Universal nucleic acid detection platform

Abstract

The present invention relates to the field of genetic engineering. Disclosed is a universal nucleic acid detection platform, which is a universal nucleic acid detection platform on the basis of CRISPR-Cas9.

Description

A universal nucleic acid detection platform Technical Field

[0001] The present invention relates to the field of genetic engineering. Specifically, the present invention relates to a universal nucleic acid detection platform. More specifically, the present invention relates to a universal nucleic acid detection platform based on CRISPR-Cas9.

[0002] Background of the Invention

[0003] Two types of CRISPR-Cas systems, including type II, type V, and type VI, have been developed as practical tools for genome editing and nucleic acid detection due to their simple effector protein composition and efficient nucleic acid targeting and cleavage activity. Cas12a and Cas13a are the effector nucleases of type VA and type VI-A systems, respectively, and both have two different substrate cleavage modes: one is cis target substrate cleavage, and the other is trans non-target substrate cleavage. Cas12a not only has target double-stranded (ds) DNA cleavage activity, but also exhibits non-target single-stranded (ss) DNA degradation activity after target DNA binding. By combining the trans DNA cleavage activity of Cas12a with isothermal amplification, a method called DETECTR (DNA Endonuclease Targeted CRISPR Trans Reporter) was created for rapid and specific DNA sample detection. Cas13a is a crRNA-guided RNA targeting and cleavage enzyme that, in addition to its specific cis ssRNA cleavage activity, also has sequence-independent trans ssRNA cleavage activity. Based on the trans RNA cleavage activity and isothermal pre-amplification of Cas13a, a platform called SHERLOCK (Specific High Sensitivity Enzymatic Reporter UnLOCKing) has been developed for rapid and sensitive detection of RNA or DNA single molecules. Cas9 is the effector enzyme of type II system, a kind of crRNA and tracrRNA dependent DNA targeting and cutting endonuclease. Unlike Cas12a and Cas13a, previous studies have shown that the Cas9 guided by sgRNA (synthetic fusion of crRNA and tracrRNA) has only cis dsDNA cleavage activity, without trans ssDNA cleavage activity (Chen, J Set al.CRISPR-Cas12a target binding unleashes indiscriminate single-stranded DNase activity.Science 360,436-439 (2018)).

[0004] Cas12a uses a single RuvC nuclease domain to cis-cleave both DNA strands of the target substrate and trans-cleave the ssDNA strand of the non-target substrate. The RuvC domain is contained in all effector nucleases of the V-type system, and in addition to the trans-ssDNA cleavage activity in these effector nucleases, it also exhibits trans-ssRNA and dsDNA cleavage activity in the Cas12a2 effector nuclease. Cas9 also possesses a RuvC nuclease domain that can specifically cleave the non-complementary DNA strand of the target dsDNA substrate in cis. Although the RuvC catalytic domain of Cas9 has high cis DNA cleavage activity, it is unclear why it does not have the same trans nucleic acid cleavage activity as the RuvC domain of the Cas12 effector nuclease.

[0005] Summary of the Invention

[0006] Through structural comparative analysis, the inventors discovered that after Cas9 is assembled with sgRNA and a complementary ssDNA activator, its two catalytic domains participate in the formation of a channel capable of accommodating non-target DNA. The inventors therefore suspected that sequence- and structure-specific DNA substrates may be required to bind to this channel for RuvC trans-cleavage to occur. Therefore, in this study, the inventors determined the trans-cleavage activity of Cas9 by testing a series of sequence- and structure-specific nucleic acid substrates, thereby developing Cas9 as a potential molecular diagnostic tool.

[0007] BRIEF DESCRIPTION OF THE DRAWINGS

[0008] Figure 1. Target DNA can activate the Cas9-sgRNA complex to trans-cleave non-specific polyT / C ssDNA. (a) The figure shows a structural comparison of Cas12a and Cas9. (b) The figure illustrates that target DNA can activate SpyCas9-sgRNA to trans-cleave polyT or polyC ssDNA, but has no significant cleavage activity against polyA or polyG. (c) The figure shows that target DNA can activate the complexes of SpyCas9, FnCas9, and SauCas9 with their respective sgRNAs to trans-cleave non-specific polyT / C ssDNA. (d) The figure shows that target DNA cannot activate SpyCas9 to trans-cleave non-specific polyT / C ssDNA. (e) The figure shows that SpyCas9-sgRNA can bind to polyT / C ssDNA but does not interact with polyA / G ssDNA.

[0009] Figure 2. Target DNA can activate the Cas9-tracrRNA-crRNA complex to trans-cleave ssDNA. (a) Target DNA can activate the SpyCas9-tracrRNA-crRNA complex to trans-cleave polyA / T / C ssDNA, but has no significant cleavage activity against polyG ssDNA. (b) Target DNA can significantly activate the SpyCas9-tracrRNA-crRNA complex to trans-cleave polyT / C ssDNA, with only weak cleavage activity against polyA ssDNA and no cleavage activity against polyG ssDNA. (c) Comparison of the kinetic parameters for target DNA activation of the SpyCas9-tracrRNA-crRNA complex and the SpyCas9-sgRNA complex to trans-cleave a fluorophore-quencher-labeled polyT ssDNA probe shows that the kcat / Km values ​​for the SpyCas9-tracrRNA-crRNA complex to trans-cleave the probe differ by approximately 100 orders of magnitude, a significant difference. (d) The figure shows that target DNA can activate the SpyCas9-tracrRNA-crRNA complex to trans-cleave the M13 phage circular ssDNA, but cannot activate the SpyCas9-sgRNA cleavage activity on the M13 phage circular ssDNA. (e) The figure shows that target DNA can activate the SpyCas9-tracrRNA-crRNA complex to trans-cleave ssDNA, but has no trans-cleavage activity on dsDNA.

[0010] Figure 3. Substrate preference of SpyCas9 for trans-cleavage of nonspecific ssDNA. (a) (b) Figures show that the number of consecutive T / C bases at the 3' end of nonspecific ssDNA significantly affects the trans-cleavage activity of target-activated SpyCas9: when the 3' end of the nonspecific ssDNA contains more than 8 consecutive T / C bases, the target DNA can significantly activate the SpyCas9-tracrRNA-crRNA complex to cleave ssDNA; when the number of consecutive T / C bases at the 3' end of the nonspecific ssDNA is less than or equal to 6, the target DNA's ability to activate SpyCas9-tracrRNA-crRNA is significantly reduced. Figures (c) and (d) show that the location of the secondary structure of polyT / C in non-specific ssDNA has a significant impact on the trans-cleavage activity of target-activated SpyCas9: when polyT / C is located in the stem-loop structure of ssDNA, SpyCas9 cannot trans-cleave it; when the polyT / C single strand is close to the 3' or 5' end of the stem-loop, the target DNA can activate SpyCas9 to trans-cleave it. Figures (e) (f) and (h) show that target DNA can activate SpyCas9 to trans-cleave long ssDNA, and SpyCas9 has stronger trans-cleavage activity towards T-rich bases than A-rich bases within the secondary structure-free region of long ssDNA.

