Chicken infectious anemia virus subunit vaccine

Abstract

The invention discloses a chicken infectious anemia virus subunit vaccine, and belongs to the technical field of animal disease vaccines. The invention provides a chicken infectious anemia virus subunit vaccine. Active ingredients of the chicken infectious anemia virus subunit vaccine are recombinant fusion protein of chicken infectious anemia virus VP1 protein B cell epitope and salmonella typhimurium flagellin. The B cell epitope of the chicken infectious anemia virus VP1 protein is obtained by connecting B cell antigen epitopes contained in the chicken infectious anemia virus VP1 protein through a connecting peptide. The salmonella typhimurium flagellin is obtained by deleting a hypervariable region of the salmonella typhimurium flagellin FliC. The fusion expression protein provided by the invention can induce generation of a specific IgG antibody after one-day-old SPF chicken, and after immunization for 28 days, immunized chicken flocks can resist challenge of chicken infectious anemia virus virulent strains, and 70% of challenge chicken flocks are protected without disease attack. The invention has great potential for clinical prevention and control of chicken infectious anemia virus infection.

Description

Technical Field

[0001] The invention relates to the technical field of animal disease vaccines, in particular to a chicken infectious anemia virus subunit vaccine, in particular to an application of a recombinant Salmonella typhimurium flagellar protein fused to express chicken infectious anemia virus VP1 B cell epitope. Background Art

[0002] Chicken infectious anemia is caused by Chicken Infectious Anemia Virus (CIAV), an infectious disease characterized by aplastic anemia, systemic lymphoid tissue atrophy, and subcutaneous and muscular hemorrhage in chicks. Chickens are the only natural host of CIAV, and chickens of all ages are susceptible. As the age of chickens increases, the susceptibility, morbidity, and mortality of chickens gradually decrease.

[0003] The genome of CIAV consists of two parts: the coding region and the non-coding region, with a total of three open reading frames, encoding three proteins: VP1, VP2 and VP3. Among them, VP1 is encoded by ORF3, which is about 51KDa. It is the only structural protein of CIAV and the most immunogenic protein among the three proteins of CIAV. However, studies have shown that the full gene of CIAV VP1 cannot be efficiently expressed in the Escherichia coli engineered bacteria host. Therefore, it is necessary to further optimize the CIAV VP1 gene sequence to improve its expression level and enhance its protective efficacy through other means.

[0004] CN116731204A discloses a genetically engineered subunit vaccine of chicken infectious anemia virus and its preparation and application, which solves the problem that the whole gene of chicken infectious anemia virus VP1 cannot be expressed in the Escherichia coli expression system and the VP1 protein vaccination has poor immune effect by fusion expression tag. However, the technology still has the problem that the expression level of VP1 full-length protein is relatively low and cannot be industrialized. In addition, the immunogenicity of the VP1 full-length protein expressed by this technology is relatively low, and a higher immune dose is required to achieve the protection level. Summary of the invention

[0005] [Technical issues]

[0006] The technical problem to be solved by the present invention is to improve the expression level and immunogenicity of key antigenic epitopes of protective protein VP1 of chicken infectious anemia virus.

[0007] [Technical solution]

[0008] The invention provides a chicken infectious anemia virus subunit vaccine, the active component of which is a recombinant fusion protein of a chicken infectious anemia virus VP1 protein B cell epitope and a salmonella typhimurium flagella protein.

[0009] The B cell epitope of the VP1 protein of chicken infectious anemia virus is obtained by connecting the B cell antigen epitope contained in the VP1 protein of chicken infectious anemia virus via a connecting peptide (GPGPG). Preferably, the amino acid sequence of the B cell epitope of the VP1 protein of chicken infectious anemia virus is as shown in SEQ ID NO.1.

[0010] The truncated flagellin of Salmonella typhimurium is obtained by removing the amino acids 144-408 in the full-length FliC protein of Salmonella typhimurium and connecting the N-terminus and the C-terminus of FliC with a connecting peptide. Preferably, the connecting peptide is GPGPG. More preferably, the amino acid sequence of the truncated flagellin of Salmonella typhimurium is shown in SEQ ID NO.2.

[0011] The recombinant fusion protein is a connecting peptide (GPVD) connecting the B cell epitope of the VP1 protein of chicken infectious anemia virus and the flagellar protein of Salmonella typhimurium. Preferably, the amino acid sequence of the recombinant fusion protein is shown in SEQ ID NO.3.

