Method for enhancing redifferentiation efficiency of hemp using immature embryo

Abstract

The present invention relates to a method for enhancing the redifferentiation efficiency of hemp using an immature embryo and, more specifically, to: a recombinant vector for enhancing the redifferentiation efficiency of hemp, the recombinant vector comprising a growth regulating factor (GRF)-interacting factor 1 (GIF1) chimeric protein or PLETHORA 5 (PLT5) protein expression cassette; a method for enhancing the redifferentiation efficiency of hemp using the recombinant vector; and a method for producing a hemp transgenic plant having enhanced redifferentiation efficiency.

Description

Method for improving redifferentiation efficiency using immature hemp embryos

[0001] The present invention relates to a method for increasing the efficiency of regeneration using immature embryos of cannabis, and more specifically, to a method for increasing the efficiency when regenerating cannabis plants in vitro or developing transformed plants using Agrobacterium.

[0002]

[0003] This invention was carried out with the support of the Research Industry Promotion Project of the Korea Institute for Science and Technology Promotion (Project No. 2022-Order Research Startup-Public-02-SB1-01).

[0004] In modern life sciences, the development of transformation and tissue culture technologies for hemp or cannabis (Cannabis sativa) has emerged as a key research topic. Hemp tissue culture involves culturing tissue sections or cells under appropriate conditions to produce large quantities of hemp plants. This technology is crucial for maintaining consistent quality in hemp plants used for hybrid breeding. Furthermore, transformation technologies are essential for modifying specific traits in hemp plants or enhancing desired growth and metabolic pathways. In this process, hemp regeneration plays a crucial role in tissue culture and transformation. However, an efficient and reliable method for transforming hemp plants remains unknown.

[0005] In the present invention, a method and technique for increasing regeneration efficiency in hemp were studied to confirm whether regeneration efficiency is increased in tissue culture and transformation of hemp.

[0006] Meanwhile, International Patent Publication No. WO2022 / 115850 discloses 'TISSUE CULTURE OF AN AUTOFLOWER CANNABIS PLANT' regarding the composition of a medium for micro-mass propagation of auto-flowered cannabis plants, and US Patent Publication No. 2023-0044740 discloses 'IN VITRO DIRECT REGENERATION OF POLYPLOID CANNABIS PLANTS'. However, there is no description of the timing of obtaining immature cannabis embryos to increase tissue culture and regeneration efficiency, the conditions for co-cultivation with Agrobacterium for transformation, and the 'method for enhancing regeneration efficiency using immature cannabis embryos' of the present invention using a GRF3-GIF1 chimeric protein coding sequence derived from cannabis having miR396 resistance.

[0007] The present invention was derived from the above-mentioned needs, and the inventors sought to provide a method for increasing the efficiency of regeneration from cannabis plant explants in order to develop new cannabis varieties using transformation. To this end, the inventors tested the conditions of immature embryos for obtaining cannabis plant explants and the temperature conditions during co-cultivation with Agrobacterium, thereby discovering a method for increasing the efficiency of regeneration from cannabis tissue explants and obtaining cannabis regenerated plants with a high frequency, thereby completing the present invention.

[0008] To solve the above problem, the present invention provides a recombinant vector for improving the regeneration efficiency of cannabis, comprising a GRF3 (Growth-regulating factor 3)-GIF1 (GRF-interacting factor 1) chimeric protein or a PLT5 (PLETHORA 5) protein expression cassette.

[0009] In addition, the present invention provides a method for improving the regeneration efficiency of cannabis, comprising a step of transforming cannabis plant cells with the recombinant vector.

[0010] In addition, the present invention provides a method for producing a transformed cannabis plant with improved regeneration efficiency, comprising the steps of transforming a cannabis plant cell with the recombinant vector; and regenerating cannabis from the transformed cannabis plant cell.

[0011] In addition, the present invention provides a composition for enhancing the regeneration efficiency of cannabis, which contains as an active ingredient a recombinant vector comprising a sequence encoding a GRF3-GIF1 chimeric protein consisting of an amino acid sequence of SEQ ID NO: 2 or a sequence encoding a PLT5 protein consisting of an amino acid sequence of SEQ ID NO: 11.

[0012] The present invention provides various methods and systems aimed at increasing regeneration efficiency, not only in hemp tissue culture but also in transformation techniques. The methods of the present invention will help maintain hemp hybrid varieties with consistent trait characteristics. Furthermore, by improving regeneration efficiency in hemp transformation methods, which have not yet been stably established, the present invention can be usefully utilized in various hemp-related industries and research fields, including medicine, agriculture, and life sciences research.