[0011] Figure 4. Target RNA can activate the trans-cleavage activity of SpyCas9. (a) (b) Figures show that target dsDNA, ssDNA, and ssRNA can all activate the trans-cleavage activity of SpyCas9 protein against ssDNA fluorescent probes. The RuvC domain of SpyCas9 plays a key role in its trans-cleavage activity: SpyCas9(D10A) mutation causes SpyCas9 to lose its trans-cleavage activity; when SpyCas9(H840A) mutates, the activation effect of target dsDNA and target ssRNA on the trans-cleavage activity of SpyCas9 is significantly reduced, while the trans-activation effect of target ssDNA is unaffected. (c) (d) Figures show that target ssDNA can significantly activate the trans-cleavage activity of the RuvC domain of SpyCas9 protein against ssRNA fluorescent probes, and the trans-cleavage activation ability of target dsDNA and ssRNA on SpyCas9 is relatively poor compared to target ssDNA. Figures (e) and (f) reflect the kinetic parameters of dsDNA01 / ssDNA01 activation of SpyCas9 for cleavage of ssRNA-FQ probes, demonstrating that ssDNA01 can better activate SpyCas9 for cleavage of ssRNA-FQ probes. Figure (g) illustrates the structural domains of the SpyCas9 protein. (h) Schematic diagram representing the binding of sgRNA to target RNA. Figure (i) shows the crystal structure of the SpyCas9-sgRNA-target RNA complex, demonstrating that target RNA can bind to the SpyCas9-sgRNA complex and drive conformational changes in the complex.

[0012] Figure 5. CRISPR-Cas9-based nucleic acid detection platform. (a) Schematic diagram of dsDNA-activated Cas9 detection. (b) and (c) demonstrate that DNA-activated Cas9-detection (DACD) can detect the monkeypox virus B6R gene inserted on the PCDH plasmid, with a copy number as low as 0.305 copies / μl. (d) Schematic diagram of RNA-activated Cas9 detection. (e) and (f) Schematic diagram of RNA-activated Cas9-detection (RACD) can detect the monkeypox virus B6R gene inserted on the PCDH plasmid, with a copy number as low as 0.75 copies / μl. (g) RACD sensitivity was tested using a pseudovirus containing the monkeypox virus B6R gene as a simulated virus. The method can detect the virus within 2.5 hours, with a detection limit of 0.145 copies / μl. (h) The figure shows the RACD method for detecting the N gene in purified respiratory syncytial virus subtype A RNA standards, achieving a detection limit of 3.83 copies / μl in less than 2.5 hours. (i) The figure shows the RACD method for species-specific identification of monkeypox virus: We selected crRNA targeting the B6R gene of the Congo strain (i.e., Central African strain) of monkeypox virus for detection. Analysis of the probe's fluorescence intensity showed that the RACD system was significantly activated by a plasmid containing the B6R gene of the Congo strain of monkeypox virus; however, plasmids containing the B6R gene of the West African strain of monkeypox virus and plasmids containing the B6R gene of cowpox virus failed to activate Cas9 cleavage of the ssDNA probe. (j) The figure shows the RACD method for differential detection of EGFR T790M. The results show that the RACD method can distinguish single-point mutations in wild-type samples with a T790M mutation rate as low as 0.1%.

[0013] Figure 6. Target DNA can activate Cas9 to trans-cleave adjacent non-target ssDNA. The figure shows that target DNA can significantly activate FnCas12a (a), FnCas9 (b), and SauCas9 (c) to cleave polyT / C ssDNA.

[0014] Figure 7. SpyCas9-tracrRNA-crRNA has significantly higher trans-cleavage activity against adjacent non-target ssDNA than SpyCas9-sgRNA. (a) Comparison of kinetic parameters for the trans-cleavage activity of SpyCas9-tracrRNA-crRNA and SpyCas9-sgRNA against targets ssDNA02 and dsDNA02. (b) Comparison of kinetic parameters for the trans-cleavage activity of SpyCas9-tracrRNA-crRNA and SpyCas9-sgRNA against targets ssDNA03 and dsDNA03.

[0015] Figure 8. Target DNA can activate the Cas9-tracrRNA-crRNA complex to trans-cleave ssDNA. (a) Target DNA can activate FnCas9-tracrRNA-crRNA to trans-cleave M13 phage circular ssDNA. (b) and (c) Target DNA can activate SpyCas9-tracrRNA-crRNA to trans-cleave any nonspecific ssDNA (c), but has no activity against any nonspecific dsDNA (b).

[0016] Figure 9. Structural preferences of Cas9 for trans-cleavage of adjacent nonspecific ssDNA substrates. (a) Shows the predicted secondary structures of six selected nonspecific ssDNA strands. (b) and (c) demonstrate that Cas9 has stronger cleavage activity against ssDNAs with significant nonspecific regions in their predicted structures. Cas9 also exhibits higher cleavage activity against polyT-rich sequences in nonspecific regions compared to polyA-rich sequences.

[0017] Figure 10. The RuvC domain is responsible for the trans-cleavage activity of SpyCas9. Figures (a-c) show the activities of wild-type SpyCas9 (WT), RuvC inactivation mutant (D10A), and HNH inactivation mutant (H840A) proteins on cis-cleavage of target dsDNA (a), cis-cleavage of target ssDNA (b), and trans-cleavage of non-target ssDNA (c). The HNH inactivation mutation impairs cis-cleavage of target dsDNA / ssDNA but has no effect on trans-processing of non-target ssDNA; the RuvC inactivation mutation impairs trans-cleavage of non-target ssDNA but has no effect on cis-processing of target dsDNA / ssDNA.

[0018] Figure 11. Substrate sequence preference for Cas9 cis-cleavage. (a) Cas9 has no particular preference for sequences adjacent to the target strand. (b) Cas9 has a certain preference for nucleic acid sequences adjacent to the PAM region of the NTS strand of the target dsDNA, as shown in the order T / C > A > G. (c) Cas9 activity decreases for plasmid substrates when the number of G bases adjacent to the PAM region of the non-target strand is greater.

[0019] Figure 12. SpyCas9 substrate preference for ssDNA fluorescent probes. (a) The figure shows that with 13 T bases, SpyCas9 can achieve a detection limit of 0.125nM. When the number of T bases in the probe is reduced to 11, the detection limit of SpyCas9 is 0.25nM (b). When the number of T bases in the probe is reduced to 8, SpyCas9 has no significant cleavage activity. (d) The figure shows that two consecutive base mutations in the target dsDNA reduce the trans-cleavage activity of Cas9. (e) The figure shows that the trans-cleavage activity of Cas9 can be activated when the target dsDNA and the gRNA are complementary for 17 or more base pairs.

[0020] Figure 13. Structural comparison of SpyCas9-sgRNA-NTS_TS and SpyCas9-crRNA-tracrRNA-NTS_TS. (a) and (b) show that crystals of SpyCas9-sgRNA-NTS_TS and SpyCas9-crRNA-tracrRNA-NTS_TS primarily adopt checkpoint activation conformations for target sequences of 16-nt, 17-nt, and 18-nt, but there are certain conformational differences between the two. (c) shows that the SpyCas9-crRNA-tracrRNA-NTS_TS18 complex assembles more uniformly than the SpyCas9-sgRNA-NTS_TS18 complex.

