Phosphodiesterase and use thereof

Abstract

The present invention provides a phosphodiesterase derived from a bacterium belonging to the genus Leptographium, the phosphodiesterase having a high GMP production capability even in the presence of a nucleic acid at a high concentration, and the phosphodiesterase comprising the amino acid sequence represented by SEQ ID NO: 1 or an amino acid sequence having 60% or higher identity with the aforementioned amino acid sequence.

Description

Phosphodiesterase and its uses

[0001] The present invention relates to a novel phosphodiesterase and uses thereof. More specifically, the present invention relates to a novel phosphodiesterase derived from a bacterium belonging to the genus Leptographium that has excellent ability to produce 5'-guanosine monophosphate (GMP) even under conditions of high substrate concentration, and uses thereof.

[0002] In recent years, the share of plant-based alternative foods and reduced-salt foods has been increasing in the food market. Nucleotide-based seasonings such as yeast extract are widely used as umami components to improve the bland taste of these products. The umami flavor of yeast extract is known to be primarily due to the 5'-guanosine monophosphate (GMP) contained in the extract.

[0003] To enhance umami, the amount of GMP in yeast extract is generally increased by reacting nucleic acids in yeast with phosphodiesterase to produce GMP, and phosphodiesterases derived from Penicillium species are widely used (Patent Document 1).

[0004] It is known that many enzymes, including phosphodiesterase, exhibit a phenomenon known as "substrate inhibition" in which, when the substrate is present in excess of a certain limit, the substrate excessively binds to the active site of the enzyme, preventing an appropriate reaction and resulting in a decrease in enzyme activity. The same is true for phosphodiesterase derived from Penicillium spp., which also tends to exhibit a decrease in activity when an excess of nucleic acid, the substrate, is present. Therefore, when yeast with a high nucleic acid concentration is used as a raw material in the production of yeast extract, it has been difficult to efficiently produce a yeast extract containing a large amount of GMP.

[0005] Japanese Patent Application Laid-Open No. 2022-119910

[0006] In view of this background, the object of the present invention is to provide a novel phosphodiesterase capable of producing high levels of GMP even under conditions of high substrate concentration, and to provide a method for efficiently producing a GMP-containing composition such as yeast extract using this enzyme.

[0007] As a result of intensive research to achieve the above-mentioned object, the inventors have found that phosphodiesterase derived from Leptographium bacteria has extremely superior GMP production ability even under high substrate concentration conditions compared to phosphodiesterase derived from Penicillium bacteria. Based on this finding, they have conducted further research and have completed the present invention.

[0008] That is, the present invention provides the following: [1] A phosphodiesterase derived from a bacterium of the genus Leptographium, which has a high ability to produce GMP even in the presence of a high concentration of nucleic acid, and which comprises the amino acid sequence represented by SEQ ID NO: 1 or an amino acid sequence that is 60% or more identical to said amino acid sequence. [2] The phosphodiesterase according to [1], wherein the bacterium of the genus Leptographium is Leptographium procerum. [3] The phosphodiesterase according to [1] or [2], characterized in that when an enzymatic reaction is carried out under the following conditions, the amount of GMP produced is 20 mg / ml or more: <Conditions> - Ribonucleic acid concentration: 40 mg / ml - Reaction temperature: 70°C - Reaction time: 180 minutes - pH of reaction solution: 5.5 - Amount of phosphodiesterase added per mg of substrate RNA: 60.8 U / mg [4] An enzymatic preparation for decomposing a composition with a high nucleic acid content, comprising the phosphodiesterase according to any one of [1] to [3]. [5] The enzymatic preparation according to [4], wherein the concentration of nucleic acid in the composition with a high nucleic acid content is 35 mg / mL or more. [6] An enzymatic preparation for producing a composition containing 5'-guanosine monophosphate, comprising the phosphodiesterase according to any one of [1] to [3]. [7] The enzymatic preparation according to [6], wherein the composition containing 5'-guanosine monophosphate is yeast extract. [8] A method for producing a composition containing 5'-guanosine monophosphate, comprising contacting a composition containing nucleic acid with the phosphodiesterase according to any one of [1] to [3] or the enzyme preparation according to any one of [4] to [7]. [9] The production method according to [8], wherein the ratio of the amount of nucleic acid in the composition to the activity of phosphodiesterase is 0.001 U to 1000 U per 1 mg of nucleic acid.

[10] The production method according to [9], wherein the concentration of nucleic acid in the composition is 35 mg / mL or more.

[11] The production method according to any one of [8] to

[10] , wherein the composition containing 5'-guanosine monophosphate is yeast extract.

[12] A GMP-containing composition produced by allowing the phosphodiesterase according to any one of [1] to [3] or the enzyme preparation according to any one of [4] to [7] to act on nucleic acid.

[13] A nucleic acid represented by SEQ ID NO: 3 or 4, or a nucleic acid having 60% or more sequence identity to said nucleic acid.

[14] A vector containing the nucleic acid according to

[13] .

[15] A cell containing the vector according to

[14] .

[0009] According to the present invention, GMP can be efficiently produced from nucleic acids even under high substrate concentrations, and GMP-containing compositions, such as yeast extract, can be produced under reaction conditions that could not be adopted when using conventional enzymes.

[0010] The present invention will be described in detail below.