[0013] Figure 1 is a schematic diagram showing the process of obtaining immature embryos from cannabis plants.

[0014] Figure 2 is a photograph showing immature embryos according to the days after pollination after the female cannabis flower was pollinated by the male flower and embryo rescued.

[0015] Figure 3 shows photographs of experimental specimens 10 days after transformation with RUBY using immature embryos of 13, 14, 17, and 21 DAP.

[0016] Figure 4 is a schematic diagram showing a method for cutting out the apical meristem, including cotyledons, from an embryo rescued immature embryo using a surgical knife.

[0017] Figure 5A is a photograph showing the part to be cut from an immature embryo with a red dotted line, Figure 5B is a photograph showing the hypocotyl section to be used in the experiment from an immature embryo with a white circle, Figure 5C is a photograph showing the redifferentiation of a new shoot 10 days after the hypocotyl section of an immature embryo was obtained, and Figure 5D is a photograph showing the redifferentiation of a new shoot 14 days after the hypocotyl section of an immature embryo was obtained.

[0018] Figure 6 shows the results of comparing the regeneration efficiency of hemp hypocotyl explants according to the period of culturing immature embryos (AR; after rescue) in hemp varieties Afghani kush and Chung-sam, respectively.

[0019] Figure 7 shows the results of comparing the regeneration efficiency of hemp hypocotyls according to temperature conditions during co-cultivation of hemp hypocotyls and Agrobacterium.

[0020] Figure 8 shows the results comparing the regeneration efficiency of cannabis hypocotyls when a cannabis-derived GRF3-GIF1 chimeric protein coding sequence with miR396 resistance was introduced.

[0021] FIG. 9A is a map of the pLSL.R.Ly-hCas9-GFP recombinant vector used in the present invention, FIG. 9B is a map of the pLSL.R.Ly-hCas9-GRF3-GIF1 recombinant vector used in the present invention, and FIG. 9C is a map of the pLSL.R.Ly-hCas9-PLT5 recombinant vector used in the present invention.

[0022] Figure 10 shows the results comparing the regeneration efficiency of cannabis hypocotyls when a cannabis-derived PLT5 protein coding sequence was introduced.

[0023] FIG. 11A is a photograph immediately after transformation (3 DAI) of a hypocotyl segment obtained from an immature embryo of the cannabis variety Afghani kush obtained at 21 DAP according to Example 2 of the present invention according to the method of Example 4 with Agrobacterium containing the recombinant vector pLSL.R.Ly-hCas9-GFP according to the method of Example 5, and FIG. 11B is a photograph 17 days after transformation (17 DAI).

[0024] In order to achieve the purpose of the present invention, the present invention provides a recombinant vector for improving the regeneration efficiency of cannabis, comprising a GRF3 (Growth-regulating factor 3)-GIF1 (GRF-interacting factor 1) chimeric protein or a PLT5 (PLETHORA 5) protein expression cassette.

[0025] The term "recombinant" as used herein refers to a cell that replicates a heterologous nucleic acid, expresses said nucleic acid, or expresses a protein encoded by a peptide, a heterologous peptide, or a heterologous nucleic acid. A recombinant cell may express a gene or gene fragment not found in the cell's native form, either in sense or antisense form. Furthermore, a recombinant cell may express a gene found in the cell's native form, but in a modified form that has been reintroduced into the cell by artificial means.

[0026] Additionally, the term "vector" is used to refer to a DNA fragment(s) or nucleic acid molecule that is delivered into a cell. A vector replicates DNA and can reproduce independently in a host cell. The term "vector" is often used interchangeably with "vector."

[0027] The term "expression cassette" as used herein refers to a nucleic acid sequence comprising one or more genes and sequences that regulate their expression, for example, any combination of various cis-acting transcriptional regulatory elements. The expression cassette of the present invention comprises three main elements: i) a promoter; ii) a second polynucleotide, which may be referred to as a "coding polynucleotide" or "coding sequence" (also referred to as a coding gene), operably linked to the promoter and whose transcription is directed by the promoter when the expression cassette is introduced into a cell; and iii) a terminator polynucleotide (also referred to as a transcription terminator) that directs the termination of transcription and is located immediately downstream of the second polynucleotide.

[0028] The above promoters are suitable promoters for transformation, and are preferably, but not limited to, the CaMV 35S promoter, the actin promoter, the ubiquitin promoter, the pEMU promoter, the MAS promoter, the histone promoter, or the Clp promoter. The term "promoter" refers to a region of DNA upstream of a structural gene and refers to a DNA molecule to which RNA polymerase binds to initiate transcription. A "plant promoter" is a promoter capable of initiating transcription in a plant cell. A "constitutive promoter" is a promoter that is active under most environmental conditions and developmental states or cell differentiation, and the use of a constitutive promoter may be preferred in the present invention. Therefore, a constitutive promoter does not limit the possibilities of selection.