[0021] Figure 14. Structural comparison of SpyCas9-sgRNA-target ssDNA and SpyCas9-sgRNA-target ssRNA. (a) and (b) demonstrate that the conformational changes induced by the target RNA in SpyCas9-sgRNA differ significantly from those in the target ssDNA. Target RNA binding triggers significant changes in the REC3 and REC2 domains of SpyCas9. (c) (d) and (e) demonstrate that the structural differences between SpyCas9-sgRNA-target ssDNA and SpyCas9-sgRNA-target ssRNA are primarily reflected in the REC2, REC3, HNH domains, and the duplex between the target RNA and sgRNA. (g) demonstrates that the target RNA-sgRNA duplex primarily adopts an A-form conformation.

[0022] Figure 15. Application of Cas9 trans-cleavage activity in detection. (a) The figure shows that when the target DNA and gRNA are complementary for 18 base pairs, a mismatch at the 17th base pair significantly reduces Cas9 trans-cleavage activity. (b) The figure demonstrates that the DACD method can achieve species-specific identification of monkeypox virus: crRNA targeting the B6R gene of the Congo strain (i.e., Central African strain) of monkeypox virus was selected for detection. Analysis of the probe's fluorescence intensity showed that the DACD system was significantly activated by a plasmid containing the B6R gene of the Congo strain of monkeypox virus; however, plasmids containing the B6R gene of the West African strain of monkeypox virus and plasmids containing the B6R gene of cowpox virus failed to activate Cas9 cleavage of the ssDNA probe. (C) The figure shows the differential detection of EGFR T790M using the DACD method. The results show that the DACD method can distinguish single-point mutations in wild-type samples with a T790M mutation rate as low as 1%.

[0023] Figure 16. Effects of different buffers on Cas9 trans-cleavage activity. (a) Comparison of Cas9 trans-cleavage activity against the T13-FQ probe in Buffers 1-6. Results indicate that Cas9 has the best activity in buffer 2. (b) Comparison of Cas9 trans-cleavage activity against the U13-FQ probe in Buffers 1-6. Results indicate that Cas9 has higher activity in Buffers 2 and 3.

[0024] Detailed Description of the Invention

[0025] 1. Definition

[0026] In the present invention, unless otherwise indicated, the scientific and technical terms used herein have the meanings commonly understood by those skilled in the art. In addition, the terms and laboratory procedures related to protein and nucleic acid chemistry, molecular biology, cell and tissue culture, microbiology, and immunology used herein are terms and routine procedures widely used in the corresponding fields. For example, the standard recombinant DNA and molecular cloning techniques used in the present invention are well known to those skilled in the art and are more fully described in the following literature: Sambrook, J., Fritsch, EF and Maniatis, T., Molecular Cloning: A Laboratory Manual; Cold Spring Harbor Laboratory Press: Cold Spring Harbor, 1989 (hereinafter referred to as "Sambrook"). At the same time, in order to better understand the present invention, definitions and explanations of relevant terms are provided below.

[0027] As used herein, the term "and / or" encompasses all combinations of items connected by the term, and should be treated as if each combination had been individually listed herein. For example, "A and / or B" encompasses "A," "A and B," and "B." For example, "A, B, and / or C" encompasses "A," "B," "C," "A and B," "A and C," "B and C," and "A and B and C."

[0028] When the word "comprising" is used herein to describe a sequence of a protein or nucleic acid, the protein or nucleic acid may be composed of the sequence, or may have additional amino acids or nucleotides at one or both ends of the protein or nucleic acid, but still have the activity described in the present invention. In addition, it is clear to those skilled in the art that the methionine encoded by the start codon at the N-terminus of the polypeptide may be retained in certain practical situations (for example, when expressed in a specific expression system), but it does not substantially affect the function of the polypeptide. Therefore, when describing a specific polypeptide amino acid sequence in the specification and claims of this application, although it may not contain a methionine encoded by a start codon at the N-terminus, a sequence containing the methionine is also covered, and accordingly, its encoding nucleotide sequence may also contain a start codon; and vice versa.

[0029] "Polynucleotide," "nucleic acid sequence," "nucleotide sequence," or "nucleic acid fragment" are used interchangeably and are single-stranded or double-stranded polymers of RNA or DNA that optionally contain synthetic, non-natural, or altered nucleotide bases. Nucleotides are referred to by their single-letter designations as follows: "A" for adenosine or deoxyadenosine (RNA or DNA, respectively), "C" for cytidine or deoxycytidine, "G" for guanosine or deoxyguanosine, "U" for uridine, "T" for deoxythymidine, "R" for purine (A or G), "Y" for pyrimidine (C or T), "K" for G or T, "H" for A or C or T, "D" for A, T, or G, "I" for inosine, and "N" for any nucleotide. Although nucleotide sequences herein may be presented as DNA sequences (including T), when reference is made to RNA, one skilled in the art can readily determine the corresponding RNA sequence (i.e., replacing T with U).

[0030] "Polypeptide," "peptide," and "protein" are used interchangeably herein to refer to a polymer of amino acid residues. The terms apply to amino acid polymers in which one or more amino acid residues is an artificial chemical analog of a corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers. The terms "polypeptide," "peptide," "amino acid sequence," and "protein" may also include modified forms including, but not limited to, glycosylation, lipid attachment, sulfation, gamma carboxylation of glutamic acid residues, hydroxylation, and ADP-ribosylation.

[0031] Sequence "identity" has an art-recognized meaning, and the percentage of sequence identity between two nucleic acid or polypeptide molecules or regions can be calculated using published techniques. Sequence identity can be measured along the full length of a polynucleotide or polypeptide or along a region of the molecule.

[0032] 2. Nucleic Acid Detection Methods

[0033] In a first aspect, the present invention provides a method for detecting the presence and / or amount of a target nucleic acid molecule in a sample, the method comprising the steps of:

[0034] (a) contacting the sample with: i) a Cas9 protein, ii) a gRNA directed against a target sequence in the target nucleic acid molecule, and iii) a nucleic acid reporter molecule capable of generating a detectable signal, thereby forming a reaction mixture;

[0035] (b) detecting the presence and / or level of a detectable signal produced in the reaction mixture,

[0036] The presence and / or level of the detectable signal represents the presence and / or amount of the target nucleic acid molecule.

[0037] In some embodiments, the target nucleic acid molecule is a double-stranded DNA molecule. In some embodiments, the target nucleic acid molecule is a single-stranded DNA molecule. In some embodiments, the target nucleic acid molecule is a single-stranded RNA molecule. The target nucleic acid molecule can be genomic DNA, mRNA, cDNA, viral RNA, viral DNA, etc., or fragments thereof.

