Method for producing polyploid plant with quantitative traits adjusted by genetic editing and polyploid plant with adjusted quantitative traits produced thereby

Abstract

The present invention relates to a method for producing a polyploid plant with quantitative traits adjusted by genetic editing, and a polyploid plant with adjusted quantitative traits, produced thereby. When the method according to the present invention is used, it is expected that varieties can be easily improved by adjusting quantitative traits of polyploid crops.

Description

Method for producing a polyploid plant with quantitative traits controlled by gene correction and a polyploid plant with quantitative traits controlled produced by the method

[0001] The present invention relates to a method for producing a polyploid plant with improved quantitative traits by genetic correction of homoeologous genes and to a polyploid plant with improved quantitative traits produced by the method.

[0002]

[0003] This work was supported by the National Research Foundation of Korea (NRF) grant funded by the Ministry of Science and ICT (Project No. 2020R1A2C1101915 and 2021R1C1C2006483) and the Rural Development Administration's Next-Generation Crop Breeding Technology Development Project (Project No. RS-2024-00322420).

[0004] Solanum nigrum is a wild plant that produces small berry-like fruits. The mature fruits are known to contain a large amount of anthocyanins, which have antioxidant and anticancer effects, as well as high levels of lutein and beta-carotene, which are good for eye health. Solanum nigrum is a plant in the Solanaceae family, like the tomato (Solanum lycopersicum), but while tomatoes are diploid plants, solanum nigrum is a hexaploid plant, meaning that orthologous genes (OG) exist in triploid form in the form of homoeologous genes (HG).

[0005] Among the methods for editing the genome, the CRISPR / Cas9 (Clustered Regularly Interspaced Short Palindromic Repeats / CRISPR associated protein 9) system has recently attracted attention. Using CRISPR / Cas9, a third-generation gene-editing technology, it can specifically edit only the desired genes in a cell in a short period of time. It has proven to be more accurate and efficient than the existing first-generation gene-editing technologies, zinc finger nucleases (ZFNs) and second-generation TALENs (Transcriptor Activator-Like Effector Nucleases), and it also boasts the advantages of simple design and low cost. Recently, it has been reported that this technology has successfully induced transformation in various plant species, including tomatoes, grapes, and rice. Furthermore, it has been confirmed that these mutants are stably transmitted to the next generation.

[0006] When this CRISPR / Cas9 system is applied to polyploid plants, since the homologous genes show high sequence homology as a characteristic, multiple homologous genes (triploid in the case of solanum, which is hexaploid) can be targeted simultaneously with the same gRNA, making it easy to create multiple mutants in polyploid crops.

[0007] Meanwhile, Korean Patent Registration No. 1429475 discloses 'a plant with improved quantitative traits and a method for producing the same' using an AP2-26-like polypeptide, and Korean Patent Publication No. 2019-0113740 discloses 'a method and composition for increasing the yield of short-storied plants through manipulation of gibberellin metabolism,' but there is no description of a method for producing a solanum plant with controlled quantitative traits by genetic correction of the present invention and a solanum plant with controlled quantitative traits produced by the method.

[0008] The present invention was derived from the above-mentioned needs, and the present inventors produced a gene-edited solanum plant using the CRISPR / Cas9 system targeting the S (Compound Inflorescence) gene, SP (Self-pruning) gene, or CLV3 / CLE9 (CLAVATA3 / EMBROUNDING REGION-RELATED 9) gene derived from the hexaploid plant Solanum nigrum in order to improve the quantitative traits of polyploid plants. Thereafter, the gene-edited solanum plant was crossed with a parent plant to produce a heterozygous mutant, and after self-fertilization of the heterozygous mutant, plant individuals having various genotypes were obtained through genotype segregation in the next generation (F2), and the present invention was completed by confirming that their phenotypic traits appear in a quantitative form according to the genotype.

[0009] To solve the above problem, the present invention provides a method for producing a polyploid plant with controlled quantitative traits related to plant growth and yield, which comprises the step of obtaining various genetic combinations of alleles in homoeologous genes of a heterozygous mutant (F1) obtained by backcrossing a polyploid plant in which homoeologous genes are edited with a wild type and F2 obtained by selfing the F1.

[0010] In addition, the present invention provides a method for producing a polyploid plant with controlled quantitative traits related to plant growth and yield, comprising the step of obtaining a heterozygous mutant by crossing a polyploid plant with edited homoeologous genes with another polyploid plant with edited homoeologous genes.

[0011] In addition, the present invention provides a Solanum nigrum plant and seeds thereof with improved quantitative traits produced by the above method.

[0012] In addition, the present invention provides a composition for genome editing for increasing quantitative traits related to plant growth and yield of a solanum plant, comprising as an active ingredient a recombinant vector comprising DNA encoding a guide RNA specific to the target base sequence of homoeologous genes derived from solanum and a nucleic acid sequence encoding an endonuclease protein; or a complex of a guide RNA specific to the target base sequence of homoeologous genes derived from solanum and an endonuclease protein.

[0013] The method for producing genome-edited polyploid plants of the present invention utilizes genetic combinations of mutations in syntenic genes to improve the traits of polyploid plants. This allows for quantitative expression of phenotypes resulting from the degree of mutation, thereby enabling selection of genotypes exhibiting the most suitable phenotypes for trait improvement. Compared to diploid crops, increased genetic diversity through syntenic gene editing is a characteristic of polyploid crops, which allows for more effective crop improvement. This strategy will enable the quantitative control of traits in many polyploid crops, such as host plants such as wheat, potatoes, and sweet potatoes, or agricultural crops such as strawberries and canola, to improve varieties. Furthermore, applying the same strategy through polyploidization of diploid plants is expected to facilitate the production of varieties with improved quantitative traits for many diploid crops.