[0029] In the recombinant vector of the present invention, conventional terminators can be used, and examples thereof include, but are not limited to, nopaline synthase, rice α-amylase RAmy1 A terminator, the terminator of the Octopine gene of Agrobacterium tumefaciens, the phaseoline terminator, and the rrnB1 / B2 terminator of Escherichia coli. Regarding the necessity of terminators, it is generally known that terminator regions increase the certainty and efficiency of gene transcription in plant cells. Therefore, the use of terminators is highly preferred in the context of the present invention.

[0030] In the recombinant vector of the present invention, the GRF3-GIF1 chimeric protein includes a protein having an amino acid sequence represented by SEQ ID NO: 2 and a functional equivalent of the protein. The term "functional equivalent" refers to a protein having at least 70%, preferably 80%, more preferably 90%, and even more preferably 95% sequence homology with the amino acid sequence represented by SEQ ID NO: 2 as a result of addition, substitution, or deletion of amino acids, and exhibiting substantially the same physiological activity as the protein represented by SEQ ID NO: 2. "Substantially the same physiological activity" refers to an activity that enhances the regeneration efficiency of a cannabis plant.

[0031] Additionally, in the recombinant vector of the present invention, the PLT5 protein includes a protein having an amino acid sequence represented by SEQ ID NO: 11 and a functional equivalent of the protein.

[0032] In addition, the sequence encoding the GRF3-GIF1 chimeric protein according to the present invention may be composed of the base sequence of SEQ ID NO: 1, but is not limited thereto. In addition, homologs of the base sequence are included within the scope of the present invention. Specifically, the coding sequence may include a base sequence having a sequence homology of 70% or more, more preferably 80% or more, even more preferably 90% or more, and most preferably 95% or more with the base sequence of SEQ ID NO: 1. The "% of sequence homology" for a polynucleotide is determined by comparing a comparison region with two optimally aligned sequences, and a portion of the polynucleotide sequence in the comparison region may include additions or deletions (i.e., gaps) compared to a reference sequence for the optimal alignment of the two sequences (which does not include additions or deletions).

[0033] More specifically, the base sequence of SEQ ID NO: 1 according to the present invention is a hemp-derived GRF3 coding sequence having miR396-resistance, a linker sequence, and a hemp-derived GIF1 coding sequence sequentially connected, and a miR396-binding sequence is located within the GRF3 coding sequence. The hemp-derived GRF3 coding sequence having miR396-resistance is located from the 1st to the 1,314th base sequence of SEQ ID NO: 1, the hemp-derived GIF1 coding sequence is located from the 1,327th to the 1,992nd base sequence of SEQ ID NO: 1, and the miR396-binding sequence is located from the 597th to the 609th base sequence of SEQ ID NO: 1.

[0034] In addition, the sequence encoding the PLT5 protein according to the present invention may be comprised of the base sequence of SEQ ID NO: 10, but is not limited thereto. In addition, homologs of the base sequence are included within the scope of the present invention, and the specific details are as described above.

[0035] The recombinant vector for improving the regeneration efficiency of cannabis according to the present invention may additionally include, in addition to the chimeric protein expression cassette, a foreign gene expression cassette or a gene correction cassette, but is not limited thereto.

[0036] The above foreign gene expression cassette may include a gene encoding a target protein to be expressed in cannabis.

[0037] Additionally, the gene correction cassette may include, but is not limited to, an endonuclease expression cassette and a guide RNA expression cassette.

[0038] In the present invention, the term "gene / genome editing" refers to a technology capable of introducing targeted mutations into the genome sequence of animal and plant cells, including human cells, by knocking out or knocking in a specific gene through deletion, insertion, or substitution of one or more nucleic acid molecules by DNA cleavage, or by introducing mutations into non-coding DNA sequences that do not produce proteins. In addition, "gene correction" may be used interchangeably with "gene editing."

[0039] In the present invention, the endonuclease protein may be at least one selected from the group consisting of Cas9, Cpf1 (also known as Cas12a), TALEN (Transcription activator-like effector nuclease), ZFN (Zinc Finger Nuclease) or a functional analog thereof, preferably an RNA-guided nuclease such as Cas9 or Cpf1, and more preferably a Cas9 protein, but is not limited thereto.