[0038] "Cas9", "Cas9 nuclease" and "Cas9 protein" are used interchangeably herein to refer to an RNA-guided sequence-specific nuclease from a microbial CRISPR system. It is well known in the art that Cas9 can target and cut a DNA target sequence under the guidance of a guide RNA to form a DNA double-strand break (DSB), also known as cis-DNA cutting activity. The inventors surprisingly found that the complex of Cas9 and gRNA, after recognizing and binding to the corresponding target DNA sequence, can activate its non-specific single-stranded nucleic acid molecule, such as single-stranded DNA or single-stranded RNA cutting activity, also known as trans-ssDNA or ssRNA cutting activity. By utilizing the trans-single-stranded nucleic acid molecule cutting activity, a single-stranded DNA or RNA reporter molecule that produces a detectable signal after being cut can be cut, which can reflect the presence and / or amount of the target DNA. Herein, a DNA molecule that is recognized and bound by the complex of Cas9 and gRNA and activates the non-specific single-stranded nucleic acid molecule cutting activity of Cas9 is also referred to as an "activator".

[0039] Herein, the Cas9 protein can be a Cas9 protein from a different species, such as a Streptococcus species, a Staphylococcus species, or a Francisella species. In some embodiments, the Cas9 protein is a spyCas9 from Streptococcus pyogenes, a Cas9 from Staphylococcus aureus (SauCas9), or a Cas9 from Francisella novicida (FnCas9).

[0040] In peptides or proteins, suitable conservative amino acid substitutions are known to those skilled in the art and can generally be performed without changing the biological activity of the resulting molecule. Generally, those skilled in the art recognize that single amino acid substitutions in non-essential regions of a polypeptide do not substantially change the biological activity (see, for example, Watson et al., Molecular Biology of the Gene, 4th Edition, 1987, The Benjamin / Cummings Pub.co., p. 224). In particular, those skilled in the art will appreciate that different strains of Cas9 proteins in the same bacterial species may have certain differences in amino acid sequence, but can achieve substantially the same function. Therefore, the Cas9 of the present invention also encompasses variants (naturally occurring variants or artificial variants) of the natural Cas9 protein that retain a complete RuvC domain or a complete RuvC function, preferably, the variant does not comprise a mutation in the RuvC domain; and / or, the Cas9 of the present invention also encompasses variants (naturally occurring variants or artificial variants) of the natural Cas9 protein that retain a complete HNH domain or a complete HNH function, preferably, the variant does not comprise a mutation in the HNH domain. A person skilled in the art can easily identify the RuvC or HNH domain of the Cas9 protein, for example, using tools provided by NCBI.

[0041] In some embodiments, the Cas9 protein is recombinantly produced. In some embodiments, the Cas9 protein also contains a fusion tag, such as a tag for isolating and / or purifying the Cas9 protein. Methods for recombinant protein production are known in the art. In addition, a variety of tags that can be used to isolate and / or purify proteins are known in the art, including but not limited to His tags, GST tags, etc. Generally speaking, these tags do not alter the activity of the target protein.

[0042] In some embodiments, the Cas9 protein comprises an amino acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, at least 99.9% sequence identity to any one of SEQ ID NOs: 1-3. In some specific embodiments, the Cas9 protein comprises the amino acid sequence shown in any one of SEQ ID NOs: 1-3.

[0043] "Guide RNA" and "gRNA" are used interchangeably herein and are generally composed of crRNA and tracrRNA molecules that are partially complementary to form a complex, wherein the crRNA comprises a spacer sequence that can hybridize with a target sequence or its complementary sequence in a target nucleic acid molecule and can guide the CRISPR complex (Cas9+crRNA+tracrRNA) to bind to the target nucleic acid molecule in a sequence-specific manner. Single guide RNA (sgRNA) can also be designed and used, which simultaneously comprises the features of crRNA and tracrRNA. However, in a preferred embodiment, the guide RNA of the present invention is not sgRNA.

[0044] The target sequence that can be recognized by the Cas9-gRNA complex in the double-stranded DNA target nucleic acid molecule has a PAM (protospacer adjacent motif) sequence immediately adjacent to its 3' end, such as 5'-NGG-3'. In the case of double-stranded DNA, the chain where the target sequence is located is often referred to as the "non-target chain", and the chain where its complementary sequence is located is called the "target chain" (i.e., the chain that is complementary to the gRNA). Therefore, for double-stranded DNA target nucleic acid molecules, the spacer sequence of the gRNA can be set to be substantially the same as the target sequence, so that it can hybridize with the complementary sequence of the target sequence.

[0045] For single-stranded DNA or RNA target nucleic acid molecules (recognition by the Cas9-gRNA complex is independent of PAM), the spacer sequence of the gRNA can be configured to be substantially complementary to the target sequence, thereby enabling hybridization to the target sequence.

[0046] In some embodiments, the guide RNA is formed by a crRNA molecule and a tracrRNA molecule through partial complementarity.In some embodiments, the crRNA molecule and the tracrRNA molecule in the guide RNA are not covalently linked.

[0047] In some embodiments, the crRNA molecule comprises a sequence as shown in one of the following:

[0048] 5'-Nx -GUUUUAGAGCUAUGCUGUU-3' (corresponding to the crRNA of SpyCas9),

[0049] 5'-N x -GUUUCAGUUGCUGAAUUAUUUGGUAAAC-3' (corresponding to the crRNA of FnCas9),

[0050] 5'-N x -GUUUUAGUACUCUGUAAU-3' (corresponding to the crRNA of SauCas9), or

[0051] where N x represents a nucleotide sequence consisting of X consecutive nucleotides, each N being independently selected from A, G, C, and T; X is an integer greater than or equal to 17. In some embodiments, 17≤X≤35. Preferably, X=18. In some embodiments, N x is a spacer sequence that is capable of specifically hybridizing to the complementary sequence of the target sequence (the target nucleic acid molecule is a double-stranded DNA). x It is a spacer sequence that can specifically hybridize to the target sequence (the target nucleic acid molecule is single-stranded DNA or RNA).

[0052] In some embodiments, the tracrRNA molecule comprises a sequence as shown in one of the following:

[0053] 5'-UUCAAAACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUC-3' (corresponding to the tracrRNA of SpyCas9),

[0054] 5'-AUGUACCAAAUAAUUAAUGCUCUGUAAUCAUUUAAAAGUAUUUUGAACGGACCUCUGUUUGACACGUCUG-3' (corresponding to tracrRNA of FnCas9); or

[0055] 5′-GGUAUACCUAAAAUUACAGAAUCUACUAAAACAAGGCAAAAUGCCGUGUUUAUCUCGUCAACUUGUUGGCGAGAUC-3′ (corresponding to the tracrRNA of SauCas9).