[0014] Figure 1 is a schematic diagram of mutants that can be produced when performing gene correction using the CRISPR / Cas9 system in a diploid plant, and a schematic diagram of mutants that can be produced when performing gene correction using the CRISPR / Cas9 system in a hexaploid plant and then backcrossing it with a wild-type plant. OG (orthologous gene): orthologous gene, HG (homoeologous gene): homologous gene.

[0015] Figure 2 shows the target sequences and locations of four gRNAs targeting the S gene of the diploid plant S. americanum and the hexaploid plant S. nigrum. The underline indicates the PAM (Protospacer Adjacent Motif) sequence, and the numbers in parentheses indicate the number of bases between the target bases of each gRNA. WT: wild type, Sas: S mutant allele of S. americanum, Sns: S mutant allele of S. nigrum.

[0016] Figure 3 is a photograph showing the phenotypes of S gene mutants of the diploid plant S. americanum and the hexaploid plant S. nigrum. Arrows: inflorescence, s / +, s1s2 / +s3: heterozygous mutants, s1s3: double mutants, s1s2s3: triple mutants.

[0017] Figure 4 shows the results of confirming fruit yields in the greenhouse and field conditions of S gene mutants of the diploid plant S. americanum and the hexaploid plant S. nigrum. s / +, s1 / +s2s3, s1s2 / +s3, s1s2s3 / +: heterozygous mutants, s1s2, s1s3, s2s3: double mutants, s1s2s3: triple mutants.

[0018] Figure 5 shows the target sequences and locations of four gRNAs targeting the SP gene of the diploid plant S. americanum and the hexaploid plant S. nigrum. The underline indicates the PAM (Protospacer Adjacent Motif) sequence, and the numbers in parentheses indicate the number of bases between the target sequences of each gRNA. WT: wild type; Sasp: Sasp SP mutant allele of S. americanum; Snsp: Sasp SP mutant allele of S. nigrum.

[0019] Figure 6A is a drawing showing the SID (semi-indeterminate) type shoot structure of the SP gene mutant of the hexaploid plant S. nigrum, and 6B is a photograph observing the phenotypes of the SP gene mutant of the diploid plant S. americanum and the hexaploid plant S. nigrum. D: determinate, ID: indeterminate, Arrow: main stem inflorescence or axillary stem inflorescence, Parentheses: length of extended axillary shoot or number of leaves between two inflorescences, sp / +, sp1sp2sp3 / +: heterozygous mutants, sp1sp2: double mutants, sp1sp2sp3: triple mutants.

[0020] Figure 7 shows the results of analyzing the fruit yield of SP gene mutants of the diploid plant S. americanum and the hexaploid plant S. nigrum. sp / +, sp1sp2sp3 / +: heterozygous mutants, sp1sp2: double mutants, sp1sp2sp3: triple mutants.

[0021] Figure 8 is a process for producing a combination of mutant genotypes of the CLV3 and CLE9 homologous genes of the hexaploid plant S. nigrum.

[0022] Figure 9 shows the target sequences and locations of four gRNAs targeting the CLV3 gene (A) and CLE9 gene (B) of the hexaploid plant S. nigrum. The underline indicates the PAM (Protospacer Adjacent Motif) sequence, and the - and + marks indicate deleted or inserted bases.

[0023] Figure 10 shows cross-sections of flowers and fruits of CLV3 and CLE9 gene mutants of the hexaploid plant S. nigrum. Arrows: ovary sacs (locules) of each fruit.

[0024] Figure 11 shows the results of confirming the number of petals (A), number of ovary sacs (B), and weight of fruit (C) of CLV3 and CLE9 gene mutants of S. nigrum, a hexaploid plant.

[0025] In order to achieve the object of the present invention, the present invention provides a method for producing a polyploid plant with controlled quantitative traits related to plant growth and yield, which comprises the step of obtaining various genetic combinations of alleles in homoeologous genes of a heterozygous mutant (F1) obtained by backcrossing a polyploid plant in which homoeologous genes are edited with a wild type and F2 obtained by selfing the F1.

[0026] In a method for producing a polyploid plant with controlled quantitative traits related to plant growth and yield according to one embodiment of the present invention, the method comprises: (a) a step of introducing guide RNA and endonuclease protein specific for the target base sequence of homoeologous genes into plant cells of a polyploid plant to correct the genome;

[0027] (b) a step of regenerating a polyploid plant from a plant cell of the polyploid plant in which the genome has been corrected;

[0028] (c) a step of backcrossing the redifferentiated genome-corrected polyploid plant with a wild type to obtain a heterozygous mutant of the homologous genes; and

[0029] (d) a step of self-pollination of the above-mentioned backcrossed plant to obtain various genetic combinations of alleles from the homologous genes; but is not limited thereto.

[0030] In addition, in the method for producing a polyploid plant with controlled quantitative traits related to plant growth and yield according to one embodiment of the present invention, the homologous gene may be an S (Compound Inflorescence) gene or an SP (Self Pruning) gene derived from Solanum nigrum, and the S gene derived from Solanum nigrum may preferably be an S gene consisting of the base sequence of SEQ ID NO: 1, and the SP gene may preferably be an SP gene consisting of the base sequence of SEQ ID NO: 2, but is not limited thereto.

[0031] In addition, in the method for producing a polyploid plant with controlled quantitative traits related to plant growth and yield according to one embodiment of the present invention, when the syngeneic gene of step (a) is an S (Compound Inflorescence) gene, the number of flower stalks and fruit yield of the plant may be controlled, and when the syngeneic gene of step (a) is an SP (Self pruning) gene, the stem growth and fruit yield of the plant may be controlled, but is not limited thereto.

