows negative-stained electron micrographs of various mutants.

[0314] FIG8 shows the results of neutralizing antibody titers in mouse serum of each recombinant mutant vaccine.

[0315] FIG. 9 shows the neutralizing antibody titer in serum of mice immunized with F protein mutant mRNA vaccine.

[0316] FIG10 shows the results of IFN-γ detection in spleen cells of mice immunized with the F protein mutant mRNA vaccine.

[0317] FIG11 shows the results of IL4 detection in spleen cells of mice immunized with F protein mutant mRNA vaccine.

[0318] FIG12 shows the results of the viral load in the lungs of mice immunized with the F protein mutant mRNA vaccine.

[0319] FIG13 shows the lung pathology scoring results of mice vaccinated with the F protein mutant mRNA vaccine.

[0320] FIG14 shows the results of neutralizing antibodies in cotton rat serum of the F protein mutant mRNA vaccine.

[0321] FIG15 shows the results of viral load in the lungs of cotton rats immunized with the F protein mutant mRNA vaccine. DETAILED DESCRIPTION

[0322] The genome of respiratory syncytial virus (RSV) is about 15200nt in length, comprises 10 open reading frames, and encodes 11 kinds of proteins. These proteins include two nonstructural proteins (NS1 and NS2), two nucleocapsid proteins (N and P), an inner envelope protein (M1), three small hydrophilic proteins (SH), attachment protein (G) and fusion protein (F) covering the surface of the virus. The M2 gene comprises overlapping open reading frames, which can encode M2.1 and M2.2 two proteins and a large (L) protein. G and F proteins are the main antigenic proteins and are the main targets of RSV vaccines. RSV is polymorphic, such as it can be spherical, asymmetric and fibrous.

[0323] RSV virus can be divided into two subtypes, A and B, according to the G protein sequence. The conservation of the surface fusion glycoprotein F of these two subtypes is very high, with sequence similarity up to about 94%, and the sequence of the antibody binding site is extremely conservative. The disclosure has selected the relatively high prevalence A subtype RSV virus F protein sequence as the basis for mutant design. However, since the F protein sequence of A subtype and B subtype RSV virus has high conservation, it will be understood by those skilled in the art that the F protein mutant prepared can be applied simultaneously to the prevention and / or treatment of two subtype RSV virus infections. The mutation site or amino acid position mentioned in the disclosure are all relative to the A subtype RSV virus F protein sequence (SEQ ID NO:22).

[0324] RSV F is a trimeric type I transmembrane protein, and its transmembrane region rivets the F protein to the RSV virus outer membrane and plays a role in stabilizing the trimer. Membrane protein is not suitable as the main component of the vaccine, and its water-insoluble nature is unacceptable for vaccine production. In a specific embodiment, the present disclosure uses the extracellular soluble region (aa 1~513) or (aa 1~526) of RSV F protein as an antigen, and in order to stabilize the extracellular trimeric state, a natural trimeric domain fibrin domain (T4 foldon) is added to its C-terminus. In order to increase the expression level of F protein, aa 109~136 of F protein is replaced with linker GSGSGR (SEQ ID NO:2). For subsequent detection and purification, Strep-II tags are added after T4-foldon. The resulting F protein structure schematic diagram is shown in Figure 1.

[0325] When RSV infects a host cell, the virus first fuses with the host cell membrane. The RSV F protein initially folds into a "prefusion" conformation. During cellular cellular processing, the F protein refolds and undergoes conformational changes from the prefusion conformation to its "postfusion" conformation. Therefore, the RSV F protein in the prefusion conformation is a metastable protein. It then undergoes discontinuous / stepwise conformational changes, irreversibly folding into a lower energy conformation (the postfusion conformation), which then attaches to the membrane and drives membrane fusion. As research deepens, it has been discovered that the postfusion F protein (Post-F) does not stimulate the production of sufficient neutralizing antibodies. However, the amount of antibodies specific for the prefusion F protein (Pre-F) determines the level of RSV neutralizing activity in serum, leading to a shift in research focus to the Pre-F protein. Studies have shown that neutralizing antibodies against the Pre-F protein not only neutralize RSV but also effectively prevent the risk of vaccine-enhanced respiratory disease (ERD). Therefore, stabilizing the Pre-F conformation has become a top priority in RSV vaccine research.

[0326] By comparing the protein structures of Pre-F and Psot-F, the present disclosure found that some regions of the two had obvious structural rearrangements. We call the region where the structural rearrangement occurred the variable region, and the region where the structural rearrangement did not occur the constant region. The RSV-F protein can be divided into three domains: 1) the constant region (amino acids 1 to 139 and 216 to 459), that is, the region where the Pre-F and Post-F structures are the same; 2) the upper variable region (amino acids 140 to 216), that is, the region where the structures of the upper half of Pre-F and Post-F change; 3) the lower variable region (amino acids 460 to 513), that is, the region where the structures of the lower half of Pre-F and Post-F change.

[0327] The present disclosure introduces stabilizing amino acid mutations or a combination of amino acid mutations to form one or more disulfide bonds, ionic bonds, hydrophobic interactions, etc. between the variable region and the constant region, thereby locking the variable region and the constant region together, thereby preventing conformational rearrangement of the variable region and stabilizing the F protein in the pre-fusion conformation.

[0328] The present disclosure has successfully screened out mutants of the pre-fusion F protein that can stabilize the F protein in the pre-fusion conformation, has good stability and high expression. Without wishing to be bound by any specific theory, the RSV F protein in the pre-fusion conformation provided by the present disclosure may contain the same epitope as on the RSV F protein expressed on natural RSV virions, and therefore may provide the advantage of eliciting protective neutralizing antibodies. The key point in RSV vaccine research and development is whether the candidate vaccine has an enhanced respiratory disease (ERD) effect. The reason why formalin-inactivated vaccines cause the ERD effect is that the inactivated vaccine stimulates RSV seronegative subjects to produce a large amount of non-neutralizing antibodies, which form antibody-virus complexes with RSV virus, and a large amount of antibody-virus complexes accumulate in the lungs of the subjects, triggering a strong Th2-biased CD4 + T cell immunity causes severe lung inflammation (ERD effect), which can even lead to the death of the subject.

[0329] In some embodiments, the recombinant RSV F polypeptide of the present disclosure introduces a disulfide bond between at least one pair of non-natural cysteines between the first domain and the third domain. In some embodiments, the recombinant RSV F polypeptide of the present disclosure introduces a disulfide bond between at least one pair of non-natural cysteines between the second domain and the fourth domain.

[0330] In some embodiments, the recombinant RSV F polypeptides of the present disclosure include a disulfide bond between the two cysteines at positions 65 and 87. In some embodiments, the recombinant RSV F polypeptides of the present disclosure include a disulfide bond between the two cysteines at positions 144 and 370. In some embodiments, the recombinant RSV F polypeptides of the present disclosure include a disulfide bond between the two cysteines at positions 484 and 499. In some embodiments, the recombinant RSV F polypeptides of the present disclosure include a disulfide bond between the two cysteines at positions 482 and 499. In some embodiments, the recombinant RSV F polypeptides of the present disclosure include a disulfide bond between the two cysteines at positions 482 and 502. In some embodiments, the recombinant RSV F polypeptides of the present disclosure include a disulfide bond between the two cysteines at positions 396 and 488. In some embodiments, the recombinant RSV F polypeptides of the present disclosure include a disulfide bond between the two cysteines at positions 398 and 485. In some embodiments, the recombinant RSV F polypeptides of the present disclosure include a disulfide bond between the 398th and 486th cysteines. In some embodiments, the recombinant RSV F polypeptides of the present disclosure include a disulfide bond between the 148th and 286th cysteines. In some embodiments, the recombinant RSV F polypeptides of the present disclosure include a disulfide bond between the 159th and 290th cysteines. In some embodiments, the recombinant RSV F polypeptides of the present disclosure include a disulfide bond between the 159th and 291st cysteines. In some embodiments, the recombinant RSV F polypeptides of the present disclosure include a disulfide bond between the 158th and 290th cysteines. In some embodiments, the recombinant RSV F polypeptides of the present disclosure include a disulfide bond between the 494th and 399th cysteines. In some embodiments, the recombinant RSV F polypeptides of the present disclosure include a disulfide bond between the 489th and 398th cysteines. In some embodiments, the recombinant RSV F polypeptides of the present disclosure include a disulfide bond between the 489th and 486th cysteines. In some embodiments, the recombinant RSV F polypeptides of the present disclosure include a disulfide bond between the 489th and 485th cysteines. In some embodiments, the recombinant RSV F polypeptides of the present disclosure include a disulfide bond between the 460th and 146th cysteines. In some embodiments, the recombinant RSV F polypeptides of the present disclosure include a disulfide bond between the 149th and 458th cysteines. In some embodiments, the recombinant RSV F polypeptides of the present disclosure include a disulfide bond between the 161st and 86th cysteines. In some embodiments, the recombinant RSV F polypeptides of the present disclosure include a disulfide bond between the 862th and 86th cysteines.In some embodiments, the recombinant RSV F polypeptides of the present disclosure include a disulfide bond between two cysteines at positions 161 and 90. In some embodiments, the recombinant RSV F polypeptides of the present disclosure include a disulfide bond between two cysteines at positions 67 and 83. In some embodiments, the recombinant RSV F polypeptides of the present disclosure include a disulfide bond between two cysteines at positions 67 and 80. In some embodiments, the recombinant RSV F polypeptides of the present disclosure include a disulfide bond between two cysteines at positions 62 and 196. In some embodiments, the recombinant RSV F polypeptides of the present disclosure include a disulfide bond between two cysteines at positions 67 and 207. In some embodiments, the recombinant RSV F polypeptides of the present disclosure include a disulfide bond between two cysteines at positions 61 and 195.

[0331] In some embodiments, the recombinant RSV F polypeptide includes the F1 domain and F2 domain from wild-type human RSV subtype A, human RSV subtype B, or bovine RSV. References to amino acids at position "x" of the RSV F polypeptide herein are intended to refer to the amino acid corresponding to amino acid position "x" of the amino acid sequence set forth in SEQ ID NO: 22. Those skilled in the art will appreciate that mutations or substitutions at the corresponding amino acid residues of the F protein of human RSV subtype A, human RSV subtype B, or bovine RSV can also achieve similar effects, stabilizing the F protein in a prefusion conformation.

[0332] In a specific embodiment, the recombinant RSV F polypeptide has an amino acid sequence as shown in SEQ ID NO: 8 or SEQ ID NO: 23, and has a mutation as shown in any one of Table 1 below compared to the wild-type RSV F protein.

[0333] Table 1.

[0334] Table 2 below shows the sequences of some mutants disclosed herein.

[0335] Table 2.

[0336] Those skilled in the art will appreciate that wild-type RSV-F protein may be derived from a variety of RSV isolates, and that there may be differences in the amino acid sequences of the F proteins of the various isolates. Those skilled in the art will also appreciate that, although there may be sequence differences, the F proteins of different isolates of RSV (different types, different species) have extremely high sequence identity (typically greater than 95%, such as greater than 96%, greater than 97%, greater than 98%, or greater than 99%) in amino acid sequence and have substantially the same biological function. Therefore, herein, the term wild-type "RSV-F protein" includes not only the protein shown in SEQ ID NO: 22, but also the F proteins of various RSV isolates, such as the F proteins of various RSV isolates derived from human RSV subtype A, human RSV subtype B, or bovine RSV. Furthermore, when describing a sequence fragment of a wild-type RSV-F protein, it includes not only the sequence fragment of SEQ ID NO: 22, but also the corresponding sequence fragments in the F proteins of various RSV isolates. For example, the phrase "amino acid residue 80 of wild-type RSV-F protein" includes amino acid residue 80 of SEQ ID NO:22, as well as corresponding fragments in the F proteins of various RSV isolates.