[0012] The chicken infectious anemia virus subunit vaccine also contains a pharmaceutically acceptable carrier, such as any one of white oil, sapogenin, and Tween, or a combination of two or more thereof.

[0013] The present invention also provides a gene fragment encoding the recombinant fusion protein, named CIAV VP1-ST FliC, which is codon-optimized and has a nucleotide sequence as shown in SEQ ID NO.4.

[0014] The present invention also provides an expression cassette, a recombinant expression vector or a recombinant strain of the recombinant fusion protein. The recombinant expression vector is obtained by inserting a gene fragment encoding the recombinant fusion protein into a pET28a plasmid vector, and the recombinant expression vector is named pET28a-CIAV VP1-ST FliC. The recombinant strain is obtained by introducing the recombinant expression vector pET28a-CIAV VP1-ST FliC into the Escherichia coli expression strain BL21.

[0015] The present invention also provides a method for constructing the recombinant strain, comprising the following steps:

[0016] (1) Designing a pair of specific primers with repeated sequences on both sides of the pET28a plasmid vector for the gene fragment CIAV VP1-ST FliC encoding the recombinant fusion protein, using the CIAV VP1-ST FliC fusion gene fragment as a template, performing PCR amplification reaction, and seamlessly cloning the obtained amplified product with the linearized pET28a plasmid vector to construct a recombinant expression vector named pET28a-CIAV VP1-ST FliC;

[0017] (2) The recombinant expression vector obtained in step (1) was introduced into competent cells of the Escherichia coli expression strain BL21 by electroporation to obtain a recombinant strain named BL21 (pET28a-CIAV VP1-ST FliC).

[0018] Wherein, preferably, the specific primer consists of an upstream primer and a downstream primer, and the nucleotide sequence thereof is:

[0019] Upstream primer: 5'GAGTGCGGCCGCAAGATGGCTCAAGTAATAAAC,

[0020] Downstream primer: 5'GAATTCGAGCTCCGTCTTACCAGTACATGGTGCTATTAG.

[0021] The present invention also discloses the use of the chicken infectious anemia virus VP1 protein B cell epitope, the Salmonella typhimurium flagellar protein, the recombinant fusion protein, the gene fragment encoding the recombinant fusion protein, the expression cassette, the recombinant expression vector, and the recombinant strain in preparing a chicken infectious anemia virus vaccine.

[0022] [Beneficial Effects]

[0023] Compared with the prior art, the present invention has the following advantages: the recombinant fusion protein of the B cell epitope of the VP1 protein of chicken infectious anemia virus and the flagellar protein of Salmonella typhimurium prepared by the present invention can induce the production of specific IgG antibodies after immunizing one-day-old SPF chickens, and 28 days after immunization, the immunized chickens can resist the attack of the strong strain of chicken infectious anemia virus, and 70% of the attacked chickens do not develop the disease and are protected.

[0024] Bacterial flagellin can activate the host innate immune system through signaling pathways such as TLR5 and NLRC4, induce the secretion of pro-inflammatory factors, and thus exert an immune adjuvant effect. Fusion expression with exogenous antigens can induce the body to produce a higher level of specific humoral and cellular immune responses. By truncating the recombinant Escherichia coli flagellin and deleting its middle hypervariable region, not only can the TLR5 receptor activity of the full-length flagellin be retained, but also its inherent antigenicity can be avoided. Fusion expression of the B cell epitope of the VP1 protein of chicken infectious anemia virus and the flagellin of Salmonella typhimurium can obtain better immune effects. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 The results are the prediction of B cell epitopes of VP1 protein of chicken infectious anemia virus.

[0026] Figure 2The figure is the result of agarose gel electrophoresis in Example 1 of the present invention; Lane M: DL 5000 DNA Marker; Lanes 1, 2 and 3: CIAV VP1-ST FliC fusion gene fragment product.

[0027] Figure 3 It is a diagram of the SDS-PAGE identification result in Example 2 of the present invention; Lane M: Protein Marker; Lane 1: BL21 (pET28a) empty vector control strain identification result; Lane 2: BL21 (pET28a-CIAV VP1-ST FliC) recombinant strain identification result.