[0032] The present invention also provides a method for producing a polyploid plant having controlled quantitative traits related to plant growth and yield, comprising the step of crossing a polyploid plant having edited homoeologous genes with another polyploid plant having edited homoeologous genes to obtain a heterozygous mutant.

[0033] In a method for producing a polyploid plant having controlled quantitative traits related to plant growth and yield according to one embodiment of the present invention, the homologous gene may be a CLV3 (CLAVATA3) gene derived from Solanum nigrum or a CLE9 (EMBRYO-SURROUNDING REGION-RELATED 9) gene, and the CLV3 gene may preferably be a CLV3 gene consisting of a base sequence of SEQ ID NO: 3, and the CLE9 gene may preferably be a CLE9 gene consisting of a base sequence of SEQ ID NO: 4, but is not limited thereto.

[0034] In addition, in the method for producing a polyploid plant with controlled quantitative traits related to plant growth and yield according to one embodiment of the present invention, when the homologous gene is the CLV3 (CLAVATA3) gene or the CLE9 (EMBRYO-SURROUNDING REGION-RELATED 9) gene, the number of petals and the number of ovary sacs of the plant may be controlled, but is not limited thereto.

[0035] In addition, in a method for producing a polyploid plant with controlled quantitative traits related to plant growth and yield according to one embodiment of the present invention, (a) a step of introducing a guide RNA and an endonuclease protein specific to the target base sequence of the CLV3 (CLAVATA3) gene derived from Solanum nigrum into a Solanum nigrum plant cell to correct the CLV3 gene;

[0036] (b) a step of re-differentiating a black sorrel plant from a black sorrel plant cell in which the CLV3 gene of step (a) has been corrected;

[0037] (c) a step of introducing a guide RNA and an endonuclease protein specific to the target base sequence of the CLE9 (EMBRYO-SURROUNDING REGION-RELATED 9) gene derived from the solanum spp. into the plant cell of the redifferentiated CLV3 gene corrected solanum spp. in step (b) to further correct the CLE9 gene;

[0038] (d) a step of re-differentiating a blackcurrant plant from a blackcurrant plant cell in which the CLV3 and CLE9 genes of step (c) have been corrected;

[0039] (e) a step of obtaining a heterozygous mutant by crossing a plant in which the CLV3 gene of step (b) has been corrected with a plant in which the CLV3 and CLE9 genes of step (d) have been corrected; and

[0040] (f) a step of self-pollination of the above-mentioned backcrossed plant to obtain various genetic combinations of alleles from the homologous genes; but is not limited thereto.

[0041] In addition, in the method for producing a polyploid plant with controlled quantitative traits related to plant growth and yield according to one embodiment of the present invention, the target base sequence of the S gene may be composed of the base sequence of SEQ ID NO: 5 to SEQ ID NO: 8, and the target base sequence of the SP gene may be composed of the base sequence of SEQ ID NO: 9 to SEQ ID NO: 12, but is not limited thereto. That is, the positions in the S gene targeted by the guide RNA specific to the target base sequence according to the present invention are a total of four, which are base sequences of SEQ ID NO: 5 to SEQ ID NO: 8, and the S gene can be corrected by at least one selected from the four guide RNAs, and the positions in the SP gene targeted by the guide RNA specific to the target base sequence according to the present invention are a total of four, which are base sequences of SEQ ID NO: 9 to SEQ ID NO: 12, and the SP gene can be corrected by at least one selected from the four guide RNAs, but is not limited thereto. In addition, the target base sequence of the CLV3 gene may be composed of the base sequence of SEQ ID NO: 13 to SEQ ID NO: 16, and the target base sequence of the CLE9 gene may be composed of the base sequence of SEQ ID NO: 17 to SEQ ID NO: 20, but is not limited thereto. That is, the positions in the CLV3 gene targeted by the guide RNA specific to the target base sequence according to the present invention are a total of four, and are base sequences of SEQ ID NO: 13 to SEQ ID NO: 16, and the positions in the CLE9 gene are a total of four, and are base sequences of SEQ ID NO: 17 to SEQ ID NO: 20, and the CLV3 gene or the CLE9 gene may be corrected by at least one selected from each of the four guide RNAs, but is not limited thereto.

[0042] In the method for producing a polyploid plant having controlled quantitative traits related to plant growth and yield according to the present invention, the quantitative traits related to plant growth and yield may be the number of flower stalks, the number of petals, the number of ovary sacs, stem growth, fruit yield, or fruit weight, and the solanum plant produced by the method according to the present invention may have increased number of flower stalks, the number of petals, the number of ovary sacs, stem growth, fruit yield, or fruit weight compared to a wild-type solanum plant, but is not limited thereto.

[0043] The term "genome / gene editing" refers to a technology that can introduce targeted mutations into the genome sequence of plant and animal cells, including human cells, by knocking out or knocking in a specific gene through deletion, insertion, substitution, etc. of one or more nucleic acid molecules by DNA cleavage, or by introducing mutations into non-coding DNA sequences that do not produce proteins. For the purposes of the present invention, the genome editing may be, in particular, introducing mutations into plants using an endonuclease, such as a Cas9 protein, and a guide RNA.

[0044] The term "target gene" refers to a portion of DNA within the genome of a plant to be corrected through the present invention. In principle, the type of gene is not limited and may include both coding and non-coding regions. Those skilled in the art can select the target gene based on the desired mutation for the genome-edited plant to be produced, depending on the purpose.