[0337] Exemplary human RSV subtype A sequences are shown in Table 3 below with Genbank or GASA accession numbers.

[0338] Table 3.

[0339] Exemplary human RSV subtype B sequences are shown in Table 4 below with Genbank or GASA accession numbers.

[0340] Table 4.

[0341] Exemplary bovine RSV F protein sequences are those shown in the Uniport database, such as Uniport Accession Nos. P29791, P22167, P23728, Q9YS24, C3UPB4, etc.

[0342] In some embodiments, the recombinant RSV F polypeptide of the present disclosure further comprises one or more amino acid mutations or substitutions to introduce disulfide bonds, ionic bonds, or hydrophobic interactions to prevent conformational rearrangement of the F polypeptide, thereby stabilizing the prefusion conformation.

[0343] The prefusion conformation of the recombinant RSV F polypeptide disclosed herein is stable and is not susceptible to conformational changes during processing (eg, purification, freeze-thaw cycles, and / or storage, etc.), ie, it will not transform into a postfusion conformation.

[0344] In some embodiments, the recombinant RSV F polypeptide includes a linker sequence comprising 1 to 10 amino acids connecting the F1 domain and the F2 domain.

[0345] The present disclosure provides a nucleic acid molecule encoding a recombinant RSV F polypeptide of the present disclosure.

[0346] In a preferred embodiment, the nucleic acid molecules encoding the recombinant RSV F polypeptide of the present disclosure are codon-optimized for expression in mammalian cells, preferably in human cells. Codon-optimized methods are well known to those skilled in the art. Codon-optimized nucleic acid molecules generally can obtain higher expression levels.

[0347] It will be appreciated by those skilled in the art that due to the degeneracy of the genetic code, there will be many different nucleic acid molecules that can encode the same polypeptide. It will also be appreciated by those skilled in the art that conventional techniques can be used to replace nucleotides, and these replacements do not affect the polypeptide sequences encoded by these nucleic acid molecules. Therefore, unless otherwise indicated, "a nucleic acid molecule (or nucleotide sequence) encoding an amino acid sequence" includes all nucleic acid molecules (or nucleotide sequences) that are in degenerate form and encode the same amino acid sequence. The nucleotide sequence encoding a protein and RNA may or may not include introns.

[0348] The present disclosure also provides a vector comprising the above-mentioned nucleic acid molecule. These vectors can be operated by methods well known to those skilled in the art and can be designed to replicate in prokaryotic and / or eukaryotic cells. In some embodiments, the vector can be transfected into eukaryotic cells and fully or partially integrated into the genome of these eukaryotic cells to produce host cells that stably express their encoded polypeptides. The vector used can be any vector suitable for cloning DNA or nucleic acid transcription. Vectors suitable for the present disclosure may include, but are not limited to, adenovirus vectors (e.g., Ad26 or Ad35), alpha virus, paramyxovirus, vaccinia virus, herpes virus, retroviral vectors, and the like.

[0349] Recombinant RSV F polypeptide, nucleic acid molecules or carrier of the present disclosure can be used for preventing and / or treating the RSV infection in a subject.In some embodiments, the subject can be a colony susceptible to RSV infection, for example the elderly (such as ≥50 years old, ≥60 years old and preferably ≥65 years old), young children (such as ≤5 years old, ≤1 year old), seek medical treatment for patients, and with other antiviral drugs but the patient with insufficient antiviral response.

[0350] To make the objectives, technical solutions, and advantages of the present invention more clearly understood, the present invention will be further described in detail below with reference to the following examples. The specific embodiments described herein are intended only to illustrate the present invention and are not intended to limit the present invention in any way. In addition, in the following description, descriptions of known structures and technologies are omitted to avoid unnecessary confusion about the concepts of the present disclosure. Such structures and technologies are also described in many publications.

[0351] definition

[0352] Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as commonly used in the field to which the present invention belongs. For the purpose of interpreting this specification, the following definitions will apply, and where appropriate, terms used in the singular will also include the plural form, and vice versa.

[0353] Unless the context clearly dictates otherwise, as used herein, the expressions "a" and "an" include plural references. For example, reference to "a cell" includes a plurality of such cells and equivalents thereof known to those skilled in the art, and so forth.

[0354] As used herein, the term "about" refers to a range of ±20% of the value that follows. In some embodiments, the term "about" refers to a range of ±10% of the value that follows. In some embodiments, the term "about" refers to a range of ±5% of the value that follows.

[0355] Herein, a fragment of an F1 domain refers to a truncated form of the F1 domain. That is, a truncated form of the F1 domain refers to a non-full-length F1 domain, and may lack one or more amino acid residues at the N-terminus or C-terminus. This also applies to fragments of the F2 domain.

[0356] Amino acids referred to herein generally refer to the 20 genetically encoded conventional amino acids, and their abbreviations are used according to rules known in the art. Genetically encoded amino acids are generally divided into the following families: (1) acidic amino acids are aspartic acid and glutamic acid; (2) basic amino acids are lysine, arginine, and histidine; (3) non-polar amino acids are alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, and tryptophan; and (4) uncharged polar amino acids are glycine, asparagine, glutamine, cysteine, serine, threonine, and tyrosine. Hydrophilic amino acids include arginine, asparagine, aspartic acid, glutamine, glutamic acid, histidine, lysine, serine, and threonine. Hydrophobic amino acids include alanine, cysteine, isoleucine, leucine, methionine, phenylalanine, proline, tryptophan, tyrosine, and valine. Other families of amino acids include (i) serine and threonine, which are an aliphatic hydroxyl family; (ii) asparagine and glutamine, which are an amide-containing family; (iii) alanine, valine, leucine, and isoleucine, which are an aliphatic family; and (iv) phenylalanine, tryptophan, and tyrosine, which are an aromatic family.

[0357] The term "linker" as used herein refers to a (peptide) linker of natural and / or synthetic origin, consisting of linear amino acids. The linker sequence can ensure that the different domains it connects (e.g., F1 domain and F2 domain) are correctly folded and appropriately presented, thereby exerting their biologically active functions. In different embodiments, the linker has a flexible conformation. Suitable flexible linkers include, for example, glycine, glutamine and / or serine residues. In some embodiments, the linker can be selected from (G n S) m 、(G) n 、(EAAAK) n or (XP) n , wherein n and m are each independently selected from an integer of 0 to 5. For example, n is selected from 0, 1, 2, 3, 4 or 5, and m is selected from 1, 2, 3, 4 or 5. In some embodiments, the linker may further include, for example, GSGSGR (SEQ ID NO: 2), KESGSVSSEQLAQFRSLD (SEQ ID NO: 3), EGKSSGSGSESKST (SEQ ID NO: 4), (Gly)8 (SEQ ID NO: 5), GSAGSAAGSGEF (SEQ ID NO: 6), etc.

[0358] As used herein, "percent sequence identity" or "percent identity" between two polynucleotide or polypeptide sequences refers to the number of identical matching positions shared by the sequences over the comparison window, taking into account additions or deletions (i.e., gaps) that must be introduced for optimal alignment of the two sequences. A matching position is any position where the same nucleotide or amino acid is present in both the target sequence and the reference sequence. Since a gap is not a nucleotide or amino acid, gaps present in the target sequence are not counted. Similarly, since target sequence nucleotides or amino acids are counted and nucleotides or amino acids from the reference sequence are not counted, gaps present in the reference sequence are not counted.

[0359] Percentage sequence identity can be calculated by the following process: determine that the number of positions where identical amino acid residues or nucleic acid bases occur in both sequences, to obtain the number of matched positions, the number of matched positions divided by the total number of positions in the comparison window, and multiply the result by 100, to obtain percent sequence identity. The determination of percent sequence identity between the comparison of a sequence and two sequences can be accomplished using software that is easy to use online and download. Suitable software programs can be obtained from various sources for the comparison of protein and nucleotide sequences. A suitable program for determining percent sequence identity is bl2seq, which is a part for the BLAST suite of programs that can be obtained from the BLAST website (blast.ncbi.nlm.nih.gov) of the National Center for Biotechnology Information of the U.S. Government. Bl2seq uses BLASTN or BLASTP algorithms to compare between two sequences. BLASTN is used for comparing nucleic acid sequences, and BLASTP is used for comparing amino acid sequences. Other suitable programs are, for example, Needle, Stretcher, Water or Matcher, part of the EMBOSS suite of bioinformatics programs and also available from the European Bioinformatics Institute (EBI) at www.ebi.ac.uk / Tools / psa. Reference herein to a first nucleic acid or amino acid sequence having at least 85% sequence identity to a second nucleic acid or amino acid sequence means that the first nucleic acid or amino acid sequence and the second nucleic acid or amino acid sequence may have at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity.

[0360] The term "adjuvant" as used herein refers to a vehicle for enhancing antigenicity. Adjuvants are known in the art to further enhance the immune response of the applied antigenic determinants. In this article, adjuvants can be used to enhance the immune response of the recombinant RSV F polypeptide of the present disclosure. Examples of suitable adjuvants include, but are not limited to, suspensions of minerals (alum, aluminum adjuvants or phosphates) adsorbed with antigens; or water-in-oil emulsions, for example, wherein the antigen solution is emulsified in mineral oil (Freund's incomplete adjuvant), sometimes including killed mycobacteria (Freund's complete adjuvant) to further enhance antigenicity, for example, to inhibit the degradation of the antigen and / or cause macrophage influx. Immunostimulatory oligonucleotides, such as CpG motifs, can also be used as adjuvants. Adjuvants can also include biomolecules (also referred to as "biological adjuvants"), such as costimulatory molecules. Exemplary adjuvants include, but are not limited to saponin, AS01B, AS01E, IL-2, RANTES, GM-CSF, TNF-α, IFN-γ, G-CSF, LFA-3, CD72, B7-1, B7-2, OX-40L, 4-1BBL and toll-like receptor (TLR) agonists. Adjuvants are well known to those skilled in the art and can be used in combination with the recombinant RSV F polypeptide of the present disclosure.

[0361] "CpG motif" or "CpG oligonucleotide" and similar terms refer to a nucleotide molecule containing an unmethylated CpG moiety and having a length of 6-50 nucleotides. In the embodiments of the present disclosure, the CpG motif refers to any other art-accepted definition of the term. The CpG motif includes modified oligonucleotides using any synthetic internucleoside linkage, modified base and / or modified sugar.

[0362] The terms "administering" or "administration" as used herein refer to introducing a recombinant RSV F polypeptide of the present disclosure or a composition containing the recombinant RSV F polypeptide into a subject by a selected route. Administration can be local or systemic. Non-limiting examples can include, for example, intradermal, subcutaneous, intramuscular, transdermal or mucosal (e.g., intranasal) or oral administration. In some embodiments, the recombinant RSV F polypeptide of the present disclosure or the composition can be administered by intramuscular injection. In some embodiments, the recombinant RSV F polypeptide of the present disclosure or the composition can be administered by intravenous injection.