[0056] In some embodiments, the gRNA is an sgRNA. In some embodiments, the sgRNA comprises a sequence as shown in one of the following:

[0057] 5'-N x -GUUUUAGAGCUAUGCUGUUUUGGAAACAAAACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUC-3' (sgRNA corresponding to SpyCas9);

[0058] 5'-N x -GUUUCAGUUGCGCCGAAAGGCGCUCUGUAAUCAUUUAAAAGUAUUUUGAACGGACCUCUGUUUGACACGUCUGUC-3' (sgRNA corresponding to FnCas9); or

[0059] 5'-N x -GUUUUAGUACUCUGGAAACAGAAUCUACUAAAACAAGGCAAAAUGCCGUGUUUC-3' (sgRNA corresponding to SauCas9);

[0060] where N x represents a nucleotide sequence consisting of X consecutive nucleotides, each N being independently selected from A, G, C, and T; X is an integer greater than or equal to 17. In some embodiments, 17≤X≤35. Preferably, X=18. In some embodiments, N x is a spacer sequence that is capable of specifically hybridizing to the complementary sequence of the target sequence (the target nucleic acid molecule is a double-stranded DNA). x It is a spacer sequence that can specifically hybridize to the target sequence (the target nucleic acid molecule is single-stranded DNA or RNA).

[0061] In some embodiments, the spacer sequence of the gRNA is configured to fully match the target sequence or its complementary sequence.

[0062] In some embodiments, the gRNA such as crRNA molecule and / or tracrRNA molecule are produced by in vitro transcription. In some embodiments, the gRNA such as crRNA molecule and / or tracrRNA molecule are produced by chemical synthesis.

[0063] In some embodiments of the present invention, the target nucleic acid molecule comprises a characteristic target sequence of 17-35 nucleotides in length, preferably 18 nucleotides in length.

[0064] In some embodiments of the present invention, particularly those related to double-stranded DNA detection, the target sequence has a PAM (protospacer adjacent motif) sequence immediately adjacent to its 3' end. For example, for SpyCas9 and FnCas9, the PAM is 5'-NGG-3'; for SauCas9, the PAM is 5'-NNGRRT-3'.

[0065] In the case of double-stranded DNA, the strand where the target sequence is located is often referred to as the "non-target strand", while the strand where its complementary sequence is located is called the "target strand" (i.e., the strand that complementarily binds to the gRNA). In some embodiments of the present invention, the target sequence does not contain a PAM sequence near it. In this case, a PAM sequence can be added by amplification.

[0066] In some embodiments of the present invention, the target sequence in the target nucleic acid molecule comprises at least one nucleotide mutation, such as a nucleotide mutation, relative to a reference sequence. In some embodiments, the at least one nucleotide mutation is set to any one or more nucleotides at the 13-17th position of the spacer sequence 3' to 5' direction corresponding to the gRNA. In some embodiments, the spacer sequence of the gRNA comprises 18 nucleotides, and the nucleotide mutation is set to the 17th nucleotide at the spacer sequence 3' to 5' direction located at the gRNA. In some embodiments, the at least one nucleotide mutation is a single nucleotide polymorphism (SNP). In some embodiments, the at least one nucleotide mutation is a disease-associated mutation. In some embodiments, the target sequence is distinguished from a reference sequence by the method.

[0067] The "nucleic acid reporter molecule" described herein is preferably a "single-stranded nucleic acid reporter molecule". The nucleic acid in the reporter molecule can be DNA or RNA. Preferably, the nucleic acid reporter molecule generates a detectable signal after being cleaved.

[0068] The "nucleic acid reporter molecule" may include a detectable label. The label can generate a detectable signal under appropriate conditions. The detectable label includes, but is not limited to, a fluorophore and / or a quencher group thereof, a chromophore, a detectable enzyme label, a biotin label, and a radioactive label.

[0069] In some embodiments, the "nucleic acid reporter molecule" may comprise a fluorophore and a quenching group thereof. For example, a "single-stranded nucleic acid reporter molecule" may comprise a fluorophore and a quenching group thereof at both ends of a single-stranded nucleic acid molecule such as a single-stranded DNA or single-stranded RNA molecule. When the single-stranded nucleic acid molecule is not cut, the fluorophore does not emit fluorescence due to the presence of the quenching group. However, when the Cas9-gRNA complex is activated by the target nucleic acid molecule and the nucleic acid single strand of the single-stranded nucleic acid reporter molecule is cut through its trans-ssDNA or ssRNA cutting activity, the fluorophore is released, thereby emitting fluorescence.

[0070] Suitable fluorophores and their corresponding quenching groups, as well as methods for labeling nucleic acid molecules thereof are known in the art. Suitable fluorophores include but are not limited to FAM, TEX, HEX, Cy3 or Cy5. Suitable quenching groups include but are not limited to BHQ1, BHQ2, BHQ3 or TAMRA. Suitable fluorophore-quenching group pairs include but are not limited to FAM-BHQ1, TEX-BHQ2, Cy5-BHQ3, Cy3-BHQ1 or FAM-TAMRA. Therefore, in some embodiments, the detectable signal is a fluorescent signal. In some embodiments, the fluorophore is FAM and the quenching group is BHQ1.

[0071] Alternatively, in other embodiments, the "nucleic acid reporter molecule" may also only contain a fluorophore, a chromophore, a detectable enzyme label, a biotin label, a radioactive label, etc. The cleavage of the nucleic acid reporter molecule can be detected by, for example, electrophoresis.

[0072] The length of the single-stranded nucleic acid in the single-stranded nucleic acid reporter molecule can be about 2 to about 500 or more nucleotides, such as about 2, about 4, about 8, about 10, about 12, about 14, about 16, about 18, about 20, about 150, about 200, about 500 or more nucleotides. The single-stranded nucleic acid in the single-stranded nucleic acid reporter molecule can contain any sequence, for example, the single-stranded nucleic acid can contain a random sequence.

[0073] In some embodiments, the single-stranded nucleic acid in the single-stranded nucleic acid reporter molecule is not polyA (polyadenylic acid) and polyG (polyguanylic acid). In some embodiments, the single-stranded nucleic acid in the single-stranded nucleic acid reporter molecule can be polyC (polycytidylic acid), polyT (polythymidylic acid) or polyU (polyuridylic acid).

[0074] In some preferred embodiments, the single-stranded nucleic acid in the single-stranded nucleic acid reporter molecule contains multiple consecutive Ts, multiple consecutive Cs, or multiple consecutive Us. In some preferred embodiments, the single-stranded nucleic acid in the single-stranded nucleic acid reporter molecule contains at least about 8, at least about 10, at least about 12, at least about 14 or more consecutive Ts, consecutive Cs, or consecutive Us. In some preferred embodiments, the multiple consecutive Ts, multiple consecutive Cs, or multiple consecutive Us are not located on the complex secondary structure of the single-stranded nucleic acid in the single-stranded nucleic acid reporter molecule. For example, the multiple consecutive Ts, multiple consecutive Cs, or multiple consecutive Us are not located within a stem-loop structure in the single-stranded nucleic acid. In some preferred embodiments, the single-stranded nucleic acid in the single-stranded nucleic acid reporter molecule does not contain a complex secondary structure such as a stem-loop structure.