[0045] The term "guide RNA" refers to an RNA specific for DNA encoding a base sequence of a target gene, and refers to a ribonucleic acid that serves to guide an endonuclease protein to the target DNA base sequence by complementarily binding to all or part of the target DNA base sequence. The guide RNA may be a dual RNA comprising two RNAs, namely, crRNA (CRISPR RNA) and tracrRNA (trans-activating crRNA) as components; or a single-stranded guide RNA (sgRNA) comprising a first region comprising a sequence that is all or partly complementary to a base sequence in the target DNA and a second region comprising a sequence that interacts with an RNA-guided nuclease. However, if the RNA-guided nuclease is in a form that can be active at the target base sequence, it may be included in the scope of the present invention without limitation. The guide RNA according to the present invention may preferably be in the form of a single-stranded guide RNA, but is not limited thereto, and may be appropriately selected according to techniques known in the art, such as the type of endonuclease used or the microorganism from which the endonuclease is derived.

[0046] Additionally, the guide RNA may be, but is not limited to, one transcribed from a plasmid template or one transcribed in vitro (e.g., an oligonucleotide duplex).

[0047] In addition, in the manufacturing method according to one embodiment of the present invention, the introduction of the guide RNA and endonuclease protein of step (a) into the solanum plant cell may be performed using, but is not limited to, a recombinant vector including a DNA encoding a guide RNA specific to the target base sequence of the solanum-derived S gene, SP gene, CLV3 gene or CLE9 gene and a nucleic acid sequence encoding an endonuclease protein; or a complex of a guide RNA specific to the target base sequence of the solanum-derived S gene, SP gene, CLV3 gene or CLE9 gene and an endonuclease protein.

[0048] In a manufacturing method according to one embodiment of the present invention, the endonuclease protein may be at least one selected from the group consisting of Cas9 (CRISPR associated protein 9), Cpf1 (CRISPR from Prevotella and Francisella 1), TALEN (Transcription activator-like effector nuclease), ZFN (Zinc Finger Nuclease) or a functional analog thereof, and may preferably be a Cas9 protein, but is not limited thereto.

[0049] Cas9 protein or genetic information can be obtained from a known database such as GenBank of the National Center for Biotechnology Information (NCBI). For example, the Cas9 protein may be one or more selected from the group consisting of, but is not limited to, a Cas9 protein derived from Streptococcus pyogenes, a Cas9 protein derived from Campylobacter jejuni, a Cas9 protein derived from Streptococcus thermophilus or Streptococcus aureus, a Cas9 protein derived from Neisseria meningitidis, a Cas9 protein derived from Pasteurella multocida, a Cas9 protein derived from Francisella novicida, etc.

[0050] The Cas9 protein is an RNA-guided DNA endonuclease enzyme that induces double-stranded DNA breaks. For the Cas9 protein to precisely bind to a target DNA sequence and cleave the DNA strand, a short three-base sequence known as a Protospacer Adjacent Motif (PAM) must be present next to the target DNA sequence. The Cas9 protein cleaves between the third and fourth base pairs from the PAM sequence (NGG).

[0051] In a manufacturing method according to one embodiment of the present invention, the guide RNA and the endonuclease protein form a ribonucleoprotein complex and operate as an RNA-Guided Engineered Nuclease (RGEN).

[0052] The CRISPR / Cas9 system used in the present invention is a gene correction method using the NHEJ (non-homologous end joining) mechanism that introduces a double-strand break at a specific location of a specific gene to be corrected, thereby inducing an insertion-deletion (InDel) mutation due to incomplete repair induced during the DNA repair process.

[0053] In the manufacturing method according to the present invention, the method for transducing the complex of the guide RNA and the endonuclease protein into plant cells can be suitably selected from the calcium / polyethylene glycol method for protoplasts, electroporation of protoplasts, microinjection into plant elements, particle bombardment of various plant elements (DNA or RNA-coated), infection by virus (incomplete) in gene transfer mediated by Agrobacterium tumefaciens, etc.

[0054] Furthermore, introducing the recombinant vector into a plant cell refers to a transformation method. Transformation of plant species is now commonplace, including both dicotyledonous and monocotyledonous plants. In principle, any transformation method can be used to introduce the recombinant vector according to the present invention into a suitable progenitor cell.

[0055] The "plant cell" used in the above trait correction may be any plant cell. The plant cell may be a cultured cell, cultured tissue, cultured organ, or a whole plant. The "plant tissue" includes differentiated or undifferentiated plant tissues, such as, but not limited to, roots, stems, leaves, pollen, seeds, and cancer tissues, and various types of cells used in culture, such as single cells, protoplasts, shoots, and callus tissues. The plant tissue may be in planta or in an organ culture, tissue culture, or cell culture state. Preferred plant cells according to the present invention are cotyledon cultures.

[0056] In the manufacturing method of the present invention, any method known in the art can be used to regenerate genome-edited plants from genome-edited plant cells. Genome-edited plant cells must be regenerated into whole plants. Techniques for regenerating mature plants from callus or protoplast cultures are well known in the art for numerous and diverse species.

[0057] The present invention also provides a plant of Kamajung with improved quantitative traits produced by the above production method and seeds of the plant.

[0058] The solanum plant with improved quantitative traits according to the present invention is a solanum plant in which the S gene, SP gene or CLV3 / CLE9 gene is corrected using the CRISPR / Cas9 system, and the solanum-derived S gene, SP gene or CLV3 / CLE9 gene is knocked out, and quantitative traits related to plant growth and yield are improved compared to a solanum plant in which the genome is not corrected.

[0059] The present invention also provides a composition for genome editing for increasing quantitative traits related to plant growth and yield of a Solanum nigrum plant, comprising as an active ingredient a recombinant vector comprising DNA encoding a guide RNA specific to the target base sequence of homoeologous genes derived from Solanum nigrum and a nucleic acid sequence encoding an endonuclease protein; or a complex of a guide RNA specific to the target base sequence of homoeologous genes derived from Solanum nigrum and an endonuclease protein.