[0028] Figure 4 It is a diagram of the Western Blot identification result in Example 2 of the present invention; Lane M: Protein Marker; Lane 1: BL21 (pET28a) empty vector control strain expression identification result; Lane 2: BL21 (pET28a-CIAV VP1-STFliC) recombinant strain identification result.

[0029] Figure 5 This is the CIAV-specific ELISA antibody test result in Example 3 of the present invention. S / N value>0.6 is judged as negative, and S / N≤0.6 is judged as positive. DETAILED DESCRIPTION

[0030] The following will be combined with the accompanying drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. The following embodiments are only used to more clearly illustrate the technical solutions of the present invention, and are therefore only used as examples, and cannot be used to limit the scope of protection of the present invention.

[0031] The experimental methods in the following examples are conventional methods unless otherwise specified. The experimental materials used in the following examples are purchased from conventional biochemical reagent stores unless otherwise specified.

[0032] The chicken infectious anemia virus strain CIAV-YB01 used in the embodiments of the present invention is provided by Yangzhou Youbang Biological Pharmaceutical Co., Ltd.

[0033] Example 1 Acquisition of the nucleotide sequence of the fusion gene fragment of the chicken infectious anemia virus VP1 B cell epitope and the truncated flagellin protein of Salmonella typhimurium

[0034] The B cell antigen epitope prediction tool (BepipredLinear EpitopePrediction 2.0, http: / / tools.iedb.org / bcell / ) was used to predict the B cell antigen epitopes contained in the VP1 protein of chicken infectious anemia virus (GenBank accession number: AAM73652.1). The database scores each amino acid residue. When the residue score is greater than 0.5, it is considered to have antigenicity, and when the scores of multiple consecutive amino acid residues are greater than 0.5, they are predicted to be B cell antigen epitopes. Prediction results Figure 1 The B cell epitopes were connected with a connecting peptide (GPGPG) to obtain the chicken infectious anemia virus VP1 protein B cell epitope with an amino acid sequence as shown in SEQ ID NO.1.

[0035] The functional domain of the flagellin FliC of Salmonella typhimurium (GenBank accession number: CP029568.1) was predicted using the antigen functional domain prediction tool (InterPro, http: / / www.ebi.ac.uk / interpro / ). Among them, the amino acids at positions 144-408 are predicted to play the function of flagellar antigenicity. In order to prevent the problem that the body produces specific antibodies against the flagellin itself due to the presence of the amino acids at positions 144-408, thereby affecting the body's secondary immune response, the amino acids at positions 144-408 were removed from the functional domain of the flagellin FliC before fusion expression of the protein. The amino acid sequence of the truncated flagellin FliC of Salmonella typhimurium after removing the amino acids at positions 144-408 is shown in SEQ ID NO.2, wherein the N-terminus and C-terminus of the protein are connected by a connecting peptide (GPGPG).

[0036] The B cell epitope of the VP1 protein of chicken infectious anemia virus (SEQ ID NO.1) and the truncated flagellin sequence of Salmonella typhimurium (SEQ ID NO.2) were obtained respectively, and then connected with a connecting peptide (GPVD) to obtain a fusion protein with an amino acid sequence as shown in SEQ ID NO.3. The codon optimization tool (GenSmart TM , https: / / www.genscript.com.cn / tools / gensmart-codon-optimization) was used to optimize the codon preference of E. coli, and E. coli was selected as the expression host. Thus, the gene fragment encoding the fusion protein after codon optimization was obtained, which was named CIAV VP1-ST FliC, and the nucleotide sequence was shown in SEQ ID NO.4.

[0037] Example 2 Construction and expression identification of recombinant Escherichia coli expressing fusion of chicken infectious anemia virus VP1 B cell epitope and Salmonella typhimurium truncated flagellin

[0038] The fusion gene fragment (CIAV VP1-ST FliC) obtained in Example 1 was commissioned to Anhui General Biotechnology Co., Ltd. for gene synthesis and connected to the commercial plasmid vector pMD-19T. The above plasmid was used as a template, and conventional PCR amplification was performed using specific primers and gel recovery. The specific primer sequences are as follows:

[0039] Upstream primer: 5'GAGTGCGGCCGCAAGATGGCTCAAGTAATAAAC

[0040] Downstream primer: 5'GAATTCGAGCTCCGTCTTACCAGTACATGGTGCTATTAG

[0041] After conventional PCR amplification, the agarose gel electrophoresis results of the CIAV VP1-ST FliC fusion gene fragment were as follows: Figure 2 shown.