[0011] 1. Phosphodiesterase The present invention provides a phosphodiesterase derived from a bacterium belonging to the genus Leptographium, which contains the amino acid sequence represented by SEQ ID NO: 1 or an amino acid sequence that is 60% or more identical to said amino acid sequence, and which has high GMP-producing ability even in the presence of a high concentration of nucleic acid (hereinafter, this may be referred to as the "phosphodiesterase of the present invention").

[0012] Phosphodiesterase is an enzyme that hydrolyzes one bond of a phosphodiester bond. The phosphodiesterase of the present invention is derived from a bacterium belonging to the genus Leptographium, and is characterized by being resistant to substrate inhibition even in the presence of high concentrations of nucleic acids as its substrate, and having high phosphodiesterase activity (particularly GMP-producing activity in the present invention).

[0013] Many species of the genus Leptographium from which the phosphodiesterase of the present invention is derived can affect the health of wood and plants, and are of interest in the fields of forestry and plant protection. Examples of Leptographium genus bacteria include Leptographium procerum, Leptographium terebrantis, Leptographium wingfieldii, and Leptographium abietinum, Leptographium serpens, Leptographium lundbergii, Leptographium wageneri, Leptographium longiclavatum, Leptographium sinense, and Leptographium Examples of Leptographium species include, but are not limited to, Leptographium murrayi. In a preferred embodiment of the present invention, the Leptographium species may be Leptographium procerum. More preferably, the Leptographium procerum NBRC110178 strain may be used. This strain is available from the National Institute of Technology and Evaluation (NITE) Biotechnology Center (NBRC).

[0014] The phosphodiesterase of the present invention is characterized by its high resistance to substrate inhibition. The ratio of substrate (i.e., nucleic acid) to phosphodiesterase at which the phosphodiesterase of the present invention can exhibit its properties is not particularly limited as long as the desired effect is achieved, but is typically 1,000 U or less per mg of nucleic acid, preferably 900 U or less, 800 U or less, 700 U or less, 600 U or less, 500 U or less, 400 U or less, 300 U or less, 200 U or less, 100 U or less, 90 U or less, 80 U or less, 70 U or less, 60 U or less, 50 U or less, 45 U or less, 40 U or less, 35 U or less, 30 U or less, or 25 U or less, and more preferably 20 U or less, 15 U or less, 13.5 U or less, 10 U or less, or 5 U or less. The lower limit is also not particularly limited as long as the desired effect is achieved, but is typically 0.01 U or more, preferably 0.1 U or more, 1 U or more, or 5 U or more per mg of nucleic acid. In one embodiment, the ratio of substrate (nucleic acid):phosphodiesterase is typically, but not limited to, 0.01 to 1000 U, preferably 0.1 to 500 U, 1 to 300 U, 5 to 100 U, 10 to 90 U, 10 to 60 U, 10 to 40 U, ​​or 10 to 20 U per 1 mg of nucleic acid.

[0015] In this specification, phosphodiesterase activity (particularly, ribonuclease activity) is defined as the amount of enzyme that liberates 1 μmol of phosphate per minute when phosphodiesterase (particularly, ribonuclease) is allowed to act on 3'-AMP as a substrate, and 1 U is the amount of enzyme that liberates 1 μmol of phosphate per minute.

[0016] The phosphodiesterase of the present invention has a higher ability to produce 5'-guanosine monophosphate (sometimes referred to herein as "GMP") at a high substrate concentration than existing phosphodiesterases. In one embodiment, the phosphodiesterase of the present invention can also be defined in terms of its ability to produce GMP at a high substrate concentration, as follows: <Condition 1> Ribonucleic acid concentration: 40 mg / ml Reaction temperature: 70°C Reaction time: 180 minutes pH of reaction solution: 5.5 Amount of phosphodiesterase added per mg of substrate RNA: 60.8 U Amount of GMP produced is 15 mg / mL or more (preferably 16 mg / mL or more, more preferably 17 mg / mL or more) <Condition 2> Ribonucleic acid concentration: 60 mg / mL Reaction temperature: 70°C Reaction time: 180 minutes pH of reaction solution: 5.5 Amount of phosphodiesterase added per mg of substrate RNA: 40.5 U Amount of GMP produced is 20 mg / mL or more (preferably 21 mg / mL or more, more preferably 22 mg / mL or more)

[0017] In another embodiment, the phosphodiesterase of the present invention can be defined as follows: <Condition 3> - Ribonucleic acid concentration: 120 mg / mL - Reaction temperature: 70°C - Reaction time: 180 minutes - pH of reaction solution: 5.5 - Amount of phosphodiesterase added per mg of substrate RNA: 20.3 U - Amount of GMP produced is 19 mg / mL or more (preferably 20 mg / mL or more, more preferably 21 mg / mL or more).

[0018] In another embodiment, the phosphodiesterase of the present invention can be defined as follows: <Condition 4> - Ribonucleic acid concentration: 180 mg / mL - Reaction temperature: 70°C - Reaction time: 180 minutes - pH of reaction solution: 5.5 - Amount of phosphodiesterase added per mg of substrate RNA: 13.5 U - Amount of GMP produced is 13 mg / mL or more (preferably 14 mg / mL or more, more preferably 15 mg / mL or more).