[0040] In addition, the Cas9 protein may be at least one selected from the group consisting of a Cas9 protein derived from Streptococcus pyogenes, a Cas9 protein derived from Campylobacter jejuni, a Cas9 protein derived from S. thermophilus or S. aureus, a Cas9 protein derived from Neisseria meningitidis, a Cas9 protein derived from Pasteurella multocida, a Cas9 protein derived from Francisella novicida, and the like, but is not limited thereto. The Cas9 protein or its genetic information can be obtained from a known database such as GenBank of the National Center for Biotechnology Information (NCBI). The above Cas9 genetic information may use a known sequence as is, or may use a sequence optimized for the codon of the target (organism) to be transduced, but is not limited thereto.

[0041] The Cas9 protein is an RNA-guided DNA endonuclease enzyme that induces double-stranded DNA breaks. For the Cas9 protein to precisely bind to its target sequence and cleave the DNA strand, a short three-base sequence known as a Protospacer Adjacent Motif (PAM) must be present next to the target sequence. The Cas9 protein cleaves between the third and fourth base pairs from the PAM sequence (NGG).

[0042] The CRISPR / Cas9 system is a gene correction method using the NHEJ (non-homologous end joining) mechanism that introduces double-strand breaks at specific locations in a specific gene to be corrected, thereby inducing insertion-deletion (InDel) mutations due to incomplete repair induced during the DNA repair process.

[0043] In addition, the term "guide RNA" in the present invention refers to a short single-stranded RNA, which is specific to a target DNA among the base sequences encoding a target gene, and refers to a ribonucleic acid that serves to guide an endonuclease protein to the target DNA base sequence by complementarily binding to all or part of the target DNA base sequence. The guide RNA refers to a dual RNA comprising two RNAs, namely crRNA (CRISPR RNA) and tracrRNA (trans-activating crRNA) as components; or a single-stranded guide RNA (single guide RNA, sgRNA) comprising a first portion including a sequence that is all or partly complementary to a base sequence in a target gene and a second portion including a sequence that interacts with an endonuclease (particularly, an RNA-guide nuclease), but may be included in the scope of the present invention without limitation, and may be manufactured and used according to a technique known in the art, taking into account the type of endonuclease used together or the microorganism originating from the endonuclease, etc. The above guide RNA is adjacent to the PAM (protospacer adjacent motif) site and may include a sequence complementary to a 10 to 20 bp base sequence of the DNA to be edited, but is not limited thereto.

[0044] The above guide RNA may be, but is not limited to, a guide RNA transcribed from a plasmid template, a guide RNA transcribed in vitro (e.g., an oligonucleotide double strand), or a synthetic guide RNA.

[0045] In addition, the recombinant vector for improving the regeneration efficiency of cannabis according to the present invention may be composed of the GRF3-GIF1 chimeric protein or PLT5 protein expression cassette and the foreign gene expression cassette or gene correction cassette as separate plasmids or as a single plasmid, but is not limited thereto.

[0046] The recombinant expression vector according to the present invention can be constructed using methods well known to those skilled in the art. These methods include in vitro recombinant DNA techniques, DNA synthesis techniques, and in vivo recombination techniques. The DNA sequence can be effectively linked to a suitable promoter within the expression vector to drive mRNA synthesis. Furthermore, the expression vector may include a ribosome binding site and a transcription terminator as a translation initiation site.

[0047] The recombinant vector may preferably include one or more selectable markers. These markers are typically nucleic acid sequences having properties that can be selected by chemical methods, and include any gene that can distinguish transformed cells from non-transformed cells. Examples include, but are not limited to, herbicide resistance genes such as glyphosate or phosphinothricin; antibiotic resistance genes such as kanamycin, hygromycin, chloramphenicol, G418 (geneticin), and bleomycin; and the aadA (aminoglycoside-3'-adenyl transferase) gene.

[0048] A preferred example of a recombinant vector of the present invention is a Ti-plasmid vector, which, when present in a suitable host such as Agrobacterium tumefaciens, is capable of transferring a portion of itself, the so-called T-region, into a plant cell. Other types of Ti-plasmid vectors (see EP 0 116 718 B1) are currently used to transfer hybrid DNA sequences into plant cells or protoplasts from which new plants can be produced, wherein the hybrid DNA is suitably integrated into the plant genome. A particularly preferred form of Ti-plasmid vector is a so-called binary vector, as claimed in EP 0 120 516 B1 and U.S. Pat. No. 4,940,838. Other suitable vectors that can be used to introduce the DNA according to the present invention into a plant host include viral vectors, such as those derived from double-stranded plant viruses (e.g., CaMV) and single-stranded viruses, geminiviruses, etc., and non-complete plant viral vectors. The use of such vectors can be particularly advantageous when it is difficult to properly transform the plant host.