[0075] In some specific embodiments, the single-stranded nucleic acid in the single-stranded nucleic acid reporter molecule comprises a nucleotide sequence selected from one of SEQ ID NOs: 203-204, 216-219, 222-225, 231-232, 236-238, 242, 244, and 259- 262. Preferably, the single-stranded nucleic acid in the single-stranded nucleic acid reporter molecule comprises the nucleotide sequence shown in SEQ ID NO: 259.

[0076] In some embodiments of the method of the present invention, the method further comprises a step of amplifying the nucleic acid molecules in the sample before or simultaneously with step (a). In some embodiments, the nucleic acid molecules or fragments thereof comprising the target sequence are amplified.

[0077] In some embodiments, the amplification is performed using primers containing a PAM sequence recognized by the Cas9, thereby introducing a PAM into the target sequence. This is particularly suitable for situations where the target sequence of interest in the target nucleic acid molecule to be detected does not itself have a PAM sequence, thereby eliminating the limitation of the method of the present invention when applied to double-stranded DNA due to the PAM.

[0078] The amplification includes, but is not limited to, PCR amplification, recombinase polymerase amplification (RPA), recombinase-aided amplification (RAA), LAMP amplification, ligase chain reaction, branched DNA amplification, NASBA, SDA, rolling circle amplification, HDA, SPIA, NEAR, TMA, and SMAP2. Preferably, the amplification is isothermal amplification, such as RPA or RAA amplification.

[0079] If the target nucleic acid molecule is RNA, the method may further comprise a reverse transcription step prior to amplification. The reverse transcription product may be used for subsequent amplification.

[0080] In some embodiments, the method further comprises a transcription step after the amplification. The transcription step transcribes the amplified DNA into an RNA molecule, and then proceeds to step (a). The inventors surprisingly discovered that using RNA molecules as detection targets can avoid being restricted by PAM sequences and can significantly improve detection sensitivity. In some embodiments, suitable elements for in vitro transcription, such as promoters, for example, T7 promoters, can be introduced during the amplification process.

[0081] However, in some embodiments of the method of the present invention, the method may not include an amplification step, i.e., a so-called amplification-free CRISPR / Cas detection method. The method of the present invention can be modified with reference to the article by Huimin Li et al. (Amplification-free CRISPR / Cas detection technology: challenges, strategies, and perspectives. Chemical Society Reviews, December 2022) to achieve amplification-free detection.

[0082] For example, in some embodiments, the reaction mixture in step (a) can be dispersed into multiple microdroplets so that each microdroplet contains the Cas9 protein, the gRNA for the target sequence in the target nucleic acid molecule, a nucleic acid reporter molecule capable of generating a detectable signal, and the target nucleic acid molecule that may be present. In some embodiments, Each microdroplet contains at most one target nucleic acid molecule. In some embodiments, the microdroplet is placed on a microdroplet chip. Then, the microdroplets that generate a detectable signal can be counted in step (b). In some embodiments, the microdroplets are counted by a fluorescence microscope. The presence and / or amount of the microdroplets that generate a detectable signal represents the presence and / or amount of the target nucleic acid molecule in the sample.

[0083] In some embodiments, prior to contacting with the sample, the Cas9 protein has been pre-complexed with the gRNA to form a Cas9-gRNA complex.

[0084] In some embodiments, step (a) comprises incubating the reaction mixture for a period of time.

[0085] In some embodiments, the reaction mixture is incubated for about 2 minutes to about 180 minutes, e.g., about 2 minutes, about 4 minutes, about 5 minutes, about 8 minutes, about 10 minutes, about 15 minutes, about 20 minutes, about 25 minutes, about 30 minutes, about 40 minutes, about 50 minutes, about 60 minutes, about 90 minutes, about 120 minutes, about 180 minutes, or any time therebetween.

[0086] In some embodiments, the incubation is performed at about 25°C to about 45°C, preferably at about 37°C.

[0087] In some embodiments, the reaction mixture of step (a) comprises a buffer, for example containing Mg 2+In some embodiments, the buffer comprises a final concentration of approximately 50 mM NaCl, approximately 10 mM Tris pH 7.9, approximately 10 mM MgCl2, and approximately 1 mM DTT. In some embodiments, the buffer comprises a final concentration of approximately 150 mM NaCl, approximately 20 mM Tris pH 7.9, approximately 10 mM MgCl2, and approximately 3 mM DTT. In some embodiments, the buffer comprises a final concentration of approximately 100 mM NaCl, approximately 20 mM Tris pH 7.9, approximately 10 mM MgCl2, and approximately 3 mM DTT. In some embodiments, the buffer comprises a final concentration of approximately 150 mM NaCl, approximately 20 mM Tris pH 7.5, approximately 10 mM MgCl2, and approximately 2 mM TCEP. In some preferred embodiments, the buffer comprises a final concentration of about 50 mM NaCl, about 10 mM Tris, about 10 mM MgCl2, about 100 μg / ml BSA, pH 7.9. In some preferred embodiments, particularly those using a single-stranded RNA reporter, the buffer comprises a final concentration of about 50 mM potassium acetate, about 10 mM Tris, about 10 mM magnesium acetate, about 100 μg / ml BSA, pH 7.9.

[0088] In some embodiments, the concentration of the Cas9 in the reaction mixture is about 1 pm to about 500 nM.

[0089] In some embodiments, the concentration of the nucleic acid reporter molecule in the reaction mixture is about 50 nM to about 800 nM.

[0090] In some embodiments, the concentration of the target nucleic acid molecule in the reaction mixture is at least about 0.3 copies / μl, at least about 0.5 copies / μl, at least about 0.75 copies / μl, at least about 1 copy / μl.

[0091] In some embodiments, the methods can detect as low as about 1 copy / μl, about 0.75 copies / μl, about 0.5 copies / μl, or even about 0.3 copies / μl of a target nucleic acid molecule.

[0092] In some embodiments, the incubation of step (a) and step (b) are performed simultaneously. In some embodiments, the detectable signal generated in the reaction mixture is detected during the entire incubation process. The detection means of the detectable signal depends on the specific detectable label used and is known to those skilled in the art.

[0093] In another aspect, the present invention provides a method for identifying the type of nucleotide at at least one nucleotide position in a target nucleic acid molecule in a sample, the method comprising:

[0094] a) detecting the presence of a target nucleic acid molecule comprising a first type of nucleotide at said at least one nucleotide position in the sample by the method of the present invention; and

[0095] b) detecting the presence of a target nucleic acid molecule comprising a second type of nucleotide at said at least one nucleotide position in the sample by the method of the present invention.

[0096] In some embodiments, the at least one nucleotide position is set to any one or more nucleotides at the 13th to 17th position of the spacer sequence 3' to 5' direction corresponding to the gRNA. In some embodiments, the spacer sequence of the gRNA includes 18 nucleotides, and the at least one nucleotide position is set to the 17th nucleotide at the spacer sequence 3' to 5' direction corresponding to the gRNA. In some embodiments, the target nucleic acid molecule includes a single nucleotide polymorphism (SNP) at the at least one nucleotide position. In some embodiments, the target nucleic acid molecule includes a disease-associated mutation at the at least one nucleotide position, such as a mutation of the nucleotide causing a T790M mutation of EGFR.