[0060] In the composition for genome correction according to the present invention, a recombinant vector including a DNA encoding a guide RNA specific to a target base sequence of a Solanum nigrum-derived S (Compound Inflorescence) gene, SP (Self pruning) gene, CLV3 (CLAVATA3) gene or CLE9 (EMBRYO-SURROUNDING REGION-RELATED 9) gene and a nucleic acid sequence encoding an endonuclease protein may be a composition for genome correction for increasing quantitative traits of a Solanum nigrum plant, which contains as an active ingredient, a complex of a guide RNA specific to a target base sequence of a Solanum nigrum-derived S (Compound Inflorescence) gene, SP (Self pruning) gene, CLV3 (CLAVATA3) gene or CLE9 gene and an endonuclease protein, but is not limited thereto.

[0061] In the composition for genome correction of the present invention, the target base sequence of the S gene may be comprised of the base sequence of SEQ ID NO: 5 to SEQ ID NO: 8, the target base sequence of the SP gene may be comprised of the base sequence of SEQ ID NO: 9 to SEQ ID NO: 12, the target base sequence of the CLV3 gene may be comprised of the base sequence of SEQ ID NO: 13 to SEQ ID NO: 16, and the target base sequence of the CLE9 gene may be comprised of the base sequence of SEQ ID NO: 17 to SEQ ID NO: 20, but is not limited thereto.

[0062] The composition for genome correction of the present invention comprises a recombinant vector including a DNA encoding a guide RNA specific to a target base sequence of an S gene, an SP gene, a CLV3 gene or a CLE9 gene and a nucleic acid sequence encoding an endonuclease protein, or a complex of a guide RNA specific to a target base sequence of an S gene, an SP gene, a CLV3 gene or a CLE9 gene and an endonuclease protein, so that when the composition is treated on a plant cell of a black solanum plant, the complex of the guide RNA and the endonuclease protein acts as an RNA genetic scissors to correct the target gene.

[0063] The composition for genome correction of the present invention preferably includes a guide RNA specific to a target base sequence of an S gene consisting of a base sequence of SEQ ID NO: 5 to SEQ ID NO: 8, a guide RNA specific to a target base sequence of an SP gene consisting of a base sequence of SEQ ID NO: 9 to SEQ ID NO: 12, a guide RNA specific to a target base sequence of a CLV3 gene consisting of a base sequence of SEQ ID NO: 13 to SEQ ID NO: 16, or a guide RNA specific to a target base sequence of a CLE9 gene consisting of a base sequence of SEQ ID NO: 17 to SEQ ID NO: 20, so that the S gene, SP gene, CLV3 gene, or CLE9 gene can be knocked out, and quantitative traits of a plant can be improved through the knock-out of the S gene, SP gene, CLV3 gene, or CLE9 gene.

[0064]

[0065] Hereinafter, the present invention will be described in detail by way of examples. However, the following examples are merely illustrative of the present invention, and the content of the present invention is not limited to the following examples.

[0066]

[0067] Materials and Methods

[0068] 1. Plant materials

[0069] In the present invention, the diploid plant Solanum americanum (registration number SP2273) and the hexaploid plant Solanum nigrum (registration number NIBRGR0000189638) were used. All plants were grown under natural long-term conditions (14-16 hours of light / 26-28℃, 8-10 hours of darkness / 18-20℃, 40-60% relative humidity) in a greenhouse with artificial light supplied by a 200 W halogen lamp.

[0070]

[0071] 2. Construction of vectors for transformation and transformation of Kamajung

[0072] To perform gene correction targeting the S (Compound Inflorescence) gene, SP (Self Pruning) gene, CLV3 (CLAVATA3) gene, or CLE9 (EMBRYO-SURROUNDING REGION-RELATED 9) gene, four gRNAs for each gene were designed using the CRISPRdirect web tool and cloned into the pAGM4723 binary vector using Golden Gate cloning. Then, cotyledon cultures obtained from 10-day-old germinated seedlings were co-cultured with Agrobacterium tumefaciens strain EHA105 containing the pAGM4723 vector for 2 days, and then cultured in shoot initiation medium (2 mg / L zeatin, 0.2 mg / L IAA, 100 mg / L kanamycin, 200 mg / L cefotaxime) for 10 days. Afterwards, the plants were cultured for 2 weeks in a shoot differentiation medium (1 mg / L zeatin and 0.1 mg / L IAA), and only those that developed roots were selected as mutants by culturing in a rooting medium containing 100 mg / L kanamycin. Afterwards, the mutants were backcrossed with wild-type solanum plants or crossed with the mother solanum plants to produce heterozygous mutants. Specifically, solanum plants in which the solanum-derived S gene and SP gene were corrected were backcrossed with wild-type solanum plants (Fig. 1), and solanum plants in which the solanum-derived CLV3 gene was corrected were crossed with solanum plants in which the CLE9 gene was additionally corrected in the solanum plant in which the CLV3 gene was corrected (Fig. 8A).

[0073]

[0074] 3. Confirmation of phenotypic and quantitative traits

[0075] To determine the fruit yield of the s mutant and sp mutant, at least 6–7 plants were grown in a greenhouse after pruning only the main stem and the first auxiliary stem for each plant in the summer of 2021 and 2022, or grown in an Ochang field without pruning. The fruit yield was calculated by multiplying the total number of inflorescences by the average inflorescence weight of each plant. The average fruit weight of the cle3 / cle9 mutant was calculated by counting the number of sepals and leaflets of the first floral organ of each plant and dividing the inflorescence weight of five inflorescences by the number of fruits.