[0049] The present invention also provides a method for improving the regeneration efficiency of cannabis, comprising a step of transforming cannabis plant cells with the recombinant vector.

[0050] The method of transporting a recombinant vector into a host cell can be carried out by the CaCl2 method, the Hanahan method (Hanahan, D., J. Mol. Biol., 166:557-580(1983)), and the electroporation method, if the host cell is a prokaryotic cell. In addition, if the host cell is a eukaryotic cell, the vector can be injected into the host cell by the gene gun-mediated transformation method (bombardment), the Agrobacterium-mediated transformation method, the microinjection method, the calcium phosphate precipitation method, the electroporation method, the liposome-mediated transfection method, and the DEAE-dextran treatment method, but is not limited thereto.

[0051] More specifically, the method for improving the efficiency of re-differentiation of hemp according to the present invention is as follows:

[0052] A step of obtaining immature embryos from a cannabis plant;

[0053] A step of cutting off the meristem including cotyledons from the immature embryo obtained above; and

[0054] The method may include, but is not limited to, a step of co-cultivating the shoot meristem including the cotyledon with Agrobacterium tumefaciens transformed with the recombinant vector according to the present invention.

[0055] In a method for improving the efficiency of regeneration of cannabis according to one embodiment of the present invention, the immature embryo may be an immature embryo obtained 17 to 24 days after pollination, more preferably an immature embryo obtained 20 to 22 days after pollination, and even more preferably an immature embryo obtained 21 days after pollination, but is not limited thereto.

[0056] In the present invention, to obtain immature embryos from cannabis plants, cannabis plants or seeds are grown for 3 to 6 weeks or more under long-period light conditions at 22 to 28°C, and then transferred to short-period light conditions to induce flowering. At this time, the sexes are distinguished by PCR assay using a sex marker or when flower buds (immature flowers) are formed, and the female and male plants are grown separately. After the male cannabis plant blooms and produces pollen, the female cannabis flower or plant is pollinated, and from this day onward, before the embryo fully matures, the immature embryos are obtained.

[0057] In addition, in the method for improving the efficiency of re-differentiation of cannabis according to one embodiment of the present invention, the co-cultivation may be preferably cultured under dark conditions of 4 to 25°C for 2 to 4 days, and more preferably cultured under dark conditions of 16 to 25°C for 3 days, but is not limited thereto.

[0058] The method for improving the efficiency of regeneration of hemp of the present invention may include, but is not limited to, a step of transferring the shoot meristem including cotyledons co-cultured with the Agrobacterium tumefaciens to a regeneration medium and further culturing at 22 to 25°C for 7 to 14 days.

[0059] The present invention also provides:

[0060] A step of transforming a cannabis plant cell with the recombinant vector of the present invention; and

[0061] A method for producing a transformed cannabis plant with improved regeneration efficiency is provided, comprising a step of regenerating cannabis from the transformed cannabis plant cell.

[0062] In the manufacturing method according to the present invention, the recombinant vector is as described above.

[0063] In a manufacturing method according to one embodiment of the present invention, the recombinant vector may be a plasmid including, but is not limited to, an expression system capable of inserting a DNA encoding a gRNA specific to a target DNA for gene correction (editing) in a cannabis plant and a nucleic acid sequence encoding an endonuclease protein and expressing the same in cannabis plant cells. The plasmid includes elements for expression of a target gene, such as a replication origin, a promoter, an operator, a transcription terminator, and the like, and may further include an appropriate enzyme site (e.g., a restriction enzyme site) for introduction into the genome of a host cell and / or a selection marker for confirming successful introduction into a host cell and / or a ribosome binding site (RBS) for translation into a protein and / or a transcriptional regulatory element.

[0064] Additionally, the manufacturing method of the present invention includes a step of regenerating a transformed cannabis plant from the transformed cannabis plant cell. Any method known in the art can be used to regenerate the transformed plant.

[0065] The present invention also provides a composition for improving the regeneration efficiency of cannabis, which comprises as an active ingredient a recombinant vector comprising a sequence encoding a GRF3-GIF1 chimeric protein consisting of an amino acid sequence of SEQ ID NO: 2 or a sequence encoding a PLT5 protein consisting of an amino acid sequence of SEQ ID NO: 11. The composition comprises as an active ingredient a sequence encoding a GRF3-GIF1 chimeric protein consisting of an amino acid sequence of SEQ ID NO: 2, which has the effect of increasing the regeneration efficiency of cannabis plant tissue, or a sequence encoding a PLT5 protein consisting of an amino acid sequence of SEQ ID NO: 11, so that the regeneration efficiency of cannabis plants can be improved by transforming a cannabis plant cell with a recombinant vector comprising a sequence encoding a GRF3-GIF1 chimeric protein or a PLT5 protein.