[0042] Using the Seamless Cloning Kit ( Ultra One Step Cloning Kit C117) was used to connect the CIAVVP1-ST FliC fusion gene fragment to the pET28a linearized plasmid. The system is as follows: 4 μL of CIAV VP1-ST FliC fusion gene fragment; 1 μL of pET28a linearized plasmid, 5 μL of 2×CloneExpress Mix. After reacting at 50°C for 5 minutes, it was immediately cooled on ice. The reaction product was added to 100 μL of BL21 Escherichia coli competent cells for chemical transformation, recovery, plating and identification, and finally a positive clone was obtained, named BL21 (pET28a-CIAV VP1-ST FliC).

[0043] Transfer the positive clone to 4 mL of LB medium containing kanamycin resistance and culture overnight in a shaker at 37°C. The next day, inoculate 4 mL of overnight cultured seed liquid into 200 mL of fresh autoclaved LB medium (kanamycin resistance) at a ratio of 1:100. Culture in a shaker at 37°C until OD600nm is about 0.6, add IPTG to a final concentration of 0.5 mM, and induce expression of CIAV VP1-ST FliC fusion protein at 37°C for 4 hours. After induction, the bacterial solution was ultrasonically broken and centrifuged to take the supernatant. The supernatant was purified by nickel column using the Lisui chromatography system (model: APPS EV 1500), and the concentration of the purified CIAV VP1-ST FliC fusion protein was 1.13 mg / mL measured by the BCA method.

[0044] The purified recombinant protein samples were subjected to SDS-PAGE electrophoresis and then Western Blot was performed, using His Tag mouse monoclonal antibody (Guangzhou Huijun Biotechnology, Catalog No.: FI01107M) as the primary antibody and goat anti-mouse IgG-HRP (Beijing Borsi, Catalog No.: BHR102) as the secondary antibody. The results of SDS-PAGE and Western Blot were shown in Figure 2. Figure 3 and Figure 4 As shown, the CIAV VP1-STFliC fusion protein is approximately 54 kDa.

[0045] Example 3 Detection of antibody levels induced by fusion expression of chicken infectious anemia virus VP1 B cell epitope and Salmonella typhimurium truncated flagellin

[0046] A subunit vaccine of fusion expression of chicken infectious anemia virus VP1 B cell epitope and truncated flagellin protein of Salmonella typhimurium was prepared with white oil adjuvant. The volume ratio of purified protein (the concentration of fusion protein after purification was 1.13 mg / mL) to white oil adjuvant was 1:2.5, and a subunit vaccine with a fusion protein concentration of 60 μg / mL was prepared. In addition, the full-length protein of chicken infectious anemia virus VP1 previously expressed in the laboratory of the applicant was prepared into a subunit vaccine of the same concentration for standby use.

[0047] Fifteen one-day-old SPF chickens were randomly divided into three groups, including 5 chickens in each of the fusion protein immunization group, VP1 full-length protein immunization group and non-immunized control group. The chickens in the fusion protein immunization group and the full-length protein immunization group were subcutaneously injected with 0.2 mL of fusion protein and full-length protein at 1 day old. On days 14, 21 and 28 after immunization, blood was collected from the wing vein of all chickens, serum was separated, and the specific IgG antibody level was detected using the CIAV ELISA antibody detection kit (IDEXX, catalog number: 99-08702).

[0048] The results of specific IgG antibody level test are as follows Figure 5 As shown, S / N value>0.6 is judged as negative, and S / N≤0.6 is judged as positive. The serum antibody test results of the non-immunized control group chickens were all negative 14, 21 and 28 days after immunization. In contrast, 40% of the chickens in the fusion protein immunization group (2 / 5) tested positive for antibodies using the IDEXX kit 21 days after immunization, and the proportion of positive chickens increased to 100% (5 / 5) 28 days after immunization. The chickens in the VP1 full-length protein immunization group only detected positive antibodies 28 days after immunization, with a proportion of 40% (2 / 5). The above results show that at the same immune dose, the ability of the fusion protein to induce specific IgG antibody levels after immunization is relatively better than that of the VP1 full-length protein.