[0363] Recombinant RSV F polypeptides of the present disclosure or their encoding nucleic acid molecules can be administered in combination with, for example, polymers, liposomes, viral vectors, virus-like particles, or nanoparticles. In an exemplary embodiment, recombinant RSV F polypeptides of the present disclosure can be administered in the presence or absence of an adjuvant, encapsulated in liposomes, virus-like particles, or nanoparticles.

[0364] The term "subject" as used herein includes, for example, mammals. Mammals include humans or non-human mammals. In some embodiments, non-human mammals may include, for example, non-human primates, cats, dogs, cows, horses, pigs, sheep, goats, mice, rabbits, rats, gerbils, guinea pigs, and the like.

[0365] As used herein, the term "prevent" or "prevent" refers to partially or completely delaying the onset of a disease (e.g., RSV), condition, and / or disorder; partially or completely delaying the onset of one or more symptoms, characteristics, or clinical manifestations of a particular disease, condition, and / or disorder; partially or completely delaying the onset of one or more symptoms, characteristics, or manifestations of a particular disease, condition, and / or disorder; partially or completely delaying the progression from a particular disease, condition, and / or disorder; and / or reducing the risk of developing pathology associated with a disease, condition, and / or disorder.

[0366] As used herein, the term "treat" refers to, for example, reducing the severity of a disease or condition (e.g., RSV); shortening the duration of the disease; ameliorating or eliminating one or more symptoms associated with the disease or condition; providing a beneficial effect to a subject suffering from the disease or condition, but not necessarily curing the disease or condition. The term also includes preventing or prophylactic treatment of a disease or condition or its symptoms.

[0367] As used herein, the term "anti-RSV agent" refers to an agent that specifically inhibits RSV replication or infection of cells. Non-limiting examples of anti-RSV agents include the monoclonal antibody palivizumab, and small molecule antiviral drugs such as ribavirin.

[0368] Antibodies D25, MEDI8897, and AM14 used herein are neutralizing monoclonal antibodies that specifically bind to the prefusion conformation of the RSV F protein but not the postfusion conformation of the RSV F protein. Antibodies D25, MEDI8897 and AM14 are all known and their amino acid sequences have been described in U.S. Patent Application Publication No. 2010 / 0239593, Joseph B Domachowske et al. (Safety, Tolerability and Pharmacokinetics of MEDI8897, an Extended Half-life Single-dose Respiratory Syncytial Virus Prefusion F-targeting Monoclonal Antibody Administered as a Single Dose to Healthy Preterm Infants, Pediatr Infect Dis J,. 2018 Sep; 37(9): 886-892) and Wayne Harshbarger et al. (Improved epitope resolution of the prefusion trimer-specific antibody AM14 bound to the RSV F glycoprotein, MABS, 2021, Vol. 13, No. 1, e1955812), which are incorporated herein by reference in their entirety.

[0369] The Moderna mRNA-1345 used in this article refers to the Pre-F RSV mRNA vaccine prepared by Moderna based on DS-CAV1 optimization, and its preparation method is described in WO 2021 / 155243 A1.

[0370] The recombinant RSV F polypeptide herein can form an antigenic epitope by continuous or discontinuous amino acids through the tertiary folding of the protein, and the antigenic epitope constitutes a unique spatial conformation that can be recognized by antibodies that specifically recognize the pre-fusion conformation of the RSV F protein (e.g., D25, MEDI8897, or AM14).

[0371] As used herein, the term "trimerization domain" refers to an amino acid sequence capable of forming a trimer structure. In some embodiments, the trimerization domain can be a foldon domain (e.g., a T4 foldon). In some embodiments, the recombinant RSV F polypeptide or recombinant protein of the present disclosure can be folded into a specific three-dimensional structure through the trimerization domain and form a specific antigenic epitope.

[0372] As used herein, the term "immune response" refers to a response by cells of the immune system, such as B cells, T cells, or monocytes, to a stimulus. In some embodiments, the response is specific for a particular antigen (an "antigen-specific response"). In some embodiments, the immune response is a T cell response, such as a CD4 + response or CD8 + In some embodiments, the response is a B cell response and results in the production of specific antibodies. In some embodiments, a "Th1" (biased) immune response is characterized by the presence of CD4 T cells that secrete IL-2 and IFN-γ. + In contrast, a "Th2" (biased) immune response is characterized by CD4 T cells that produce IL-4, IL-5, and IL-13. + Accessory cells predominate.

[0373] As used herein, the term "effective amount" refers to an amount sufficient to produce a desired reaction, such as an immune response to RSV F protein, or to reduce or eliminate the amount of a medicament (such as recombinant F antigen of the present disclosure or its encoding nucleic acid molecule or other medicament) of the sign or symptom of a condition or disease such as RSV infection. For example, an "effective amount" may be the amount required for suppressing viral replication or measurably changing the outward symptoms of a viral infection. In general, this amount will be sufficient to measurably suppress viral (such as, RSV) replication or infectivity. When administered to a subject, typically a dosage that will reach a target tissue concentration (such as, in respiratory tissue) will be used, which has been demonstrated to achieve in vitro inhibition of viral replication. In some instances, an "effective amount" is one or more symptoms and / or potential causes of disease that prevent or treat any condition or disease, such as, the amount for the treatment of RSV infection.

[0374] As used herein, the expressions "inhibit" or "treat" refer to, for example, inhibiting the full development of a disease or condition in a subject at risk of a disease (e.g., RSV infection). "Treatment" refers to a therapeutic intervention that improves the signs or symptoms of a disease or pathological condition after it has begun to develop. The term "improve" with respect to a disease or pathological condition refers to any observable beneficial therapeutic effect. A beneficial effect can be demonstrated, for example, by a delayed onset of clinical symptoms of the disease in a susceptible subject, a reduction in the severity of some or all of the clinical symptoms of the disease, a slower progression of the disease, an improvement in the overall health or health of the subject, or other parameters that are well known in the art to be specific for a particular disease. "Prophylactic" treatment is a treatment administered to a subject who does not show signs of the disease or only shows early signs in order to reduce the risk of developing the disease.

[0375] In this article, antibody refers to a polypeptide basically encoded by an immunoglobulin gene or multiple immunoglobulin genes or its fragment in nature, which specifically binds to and recognizes an analyte (such as an antigen or immunogen), such as RSV F protein or its antigenic fragment. Immunoglobulin genes include kappa, lambda, alpha, gamma, beta, epsilon and mu constant region genes, as well as countless immunoglobulin variable region genes. As used herein, the term "antibody" includes, for example, antibody fragments produced by modification of complete antibodies and by de novo synthesis using a recombinant DNA method. Antibodies exist, for example, in the form of complete immunoglobulins and in the form of a variety of well-characterized antibody fragments. For example, Fab, Fv and single-chain Fv (scFv) incorporated into RSV F protein will be RSV F protein-specific binding agents. When referring to antibodies herein, variants and fragments thereof, such as Fab' fragments, F(ab)'2 fragments, single-chain Fv proteins ("scFv") and disulfide-stabilized Fv proteins ("dsFv") are included, as well as variants well-known in the art. A scFv protein is a fusion protein in which the variable region of the light chain of an immunoglobulin is bound to the variable region of the heavy chain of an immunoglobulin by a linker, whereas in a dsFv, the chains have been mutated to introduce disulfide bonds to stabilize the association of the chains. The term also includes genetically engineered forms such as chimeric antibodies (e.g., humanized murine antibodies) or heterologous conjugate antibodies (e.g., bispecific antibodies). The antibodies may be of the IgM, IgD, IgG, IgA, or IgE type.

[0376] The term "pharmaceutically acceptable carrier" as used herein, its nature depends on the mode of administration of the immunogenic composition. For example, parenteral compositions generally include injectable solutions, wherein the pharmaceutically acceptable carrier can be, for example, water, physiological saline, balanced salt solution, dextrose solution, glycerol and other carriers. For solid compositions, such as powders, pills, tablets or capsules, the pharmaceutically acceptable carrier can be, for example, mannitol, lactose, starch or magnesium stearate. In a specific embodiment, the carrier suitable for administration to the subject can be sterile and / or suspended, or otherwise included in a unit dosage form containing one or more suitable for inducing an anti-RSV immune response. The unit dosage form can be, for example, in a sealed vial with sterile contents or in a syringe for injection into the subject, or lyophilized for subsequent dissolution and administration.

[0377] The term "virus-like particle (VLP)" as used herein refers to the non-replicative viral coat derived from a virus. VLP is generally composed of one or more viral proteins, including but not limited to capsid, coating, shell, surface and / or membrane proteins. After recombinant expression in a suitable expression system, VLP can form spontaneously. The recombinant RSV F polypeptide herein can be displayed on the surface of the VLP and can be used to induce an immune response against RSV. VLP and its preparation method are well known in the art. For example, VLP can derive from human papillomavirus, HIV, Semliki-Forest virus, human polyomavirus, rotavirus, parvovirus, canine parvovirus, hepatitis E virus and Newcastle disease virus etc. The formation of these VLPs can be detected by any suitable technology (for example electron microscopy, dynamic light scattering (DLS), selective chromatographic separation such as ion exchange, hydrophobic interaction and / or size exclusion chromatography separation, and density gradient centrifugation).

[0378] The term "nanoparticle" as used herein may be a protein nanoparticle. Non-limiting examples of protein nanoparticles include ferritin nanoparticles, encapsulin nanoparticles, sulfur oxidoreductase (SOR) nanoparticles, and the like. The polypeptide subunits constituting the protein nanoparticles can be fused with the recombinant RSV F polypeptide of the present disclosure to form a fusion protein, which can then self-assemble into nanoparticles under appropriate conditions, and the recombinant RSV F polypeptide of the present disclosure can be displayed on the surface of the nanoparticles or packaged inside the nanoparticles.

[0379] It will be appreciated by those skilled in the art that an epitope can be formed by continuous or discontinuous amino acids juxtaposed by the tertiary folding of a protein. Epitopes formed by continuous amino acids generally remain exposed to denaturing solvents, while epitopes formed by tertiary folding are generally lost when treated with denaturing solvents. An epitope generally includes at least 3 and more generally at least 5, about 9, or about 8-10 amino acids in a unique spatial conformation. Methods for determining the spatial conformation of an epitope include, for example, x-ray crystallography and nuclear magnetic resonance. An epitope may also include post-translational modifications of amino acids, such as N-linked glycosylation.

[0380] The F albumen from mankind RSV hypotype A, mankind RSV hypotype B or cattle RSV mentioned herein and encoding nucleic acid thereof are known in the art.It will be appreciated by those skilled in the art that although the amino acid mutation site herein is based on the F albumen (such as such as SEQ ID NO:Amino acid sequence shown in 22) of mankind RSV hypotype A, but from other mankind RSV hypotypes A (such as the sequence of mankind RSV hypotype A shown in Table 3), mankind RSV hypotype B (such as the sequence of mankind RSV hypotype B shown in Table 4) or cattle RSV (such as those shown in Uniport database, such as Uniport accession numbers P29791, P22167, P23728, Q9YS24, C3UPB4 etc.) the sudden change of the corresponding amino acid site of the F albumen can also realize similar effect, so that the recombinant F albumen obtained can remain on conformation before fusion.Based on the conservativeness of the F protein sequence of RSV, those skilled in the art can easily obtain the corresponding amino acid site of the F albumen of the RSV in different sources.