[0066]

[0067] Hereinafter, the present invention will be described in detail by way of examples. However, the following examples are merely illustrative of the present invention, and the content of the present invention is not limited to the following examples.

[0068]

[0069] Example 1. Cloning of a GRF3-GIF1 chimeric protein expression gene from cannabis with miR396 resistance.

[0070] In order to obtain a hemp-derived GRF3 (Growth-regulating factor 3)-GIF1 (GRF-interacting factor 1) chimeric protein coding gene (SEQ ID NO: 1) with miR396-resistance to be introduced to increase the regeneration efficiency in the present invention, cloning was performed using the cDNA of the hemp chung-sam variety as a template using the PCR (polymerase chain reaction) site-directed mutagenesis technique (Hemsley, Anne, et al., Nucleic Acids Res. 1989, 17(16):6545-51).

[0071] Afterwards, Bean yellow dwarf virus (BeYDV)-derived replicon pLSL.R.Ly (Vu, Tien Van, et al., Plant Biotechnol J. 2020, 18(10):2133-2143) was used as a recombinant vector backbone for gene expression in cannabis plants, and the recombinant vector pLSL.R.Ly-hCas9-GFP (Fig. 9A) containing an antibiotic marker expression cassette; a GFP (Green fluorescent protein) expression cassette; an endonuclease expression cassette; and a gRNA expression cassette targeting the cannabis-derived THCAS (tetrahydrocannabinolic acid synthase) gene (GenBank: MN422084.1) between the LB (left border) and RB (right border) sequences; and an antibiotic marker expression cassette between the LB and RB sequences; A recombinant vector, pLSL.R.Ly-hCas9-GRF3-GIF1 (Fig. 9B), containing a miR396-resistant cannabis-derived GRF3-GIF1 chimeric protein expression cassette, an endonuclease expression cassette, and a gRNA expression cassette targeting the cannabis-derived THCAS gene was constructed by Golden Gate cloning using the Type IIS restriction enzyme BsaI (Engler et al., PLoS One. 2008, 3(11):e3647).

[0072] In the vector map of FIG. 9, 2Xp35S-hCas9-tEu35SRb7 (SEQ ID NO: 3) corresponds to an endonuclease expression cassette, p35SL-intron-CLOVER-tEu35SRb7 (SEQ ID NO: 4), p35SL-intron-CsGRF3-GIF1-tEuRb7 (SEQ ID NO: 5), and p35SL-intron-PLT5-t35s (SEQ ID NO: 12) correspond to GFP, GRF3-GIF1, and PLT5 expression cassettes, respectively, and AtU6-sgR.11(THCAS) (SEQ ID NO: 8) and AtU6-sgR.13(THCAS) (SEQ ID NO: 9) correspond to gRNA expression cassettes targeting the cannabis-derived THCAS gene, which are cassettes expressing gRNAs in Table 1 below, respectively.

[0073] Origin of cannabis THCAS gRNA base sequence (5'-3') targeting the gene Sequence number gRNA11ACCAATTCCAGAAACTGCAA6 gRNA13cccttacggtggtataatgg7

[0074] The above recombinant vector was transformed into Agrobacterium tumefaciens EHA-105 via electroporation.

[0075]

[0076] Example 2. Method for obtaining immature embryos from cannabis plants

[0077] The present invention was made under the Narcotics Handling (Academic Researcher) License (Identification Number L00202725).

[0078] In the present invention, to obtain immature embryos, cannabis was grown in a greenhouse under long-cycle conditions (16 h light / 8 h dark) during the flowering period, and then transferred to short-cycle conditions (12 h light / 12 h dark) in the 5th week to induce flowering. At this time, male and female trees were distinguished by PCR using a sex determination marker (Faux, Anne-Michelle, et al. Euphytica 2014, 196:183-197), and then grown separately. When each tree bloomed, pollen from the male flower of the male tree was pollinated into the pistil of the female tree, and the period from this day to the day when embryo rescue was performed was referred to as Days after pollination (DAP). In the present invention, embryo rescue was performed at 7, 10, 12, 13, 14, 17, 19, 21, 24, 28, or 30 DAP, and the status of each embryo was confirmed (Fig. 2).