[0019] In another embodiment, the phosphodiesterase of the present invention has at least 2.6-fold higher GMP production ability than a control phosphodiesterase under the following conditions: <Condition 5> - Ribonucleic acid concentration: 240 mg / mL - Reaction temperature: 70°C - Reaction time: 180 minutes - pH of reaction solution: 5.5 - Amount of phosphodiesterase added per mg of substrate RNA: 10.1 U - Amount of GMP produced is 8 mg / mL or more (preferably 9 mg / mL or more, more preferably 10 mg / mL or more).

[0020] Furthermore, the phosphodiesterase of the present invention comprises or consists of the amino acid sequence represented by SEQ ID NO: 1 or an amino acid sequence that is 60% or more, preferably 70% or more, 80% or more, or 90% or more (more preferably 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more) identical to said amino acid sequence. The phosphodiesterase comprising or consisting of an amino acid sequence that is 60% or more, preferably 70% or more, 80% or more, or 90% or more (more preferably 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more) identical to the amino acid sequence represented by SEQ ID NO: 1 may be a phosphodiesterase that has GMP-producing ability equivalent to or greater than that of a phosphodiesterase consisting of the amino acid sequence represented by SEQ ID NO: 1. The identity (%) of amino acid sequences may be determined by a method known per se, for example, by calculation using sequence comparison software such as Basic Local Alignment Search Tool (BLAST).

[0021] As shown in the following examples, the active center of the phosphodiesterase of the present invention is seven amino acids (DSYRATA (SEQ ID NO: 5), D and R are the binding sites) located at positions 45 to 51 of the amino acid sequence represented by SEQ ID NO: 1 (corresponding to positions 65 to 71 in SEQ ID NO: 2). Therefore, the phosphodiesterase of the present invention may have no amino acid substitutions at positions 45 to 51 of the amino acid sequence represented by SEQ ID NO: 1, but may have amino acid substitutions at other positions.

[0022] The phosphodiesterase of the present invention derived from Leptographium sp. can be prepared by a method known per se. The phosphodiesterase of the present invention derived from Leptographium sp. can be prepared by isolating it from a culture medium of Leptographium sp. Alternatively, the phosphodiesterase of the present invention can be prepared by introducing a nucleic acid encoding the phosphodiesterase of the present invention into a microorganism for protein expression using genetic recombination technology or genome editing technology and culturing the microorganism. An example of a preparation method is a method in which the target phosphodiesterase is recovered from the culture medium or cells of Leptographium sp. When the phosphodiesterase is secreted from the cells, the cells can be removed from the culture medium using filtration or centrifugation as necessary, and the phosphodiesterase can be separated and / or purified from the culture medium from which the cells have been removed. Alternatively, when phosphodiesterase is not secreted from the bacterial cells, the bacterial cells can be recovered from the culture medium, disrupted by pressure treatment or ultrasonic treatment, and then the phosphodiesterase can be isolated and / or purified. The method for isolating and / or purifying phosphodiesterase may be any known method for isolating and / or purifying proteins. Examples of such methods include, but are not limited to, centrifugation, UF concentration, salting out, and various chromatographic methods using ion exchange resins, etc.

[0023] When the phosphodiesterase of the present invention is prepared using a microorganism, the phosphodiesterase of the present invention may or may not be isolated and / or purified from the microorganism. When the phosphodiesterase of the present invention is purified, the purity of the purified phosphodiesterase is not particularly limited.

[0024] In one aspect of the present invention, the phosphodiesterase of the present invention can be a nuclease or alternatively, a ribonuclease.

[0025] 2. Enzyme Preparation for Degrading a Nucleic Acid-Rich Composition The present invention also provides an enzymatic preparation for degrading a nucleic acid-rich composition (hereinafter, sometimes referred to as the "degradative enzymatic preparation of the present invention"), which comprises the phosphodiesterase of the present invention.

[0026] As described above, the phosphodiesterase of the present invention is characterized by its higher GMP-producing ability than existing phosphodiesterases at high substrate concentrations. Therefore, by utilizing this aspect of the phosphodiesterase of the present invention, it is possible to more efficiently degrade nucleic acids in compositions containing high concentrations of nucleic acids than existing phosphodiesterases.

[0027] The amount of the phosphodiesterase of the present invention to be incorporated into the decomposing enzymatic preparation of the present invention is not particularly limited and may be generally 0.0001 to 100% by weight, preferably 0.001 to 100% by weight, based on the weight of the enzymatic preparation of the present invention.

[0028] The degrading enzyme preparation of the present invention may contain components other than the phosphodiesterase of the present invention. Such components include, but are not limited to, additives such as stabilizers, buffers, preservatives, excipients, suspending agents, antiseptics, pH adjusters, and physiological saline. Excipients include, but are not limited to, starch, dextrin, maltose, trehalose, lactose, D-glucose, sorbitol, D-mannitol, sucrose, and glycerol. Buffers include, but are not limited to, phosphates, citrates, and acetates. Stabilizers include, but are not limited to, propylene glycol and ascorbic acid. Preservatives include, but are not limited to, phenol, benzalkonium chloride, benzyl alcohol, chlorobutanol, and methylparaben. Preservatives include, but are not limited to, ethanol, benzalkonium chloride, parahydroxybenzoic acid, and chlorobutanol. Examples of pH adjusters include, but are not limited to, acetate buffer, phosphate buffer, MES buffer, HEPES buffer, PIPES buffer, Bis-tris buffer, MOPS buffer, etc. These additives may be contained alone or in combination.