[0381] The following examples and figures are provided to assist in understanding the present invention. However, it should be understood that these examples and figures are intended to illustrate the present invention only and do not constitute any limitation. The reagents used in the examples can be prepared or commercially available in conventional manner. The techniques involved in the examples, unless otherwise specified, are conventional techniques in various fields such as cell biology, biochemistry, and molecular biology well known to those skilled in the art. The actual scope of protection of the present invention is set forth in the claims. It should be understood that any modifications and changes can be made without departing from the spirit of the present invention.

[0382] Example

[0383] Example 1. Preparation of RSV wild-type F protein

[0384] This embodiment selects the F protein of subtype A RSV virus (SEQ ID NO: 22) as an example, and the F protein is used as the basis for the following operation. The extracellular soluble region aa 1 to 513 (SEQ ID NO: 1) or aa 1 to 526 (SEQ ID NO: 22) of the F protein is used as an antigen, and the aa 109 to 136 region of the F protein is replaced with the linker GSGSGR (SEQ ID NO: 2) to obtain the amino acid sequence of the single-chain recombinant F protein of SEQ ID NO: 8 (corresponding to aa 1 to 513) or SEQ ID NO: 23 (corresponding to aa 1 to 526). At the same time, in order to stabilize the extracellular trimer state, the natural trimer domain fibrin domain T4 foldon (GYIPEAPRDGQAYVRKDGEWVLLSTFL, SEQ ID NO: 7) is added to its C-terminus. For subsequent detection and purification, a Strep-II tag was added after the T4-foldon, and finally the recombinant F-T4-Strep protein (SEQ ID NO: 9 or SEQ ID NO: 24) was obtained.

[0385] Example 2. Design and conformational screening of RSV F mutants

[0386] This example compares the structures of the Pre-F and Post-F proteins and divides the F protein into three parts based on their structural differences: the constant region, the upper variable region, and the lower variable region. To stabilize the F protein in the Pre-F conformation, mutations were introduced into certain amino acid pairs between the constant region and the upper variable region, between the constant region and the lower variable region, and into specific amino acids.

[0387] Initial screening of mutants: Site-directed mutagenesis primers were designed, and the designed mutation sites were introduced into the RSV F gene. Mutant strand synthesis was performed, and the target fragment was recovered by gel electrophoresis. The pCDNA3.4 vector was double-digested with the restriction endonucleases HindIII and NotI. The vector fragment was recovered by gel electrophoresis, and the recovered RSV F protein mutant fragment was ligated into the pCDNA3.4 vector to generate the RSV F protein mutant expression vector. The RSV F protein mutant expression vector was transfected into 50 mL of HEK 293F cells, cultured for 5 days, and the supernatant was collected by centrifugation. The supernatant was then assayed by ELISA with three pre-F-specific antibodies: D25, AM14, and MEDI8897. D25, AM14, and MEDI8897 antibodies were used as coating antibodies, anti-Strep II antibody as detection antibody, and goat anti-mouse HRP as enzyme-labeled antibody. Antibodies D25, AM14, and MEDI8897 were diluted to 1 μg / mL, and 100 μL / well was coated overnight at 2-8°C. 100 μL / well of cell supernatant was added and incubated at room temperature for 30 minutes. The cell supernatant was discarded and the ELISA plate was washed with PBS. After adding Anti-StrepⅡ antibody and goat anti-mouse-HRP antibody, the ELISA plate was read with a microplate reader at a wavelength of 450 nm. Table 5 shows the results of the ELISA test that were positive. The F protein DS-Cav1 (Michelle C Crank et al., A proof of concept for structure-based vaccine design targeting RSV in humans, Science, 2019Aug 2; 365(6452): 505-509), which is known to be stable in the prefusion conformation, was used as a positive control.

[0388] Table 5. ELISA results of 293 cell supernatant for F protein mutants

[0389] Note: ND: Not Detected; NA: Not Detected

[0390] Mutants M123 to M130 in Table 5 were obtained based on SEQ ID NO: 23 (corresponding to aa 1 to 526), ​​and the other mutants were mutated based on SEQ ID NO: 8 (corresponding to aa 1 to 513).

[0391] The results in Table 5 show that compared with the wild-type F protein, the displayed mutants can all bind to the three antibodies D25, AM14, and MEDI8897, indicating that these mutants are in the pre-fusion conformation.

[0392] Secondary screening of mutants: M43, M60, M61, M62, M63, M64, M66, M75, M103, M105, M109, M110, M111, M112, M114, M119, M120, M128, M133, M142, M143, M146, M147, M149, M150 and M152 mutants were selected for amplified expression and purification. After protein quantification, equal amounts of protein were used for ELISA detection with three antibodies: D25, AM14 and MEDI8897. 1 mg of RSV F protein mutant plasmid was transfected into 1 L of HEK 293F cells and the supernatant was obtained by centrifugation after 5 days of culture. The supernatant was purified by Strep affinity chromatography resin ( The protein eluate obtained by affinity chromatography was purified by molecular sieve chromatography (HiLoad supeMdex 200 pg) to obtain a purified protein solution of the F protein mutant (in the form of a trimer). Figure 2 shows an example of the molecular sieve chromatography purification results of mutant M114.

[0393] ELISAs were performed using 8 μg of F protein mutants with antibodies D25, AM14, and MEDI8897. Table 6 shows the ELISA results for 8 μg of M43, M60, M61, M62, M63, M64, M66, M75, M103, M105, M109, M110, M111, M112, M114, M119, M120, M128, M133, M142, M143, M146, M147, M149, M150, and M152 mutants with antibodies D25, AM14, and MEDI8897. DS-CAV1 and wild-type (WT) F proteins served as positive and negative controls, respectively.

[0394] Table 6. ELISA test results of purified F protein mutants and three antibodies D25, AM14, and MEDI8897

[0395] Table 6 shows that the M43, M60, M61, M62, M63, M64, M66, M75, M103, M105, M109, M110, M111, M112, M114, M119, M120, M128, M133, M142, M143, M146, M147, M149, M150, and M152 mutants all exhibited significant binding ability to the three Pre-F antibodies, with no significant difference from the positive control DS-CAV1.

[0396] Example 3. Protein stability assay of RSV F protein mutants

[0397] This example uses the UNCLE molecular characterization instrument (Unchained Labs), and exemplary mutants M43, M60, M61, M62, M63, M64, M66, M75, M103, M105, M109, M110, M111, M112, M114, M119, M120, M128, M133, M142, M143, M146, M147, M149, M150, and M152 were tested for Tm values ​​to investigate the stability of each mutant. 9 μL (1 mg / mL) of purified mutant samples were respectively taken and tested on the UNCLE device, the temperature range was set to 25-95°C, and a replicate well was set for each sample. Figure 3 shows the Tm value test results of each mutant provided in this example. UNcle assay results showed that the Tm values ​​of all mutants were greater than 55°C, with no significant difference from the Tm value of DS-CAV1, indicating good thermal stability and suitability as vaccine antigens. UNcle assay results for mutant M111 showed that its Tm value was greater than 55°C, with no significant difference from the Tm value of DS-CAV1, indicating good thermal stability and suitability as a vaccine antigen.

[0398] Example 4. Accelerated thermal stability study

[0399] This example uses a thermal acceleration method to exemplify a more in-depth evaluation of the thermal stability of some mutants. 100 μL (5 μg) of purified mutant samples were taken and treated at 50°C and 60°C for 1 hour, respectively. The binding ability of the heat-treated mutant samples to AM14 and D25 antibodies (Pre-F specific antibodies) was tested by ELISA. DS-CAV1 F protein was used as a positive control. Figure 4 shows the results of ELISA tests of mutants M43, M60, M61, M62, M63, M64, M66, M75, M103, M105, M109, M110, M112, M114, M119, M120, M128, M133, M142, M143, M146, M147, M149, M150, and M152 treated at 50°C for 1 hour with AM14 and D25 antibodies, respectively. Figure 5 shows the ELISA results of mutants M43, M60, M61, M62, M63, M64, M66, M75, M103, M105, M109, M110, M112, M114, M119, M120, M128, M133, M142, M143, M146, M147, M149, M150, and M152 treated at 60°C for 1 hour and then tested with antibodies AM14 and D25, respectively. The results showed that the binding ability of each mutant to antibodies AM14 and D25 after treatment at 50°C for 1 hour was slightly higher than that after treatment at 60°C for 1 hour. Regardless of whether the mutants were treated at 50°C for 1 hour or at 60°C for 1 hour, the binding ability of each mutant to antibodies AM14 and D25 was not significantly different from that of the positive control DS-CAV1.

[0400] In summary, the Tm values ​​of all mutants were greater than 55°C, demonstrating good stability. The results of thermal acceleration studies were not significantly different from those of the positive control, DS-CAV1. The results of thermal acceleration studies of mutant M111 were also not significantly different from those of the positive control, DS-CAV1. This indicates that all mutants can partially maintain the Pre-F conformation after high-temperature treatment, meeting design expectations and satisfying vaccine production requirements.

[0401] Example 5. Detection of RSV F protein mutant expression

[0402] This example exemplifies the expression levels of mutants M43, M60, M61, M62, M63, M64, M66, M75, M103, M105, M109, M110, M111, M112, M114, M119, M120, M128, M133, M142, M143, M146, M147, M149, M150, and M152. 1 mg of the vector containing the F protein mutant coding sequence was transfected into 1 L of HEK 293F cells for expression, and then purified by chromatography according to the method of Example 2. And the expression level of each mutant was detected by nanodrop instrument. Figure 6 is the detection result of the expression level of mutants M43, M60, M61, M62, M63, M64, M66, M75, M103, M105, M109, M110, M112, M114, M119, M120, M128, M133, M142, M143, M146, M147, M149, M150, and M152. The result shows that the expression level of each mutant is relatively different but all higher than 2mg / ml, and the expression level of some mutants is nearly 10mg / ml. The expression level of mutant M111 is also higher than 2mg / mL. The expression level detection results provided by the embodiment of the present invention are all based on the transient cell expression level detection results, and the expression level of the stable cell line used for large-scale production is expected to reach ten times of the existing expression level. Therefore, the mutant expression levels shown in this embodiment all meet industrial production requirements and can be used for vaccine production.

[0403] Example 6. Confirmation of protein conformation of RSV F protein mutants

[0404] In this example, negative staining electron microscopy was used to confirm the conformations of mutants M43, M60, M61, M62, M63, M64, M66, M75, M103, M105, M109, M110, M111, M112, M114, M119, M120, M128, M133, M142, M143, M146, M147, M149, M150, and M152. A 400-mesh microgrid copper grid was hydrophilized. 4 μL of protein sample was placed on the grid and allowed to stand for 1 minute. Filter paper was placed on the edge of the grid to absorb the protein sample. 4 μL of 5% uranyl acetate was placed on the grid and allowed to stand for 1 minute. Filter paper was placed on the edge of the grid to absorb the uranyl acetate. Another 4 μL of 5% uranyl acetate was placed on the grid and allowed to stand for 1 minute. Filter paper was placed on the edge of the grid to absorb the uranyl acetate. The uranyl acetate was allowed to air-dry for 1 minute. Finally, the grid was placed on the negative-staining electron microscope specimen stage to observe the protein sample. Figure 7 shows negative-staining electron microscope images of the mutants tested.