[0079]

[0080] Example 3. Method for culturing immature embryos

[0081] In the present invention, immature embryos obtained through embryo rescue were cultured at 25°C on an in vitro solid medium (MS basal medium, 1.5% sucrose, 5% agar, pH 5.8) until the experiment. The embryo rescued immature embryos were referred to as Afterrescue (AR) according to the culture period.

[0082]

[0083] Example 4. Method for obtaining hypocotyl segments from hemp seedlings or immature embryos.

[0084] After embryo rescue, immature embryos or cannabis seedlings cultured for several days were cut with a razor blade to obtain hypocotyl sections by cutting the shoot meristem including cotyledons (Fig. 4).

[0085]

[0086] Example 5. Method for transforming cannabis using Agrobacterium

[0087] The hypocotyl segments of the immature embryos obtained in Example 4 above were immersed in a fungal inoculation medium (1 / 2 MS basal medium, 2% sucrose, 1% glucose, 200 μM acetosyringone, pH 5.2) containing Agrobacterium tumefaciens containing a recombinant plant expression vector for 40 to 50 minutes, and then co-cultured under dark conditions.

[0088] Agrobacterium transformed with the above recombinant plant expression vector was cultured in liquid LB medium containing 20 mg / L rifampicin, 25 mg / L gentamicin, and 50 mg / L kanamycin at 28°C and 180 rpm for 16 hours. Afterwards, it was diluted 1:10 using 30 ml of fresh medium and further cultured for 4 to 6 hours at 28°C and 180 rpm. Agrobacterium (OD 600 =0.6~0.8) were collected by centrifugation at 3,500 rpm, resuspended in 30 ml of liquid inoculation medium (pH 5.2; Wu et al., Plant Methods 2014, 10:19) containing 200 μM acetosyringone (AS) for 15 min, and used after activation at 28°C, 180 rpm for 1 h before cannabis transformation.

[0089]

[0090] Example 6. Confirmation of regeneration efficiency from hemp hypocotyl explants.

[0091] The hypocotyl segments obtained in the above Example 4 were cultured in MS basal medium or a regeneration medium containing 0.2 mg / L of auxin (e.g., 1-Naphthaleneacetic acid (NAA)) and 0.4 mg / L of cytokinin (e.g., Thidiazuron (TDZ)), and the hypocotyl segments co-cultured in the above Example 5 were cultured in MS basal medium containing 300 mg / L of timentin or a regeneration medium containing 0.2 mg / L of auxin and 0.4 mg / L of cytokinin, at a temperature of 22 to 25°C for 7 to 14 days, and the number of segments from which new shoots emerged was counted to confirm the regeneration efficiency (Fig. 5).

[0092]

[0093] Example 7. Confirmation of growth of transgenic hemp hypocotyl explants according to DAP.

[0094] Immature embryos of 13, 14, 17, or 21 DAP obtained according to the above Example 2 were cultured for 3 days, and then hypocotyl segments of the immature embryos were obtained according to the above Example 4, and co-cultured with Agrobacterium containing a vector expressing the RUBY reporter (HE, Yubing, et al., Horticulture research, 2020, 7:152) in the same manner as the above Example 5. The results of checking the hemp segment tissue 10 days later showed that the best growth performance was achieved when 21 DAP immature embryos were used (Fig. 3).

[0095]

[0096] Example 8. Confirmation of redifferentiation efficiency of hemp hypocotyl explants according to the culture period of immature embryos.

[0097] Immature embryos of cannabis varieties Afghani kush and Cheongsam, obtained at 21 DAP according to Example 2, were cultured to 0, 1, 2, or 3 AR, respectively, and then hypocotyl segments were obtained according to the method of Example 4. Thereafter, each segment was transformed with Agrobacterium containing the recombinant vector pLSL.R.Ly-hCas9-GFP. Thereafter, co-culture was performed according to Example 5, and regeneration efficiency was confirmed 7 days later, and it was confirmed that both cannabis varieties had the best regeneration efficiency at 0 AR (Fig. 6).

[0098]

[0099] Example 9. Confirmation of regeneration efficiency of hemp hypocotyls according to co-culture temperature conditions.

[0100] According to Example 2, immature embryos of the cannabis variety Afghani kush obtained at 21 DAP were used to obtain hypocotyl segments according to the method of Example 4. At this time, the cannabis hypocotyl segments were immersed in an Agrobacterium suspension containing the recombinant vector pLSL.R.Ly-hCas9-GFP according to Example 5, and then co-cultured under various temperature conditions. Specifically, after co-culture for 3 days at temperatures of 4, 16, 22, 25, or 31°C and in the dark, the regeneration efficiency was confirmed after 7 days. The highest regeneration efficiency was observed at 16°C, but there was no significant difference from 4 to 22°C. The regeneration efficiency decreased from 25°C, and it was confirmed that the regeneration efficiency was significantly lower at 31°C (Fig. 7).