[0049] Example 4 Evaluation of the protective efficacy of fusion expression of chicken infectious anemia virus VP1 B cell epitope and Salmonella typhimurium truncated flagellin

[0050] Thirty one-day-old SPF chickens were randomly divided into three groups, including 10 chickens in each of the fusion protein immunization group, PBS control group, and healthy control group. The immunization and challenge methods are shown in Table 1. Chickens in the immunization group were subcutaneously injected with 0.2 mL of subunit vaccine (containing 15 μg of fusion protein) at 1 day old, and the PBS control group was immunized with the same volume of sterile PBS.

[0051] 28 days after immunization, chickens in the fusion protein immunization group and the PBS control group were challenged with the CIAV-YB01 strain, with a dose of 0.2 mL per chicken, and the route of challenge was intravenous injection. After the challenge, the chickens were observed for 14 consecutive days, and the incidence and mortality were recorded. The chickens were weighed and dissected on the 14th day after the challenge, and the thymus was weighed and the thymus index was calculated. Among them, thymus index = immune organ weight (g) / live weight (kg). Taking the average thymus index of the chickens in the healthy control group as a reference, the thymus index of a single chicken in the fusion protein immunization group was not less than 80% of the average thymus index of the chickens in the healthy control group, which was judged as protection. It is also worth noting that in the PBS control group, the thymus index of 70% or more chickens is not higher than 60% of the average thymus index of the chickens in the healthy control group to be used as a suitable challenge model. The results of the thymus index of all chickens after autopsy are shown in Table 2. Among them, the average thymus index of the chickens in the healthy control group, the fusion protein immunization group and the PBS control group were 3.88, 3.20 and 2.15, respectively. Among them, the thymus index of 7 / 10 chickens in the fusion protein immunization group exceeded 80% of the average thymus index of chickens in the healthy control group; the thymus index of 7 / 10 chickens in the PBS control group was lower than 60% of the average thymus index of chickens in the healthy control group. The above results show that the CIAV VP1-ST FliC fusion protein can provide 70% protection against chicken infectious anemia virus after chickens are immunized, and has the potential for application in the prevention and control of clinical chicken infectious anemia.

[0052] Table 1 Chicken grouping, immunization and virus attack information

[0053]

[0054] Table 2 Challenge protection efficacy results

[0055]

[0056]

[0057]

[0058]

[0059] Although the present invention has been disclosed as above in the form of a preferred embodiment, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.

Claims

1. A recombinant fusion protein, characterized in that: The invention is obtained by connecting the B cell epitope of the VP1 protein of chicken infectious anemia virus and the truncated flagellar protein of Salmonella typhimurium via a connecting peptide.

2. The recombinant fusion protein according to claim 1, characterized in that The chicken infectious anemia virus VP1 protein B cell epitope is obtained by connecting the B cell antigen epitope contained in the chicken infectious anemia virus VP1 protein via a connecting peptide.

3. The recombinant fusion protein according to claim 2, characterized in that The amino acid sequence of the B cell epitope of the chicken infectious anemia virus VP1 protein is as shown in SEQ ID NO.

1.

4. The recombinant fusion protein according to claim 1, characterized in that The truncated flagellin of Salmonella typhimurium is obtained by removing the amino acids at positions 144-408 in the full-length FliC protein of Salmonella typhimurium and connecting the N-terminus and the C-terminus of FliC with a connecting peptide.

5. The recombinant fusion protein according to claim 4, characterized in that The amino acid sequence of the truncated flagellin of Salmonella typhimurium is shown in SEQ ID NO.

2.

6. The recombinant fusion protein according to any one of claims 1 to 5, characterized in that: The amino acid sequence of the recombinant fusion protein is shown in SEQ ID NO.

3.

7. A chicken infectious anemia virus subunit vaccine, characterized in that: Contains the recombinant fusion protein according to any one of claims 1 to 6.

8. A chicken infectious anemia virus subunit vaccine according to claim 7, characterized in that: The chicken infectious anemia virus subunit vaccine also contains a carrier.

9. A gene fragment encoding the recombinant fusion protein according to any one of claims 1 to 6.

10. Use of the recombinant fusion protein according to any one of claims 1 to 6, the gene fragment according to claim 9, the recombinant plasmid or the recombinant cell carrying the gene fragment according to claim 9 in the preparation of a chicken infectious anemia virus vaccine.

Images