[0405] The negative-stained electron micrographs in Figure 7 show that these mutants all exhibit an elliptical Pre conformation, clearly distinct from the elongated structure of Post F. To further clarify the shape details of these mutant proteins, 2D classification analysis of the protein particles in these negative-stained images was performed. The results (not shown) also show that the protein particles exhibit characteristic "elliptical" and "comma" shapes, consistent with the structural characteristics of the Pre-F conformation. Negative-stained electron micrographs of mutant M111 and their 2D classification analysis indicate that M111 also conforms to the structural characteristics of the Pre-F conformation, further demonstrating that these mutants can stabilize the F protein in the prefusion conformation.

[0406] Example 7. Detection of the immunogenicity of RSV F protein mutant recombinant protein mixed with different adjuvants

[0407] This example tests the immunogenicity of F protein mutants M43, M60, M61, M62, M63, M64, M66, M75, M103, M105, M109, M110, M111, M112, M114, M119, M120, M128, M133, M142, M143, M146, M147, M149, M150, and M152. BALB / c mice were randomly divided into 78 groups of 5 mice each. Three groups of mice constituted a large group. Three groups of mice in each large group were injected with 6 μg of purified mutant protein, 6 μg of purified mutant protein containing aluminum adjuvant, and 6 μg of purified mutant protein containing AS01E adjuvant, respectively. DS-CAV1 and PBS were used as positive and negative controls, respectively. The positive control group was immunized in the same manner as the mutant protein group. Two immunizations were performed on days 0 and 14, respectively. Mice were sacrificed on day 28 and serum was collected. The serum was neutralized with RSV subtype A carrying a luciferase reporter gene (Bouillier C et al. Generation, Amplification, and Titration of Recombinant Respiratory Syncytial Viruses. J Vis Exp. 2019 Apr 4; (146)) and then infected with 293T cells. The neutralizing antibody level in the serum was then assessed using Bio-Lite luciferase assay reagent (Vazyme).

[0408] Figure 8 shows the neutralizing antibody titers in mouse serum for the aforementioned F protein mutants. The results showed that, in mice, the protein vaccine using the AS01E adjuvant induced the highest levels of neutralizing antibodies, followed by the aluminum adjuvant vaccine group. The unadjuvanted protein vaccine had a weaker ability to induce neutralizing antibodies in mouse serum. Regardless of the AS01E adjuvanted, aluminum adjuvanted, or unadjuvanted vaccine groups, the ability of each mutant vaccine to induce neutralizing antibodies in mouse serum was not significantly different from that of the DS-CVA1 positive control group. Some mutant vaccine groups even had slightly higher neutralizing antibody levels than the positive control group. Regarding the M111 mutant, the ability of the adjuvanted, aluminum adjuvanted, or unadjuvanted vaccine groups to induce neutralizing antibodies in mouse serum was not significantly different from that of the DS-CVA1 positive control group. The AS01E adjuvanted protein vaccine induced the highest levels of neutralizing antibodies in mice, followed by the aluminum adjuvanted vaccine group. The unadjuvanted protein vaccine had a weaker ability to induce neutralizing antibodies in mouse serum.

[0409] Example 8. Preparation of mRNA vaccine and evaluation of neutralizing antibody titer

[0410] 1) The nucleic acid sequences of F protein mutants M43, M60, M61, M62, M63, M64, M66, M75, M103, M105, M109, M110, M111, M112, M114, M119, M120, M128, M133, M142, M143, M146, M147, M149, M150, and M152 were codon-optimized and constructed into the pcDNA3.1 vector.

[0411] 2) Transform the constructed vector into Top10 competent cells, culture at 37°C for 12-16 hours, and collect the cells by centrifugation.

[0412] 3) Plasmid DNA was extracted from the collected E. coli using the Tiangen Endotoxin-Free Plasmid Extraction Kit (Model: DP117). Plasmid DNA purity and supercoiling ratio were determined by agarose gel electrophoresis.

[0413] 4) Plasmid linearization: Add BsaI restriction endonuclease at a ratio of 2 U / 1 μg to the plasmid that meets the requirements. Incubate at 37°C for 3 hours to obtain a DNA transcription template that meets the requirements. Samples are then submitted for agarose gel electrophoresis.

[0414] 5) Linearized plasmid magnetic bead purification: DNA sorting magnetic beads (Hieff The linearized plasmid was purified using DNA Selection Beads.

[0415] 6) In vitro mRNA transcription: T7 RNA polymerase (final concentration 5 U / μl), pyrophosphatase (final concentration 0.005 U / μl), RNase inhibitor (final concentration 4 U / μl), four nucleotide bases (final concentration 25 mmol / L), linearized template plasmid (final concentration 0.25 μg / μl), and cap analog m7GpppAmG (final concentration 30 mmol / L) were added to the reaction system, mixed evenly, and incubated at 37°C for 3 hr. DNaseI (final concentration 5 U / μg) was then added to the reaction solution and incubated at 37°C for 30 min to digest the DNA transcription template to obtain a transcription reaction solution.

[0416] 7) mRNA purification: DNA sorting magnetic beads (Hieff DNA Selection Beads) were used to purify the mRNA obtained by in vitro reverse transcription.

[0417] 8) mRNA-LNP Preparation: The LNP formulation was consistent with Moderna mRNA-1345. mRNA was diluted in 50 mM citrate buffer, pH 4.0, RNase-free. The aqueous and oil phases were aspirated separately using syringes. mRNA-LNPs were prepared using a rapid nanomedicine preparation system. The aqueous and ethanol solutions were mixed in a 3:1 volume ratio at a total flow rate of 12 mL / min. The prepared mRNA-LNPs were transferred to a 10K molecular cutoff dialysis cassette and dialyzed overnight against 10 mM Tris-HCl buffer. The dialyzed mRNA-LNPs were stored in a -80°C freezer.

[0418] 9) BALB / c mice were randomly divided into 29 groups of 10 mice each. The mice in each group were injected with 5ug of the mRNA vaccine of the mutant F protein prepared in Example 6. mRNA-1345 (WO 2021 / 155243 A1) and formalin-inactivated vaccine were used as positive controls, and PBS was used as a negative control group. Two immunizations were performed on days 0 and 14, respectively. The mice were sacrificed on day 28, and the mouse serum was taken. The neutralizing antibody level of the serum against RSV virus subtype A was detected according to the method of Example 7. Figure 9 shows the neutralizing antibody titer of mice serum after immunization with each F protein mutant mRNA vaccine.

[0419] Figure 9 shows that both the positive control group and the mutant protein mRNA vaccines induced high levels of neutralizing antibodies in mice, with no significant differences. Some mutant protein mRNA vaccines induced higher neutralizing antibody levels than the positive control group. Neutralizing antibody levels in the mRNA1345 and mutant protein mRNA vaccine groups were significantly higher than those in the formalin-inactivated vaccine group. The M111 mutant protein mRNA vaccine induced high levels of neutralizing antibodies in mice, with no significant differences observed for the other mutants.

[0420] Example 9. Evaluation of mRNA vaccine ERD effect (cytokine detection)

[0421] Whether a vaccine can induce Th2-biased CT4 cellular immunity is an important indicator for determining whether a vaccine carries an ERD risk. In this example, IFN-γ was selected as a Th1 cellular immunity marker and IL4 as a Th2 cellular immunity marker. The relative ratios of these two cytokines were used to determine whether a candidate vaccine carries an ERD risk.

[0422] BALB / c mice were randomly divided into 29 groups of 5 mice each. Each group of mice was injected with 5 μg of the mRNA vaccine of the mutant F protein prepared in Example 8. mRNA-1345 and formalin-inactivated RSV vaccine (F1-RSV) were used as positive controls, and PBS was used as a negative control group. Two immunizations were performed on days 0 and 14, and mice were killed on day 33 and their spleens were taken. Flow cytometry screening was used to detect IFN-γ and IL4 cytokines using anti-IFN-γ antibodies (Biolegend) and anti-IL4 antibodies (Biolegend). The results are shown in Figures 10 and 11.

[0423] Figures 10 and 11 show the results of IFN-γ and IL4 cytokine detection in splenocytes of mice immunized with mRNA vaccines of various F protein mutants M43, M60, M61, M62, M63, M64, M66, M75, M103, M105, M109, M110, M112, M114, M119, M120, M128, M133, M142, M143, M146, M147, M149, M150, and M152. The cytokine detection results showed that the Th2 cytokine level (IL4) of the formalin-inactivated vaccine (FI-RSV) was significantly higher than the Th1 cytokine level (IFN-γ), indicating that the formalin-inactivated vaccine easily induces Th2-biased CT4 cellular immunity in mice, which has the risk of ERD, which is consistent with the results of clinical trials. In both the mutant mRNA vaccine groups and the positive control group, Th1 cytokine levels (IFN-γ) were significantly higher than Th2 cytokine levels (IL4), eliciting Th1-biased cellular immunity in mice and high levels of neutralizing antibodies, with a low risk of ERD. In the M111 mutant mRNA vaccine group, Th1 cytokine levels (IFN-γ) were also significantly higher than Th2 cytokine levels (IL4), eliciting Th1-biased cellular immunity in mice and high levels of neutralizing antibodies, with a low risk of ERD.

[0424] Example 10. Study on protection against mRNA vaccine challenge

[0425] This example tests the protective effect of each mutant mRNA vaccine on mice. BALB / c mice were randomly divided into 29 groups, with 5 mice in each group. Each group of mice was injected with 5 μg of the mRNA vaccine of the mutant F protein M43, M60, M61, M62, M63, M64, M66, M75, M103, M105, M109, M110, M112, M114, M119, M120, M128, M133, M142, M143, M146, M147, M149, M150, and M152 prepared in Example 8. mRNA1345 and formalin inactivated vaccine were used as positive controls, and PBS was the group that was directly attacked by the virus without vaccination. Two immunizations were performed on days 0 and 14, respectively. On day 28, the mice were treated with 1×10 6 The mice were challenged with pfu RSV A2 live virus, and the mice were killed on the 33rd day to detect the viral load in the mouse lungs.

[0426] The viral load in mouse lungs was determined by RT-qPCR. RNA was extracted from the mouse lung homogenates using an RNA extraction kit (TIANGEN) and reverse transcribed using a Takara reverse transcription kit. The cDNA obtained by reverse transcription was quantitatively detected by qPCR using the following primer pairs:

[0427] RSVA-NF: AGATCAACTTCTGTCATCCAGCAA (SEQ ID NO: 25);

[0428] RSVA-NR:TTCTGCACATCATAATTAGGAGTATCAAT (SEQ ID NO: 26).

[0429] At the same time, pathological sections of the mouse lung tissue were observed and scored for lung pathology. On day 4 after RSV infection, whole lungs were collected from three mice, soaked in 4% paraformaldehyde, embedded in paraffin, and sectioned. Tissue sections were stained with hematoxylin and eosin for routine evaluation. A score of 0 indicates no inflammation, 1 indicates mild inflammation, 2 indicates mild to moderate inflammation, 3 indicates moderate inflammation, and 4 indicates significant inflammation. Pathology scoring was performed double-blind, meaning that neither the subject nor the pathologist was aware of the sample number or name.