[0101]

[0102] Example 10. Confirmation of the efficiency of hemp hypocotyl regeneration following introduction of a hemp-derived GRF3-GIF1 chimeric protein expression gene with miR396 resistance.

[0103] Hypocotyl fragments were obtained from immature embryos of the cannabis variety Afghani kush obtained at 21 DAP according to the above Example 2 according to the method of Example 4. At this time, the hypocotyl fragments were transformed with Agrobacterium containing the recombinant vectors pLSL.R.Ly-hCas9-GFP and pLSL.R.Ly-hCas9-CsGRF3GIF1, respectively, according to Example 5. After co-cultivation for 3 days under dark conditions at 22°C, the regeneration efficiency was confirmed after 7 days, and it was confirmed that the fragments into which the GRF3-GIF1 chimeric protein coding gene derived from cannabis with miR396 resistance was introduced showed better regeneration efficiency (Fig. 8).

[0104]

[0105] Example 11. Confirmation of the efficiency of hemp hypocotyl regeneration following introduction of the hemp-derived PLT5 protein-coding gene.

[0106] Hypocotyl fragments were obtained from immature embryos of the cannabis variety Afghani kush obtained at 21 DAP according to the above Example 2 according to the method of Example 4. At this time, the hypocotyl fragments were transformed with Agrobacterium containing the recombinant vectors pLSL.R.Ly-hCas9-GFP and pLSL.R.Ly-hCas9-PLT5, respectively, according to the method of Example 5. After co-cultivation for 3 days under dark conditions at 22°C, the regeneration efficiency was confirmed after 7 days, and it was confirmed that the fragments into which the cannabis-derived PLT5 protein coding gene was introduced showed better regeneration efficiency (Fig. 10).

[0107]

[0108] This application was carried out with the support of the “Gyeongnam Regional Enterprise Growth Ladder Support Project” of the Ministry of SMEs and Startups and Gyeongsangnam-do Province.

Claims

1. A recombinant vector for improving the regeneration efficiency of cannabis, comprising a GRF3 (Growth-regulating factor 3)-GIF1 (GRF-interacting factor 1) chimeric protein or a PLT5 (PLETHORA 5) protein expression cassette.

2. A recombinant vector for improving the regeneration efficiency of cannabis, characterized in that it additionally comprises a foreign gene expression cassette or a gene correction cassette in the first paragraph.

3. A recombinant vector for improving the efficiency of regeneration of cannabis, characterized in that the GRF3-GIF1 chimeric protein or PLT5 protein expression cassette and the foreign gene expression cassette or gene correction cassette are composed of separate plasmids or are composed of one plasmid, in the second paragraph.

4. A recombinant vector for improving the redifferentiation efficiency of cannabis, characterized in that in paragraph 1, the GRF3-GIF1 chimeric protein consists of an amino acid sequence of sequence number 2, and the PLT5 protein consists of an amino acid sequence of sequence number 11.

5. A method for improving the efficiency of regeneration of cannabis, comprising a step of transforming cannabis plant cells with a recombinant vector of any one of claims 1 to 4.

6. In paragraph 5, A step of obtaining immature embryos from a cannabis plant; A step of cutting off the apical meristem including cotyledons from the immature embryo obtained above; and A method for improving the efficiency of regeneration of cannabis, comprising the step of cocultivating the shoot meristem including the cotyledon with Agrobacterium tumefaciens transformed with the recombinant vector of any one of claims 1 to 4.

7. A method for improving the efficiency of regeneration of cannabis, characterized in that the immature embryo in paragraph 6 is obtained 17 to 24 days after pollination.

8. A method for improving the efficiency of regeneration of cannabis, characterized in that the co-cultivation in paragraph 6 is performed under dark conditions of 4 to 25°C for 2 to 4 days.

9. A step of transforming a cannabis plant cell with a recombinant vector of any one of claims 1 to 4; and A method for producing a transformed cannabis plant with improved regeneration efficiency, comprising a step of regenerating cannabis from the transformed cannabis plant cell.

10. A composition for improving the regeneration efficiency of cannabis, comprising as an active ingredient a recombinant vector comprising a sequence encoding a GRF3 (Growth-regulating factor 3)-GIF1 (GRF-interacting factor 1) chimeric protein consisting of an amino acid sequence of sequence number 2 or a sequence encoding a PLT5 (PLETHORA 5) protein consisting of an amino acid sequence of sequence number 11.

Images