[0097] The sample of the present invention can be a biological sample. Biological samples that can be used in the methods of the present invention include, but are not limited to, whole blood, plasma, serum, cerebrospinal fluid, urine, feces, cell or tissue extracts, and the like. The biological sample encompasses nucleic acid samples extracted from cells or tissues. The biological sample can be from animals, plants, humans, microorganisms such as fungi, bacteria, or viruses, and the like.

[0098] The sample of the present invention may also be an environmental sample. The environmental sample encompasses nucleic acid samples extracted from the environment, such as water, soil, etc.

[0099] Also included within the scope of the present invention are kits for the methods of the present invention, including reagents for implementing the methods of the present invention, and instructions for use. For example, the kit may include a Cas9 protein (e.g., a Cas9 protein of the present invention), a gRNA (crRNA molecule and / or tracrRNA molecule or sgRNA molecule) or a reagent for producing a gRNA (crRNA molecule and / or tracrRNA molecule or sgRNA molecule), a nucleic acid reporter molecule (e.g., a single-stranded nucleic acid reporter molecule of the present invention), a suitable buffer (e.g., the buffer described in the present invention), and / or a nucleic acid amplification reagent. The kit generally includes a label indicating the intended use and / or method of use of the contents of the kit. The term label includes any written or recorded material provided on or with the kit or otherwise provided with the kit.

[0100] The present invention also provides the use of the Cas9 protein, gRNA, nucleic acid reporter molecule, buffer and / or nucleic acid amplification reagent defined above in the preparation of a kit for use in the method of the present invention. Example

[0101] The present invention will be further illustrated below by way of examples, but the invention is not limited to the scope of the examples described. It should be understood that within the scope of the present invention, the different aspects and different technical features of the different embodiments of the present invention described above and the different technical features specifically described in the examples below can be combined with each other to form new or preferred embodiments. Due to space limitations, they will not be listed here one by one.

[0102] Protein expression and purification

[0103] Full-length Streptococcus pyogenes Cas9 (SpyCas9), Staphylococcus aureus Cas9 (SauCas9) and Francisella neocidae Cas9 (FnCas9) DNA sequences were synthesized by SYNBIOB GENE and cloned into a modified pET28a-His6SUMO vector using a one-step cloning kit (Vazyme, catalog number: C112-02). Escherichia coli Rosetta (DE3) (Novagen) cells transformed with the overexpression plasmids were grown at 37°C to an OD600 of 0.6 to 0.8 and induced with 0.1 mM propyl-1-thio-β-D-galactopyranoside (IPTG) at 16°C for 14 hours. The harvested cells were resuspended in buffer A (20 mM Tris-HCl pH 7.5, 500 mM NaCl). After sonication and centrifugation, the supernatant was purified using Ni Sepharose (GE Healthcare), and the target protein was eluted with buffer B (20 mM Tris-HCl pH 7.5, 300 mM NaCl, 300 mM imidazole). The eluted protein was digested with homemade Ulp1 protease at 4°C for 2 hours and then loaded onto a heparin HP column (Cytiva) with an elution buffer containing 20 mM Tris-HCl pH 7.5 and 1 M NaCl. The protein was then purified using a Superdex200 Improve 10 / 300 gel filtration column (Cytiva) pre-equilibrated with buffer C containing 20 mM Tris pH 7.5, 500 mM NaCl, and 2 mM dithiothreitol (DTT), and further concentrated to a concentration of 25 mg / ml. The indicated mutants were prepared in the same manner.

[0104] RNA preparation

[0105] All crRNAs and target RNAs mentioned in this study were synthesized by GenScript. sgRNA and tracrRNA were obtained by T7 polymerase-dependent in vitro transcription. All transcription templates containing the T7 promoter, RNA template sequence, and ribozyme sequence were synthesized by Synbio Gene and cloned into the pUC19 vector. Template plasmids were linearized by Hind III digestion and extracted using phenol / chloroform and ethanol precipitation. The in vitro transcription system consisted of 100 mM HEPES-KOH, pH 7.9, 2 mM of each rNTP, 2 mM spermidine, 20–30 mM MgCl₂, 30 mM DTT, 0.1 mg / ml T7 RNA polymerase, and 40 ng / μl of the linearized plasmid template. The cells were incubated in a 37°C water bath for 3–4 hours. After transcription, the reaction products were further purified using 20% ​​denaturing preparative polyacrylamide gel electrophoresis (PAGE) and an Elutrap electroelution system. Finally, the alcohol-precipitated RNA was resuspended in diethylpyrocarbonate (DEPC)-treated water, divided into small aliquots, and stored at −40°C before use.

[0106] Fluorophore-labeled trans-cleavage assay

[0107] Fluorophore-labeled nonspecific ssDNA / dsDNA / ssRNA was synthesized by Sangon Biotechnology. The assay was performed in a 0.2 ml PCR tube with a total reaction volume of 10 μl. The lysis buffer contained 20 mM Tris-HCl pH 7.5, 150 mM NaCl, 10 mM MgCl2. For the Cas9-sgRNA trans-cleavage assay, 250 nM sgRNA, target DNA, and 250 nM fluorophore-labeled nonspecific substrate were added to the reaction system in sequence, and then 250 nM Cas9 was added to start the reaction. The reaction was incubated at 37 ° C for the designated time points and terminated by adding an equal volume of loading buffer (8 M urea, 0.5 M EDTA). The reaction samples were analyzed by 20% denaturing PAGE and visualized using a chemiluminescence imaging system (Sagecreation). The percentage of cleavage was quantified by band density determination. A similar method was used for the Cas9-tracrRNA-crRNA trans-cleavage assay.

[0108] M13 ssDNA trans-cleavage assay

[0109] The assay was performed in a reaction mixture containing 20 mM Tris-HCl pH 7.5, 150 mM NaCl, 10 mM MgCl2, 35 ng / μl commercial M13mp18 ssDNA (New England Biolabs), 187.5 nM target DNA, and 187.5 nM sgRNA / tracrRNA-crRNA. The reaction was started by adding 150 nM Cas9 protein, in a final volume of 10 μl, and incubated at 37°C for 0 to 30 min. 10 μl of 50 mM EDTA was added at the designated time points to quench the reaction. The reaction samples were then mixed with 5× prestained DNA loading buffer (Generay) and separated by 1.5% agarose gel.

[0110] Fluorescence quenching probe assay

[0111] 5'-FAM and 3'-BHQ1-labeled ssDNA / ssRNA probes were synthesized by Sangon Biotechnology. For the general tracrRNA-crRNA system, the reaction was assembled from 45nM SpyCas9 protein, 45nM tracrRNA-crRNA, 50nM activator, and 500nM probe in a total volume of 20μl in the wells of a white low-capacity 384-well plate (Corning). The reaction was carried out at 37°C in a buffer containing 20mM Tris-HCl pH 7.5, 150mM NaCl, and 10mM MgCl2. The fluorescence signal (485nm excitation and 535nm emission) was monitored by a Tecan Infinite E plex with an interval of 30s. The optimization of fluorescence gain was calculated based on the negative control wells without activator. For each sample: net fluorescence intensity = fluorescence intensity (corresponding time point) - fluorescence intensity (zero time point).