[0430] Figures 12 and 13 show the lung viral load and lung pathology score results of mice immunized with various F protein mutant mRNA vaccines.

[0431] The results of mouse lung viral load testing showed that compared with the direct challenge group (PBS group), each mutant mRNA vaccine could reduce the mouse lung viral load by at least 1,000 times, demonstrating a good ability to eliminate mouse lung viruses. There was no significant difference from the mRNA1345 vaccine group, and it was significantly higher than the formalin-inactivated vaccine group (FI-RSV). The results of lung pathology scoring showed that the formalin-inactivated vaccine group had the highest lung score, which was higher than the direct challenge group (PBS group), indicating that the lung inflammation of mice vaccinated with the formalin-inactivated vaccine was more severe than that of the mice in the direct challenge group, resulting in an ERD effect. The pathology scores of the mutant mRNA vaccine groups and the mRNA1345 vaccine groups were almost the same, significantly lower than the formalin-inactivated vaccine group and the direct challenge group, indicating that the mutant mRNA vaccines and the mRNA1345 vaccine both produced good protective effects on mice and did not produce an ERD effect. Compared with the direct challenge group (PBS group), the M111 mutant mRNA vaccine can reduce the viral load in the lungs of mice by at least 1,000 times; and the pathological scores of the M111 mutant mRNA vaccine group and the mRNA1345 vaccine group are almost the same, indicating that both the M111 mutant mRNA vaccine and the mRNA1345 vaccine have a good protective effect on mice and do not produce ERD effect.

[0432] Example 11. Immunogenicity and protection studies of mRNA vaccines in cotton rat models (neutralizing antibodies, lung viral load)

[0433] Mice are not susceptible to RSV virus, and there are certain limitations in using mouse models to study the effectiveness of RSV vaccines. The currently generally recognized RSV animal model is cotton rats. To this end, this example used cotton rats to study the immunogenicity and protectiveness of each mutant mRNA vaccine, including the detection of cotton rat serum neutralizing antibodies and cotton rat lung virus load. The cotton rat immunization method and the detection method of serum neutralizing antibodies and lung virus load are the same as Examples 8 and 10. The difference is that the cotton rat immunization dose is 10 μg mRNA vaccine and the challenge dose on day 28 is changed to 1×10 5 pfu.

[0434] Figures 14 and 15 are the results of neutralizing antibodies and lung virus loads in cotton rat serum of the mRNA vaccine for the F protein mutants M43, M60, M61, M62, M63, M64, M66, M75, M103, M105, M109, M110, M112, M114, M119, M120, M128, M133, M142, M143, M146, M147, M149, M150, and M152 provided by the present invention.

[0435] Neutralizing antibody results in cotton rat serum showed that both the positive control (mRNA1345) and the mutant protein mRNA vaccines induced high levels of neutralizing antibodies in cotton rats, with some mutant protein mRNA vaccines producing higher neutralizing antibody levels than the positive control. Neutralizing antibody levels in both the mRNA1345 and mutant protein mRNA vaccine groups were significantly higher than those in the formalin-inactivated vaccine group.

[0436] The results of cotton rat lung viral load detection showed that compared with the direct challenge group (PBS group), each mutant mRNA vaccine could reduce the mouse lung viral load by at least about 1,000 times, demonstrating a good ability to eliminate the virus in the mouse lungs, which was significantly lower than the formalin inactivated vaccine group (FI-RSV), consistent with the results of the mouse model.

[0437] The M111 mutant protein mRNA vaccine induced cotton rats to produce high levels of neutralizing antibodies. The results of the viral load test in the cotton rats' lungs showed that compared with the direct challenge group (PBS group), the M111 mutant mRNA vaccine could reduce the viral load in the mice's lungs by at least about 1,000 times, which was consistent with the results of the mouse model.

[0438] The technical solution of the present invention is not limited to the above-mentioned specific embodiments. Any technical variations made according to the technical solution of the present invention fall within the protection scope of the present invention.

Claims

1. A recombinant respiratory syncytial virus (RSV) F polypeptide, characterized in that The recombinant RSV F polypeptide is stably in a prefusion conformation, and the recombinant RSV F polypeptide includes an F1 domain and an F2 domain.

2. The recombinant RSV F polypeptide according to claim 1, characterized in that The recombinant RSV F polypeptide is stabilized in a prefusion conformation by introducing a disulfide bond between one or more non-naturally occurring hydrophobic amino acids, at least one pair of non-naturally occurring amino acids with opposing electrostatic charge, at least one pair of non-naturally occurring prolines, and / or at least one pair of non-naturally occurring cysteines, Preferably, the recombinant RSV F polypeptide is at least 26, 29, 30, 31, 32, 33, 34, 35, 55, 57, 59, 61, 62, 65, 67, 74, 75, 79, 80, 83, 86, 87, 90, 137, 138, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 155, 158, 159, 172 、173、174、178、180、181、182、183、186、187、188、189、190、193、195、196、207、210、211、213、214、217、227、229、241、253、254、256、279、286、290、291、298、302、332、334、337、 338, 339, 340, 353, 354, 355, 356, 368, 370, 371, 373, 394, 396, 397, 398, 399, 400, 404, 406, 407, 427, 443, 445, 449, 458, 459, 460, 461, 462, 463, 465, 466, 467, 468, 469, 470, 481 The invention relates to a polypeptide having an amino acid mutation at one or more of amino acid positions 71, 473, 474, 475, 480, 482, 483, 484, 485, 486, 487, 488, 489, 491, 494, 499, 502, 505, 506, 508, 509, 512, 513, 515, 516, 520, 522 and 523, wherein the mutation is numbered based on the amino acid sequence set forth in SEQ ID NO:

22.

3. The recombinant RSV F polypeptide according to claim 1, characterized in that The recombinant RSV F polypeptide comprises any one or more of the following mutations: (1) K80A, K80I, K80L, K80V, K80F, K80W, K80Y, K80M, K80S, K80P or K80C; (2) N183P or N183D; (3) Q210P; (4) S211P; (5) S213P; (6) I214P; and, (7) I506D or I506E.

4. The recombinant RSV F polypeptide according to claim 1, characterized in that The recombinant RSV F polypeptide comprises any one or more of the following mutations: (1) P484C and I499C; (2) V482C and I499C; (3) V482C and S502C; (4) M396C and F488C; (5) S398C and S485C; (6) S398C and D486C; (7) I148C and Y286C; (8) H159C and S290C; (9) H159C and I291C; (10) L158C and S290C; (11) Q494C and K399C; (12) D489C and S398C; (13) D489C and D4 86C; (14) D489C and S485C; (15) N460C and S146C; (16) A149C and Y458C; (17) I64C and K87C; (18) K65C and K87C; (19) L61C and Y86C; (20) S62C and Y86C; (21) L61C and V90C; (22) N67C and L83C; (23) N67C and K80C; (24) S62C and K196C; (25) N67C and V207C; (26) L61C and L195C; and, (27) V144C and M370C.

5. The recombinant RSV F polypeptide according to claim 1, characterized in that The recombinant RSV F polypeptide includes the following mutations: (1) N67A; and, (2) K80A, K80I, K80L, K80V, K80F, K80W, K80Y, K80M, K80S, K80P, K87A, K87I, K87L, K87V, K87F, K87W, K87Y, K87M, K87S or K87P.

6. The recombinant RSV F polypeptide of claim 1, wherein The recombinant RSV F polypeptide includes the following mutations: (1) F505H or F505K; and, (2) I506D or I506E.

7. The recombinant RSV F polypeptide of claim 1, wherein The recombinant RSV F polypeptide includes any one or more of the following mutations: (1) S213P and I214P; (2) Q210P and S211P; (3) S173P and T174P; (4) S182P and N183P; (5) L181P and S182P; and, (6) S173P and T174P.

8. The recombinant RSV F polypeptide of claim 1, wherein The recombinant RSV F polypeptide includes the following mutations: (1) N67A; (2) K80A; and, (3) K87A, K87I, K87L, K87V, K87F, K87W, K87Y, K87M, K87S or K87P.