[0076]

[0077] Example 1. Gene correction targeting the S (Compound Inflorescence) gene

[0078] Gene correction was performed using the gRNAs shown in Table 1 below targeting the exon region of the S gene of the diploid plant S. americanum, and heterozygous s / + and mutant s were obtained. In addition, the solanum mutants obtained by performing gene correction using the gRNAs shown in Table 1 below targeting the exon region of the S gene of the hexaploid plant S. nigrum were crossed with wild-type solanum (Fig. 1), and heterozygous mutants (s1 / +s2s3, s1s2 / +s3, s1s2s3 / +), double mutants (s1s2, s1s3, s2s3), and triple mutants (s1s2s3) were obtained (Fig. 2).

[0079] S Gene-targeting gRNA information Name Direction Sequence (5'-3') gRNA1 antisense GGTTTTGATTTAAACATGCT: SEQ ID NO. 5 gRNA2 sense GTCCGGAGCCAAAGCCAAGA: SEQ ID NO. 6 gRNA3 antisense GGTTGAACGGTGAAAAAGAA: SEQ ID NO. 7 gRNA4 sense GTTGCTTTTGAGGTTGGGAT: SEQ ID NO. 8

[0080] 1-1. Phenotype confirmation

[0081] The S gene mutant of the diploid plant S. americanum was confirmed to exhibit a vegetative inflorescence phenotype and to exhibit excessive proliferation, but to fail to develop normal flowers, and the double mutant (s1s3), heterozygous mutant (s1s2 / +s3), and triple mutant (s1s2s3) of the hexaploid plant S. nigrum were confirmed to have increased inflorescence numbers compared to the wild type and to develop normal flowers and fruits that produce viable seeds (Fig. 3).

[0082]

[0083] 1-2. Quantitative trait verification

[0084] The fruit yields of S gene mutants of the diploid plant S. americanum and the hexaploid plant S. nigrum were measured, respectively.

[0085] As a result, under greenhouse conditions with sufficient nutrients, the fruit yield of double mutants (s1s2, s1s3, s2s3), heterozygous mutants (s1 / +s2s3, s1s2 / +s3, s1s2s3 / +), and triple mutant (s1s2s3) of S. nigrum was confirmed to increase compared to the wild type both in the greenhouse and in the field. In particular, the fruit yield of s1s2 / +s3 and s1 / +s2s3 heterozygous mutants was confirmed to increase by approximately 2 times compared to the wild type, confirming that s1s2 / +s3 and s1 / +s2s3 heterozygous mutants are the most optimized genotypes for fruit yield. The triple mutant (s1s2s3) had a very large number of flowers, but a low fruit setting rate, confirming that the number of fruits that could be harvested was small (Fig. 4).

[0086] The above phenotypic and yield changes were not successfully achieved in the diploid plant S. americanum, due to the presence of only one orthologous gene for the S gene for this trait. In conclusion, we demonstrated that editing the S homoeolog and screening genotypes with varying S gene copy numbers can precisely generate inbred strains of S. nigrum optimized for yield.

[0087]

[0088] Example 2. Gene correction targeting the SP (Self-pruning) gene

[0089] Gene correction was performed using the gRNAs shown in Table 2 below targeting the exon region of the SP gene of the diploid plant S. americanum, and heterozygous sp / + and mutant sp were obtained. In addition, the solanum mutants obtained by performing gene correction using the gRNAs shown in Table 2 below targeting the exon region of the SP gene of the hexaploid plant S. nigrum were crossed with wild-type solanum (Fig. 1), and heterozygous mutants (sp1 / +sp2sp3, sp1sp2 / +sp3, sp1sp2sp3 / +), double mutants (sp1sp2, sp1sp3, sp2sp3), and triple mutants (sp1sp2sp3) were obtained (Fig. 5).

[0090] gRNA information targeting the SP gene Name Direction Sequence (5'-3') gRNA1 antisense ATAACAGACATCTTAACACTTGG: SEQ ID NO: 9 gRNA2 sense AAACCTAGGGTTGAAGTTCATGG: SEQ ID NO: 10 gRNA3 sense CCTAGGGTTGAAGTTCATGGTGG: SEQ ID NO: 11 gRNA4 sense GTCCTAGTGATCCATATCTCAGG: SEQ ID NO: 12

[0091] 2-1. Phenotype confirmation

[0092] The heterozygous mutant sp / + of the SP gene of the diploid plant S. americanum showed a phenotype showing an indeterminate (ID) type shoot structure similar to the wild type, confirming the functional conservation of the SP gene, and the mutant sp was confirmed to show a determinate (D) type shoot structure. On the other hand, the double mutant (sp1sp2) and the heterozygous mutant (sp1sp2sp3 / +) of the hexaploid plant S. nigrum showed a semi-indeterminate (SID) type shoot structure and increased inflorescence number, and the triple mutant (sp1sp2sp3) showed a D type shoot structure, shortened internode length, and suppressed axillary shoot elongation (Fig. 6).

[0093]

[0094] 2-2. Quantitative trait verification

[0095] Fruit yields of SP gene mutants of the diploid plant S. americanum and the hexaploid plant S. nigrum were measured, respectively.