[0029] The form of the decomposing enzyme preparation of the present invention is not particularly limited as long as the biological activity of the phosphodiesterase of the present invention is maintained, and it may be in any form of solid, semi-solid, powder, slurry, or liquid.

[0030] The nucleic acid-rich composition to which the degrading enzyme preparation of the present invention is applied means a composition containing a large amount of nucleic acid to such an extent that the GMP-producing ability of an existing phosphodiesterase (e.g., phosphodiesterase derived from bacteria of the genus Penicillium) is reduced by substrate inhibition. The nucleic acid-rich composition may be a composition that inherently contains a large number of nucleic acids (e.g., high-nucleic acid yeast), or may be a composition to which nucleic acids have been added from outside to increase the nucleic acid concentration.

[0031] The nucleic acid concentration contained in the high-nucleic acid composition is not particularly limited as long as it is sufficient to cause a decrease in the activity of existing phosphodiesterases, but is usually 35 mg / mL or more, preferably 40 mg / mL or more, 45 mg / mL or more, 50 mg / mL or more, 55 mg / mL or more, 60 mg / mL or more, 65 mg / mL or more, 70 mg / mL or more, 75 mg / mL or more, 80 mg / mL or more, 85 mg / mL or more, 90 mg / mL or more, 95 mg / mL or more, 100 mg / mL or more, 110 mg / mL or more, 120 mg / mL or more, 130 mg / mL or more, 140 mg / mL or more, 150 mg / mL or more, 160 mg / mL or more, 170 mg / mL or more, and more preferably 180 mg / mL or more, 190 mg / mL or more, 200 mg / mL or more, 210 mg / mL or more, 220 mg / mL or more, 230 mg / mL or more, 240 mg / mL or more, 250 mg / mL or more, 260 mg / mL or more, 270 mg / mL or more, and more preferably 280 mg / mL or more, 290 mg / mL or more, 300 mg / mL or more, 310 mg / mL or more, 320 mg / mL or more, 330 mg / mL or more, 340 mg / mL or more, 350 mg / mL or more, 360 mg / mL or more, 370 mg / mL or more, 380 mg / mL or more, 390 mg / mL or more, 400 mg / mL or more, 410 mg / mL or more, 420 mg / mL or more, 430 mg / mL or more, 440 The concentration may be, but is not limited to, 180 mg / mL or more, 190 mg / mL or more, 200 mg / mL or more, 210 mg / mL or more, 220 mg / mL or more, 230 mg / mL or more, 240 mg / mL or more, 250 mg / mL or more, 260 mg / mL or more, 270 mg / mL or more, 280 mg / mL or more, 290 mg / mL or more, 300 mg / mL or more, 350 mg / mL or more, 400 mg / mL or more, 500 mg / mL or more, 600 mg / mL or more, 700 mg / mL or more, 800 mg / mL or more, 900 mg / mL or more, 1000 mg / mL or more, 1100 mg / mL or more, or 1200 mg / mL or more.The upper limit of the nucleic acid concentration is not particularly limited, but is usually 10,000 mg / mL or less, preferably 9,000 mg / mL or less, 8,000 mg / mL or less, 7,000 mg / mL or less, 6,000 mg / mL or less, 5,000 mg / mL or less, 4,000 mg / mL or less, 3,500 mg / mL or less, 3,400 mg / mL or less, 3,300 mg / mL or less, 3,200 mg / mL or less, 3,100 mg / mL or less, 3,000 mg / mL or less, 2,900 mg / mL or less, 2,800 mg / mL or less mL or less, 2700 mg / mL or less, 2600 mg / mL or less, 2500 mg / mL or less, 2400 mg / mL or less, 2300 mg / mL or less, 2200 mg / mL or less, 2100 mg / mL or less, 2000 mg / mL or less, 19 00mg / mL or less, 1800mg / mL or less, 1700mg / mL or less, 1600mg / mL or less, 1500mg / mL or less, 1400mg / mL or less, 1300mg / mL or less, 1200mg / mL or less, 1100mg / mL or less Bottom, 1000 mg / mL or less, 900 mg / mL or less, 800 mg / mL or less, 700 mg / mL or less, 600 mg / mL or less, 500 mg / mL or less, 400 mg / mL or less, 300 mg / mL or less, 250 mg / mL or less, 2 00mg / mL or less, 190mg / mL or less, 180mg / mL or less, 170mg / mL or less, 160mg / mL or less, 150mg / mL or less, 140mg / mL or less, 130mg / mL or less, 120mg / mL or less, 110mg The concentration may be, but is not limited to, 100 mg / mL or less, 90 mg / mL or less, 80 mg / mL or less, 70 mg / mL or less, 60 mg / mL or less, 50 mg / mL or less, 40 mg / mL or less, 30 mg / mL or less, 20 mg / mL or less, 10 mg / mL or less, 9 mg / mL or less, 8 mg / mL or less, 7 mg / mL or less, 6 mg / mL or less, 5 mg / mL or less, 4 mg / mL or less, 3 mg / mL or less, 2 mg / mL or less, or 1 mg / mL or less.

[0032] The amount of the decomposing enzyme of the present invention to be added to a composition with a high nucleic acid content may vary depending on the amount of the phosphodiesterase of the present invention incorporated into the decomposing enzyme of the present invention, the enzyme reaction conditions, etc., but may be determined appropriately using a method known per se.