9. The recombinant RSV F polypeptide of claim 1, wherein The recombinant RSV F polypeptide includes K65C and K87C mutations, and also includes mutations 26, 29, 30, 31, 32, 33, 34, 35, 55, 57, 62, 67, 74, 75, 79, 80, 87, 137, 138, 140, 141, 142, 143, 144, 145, 146, 147, 149, 150, 151, 155, 159, 183, 188, 189, 190, 195, 207, 211, 217, 227, 229, 241, 253, 254, 256, 279, 290, 291, 298, 302, 332, 334, 337, 338, 339, 340, 353, 354, 355, 356, 368, 370, 371, 373, 394, 396, 397, 398, 400, 404, 406, 407, 427, 443 , 445,449,458,459,460,461,462,463,465,466,467,468,469,470,471,473,474,475,480,482,483,485,486,487,488,489,491,502,505,506,508,509,512,513,515,516,520,522,523 has an amino acid mutation at one or more of the following positions: Preferably, the recombinant RSV F polypeptide comprises K65C and K87C mutations, and further comprises any one or more of the following mutations: (1) S62L or S62P, (2) A74F, A74W, A74Y, A74K or A74R, (3) L141R or L141K, (4) G145I, (5) S150L, (6)G151L, (7)S155I, (8)S211P, (9)N254Y, (10) S290P, (11) I291E or I291D, (12) A298K, A298Y, A298I or A298L, (13) T337W, (14) G340F or G340Y, (15)Y458P, (16) V459P, (17) N460P, (18) K461P, (19)Q462P, (20)E463P, (21) V482P, (22)F483P, (23)D489F, (24) S502F, S502W or S502Y, (25) F505H or F505K; and, I506D or I506E, (26) L141C, L141R or L141K; and N371C or L373C, (27) V144C, G145C or S146C; and, M370C, (28) L138C; and, Q354C or D338C, (29) L334C; and, I475C, (30) F137C; and, T337C, D338C, R339C or P353C, (31) I57C; and, S190C, (32) S55C; and, L188C, (33) H159C; and, I291C, I291E or I291D, (34) Q34C; and, K470C or G471C, (35) S35C; and, P473C or I474C, (36) I332C; and, P480C or F483C, (37) M396C; and, F488C, (38) K394C, K394W, K394F, K394Y or K394L; and, S491C, (39) T397C; and S485C, D486C or E487C, (40) F32C; and, Y468C, (41) E30C or S443C; and, S466C, (42) Y33C; and, V469C, (43) E31C; and, L467C, (44) T29C; and, K465C, (45) Q26C or K445C; and, E463C or E463P, (46) T449C; and, Y458C or Y458P, (47) Q354C or Q354L; and N371F, N371W, N371Y, N371L or N371C, (48) G151L; and, Q302L or Q302V, (49) K75C; and, I217C, (50) G143C; and V406C, N371F, N371W, N371Y, N371L or N371C, (51) G145I or G145C; and, I407C or M370C, (52) F140C; and S404C, (53) A241C; and, Q279C, (54) T189V; and A298K, A298Y, A298I, A298L or A298F, (55) L195C or L195K; and N227E, (56) S398C or S398F; and, D489C, D489F or D489L, (57) L142C; and, P353C, N371F, N371W, N371Y, N371L or N371C, (58) K508C; and S509C, (59) L512C; and, L513C, (60) A149C; and, Y458C, (61) V144C; and, N371C, (62) K394C, K394W, K394F, K394Y or K394L; D489C, D489F or D489L; and T337W, T337L or T337C, (63) S150L, ​​S150F, S150W or S150Y; G151L; and Q302L or Q302V, (64) S155I or S155V; S290C, S290P, S290V or S290A; and A298K, A298Y, A298I, A298L or A298F, (65) N67A, N67C, N67L or N67V; I79L; and V207C or V207I, (66) A74F, A74W, A74Y, A74K or A74R; K508C; and S509C, (67) V144C; M370C; and A74F, A74W, A74Y, A74K, A74R, K80A, K80I, K80L, K80V, K80F, K80W, K80Y, K80M, K80S, K80P, K80C, I291C, I291E, I291D, S211P, A298K, A298Y, A298I, A298L, or A298F, (68) S190C, S190F or S190L; R229Y or R229W; T253L; and, E256F, (69) V144C; M370C; F505H or F505K; and I506D or I506E, (70) V144C; M370C; A74F, A74W, A74Y, A74K or A74R; and S404C, S404V, S404I, S404L or S404C, (71) V144C; M370C; A74F, A74W, A74Y, A74K or A74R; and S150L, ​​S150F, S150W or S150Y, (72) V144C; M370C; N67A, N67C, N67L or N67V; and A74F, A74W, A74Y, A74K or A74R, (73) V144C; M370C; T189V; and A298K, A298Y, A298I, A298L or A298F, (74) V144C; M370C; K508C; and S509C, (75) V144C; M370C; L512C; and, L513C, (76) V144C; M370C; A74F, A74W, A74Y, A74K or A74R; and N183P, N183D, N515C, N515D or K520R, (77) V144C; M370C; N67A, N67C, N67L or N67V; I79L; and, V207C or V207I; (78) A147V; Q354C or Q354L; A355L; D368L; and N371F, N371W, N371Y, N371L or N371C, (79) V144C; M370C; A74F, A74W, A74Y, A74K or A74R; K508C; and S509C, (80) V144C; M370C; A74F, A74W, A74Y, A74K or A74R; L512C; and, L513C, (81) V144C; M370C; A74F, A74W, A74Y, A74K or A74R; T522C; and, T523C, (82) V144C; M370C; A74F, A74W, A74Y, A74K or A74R; N515C or N515D; and V516C or K520R, (83) V144C; M370C; A74F, A74W, A74Y, A74K or A74R; N183P or N183D; and K427R, (84) V144C; M370C; A74F, A74W, A74Y, A74K or A74R; G143C; and V406C, (85) V144C; M370C; A74F, A74W, A74Y, A74K or A74R; G145I or G145C; and I407C, (86) V144C; M370C; A74F, A74W, A74Y, A74K or A74R; F140C; and S404C, S404V, S404I, S404L or S404C, (87) V144C; M370C; N67A, N67C, N67L or N67V; A74F, A74W, A74Y, A74K or A74R; and K80A, K80I, K80L, K80V, K80F, K80W, K80Y, K80M, K80S, K80P or K80C, (88) A355L; E356W; D368L; N371F, N371W, N371Y, N371L or N371C; K394C, K394W, K394F, K394Y or K394L; T400V; D489C, D489F or D489L.

10. The recombinant RSV F polypeptide of claim 1, wherein The recombinant RSV F polypeptide includes V144C and M370C mutations, and further includes one or more mutations in positions 65, 67, 74, 79, 80, 87, 140, 143, 145, 150, 183, 189, 207, 211, 291, 298, 404, 406, 407, 427, 505, 506, 508, 509, 512, 513, 515, 516, 520, 522, 523, Preferably, the recombinant RSV F polypeptide comprises V144C and M370C mutations, and further comprises any one or more of the following mutations: (1) N67A, N67C, N67L or N67V; and K87A, K87I, K87L, K87V, K87F, K87W, K87Y, K87M, K87S, K87P or K87C, (2) K65C; and, K87A, K87I, K87L, K87V, K87F, K87W, K87Y, K87M, K87S, K87P or K87C, (3) N67A, N67C, N67L, or N67V; A74F, A74W, A74Y, A74K, or A74R; and K87A, K87I, K87L, K87V, K87F, K87W, K87Y, K87M, K87S, K87P, or K87C, (4) K65C; K87A, K87I, K87L, K87V, K87F, K87W, K87Y, K87M, K87S, K87P or K87C; and I291C, I291E or I291D, (5) K65C; K87A, K87I, K87L, K87V, K87F, K87W, K87Y, K87M, K87S, K87P or K87C; and A74F, A74W, A74Y, A74K or A74R, (6) K65C; K87A, K87I, K87L, K87V, K87F, K87W, K87Y, K87M, K87S, K87P or K87C; and K80A, K80I, K80L, K80V, K80F, K80W, K80Y, K80M, K80S, K80P or K80C, (7) K65C; K87A, K87I, K87L, K87V, K87F, K87W, K87Y, K87M, K87S, K87P or K87C; and, S211P, (8) K65C; K87A, K87I, K87L, K87V, K87F, K87W, K87Y, K87M, K87S, K87P or K87C; and A298K, A298Y, A298I, A298L or A298F, (9) N67A, N67C, N67L, or N67V; A74F, A74W, A74Y, A74K, or A74R; K80A, K80I, K80L, K80V, K80F, K80W, K80Y, K80M, K80S, K80P, or K80C; and K87A, K87I, K87L, K87V, K87F, K87W, K87Y, K87M, K87S, K87P, or K87C, (10) K65C; K87A, K87I, K87L, K87V, K87F, K87W, K87Y, K87M, K87S, K87P or K87C; F505H or F505K; and, I506D or I506E, (11) K65C; K87A, K87I, K87L, K87V, K87F, K87W, K87Y, K87M, K87S, K87P or K87C; A74F, A74W, A74Y, A74K or A74R; and S404C, S404V, S404I, S404L or S404C, (12) K65C; K87A, K87I, K87L, K87V, K87F, K87W, K87Y, K87M, K87S, K87P or K87C; A74F, A74W, A74Y, A74K or A74R; and S150L, ​​S150F, S150W or S150Y, (13) K65C; N67A, N67C, N67L or N67V; K87A, K87I, K87L, K87V, K87F, K87W, K87Y, K87M, K87S, K87P or K87C; and A74F, A74W, A74Y, A74K or A74R, (14) K65C; K87A, K87I, K87L, K87V, K87F, K87W, K87Y, K87M, K87S, K87P or K87C; A74F, A74W, A74Y, A74K or A74R; and, N183P or N183D, (15) K65C; K87A, K87I, K87L, K87V, K87F, K87W, K87Y, K87M, K87S, K87P or K87C; A74F, A74W, A74Y, A74K or A74R; and, K520R, (16) K65C; K87A, K87I, K87L, K87V, K87F, K87W, K87Y, K87M, K87S, K87P or K87C; T189V; and A298K, A298Y, A298I, A298L or A298F, (17) K65C; K87A, K87I, K87L, K87V, K87F, K87W, K87Y, K87M, K87S, K87P or K87C; K508C; and, S509C, (18) K65C; K87A, K87I, K87L, K87V, K87F, K87W, K87Y, K87M, K87S, K87P or K87C; L512C; and, L513C, (19) K65C; K87A, K87I, K87L, K87V, K87F, K87W, K87Y, K87M, K87S, K87P or K87C; A74F, A74W, A74Y, A74K or A74R; and N515C or N515D, (20) K65C; N67A, N67C, N67L or N67V; I79L; K87A, K87I, K87L, K87V, K87F, K87W, K87Y, K87M, K87S, K87P or K87C; and, V207C or V207I, (21) K65C; N67A, N67C, N67L or N67V; A74F, A74W, A74Y, A74K or A74R; K80A, K80I, K80L, K80V, K80F, K80W, K80Y, K80M, K80S, K80P or K80C; and K87A, K87I, K87L, K87V, K87F, K87W, K87Y, K87M, K87S, K87P or K87C, (22) K65C; A74F, A74W, A74Y, A74K or A74R; K87A, K87I, K87L, K87V, K87F, K87W, K87Y, K87M, K87S, K87P or K87C; K508C; and, S509C, (23) K65C; A74F, A74W, A74Y, A74K or A74R; K87A, K87I, K87L, K87V, K87F, K87W, K87Y, K87M, K87S, K87P or K87C; L512C; and, L513C, (24) K65C; A74F, A74W, A74Y, A74K or A74R; K87A, K87I, K87L, K87V, K87F, K87W, K87Y, K87M, K87S, K87P or K87C; T522C; and, T523C, (25) K65C; A74F, A74W, A74Y, A74K or A74R; K87A, K87I, K87L, K87V, K87F, K87W, K87Y, K87M, K87S, K87P or K87C; N515C or N515D; and, V516C, (26) K65C; A74F, A74W, A74Y, A74K or A74R; K87A, K87I, K87L, K87V, K87F, K87W, K87Y, K87M, K87S, K87P or K87C; N515C or N515D; and, K520R, (27) K65C; A74F, A74W, A74Y, A74K or A74R; K87A, K87I, K87L, K87V, K87F, K87W, K87Y, K87M, K87S, K87P or K87C; N183P or N183D; and, K427R, (28) K65C; A74F, A74W, A74Y, A74K or A74R; K87A, K87I, K87L, K87V, K87F, K87W, K87Y, K87M, K87S, K87P or K87C; G143C; and, V406C, (29) K65C; A74F, A74W, A74Y, A74K or A74R; K87A, K87I, K87L, K87V, K87F, K87W, K87Y, K87M, K87S, K87P or K87C; G145I or G145C; and, I407C, (30) K65C; A74F, A74W, A74Y, A74K or A74R; K87A, K87I, K87L, K87V, K87F, K87W, K87Y, K87M, K87S, K87P or K87C; F140C; and, S404C, S404V, S404I, S404L or S404C.