[0096] As a result, it was confirmed that the fruit yield of sp / + heterozygous mutants and sp mutants of S. americanum was either not significantly different from or decreased compared to the wild type. On the other hand, the fruit yield of double mutants (sp1sp2, sp1sp3, sp2sp3) and heterozygous mutants (sp1 / +sp2sp3, sp1sp2 / +sp3) of S. nigrum was confirmed to increase compared to the wild type. In particular, the fruit yield of sp1 / +sp2sp3 and sp1sp2 / +sp3 heterozygous mutants was confirmed to increase by approximately 2 times compared to the wild type, confirming that sp1 / +sp2sp3 and sp1sp2 / +sp3 heterozygous mutants are the most optimized genotypes for fruit yield. The triple mutant (sp1sp2sp3) exhibited a dense shoot structure and increased fruit size, but the fruit yield was confirmed to decrease significantly due to early growth termination (Fig. 7).

[0097]

[0098] Example 3. Gene correction targeting the CLV3 (CLAVATA3) and CLE9 (EMBRYO-SURROUNDING REGION-RELATED 9) genes.

[0099] Gene correction was performed using the gRNAs shown in Table 3 below targeting the exonic regions of four homoeologs of CLV3 of the hexaploid plant S. nigrum, thereby obtaining a clv3 mutant (clv3Q). Afterwards, additional genetic correction was performed using the gRNAs in Table 3 below targeting the exon regions of the three homologous genes of cle9 of the clv3Q mutant, and the obtained clv3 / cle9 mutant (clv3Qcle9T) was crossed with the above clv3Q mutant to obtain six-stage mutants (clv3Qcle9h1cle9h2, clv3Qcle9h1cle9h3, clv3Qcle9h2cle9h3) and higher-order mutants (clv3Qcle9h1 / +cle9h2cle9h3, clv3Qcle9h1cle9h2 / +cle9h3, clv3Qcle9h1cle9h2cle9h3 / +) (Fig. 8).

[0100] CLV3 and CLE9 gRNA information targeting the gene Name Direction Sequence (5'-3') CLV3-gRNA1antisenseGATCAAGAGAGTGAAATGTT: SEQ ID NO: 13 CLV3-gRNA2senseGCTTAAAATGCATTTCACTAA: SEQ ID NO: 14 CLV3-gRNA3senseTGTGACACTCCTAAACAGAA: SEQ ID NO: 15 CLV3-gRNA4senseGAGCTAAGAGGAGTTCCAGC: SEQ ID NO: 16 CLE9-gRNA1antisenseTTGTGAAGAGTAAGATGCAG: SEQ ID NO: 17 CLE9-gRNA2senseACAATGCAAGCACAATCCTC: SEQ ID NO: 18 CLE9-gRNA3antisenseGCTTCTTGTTTTTCCATTTA: SEQ ID NO: 19 CLE9-gRNA4antisenseTGCAAAGGGTCTGGACTCAT: SEQ ID NO: 20

[0101] 3-1. Confirmation of phenotypic and quantitative traits

[0102] The clv3Qcle9T mutant developed fasciculated flowers with a significantly increased number of petals, but failed to develop normal fruits from the primary inflorescence. The six-dimensional mutants with only one functional CLE9H (clv3Qcle9h1cle9h2, clv3Qcle9h1cle9h3, clv3Qcle9h2cle9h3) showed a significant increase in the number of petals and ovary sacs compared to the wild type, and the higher-order mutants (clv3Qcle9h1 / +cle9h2cle9h3, clv3Qcle9h1cle9h2 / +cle9h3, clv3Qcle9h1cle9h2cle9h3 / +) showed a significant increase in the number of petals and ovary sacs compared to the wild type, which led to the development of more fasciculated flowers and fruits, resulting in increased fruit weight (Fig. 9, Fig. 10).

[0103] Based on the above results, it was found that the weight of the blackcurrant fruit could be optimized by regulating the CLV3 and CLE9 genes.

[0104] Through the above results, it was found that the activity level of the homologous gene related to quantitative traits can be controlled through CRISPR gene editing in hexaploid solanum plants, and by producing heterozygotes through crossing the mutants created through gene editing with the parent plant, it was found that various intermediate genotypes can be constructed, and among them, genotypes with optimized quantitative traits can be selected and used usefully for trait improvement and variety improvement.

Claims

1. A method for producing a polyploid plant with controlled quantitative traits related to plant growth and yield, comprising the step of obtaining various genetic combinations of alleles from homoeologous genes of a heterozygous mutant (F1) obtained by backcrossing a polyploid plant in which homoeologous genes have been edited with a wild type and F2 obtained by self-pollination of the F1.

2. In paragraph 1, (a) A step of correcting the genome by introducing guide RNA and endonuclease protein specific to the target base sequence of homoeologous genes into plant cells of a polyploid plant; (b) a step of regenerating a polyploid plant from a plant cell of the polyploid plant in which the genome has been corrected; (c) a step of backcrossing the redifferentiated genome-corrected polyploid plant with a wild type to obtain a heterozygous mutant of the homologous genes; and (d) A method for producing a polyploid plant with controlled quantitative traits related to plant growth and yield, comprising the step of self-pollination of the backcrossed plant to obtain various genetic combinations of alleles from the homologous genes.

3. A method for producing a polyploid plant with controlled quantitative traits related to plant growth and yield, characterized in that the syngeneic gene in the second paragraph is an S (Compound Inflorescence) gene or SP (Self pruning) gene derived from Solanum nigrum.

4. A method for producing a polyploid plant with controlled quantitative traits related to plant growth and yield, characterized in that, in the second paragraph, when the synthesizing gene of step (a) is the S (Compound Inflorescence) gene, the number of flower stalks and fruit yield of the plant are controlled, and when the synthesizing gene of step (a) is the SP (Self pruning) gene, the stem growth and fruit yield of the plant are controlled.

5. A method for producing a polyploid plant with controlled quantitative traits related to plant growth and yield, comprising the step of obtaining a heterozygous mutant by crossing a polyploid plant with edited homoeologous genes with another polyploid plant with edited homoeologous genes.