[0033] 3. Enzyme Preparation for Producing a GMP-Containing Composition The present invention also provides an enzymatic preparation for producing a GMP-containing composition, which contains the phosphodiesterase of the present invention (hereinafter, sometimes referred to as the "enzymatic preparation for producing a GMP-containing composition of the present invention").

[0034] The phosphodiesterase of the present invention can efficiently produce GMP using nucleic acids as substrates, particularly under conditions of high substrate concentrations. By utilizing this property, the phosphodiesterase of the present invention can be suitably used for producing GMP-containing compositions, such as yeast extract. Furthermore, as described above, the phosphodiesterase of the present invention is less susceptible to substrate inhibition even under conditions of high substrate concentrations, making it possible to produce compositions with high GMP contents.

[0035] The amount of the phosphodiesterase of the present invention, the components other than the phosphodiesterase, the form, etc. in the enzyme preparation for producing a GMP-containing composition of the present invention are the same as those explained for the decomposing enzyme preparation of the present invention.

[0036] The amount of the enzyme preparation for producing a GMP-containing composition of the present invention to be added may vary depending on the amount of the phosphodiesterase of the present invention in the enzyme preparation for producing a GMP-containing composition of the present invention, the reaction conditions, etc., but may be determined appropriately using a method known per se.

[0037] The subject to which the enzyme preparation for producing a GMP-containing composition of the present invention is applied is not particularly limited, but since the phosphodiesterase of the present invention contained in the enzyme preparation for producing a GMP-containing composition of the present invention uses nucleic acid as a substrate and aims to produce GMP, it is essential that the subject to which the enzyme preparation for producing a GMP-containing composition of the present invention is applied contains nucleic acid. The nucleic acid may be derived from the subject or may be added externally. An example of such a subject is yeast extract. Below, a process for producing yeast extract using the enzyme preparation for producing a GMP-containing composition of the present invention will be described as an example of an embodiment of the enzyme preparation of the present invention.

[0038] Yeast grown using conventional methods is recovered, disrupted using a homogenizer or ultrasonic treatment, and intracellular components are extracted with a solvent. The resulting extract is filtered to remove solids, and then concentrated by evaporation or centrifugation to prepare a yeast extract. The phosphodiesterase of the present invention is added to the prepared yeast extract and allowed to react for 1 to 24 hours at 50-90°C and pH 4.0-7.0, thereby converting nucleic acids (particularly RNA) contained in the yeast extract to GMP. The timing of the application of the phosphodiesterase of the present invention to yeast or yeast extract is not particularly limited as long as the desired effect is achieved, and may occur during any of the following steps: disrupting yeast, extracting intracellular components with a solvent, filtering the extract to remove solids, or concentrating. In one aspect of the present invention, the yeast used as a starting material may be yeast characterized by containing a large amount of nucleic acids. This aspect can be interpreted as a method for producing a yeast extract containing a high concentration of GMP, which includes a step of reacting a yeast or yeast extract with the phosphodiesterase of the present invention (hereinafter, sometimes referred to as the "method for producing the yeast extract of the present invention.") The GMP content of such a yeast extract can usually be, but is not limited to, 1 mg / mL or more, preferably 2 mg / mL or more, 3 mg / mL or more, 4 mg / mL or more, 5 mg / mL or more, 6 mg / mL or more, 7 mg / mL or more, 8 mg / mL or more, or 9 mg / mL or more.The upper limit is not particularly limited, but is usually 1000 mg / mL or less, preferably 900 mg / mL or less, 800 mg / mL or less, 700 mg / mL or less, 600 mg / mL or less, 500 mg / mL or less, 450 mg / mL or less, 400 mg / mL or less, or 350 mg / mL or less, 300 mg / mL or less, 250 mg / mL or less, 200 mg / mL or less, 190 mg / mL or less, 180 mg / mL or less, 170 mg / mL or less, 160 mg / mL or less, 150 mg / mL or less, 140 mg / mL or less, 130 mg / mL or less The concentration may be, but is not limited to, 120 mg / mL or less, 110 mg / mL or less, 100 mg / mL or less, 90 mg / mL or less, 80 mg / mL or less, 70 mg / mL or less, 60 mg / mL or less, 50 mg / mL or less, 40 mg / mL or less, 30 mg / mL or less, 20 mg / mL or less, 10 mg / mL or less, 9 mg / mL or less, 8 mg / mL or less, 7 mg / mL or less, 6 mg / mL or less, 5 mg / mL or less, 4 mg / mL or less, 3 mg / mL or less, 2 mg / mL or less, or 1 mg / mL or less.

[0039] A specific embodiment of the method for producing a yeast extract of the present invention is as follows: A method for producing a yeast extract, comprising the following steps: a first step of preparing a composition containing nucleic acid; a second step of allowing the phosphodiesterase of the present invention to act on the composition containing nucleic acid prepared in the first step; and a step of recovering the composition containing GMP prepared in the second step.

[0040] The nucleic acid used in this embodiment may be chemically synthesized or derived from a living organism. The species from which the nucleic acid is derived is not particularly limited, but is preferably yeast.