11. The recombinant RSV F polypeptide of claim 1, wherein Compared to the wild-type RSV F protein, the recombinant RSV F polypeptide comprises one or more of the following mutations: (1) K65C and K87C; (2) K65C, K87C, F505H and I506D; (3) K65C, K87C, F505K and I506E; (4) K65C, K87C, S211P; (5) K65C, K87C and A74F; (6) K65C, K87C and A74W; (7) K65C, K87C and A74Y; (8) K65C, K87C and N254Y; (9) K65C, K87C and A298Y; (10) K65C, K87C and D489F; (11) K65C, K87C and S502F; (12) K65C, K87C and S502Y; (13) S62L, K65C and K87C; (14) S62P, K65C and K87C; (15) K65C, K87C and A298I; (16) K65C, K87C and A298L; (17) K65C, K87C, L141C and N371C; (18) K65C, K87C, V144C and M370C; (19) K65C, K87C, S55C and L188C; (20) K65C, K87C, H159C and I291C; (21) K65C, K87C, I332C and F483C; (22) K65C, K87C, I332C and P480C; (23) K65C, K87C, M396C and F488C; (24) K65C, K87C, T397C and D486C; (25) K65C, K87C, T397C and S485C; (26) K65C, K87C, Q26C and E463C; (27) K65C, K87C, K445C and E463C; (28) K65C, K87C, S443C and S466C; (29) K65C, K87C, K394W, D489F and T337L; (30) K65C, K87C, K394W, D489L and T337L; (31) K65C, K87C and L141R; (32) K65C, K87C and L141K; (33) K65C, K87C, Q354L and N371F; (34) K65C, K87C, Q354L and N371W; (35) K65C, K87C, Q354L and N371Y; (36) K65C, K87C and I291D; (37) K65C, K87C, S155V, S290A and A298L; (38) K65C, K87C, and Y458P; (39) K65C, K87C and V459P; (40) K65C, K87C and N460P; (41) K65C, K87C and K461P; (42) K65C, K87C and E463P; (43) K65C, K87C, K75C and I217C; (44) K65C, K87C and A74K; (45) K65C, K87C and A74R; (46) K65C, K87C, T189V and A298F; (47) K65C, K87C, S398F, and D489L; (48) K65C, K87C, N67L, I79L, and V207I; (49) K65C, K87C, L142C and N371C; (50) K65C, K87C, V144C and N371C; (51) K65C, K87C, G145C and M370C; (52) K65C, K87C, K508C and S509C; (53) K65C, K87C, L512C and L513C; (54) K65C, K87C, V144C, M370C and A74F; (55) K65C, K87C, V144C, M370C and A74W; (56) K65C, K87C, V144C, M370C and A74Y; (57) K65C, K87C, V144C, M370C, F505K and I506E; (58) K65C, K87C, V144C, M370C and S211P; (59) K65C, K87C, V144C, M370C and A298Y; (60) K65C, K87C, V144C, M370C, T189V and A298Y; (61) K65C, K87C, V144C, M370C, N67L, I79L and V207I; (62) N67A, K87V, V144C and M370C; (63) K65C, K87C, V144C, M370C and K80W; (64) K65C, K87C, V144C, M370C, K508C and S509C; (65) K65C, K87C, V144C, M370C, L512C and L513C; (66) K65C, K87C, V144C, M370C, A74Y, K508C and S509C; (67) K65C, K87C, V144C, M370C, A74Y, L512C and L513C; (68) K65C, K87C, V144C, M370C, A74Y, T522C and T523C; (69) K65C, K87C, V144C, M370C, A74Y, N515C and V516C; (70) K65C, K87C, V144C, M370C, A74Y and N515D; (71) K65C, K87C, V144C, M370C, A74Y and K520R; (72) K65C, K87C, V144C, M370C, A74Y, N515D and K520R; (73) K65C, K87C, V144C, M370C, A74Y and N183D; (74) K65C, K87C, V144C, M370C, A74Y, N183D and K427R; (75) K65C, K87C, V144C, M370C, A74Y and S404V; (76) K65C, K87C, V144C, M370C, A74Y and S404I; (77) K65C, K87C, V144C, M370C, A74Y and S404L; (78) K65C, K87C, V144C, M370C, A74Y, G143C and V406C; (79) K65C, K87C, V144C, M370C, A74Y, F140C and S404C; (80) K65C, K87C, V144C, M370C, A74Y and S150L; (81) K65C, K87C, V144C, M370C, A74Y and S150F; (82) K65C, K87C, V144C, M370C, A74Y and S150W; (83) K65C, K87C, V144C, M370C, A74Y and S150Y; (84) K65C, K87C, V144C, M370C and A74Y; (85) K65C, K87C, A74Y, K508C and S509C; (86) K65C, K87C, V144C, M370C, N67A and A74Y; (87) K65C, K87C, V144C, M370C, N67V and A74Y; (88) K65C, K87C, V144C, M370C, N67V, A74Y and K80V; (89) K65C, K87C, V144C, M370C, N67V, A74Y and K80F; (90) K65C, K87C, V144C, M370C, N67V, A74Y and K80W; (91) K65C, K87C, V144C, M370C, N67V, A74Y and K80L; and (92) K65C, K87C, V144C, M370C, N67V, A74Y and K80Y.

12. The recombinant RSV F polypeptide of claim 1, wherein Compared to the wild-type RSV F protein, the recombinant RSV F polypeptide comprises one or more of the following mutations: (1) V144C and M370C; (2) K65C, K87C, V144C, M370C and A74F; (3) K65C, K87C, V144C, M370C and A74W; (4) K65C, K87C, V144C, M370C and A74Y; (5) K65C, K87C, V144C, M370C, F505K and I506E; (6) K65C, K87C, V144C, M370C and S211P; (7) K65C, K87C, V144C, M370C and A298Y; (8) K65C, K87C, V144C, M370C, T189V and A298Y; (9) K65C, K87C, V144C, M370C, N67L, I79L and V207I; (10) N67A, K87V, V144C and M370C; (11) K65C, K87C, V144C, M370C and K80W; (12) K65C, K87C, V144C, M370C, K508C and S509C; (13) K65C, K87C, V144C, M370C, L512C and L513C; (14) K65C, K87C, V144C, M370C, A74Y, K508C and S509C; (15) K65C, K87C, V144C, M370C, A74Y, L512C and L513C; (16) K65C, K87C, V144C, M370C, A74Y, T522C and T523C; (17) K65C, K87C, V144C, M370C, A74Y, N515C and V516C; (18) K65C, K87C, V144C, M370C, A74Y and N515D; (19) K65C, K87C, V144C, M370C, A74Y and K520R; (20) K65C, K87C, V144C, M370C, A74Y, N515D and K520R; (21) K65C, K87C, V144C, M370C, A74Y and N183D; (22) K65C, K87C, V144C, M370C, A74Y, N183D and K427R; (23) K65C, K87C, V144C, M370C, A74Y and S404V; (24) K65C, K87C, V144C, M370C, A74Y and S404I; (25) K65C, K87C, V144C, M370C, A74Y and S404L; (26) K65C, K87C, V144C, M370C, A74Y, G143C, and V406C; (27) K65C, K87C, V144C, M370C, A74Y, F140C and S404C; (28) K65C, K87C, V144C, M370C, A74Y and S150L; (29) K65C, K87C, V144C, M370C, A74Y and S150F; (30) K65C, K87C, V144C, M370C, A74Y and S150W; (31) K65C, K87C, V144C, M370C, A74Y and S150Y; (32) K65C, K87C, V144C, M370C and A74Y; (33) N67A, A74Y, K87V, V144C and M370C; (34) K65C, K87C, V144C, M370C, N67A and A74Y; (35) N67V, A74Y, K87V, V144C and M370C; (36) N67V, A74Y, K80V, K87V, V144C and M370C; (37) N67V, A74Y, K80F, K87V, V144C and M370C; (38) N67V, A74Y, K80W, K87V, V144C and M370C; (39) N67V, A74Y, K80L, K87V, V144C and M370C; (40) N67V, A74Y, K80Y, K87L, V144C and M370C; (41) K65C, K87C, V144C, M370C, N67V and A74Y; (42) K65C, K87C, V144C, M370C, N67V, A74Y and K80V; (43) K65C, K87C, V144C, M370C, N67V, A74Y and K80F; (44) K65C, K87C, V144C, M370C, N67V, A74Y and K80W; (45) K65C, K87C, V144C, M370C, N67V, A74Y and K80L; and (46) K65C, K87C, V144C, M370C, N67V, A74Y and K80Y.

13. The recombinant RSV F polypeptide of claim 1, wherein The recombinant RSV F polypeptide also includes a trimerization domain, Preferably, the trimerization structure is located at the C-terminus of the recombinant RSV F polypeptide. More preferably, the trimerization domain is derived from the minor fiber protein fold of bacteriophage T4, and more preferably has the amino acid sequence shown in SEQ ID NO: 7, or an amino acid sequence having at least 85% sequence identity thereto.

14. The recombinant RSV F polypeptide of claim 1, wherein The wild-type RSV F protein is derived from the F protein of human RSV subtype A, human RSV subtype B or bovine RSV.

15. A nucleic acid molecule encoding the recombinant RSV F polypeptide of any one of claims 1 to 14.

16. The nucleic acid molecule according to claim 15, characterized in that The nucleic acid molecule is a DNA molecule or an RNA molecule.

17. The nucleic acid molecule according to claim 16, characterized in that The nucleic acid molecule is an RNA molecule, preferably an mRNA molecule.

18. The nucleic acid molecule according to claim 17, characterized in that The nucleic acid molecule comprises at least one chemical modification, more preferably comprises a chemical modification selected from the group consisting of pseudouridine, N1-methylpseudouridine, N1-ethylpseudouridine, 2-thiouridine, 4′-thiouridine, 5-methylcytosine, 2-thio-1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-pseudouridine, 2-thio-5-aza-uridine, 2-thio-dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-pseudouridine, 4-methoxy-2-thio-pseudouridine, 4-methoxy-pseudouridine, 4-thio-1-methyl-pseudouridine, 4-thio-pseudouridine, 5-aza-uridine, dihydropseudouridine, 5-methoxyuridine and 2′-O-methyluridine.

19. The nucleic acid molecule according to claim 17, characterized in that The nucleic acid molecule comprises at least one 5' terminal cap or cap analog.

20. A vector comprising the nucleic acid molecule according to any one of claims 15 to 19, preferably, the vector is a viral vector, More preferably, the vector is selected from a paramyxovirus vector, a human parainfluenza virus vector, a metapneumovirus vector, a Newcastle disease virus vector, a Sendai virus vector, a measles virus vector, a Newcastle disease virus vector, an adenovirus vector, a polyoma virus vector, a vaccinia virus vector, an adeno-associated virus vector or a herpes virus vector.

21. A host cell comprising the vector according to claim 20.

22. An immunogenic composition comprising the recombinant RSV F polypeptide of any one of claims 1 to 14, the nucleic acid molecule of any one of claims 15 to 19, the vector of claim 20, or the host cell of claim 21; and, a pharmaceutically acceptable carrier.

23. The immunogenic composition according to claim 22, characterized in that The immunogenic composition further comprises an adjuvant, preferably the adjuvant comprises alum, mineral salts, oil-in-water compositions, AS01B, AS01E, MF59, AS01, AS03, AS04, MPL, QS21, CpG oligonucleotides, TLR7 agonists, TLR4 agonists, TLR3 agonists or a combination of two or more thereof.

24. The immunogenic composition according to claim 22, characterized in that The carrier is a lipid nanoparticle, preferably selected from cationic lipids, PEG-modified lipids, sterols and phospholipids.

25. The immunogenic composition according to claim 22, characterized in that The immunogenic composition is administered nasally, pulmonary, intratracheally, intramuscularly, subcutaneously, intravenously, intravitreally, intraperitoneally, or parenterally.

26. Use of the immunogenic composition of any one of claims 22 to 25 in the preparation of a medicament for treating or preventing RSV infection in a subject.

27. The use according to claim 26, characterized in that The RSV infection includes infection with human RSV subtype A, human RSV subtype B, or bovine RSV; and / or the subject includes a human mammal or a non-human mammal.

28. The use according to claim 26, characterized in that The immunogenic composition is administered nasally, pulmonary, intratracheally, intramuscularly, subcutaneously, intravenously, intravitreally, intraperitoneally, or parenterally.

Images