6. A method for producing a polyploid plant with controlled quantitative traits related to plant growth and yield, characterized in that the syngeneic gene in paragraph 5 is a CLV3 (CLAVATA3) gene or a CLE9 (EMBRYO-SURROUNDING REGION-RELATED 9) gene derived from Solanum nigrum.

7. A method for producing a polyploid plant with controlled quantitative traits related to plant growth and yield, characterized in that, in the fifth paragraph, when the syngeneic gene is the CLV3 (CLAVATA3) gene or the CLE9 (EMBRYO-SURROUNDING REGION-RELATED 9) gene, the number of petals and the number of ovary sacs of the plant are controlled.

8. In paragraph 6, (a) A step of correcting the CLV3 gene by introducing a guide RNA and an endonuclease protein specific to the target base sequence of the CLV3 (CLAVATA3) gene derived from Solanum nigrum into a Solanum nigrum plant cell; (b) a step of re-differentiating a black sorrel plant from a black sorrel plant cell in which the CLV3 gene of step (a) has been corrected; (c) a step of introducing a guide RNA and an endonuclease protein specific to the target base sequence of the CLE9 (EMBRYO-SURROUNDING REGION-RELATED 9) gene derived from the solanum spp. into the plant cell of the redifferentiated CLV3 gene corrected solanum spp. in step (b) to further correct the CLE9 gene; (d) a step of re-differentiating a blackcurrant plant from a blackcurrant plant cell in which the CLV3 and CLE9 genes of step (c) have been corrected; (e) a step of obtaining a heterozygous mutant by crossing a plant in which the CLV3 gene of step (b) has been corrected with a plant in which the CLV3 and CLE9 genes of step (d) have been corrected; and (f) A method for producing a polyploid plant with controlled quantitative traits related to plant growth and yield, comprising the step of self-pollination of the above-mentioned backcrossed plant to obtain various genetic combinations of alleles from the homologous genes.

9. A method for producing a polyploid plant with controlled quantitative traits related to plant growth and yield, characterized in that the quantitative traits related to plant growth and yield in paragraph 1 or paragraph 5 are the number of flower stalks, the number of petals, the number of ovary sacs, stem growth, fruit yield, or fruit weight.

10. A method for producing a polyploid plant with controlled quantitative traits related to plant growth and yield, characterized in that the target base sequence of the S gene in the third paragraph consists of the base sequences of SEQ ID NO: 5 to SEQ ID NO:

8.

11. A method for producing a polyploid plant with controlled quantitative traits related to plant growth and yield, characterized in that the target base sequence of the SP gene in the third paragraph consists of the base sequences of SEQ ID NO: 9 to SEQ ID NO:

12.

12. A method for producing a polyploid plant with controlled quantitative traits related to plant growth and yield, characterized in that, in paragraph 6, the target base sequence of the CLV3 gene is comprised of the base sequences of SEQ ID NO: 13 to SEQ ID NO: 16, and the target base sequence of the CLE9 gene is comprised of the base sequences of SEQ ID NO: 17 to SEQ ID NO:

20.

13. A method for producing a polyploid plant with controlled quantitative traits related to plant growth and yield, characterized in that the introduction of the guide RNA and endonuclease protein of step (a) or (c) into the solanum plant cell uses a recombinant vector comprising a DNA encoding a guide RNA specific to the target base sequence of the solanum-derived S gene, SP gene, CLV3 gene or CLE9 gene and a nucleic acid sequence encoding an endonuclease protein; or a complex of a guide RNA specific to the target base sequence of the solanum-derived S gene, SP gene, CLV3 gene or CLE9 gene and an endonuclease protein.

14. A polyploid plant having controlled quantitative traits related to plant growth and yield, produced by the method of paragraph 1 or paragraph 5.

15. Seeds of plants according to Article 14.

16. A composition for genome editing for increasing quantitative traits related to plant growth and yield of a Solanum nigrum plant, comprising as an active ingredient a recombinant vector comprising DNA encoding a guide RNA specific for the target base sequence of homoeologous genes derived from Solanum nigrum and a nucleic acid sequence encoding an endonuclease protein; or a complex of a guide RNA specific for the target base sequence of homoeologous genes derived from Solanum nigrum and an endonuclease protein.

17. A composition for genome editing for increasing quantitative traits related to plant growth and yield of a Solanum nigrum plant, comprising, as an active ingredient, a recombinant vector comprising DNA encoding a guide RNA specific to the target base sequence of the Solanum nigrum-derived S (Compound Inflorescence) gene, the Solanum nigrum-derived SP (Self pruning) gene, the Solanum nigrum-derived CLAVATA3 (CLV3) gene, or the Solanum nigrum-derived CLE9 (EMBRYO-SURROUNDING REGION-RELATED 9) gene, and a nucleic acid sequence encoding an endonuclease protein; or a complex of a guide RNA specific to the target base sequence of the Solanum nigrum-derived S gene, the Solanum nigrum-derived SP gene, the Solanum nigrum-derived CLV3 gene, or the Solanum nigrum-derived CLE9 gene, and an endonuclease protein.

18. A composition for genome correction for increasing quantitative traits related to plant growth and yield of a crow plant, characterized in that, in paragraph 17, the target base sequence of the S gene consists of base sequences of SEQ ID NO: 5 to SEQ ID NO: 8, the target base sequence of the SP gene consists of base sequences of SEQ ID NO: 9 to SEQ ID NO: 12, the target base sequence of the CLV3 gene consists of base sequences of SEQ ID NO: 13 to SEQ ID NO: 16, and the target base sequence of the CLE9 gene consists of base sequences of SEQ ID NO: 17 to SEQ ID NO: 20.

Images