[0041] In another embodiment, the nucleic acid concentration of the composition containing nucleic acid prepared in step 1 is preferably high. The nucleic acid concentration is not particularly limited as long as it is sufficient to reduce the activity of existing phosphodiesterases, but is typically 35 mg / mL or higher, and preferably 40 mg / mL or higher, 45 mg / mL or higher, 50 mg / mL or higher, 55 mg / mL or higher, 60 mg / mL or higher, 65 mg / mL or higher, 70 mg / mL or higher, 75 mg / mL or higher, 80 mg / mL or higher, 85 mg / mL or higher, 90 mg / mL or higher, 95 mg / mL or higher, 100 mg / mL or higher, 110 mg / mL or higher, 120 mg / mL or higher, 130 mg / mL or higher, 140 mg / mL or higher, 150 mg / mL or higher, 160 mg / mL or higher, or 170 mg / mL. or more, 180 mg / mL or more, 190 mg / mL or more, 200 mg / mL or more, 210 mg / mL or more, 220 mg / mL or more, 230 mg / mL or more, 240 mg / mL or more, 250 mg / mL or more, 260 mg / mL or more, 270 mg / mL or more, 280 mg / mL or more, 290 mg / mL or more, 300 mg / mL or more, 350 mg / mL or more, 400 mg / mL or more, 500 mg / mL or more, 600 mg / mL or more, 700 mg / mL or more, 800 mg / mL or more, 900 mg / mL or more, 1000 mg / mL or more, 1100 mg / mL or more, or 1200 mg / mL or more.The upper limit of the nucleic acid concentration is not particularly limited, but is usually 10,000 mg / mL or less, preferably 9,000 mg / mL or less, 8,000 mg / mL or less, 7,000 mg / mL or less, 6,000 mg / mL or less, 5,000 mg / mL or less, 4,000 mg / mL or less, 3,500 mg / mL or less, 3,400 mg / mL or less, 3,300 mg / mL or less, 3,200 mg / mL or less, 3,100 mg / mL or less, 3,000 mg / mL or less, 2,900 mg / mL or less, 2,800 mg / mL or less mL or less, 2700 mg / mL or less, 2600 mg / mL or less, 2500 mg / mL or less, 2400 mg / mL or less, 2300 mg / mL or less, 2200 mg / mL or less, 2100 mg / mL or less, 2000 mg / mL or less, 19 00mg / mL or less, 1800mg / mL or less, 1700mg / mL or less, 1600mg / mL or less, 1500mg / mL or less, 1400mg / mL or less, 1300mg / mL or less, 1200mg / mL or less, 1100mg / mL or less Bottom, 1000 mg / mL or less, 900 mg / mL or less, 800 mg / mL or less, 700 mg / mL or less, 600 mg / mL or less, 500 mg / mL or less, 400 mg / mL or less, 300 mg / mL or less, 250 mg / mL or less, 2 00mg / mL or less, 190mg / mL or less, 180mg / mL or less, 170mg / mL or less, 160mg / mL or less, 150mg / mL or less, 140mg / mL or less, 130mg / mL or less, 120mg / mL or less, 110mg The concentration may be, but is not limited to, 100 mg / mL or less, 90 mg / mL or less, 80 mg / mL or less, 70 mg / mL or less, 60 mg / mL or less, 50 mg / mL or less, 40 mg / mL or less, 30 mg / mL or less, 20 mg / mL or less, 10 mg / mL or less, 9 mg / mL or less, 8 mg / mL or less, 7 mg / mL or less, 6 mg / mL or less, 5 mg / mL or less, 4 mg / mL or less, 3 mg / mL or less, 2 mg / mL or less, or 1 mg / mL or less.

[0042] According to the method for producing a yeast extract of the present invention, a liquid or solid (typically, powdered, granular, etc.) yeast extract can be obtained. The yeast extract obtained by the method for producing a yeast extract of the present invention can be used to enhance or adjust the flavor of various foods and beverages. Examples of applicable foods and beverages include processed seafood products (chikuwa, kamaboko, hanpen, dried squid, dried fish, salted fish, fish sausage, tsukudani, canned goods, etc.), processed meat products (ham, bacon, sausage, jerky, corned beef, formed meat, etc.), processed vegetables (canned and bottled vegetables, processed tomatoes, processed mushrooms, pickled vegetables, dried vegetables, tsukudani, etc.), noodles and breads (various types of noodles, bread, sweet rolls, etc.), processed grain products (cereal, oatmeal, muesli, processed rice products, wheat gluten, barley tea, etc.), dairy products (milk, processed milk, dairy drinks, concentrated milk, milk powder, condensed milk, fermented milk, lactic acid bacteria drinks, butter, cheese, ice cream, etc.), processed fruit products (canned and bottled fruit) jams, marmalades, dried fruits, etc.), sweets and desserts (biscuits, baked goods, rice crackers, fried sweets, fresh Japanese sweets, fresh Western sweets, semi-fresh sweets, dried Japanese sweets, candies, chocolates, chewing gum, snacks, frozen desserts, etc.), beverages (soft drinks, carbonated drinks, fruit juice drinks, coffee drinks, vegetable juice drinks, tea drinks, non-alcoholic drinks, alcoholic drinks, etc.), seasonings (sauces, soups, dressings, sauces, etc.), soups, roux (curry roux, stew roux, etc.), nutritional supplements and beverages (protein powders, protein drinks, supplements, energy drinks, etc.), pet food, nutritional supplements for pets.

[0043] 4. Nucleic Acids, Vectors, and Cells The present invention also provides a nucleic acid represented by SEQ ID NO: 3 or 4, or a nucleic acid having 60% or more sequence identity to said nucleic acid (hereinafter sometimes referred to as a "nucleic acid of the present invention"), a vector containing said nucleic acid (hereinafter sometimes referred to as a "vector of the present invention"), or a cell containing said vector (hereinafter sometimes referred to as a "cell of the present invention").

[0044] The nucleic acid of the present invention is a nucleic acid encoding the above-described phosphodiesterase of the present invention. The amino acid sequence of the phosphodiesterase of the present invention is as described above. When the amino acid sequence is known, a person skilled in the art can determine the nucleic acid sequence encoding the amino acid sequence using a method known per se. Note that SEQ ID NO: 3 is a nucleic acid encoding the phosphodiesterase of the present invention (without a signal sequence), and SEQ ID NO: 4 is a nucleic acid encoding the phosphodiesterase of the present invention (with a signal sequence).

[0045] The nucleic acid of the present invention may have a codon substituted with a degenerate codon, so long as it encodes the phosphodiesterase of the present invention. In other words, the nucleic acid of the present invention does not have to be SEQ ID NO: 3 or SEQ ID NO: 4 itself, so long as it encodes the phosphodiesterase of the present invention.

[0046] In another embodiment, the nucleic acid of the present invention comprises or consists of a nucleic acid represented by SEQ ID NO: 3 or 4, or a nucleic acid that is 60% or more, preferably 70% or more, 80% or more, or 90% or more (more preferably 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more) identical to said nucleic acid. A nucleic acid comprising or consisting of a nucleic acid that is 60% or more, preferably 70% or more, 80% or more, or 90% or more (more preferably 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more) identical to a nucleic acid represented by SEQ ID NO: 3 or 4 may be a nucleic acid encoding a phosphodiesterase having GMP-producing activity equal to or greater than that of a phosphodiesterase consisting of the amino acid sequence represented by SEQ ID NO: 1 or 2. The identity (%) of a nucleic acid sequence may be determined by a method known per se.

[0047] In one embodiment, the nucleic acid of the present invention may be unaltered in the nucleic acid encoding the amino acid at the active center of the phosphodiesterase of the present invention (i.e., GACTCGTATCGGGCCACGGCA, SEQ ID NO: 6 (corresponding to positions 133 to 153 in SEQ ID NO: 3 or positions 193 to 213 in SEQ ID NO: 4)), but may be altered at other positions. In another embodiment, the nucleic acid of the present invention may be altered from SEQ ID NO: 6 in the nucleic acid encoding the amino acid at the active center, as long as the amino acid sequence at the active center of the phosphodiesterase of the present invention (i.e., DSYRATA (SEQ ID NO: 5)) is maintained.

[0048] The vector of the present invention may be any vector as long as it contains the nucleic acid of the present invention. The vector may be a cloning vector or an expression vector. The cloning vector or expression vector may be selected appropriately depending on the host cell. For example, when Escherichia coli is the host cell, cloning vectors include, but are not limited to, M13-based vectors, pUC-based vectors, pBR322, pBluescript, pCR-Script, pGEM-T, pDIRECT, and pT7. Expression vectors include, but are not limited to, pGEX and pET.

[0049] The cells of the present invention are not particularly limited as long as they are capable of amplifying the vectors of the present invention and capable of expressing the phosphodiesterase of the present invention by introducing the vectors of the present invention. Examples of such cells include, but are not limited to, Escherichia coli, yeast, animal cells, plant cells, and insect cells.

[0050] The present invention will be described in more detail below with reference to examples, but these are merely illustrative and the present invention is not limited thereto.

[0051] [Preparation of Phosphodiesterase] Leptographium procerum NBRC110178 strain (obtained from the National Institute of Technology and Evaluation (NITE) Biotechnology Center (NBRC)) was cultured in PDA medium (manufactured by Becton Dickinson and Company), and then water was added to obtain a soaking solution. The soaking solution was filtered using filter paper and then ultrafiltered to remove insoluble components and impurities, concentrating the phosphodiesterase and obtaining an enzyme solution. As a comparative example, a commercially available phosphodiesterase derived from Penicillium sp. (manufactured by Amano Enzyme Inc.) was used.

[0052] The activity of each phosphodiesterase was measured based on the phosphodiesterase activity test method in the 9th edition of the Japanese Standards for Food Additives.

[0053] A substrate solution was prepared by dissolving 20 mg of adenosine-3'-monophosphate in 10 mL of sodium barbital hydrochloride buffer (pH 5.0) and filtering through a membrane filter (0.45 μm). Amidol reagent solution was prepared by weighing 0.50 g of 2,4-diaminophenol dihydrochloride and 10.0 g of sodium bisulfite, dissolving in water to 50 mL, and filtering. 0.4 mL of the freshly prepared substrate solution was left at 70±0.5°C for exactly 5 minutes, followed by the addition of 0.1 mL of enzyme solution and leaving at 70±0.5°C for exactly 15 minutes. 4 mL of 6% perchloric acid reagent, 0.4 mL of Amidol reagent, and 0.2 mL of hexaammonium heptamolybdate tetrahydrate solution (8.3 → 100) were mixed. The mixture was left in running water for 15 minutes, and the absorbance at 750 nm was measured using water as a control.

[0054] Test Example 1: Measurement of Enzyme Activity Solutions containing ribonucleic acid (yeast-derived; manufactured by Fujifilm Wako Pure Chemical Industries, Ltd.) and the phosphodiesterase obtained in Example 1 or the phosphodiesterase of the comparative example were prepared to achieve the various substrate concentrations and enzyme activities per substrate shown in Table 1, and the solutions were reacted at 70°C for 180 minutes. After completion of the reaction, the enzyme was inactivated by boiling at 100°C for 5 minutes. Each reaction solution was filtered through a 0.45 μm hydrophilic mixed cellulose ester (MCE) membrane filter, and then GMP was fractionated and quantified using Shim-Pack WAX-1 (manufactured by Shimazu: 4.0 mm I.D., × 50 mm L 3 μm, P / N: 228-16225-91). Furthermore, the amount of GMP produced by the enzyme of the present invention (phosphodiesterase derived from the genus Leptographium) (GMP production ratio) was calculated, assuming that the amount of GMP produced by the commercially available product (phosphodiesterase derived from the genus Penicillium) was set to 1. The results are shown in Table 1.

[0055]

[0056] Compared with the nuclease derived from the genus Penicillium, the nuclease derived from the genus Leptographium showed high GMP production even at high substrate concentrations. According to the present invention, it was demonstrated that a high amount of GMP can be produced even at a substrate concentration as high as 40 mg / ml or more.

[0057] [Test Example 2] Determination of Amino Acid Sequence of Phosphodiesterase The amino acid sequence of the phosphodiesterase derived from Leptographium procerum used in this example was determined using a known method. Briefly, first, Leptographium procerum NBRC110178 strain was cultured and grown, and then the bacterial cells were collected. Next, the genome was extracted using a conventional method, and the base sequence corresponding to the phosphodiesterase possessed by the microorganism was determined using a next-generation sequencer. The amino acid sequence of the phosphodiesterase was determined from the determined base sequence.

[0058] The determined sequences are as follows: SEQ ID NO: 1: Amino acid sequence of the phosphodiesterase used in this example (without signal sequence) SEQ ID NO: 2: Amino acid sequence of the phosphodiesterase used in this example (with signal sequence (intact sequence)) SEQ ID NO: 3: Nucleotide sequence encoding the amino acid sequence of the phosphodiesterase used in this example (without signal sequence) SEQ ID NO: 4: Nucleotide sequence encoding the amino acid sequence of the phosphodiesterase used in this example (with signal sequence) SEQ ID NO: 5: Amino acid sequence of the active center of the phosphodiesterase used in this example SEQ ID NO: 6: Nucleotide sequence encoding the amino acid sequence of the active center of the phosphodiesterase used in this example

[0059] According to the present invention, GMP can be efficiently produced from nucleic acids even under high substrate concentrations. Furthermore, according to the present invention, GMP-containing compositions, such as yeast extract, can be produced under reaction conditions that could not be adopted when using conventional enzymes. Therefore, the present invention is extremely useful, for example, in the field of food production.

[0060] This application is based on Japanese Patent Application No. 2023-144802 (filing date: September 6, 2023) and Japanese Patent Application No. 2023-194225 (filing date: November 15, 2023), the contents of which are incorporated in their entirety herein.

Claims

1. A phosphodiesterase derived from the genus Leptographium, which contains an amino acid sequence represented by SEQ ID NO: 1 or an amino acid sequence which is 60% or more identical to said amino acid sequence, and has high GMP-producing ability even in the presence of a high concentration of nucleic acid.

2. The phosphodiesterase according to claim 1, wherein the Leptographium bacterium is Leptographium procerum.

3. The phosphodiesterase according to claim 1 or 2, characterized in that the amount of GMP produced is 20 mg / ml or more when the enzyme reaction is carried out under the following conditions: <Conditions> Ribonucleic acid concentration: 40 mg / ml Reaction temperature: 70°C Reaction time: 180 minutes pH of reaction solution: 5.5 Amount of phosphodiesterase added per mg of substrate RNA: 60.8 U / mg 4. An enzymatic preparation for decomposing a composition having a high nucleic acid content, comprising the phosphodiesterase according to claim 1.

5. The enzyme preparation according to claim 4, wherein the concentration of nucleic acid in the high nucleic acid content composition is 35 mg / mL or more.

6. An enzyme preparation for producing a composition containing 5'-guanosine monophosphate, comprising the phosphodiesterase according to claim 1.

7. The enzyme preparation according to claim 6, wherein the composition containing 5'-guanosine monophosphate is a yeast extract.

8. A method for producing a composition containing 5'-guanosine monophosphate, comprising contacting the phosphodiesterase according to claim 1 or 2, or the enzyme preparation according to any one of claims 4 to 7, with a composition containing a nucleic acid.

9. The method according to claim 8, wherein the ratio of the amount of nucleic acid in the composition to the activity of phosphodiesterase is 0.001 U to 1000 U per 1 mg of nucleic acid.

10. The method of claim 9, wherein the concentration of the nucleic acid in the composition is 35 mg / mL or more.

11. The method according to claim 8, wherein the composition containing 5'-guanosine monophosphate is a yeast extract.

12. A GMP-containing composition produced by allowing the phosphodiesterase according to claim 1 or 2, or the enzyme preparation according to any one of claims 4 to 7, to act on a nucleic acid.

13. A nucleic acid represented by SEQ ID NO: 3 or 4, or a nucleic acid having 60% or more sequence identity thereto.

14. A vector comprising the nucleic acid of claim 13.

15. A cell comprising the vector of claim 14.

Images