[0112] To determine the kinetic parameters of the FQ probe, a reaction containing 312.50 nM FQ probe, 25 nM SpyCas9, tracrRNA-crRNA, and activator was incubated at 37°C for 2 hours to ensure that all FQ probes were cleaved. A fluorescence intensity standard curve for cleavage-FQ probe concentration was then established using serial two-fold dilutions of a reaction solution containing 312.50 nM cleavage-FQ probe and 25 nM SpyCas9, tracrRNA-crRNA / sgRNA, activator, and 1× reaction buffer. The reaction solution was assembled using serial dilutions of FQ probe concentrations (39.06, 78.12, 156.25, 312.50, 625.00, 1250.00 nM) and a 1:1:1 molar ratio of SpyCas9:tracrRNA-crRNA / sgRNA:activator (25-125 nM) and incubated for continuous fluorescence detection at 37°C for 10 minutes. The initial velocity (V0) calculated using a linear fit was plotted against the FQ probe concentration, and the Michaelis-Menten constant was determined using Graphpad Prism software version 9.0.

[0113] Microscale thermophoresis (MST) assay

[0114] The target ssDNA (Sangon Biotech) was labeled with Cy5 at the 5' end at a final concentration of 400 nM and incubated with 400 nM SpyCas9 and sgRNA1 in a buffer containing 20 mM Tris-HCl pH 7.5, 200 mM NaCl, 10 mM MgCl2, 0.01% Tween 20 for 30 minutes on ice in a total volume of 200 μl. Next, a 20 μl volume of 917.38 μM nonspecific ssDNA (polyA18, polyT18, polyG18, and polyC18) was prepared in a 0.2 ml PCR tube, dissolved in ddH2O, and serial two-fold dilutions were performed by transferring 10 μl from the 917.38 μM nonspecific ssDNA. The solution was added to a test tube containing 10 μl of buffer (20 mM Tris-HCl pH 7.5, 200 mM NaCl, 10 mM MgCl2, 0.01% Tween 20). 10 μl of two-fold diluted nonspecific ssDNA (ligand) was then mixed with an equal volume of 400 nM SpyCas9-sgRNA*-TS (target) and loaded into a Monolith standard-treated capillary. Monolith Pico (Nano Temper) was used for measurement and excitation with a red laser at 25 ° C for 20 seconds and an MST power of 40%. Data were analyzed using MO. Kd values ​​were determined using Affinity Analysis v3.0.5 software. The assay was repeated three times.

[0115] DNA-activated Cas9 detection (DACD)

[0116] In Cas9-dependent assays, T 13 The cleavage of the -FQ probe was activated by dsDNA fragments amplified by PCR using PrimerSTAR (TaKaRa, catalog number: DR044A). -1 , 3.05, 3.05×10, 3.05×10 2 The dsDNA activator was amplified in a 50 μl PCR system using 0.2 μM primers B6R_F1 and B6R_R1, and purified using the SteadyPure PCR DNA purification kit (Accurate Biology). The sample volume was 30 μl after elution with ddH2O. 8 μl of the purified PCR product was added to a 50 μl PCR system containing 100 nM SpyCas9-tracrRNA1-crRNA2, 1 μM T 13The reaction was activated at 37°C for 90 minutes using a 10 μl Cas9 detection mixture containing a -FQ probe and 1× reaction buffer (20 mM Tris pH 7.5, 150 mM NaCl, 10 mM MgCl2, 2 mM TCEP). Statistical analysis of net fluorescence intensity over 90 minutes was performed using an unpaired t-test (Graphpad Prism 9.0). The PCR template was obtained by digital PCR using a ten-fold dilution of the pCDH-B6R plasmid, which was quantified at an initial concentration of 1526.67 ± 133.71 copies / μl.

[0117] RNA-activated Cas9 detection (RACD)

[0118] The first step of the assay is RNA amplification. For the detection of the B6R gene in the pCDH plasmid, a 24.25 μl recombinase-assisted amplification (RAA) system (ZC Bioscience, catalog number: S001ZC) was assembled with 20 μl of resuspended RAA solution (one tube of RAA lyophilized powder was dissolved in 25 μl of buffer a and 18 μl of ddH2O provided in the RAA kit), 1 μl of B6R_F2 (10 μM), 1 μl of B6R_R2 (10 μM), 1 μl of template, and 1.25 μl of buffer and incubated at 39°C for 20 minutes. Then, 3 μl of the RAA amplification product was directly added to a 60 μl transcription system containing 20 mM MgCl2, 30 mM DTT, 4.5 mM of each rNTP, 2 mM spermidine, and 0.1 mg / ml T7 RNA polymerase. Transcription was performed at 37°C for 2 h and further purified using the UNIQ-10 Spin Column Oligo DNA Purification Kit (Sangon Biotechnology, Cat. No. B511143-0100). 30 μl of sample was eluted with DEPC-H O. Then, 8 μl of purified RNA was added to activate 10 μl of the Cas9 detection system, as described for the DACD assay.

[0119] The wild-type pseudovirus standard containing the monkeypox B6R gene was purchased from the National Institute of Metrology (NIM-RM4059). The standard value of the reference substance was (2.34±0.40)×10 3The control was diluted fivefold to serve as a template for RAA amplification. During the assay, the B6R-pseudovirus was first heated at 95°C for 5 minutes to inactivate the virus. A 24.25 μl RAA system was assembled with 20 μl of resuspended RAA solution, 1 μl of B6R_F4 (10 μM), 1 μl of B6R_R3 (10 μM), 1 μl of B6R-pseudovirus template, and 1.25 μl of buffer and incubated at 39°C for 20 minutes. Then, 60 μl of T7 transcription system (20 mM MgCl2, 30 mM DTT, 4.5 mM of each rNTP, 2 mM spermidine, and 0.1 mg / ml T7 RNA polymerase, 6 μl of RAA product) was incubated at 37°C for 1.5 hours. After column purification, 8 μl of sample in 30 μl of eluate was mixed with 10 μl of Cas9 detection system (500 nM SpyCas9-tracrRNA1-crRNA5, 1 μM T 13 The -FQ probe and 1× reaction buffer (20 mM Tris pH 7.5, 150 mM NaCl, 10 mM MgCl 2 , 2 mM TCEP) were mixed at 37° C. for 25 minutes.

[0120] In the assay for distinguishing monkeypox B6R (CB) from different orthopoxviruses or clades by DACD or RACD, point mutations were made in the target region of the pCDH-B6R plasmid to mimic the corresponding virus. Amplification and purification of the target dsDNA / ssRNA activator were performed as described in the DACD (primers: B6R_F3 / R3) and RACD (primers: B6R_F4 / R3) assays, respectively. The concentration and purity of the target dsDNA / ssRNA were determined spectrophotometrically (TGem Pro, TIANGEN). 8 μl of purified dsDNA / RNA adjusted to the same concentration was then added to initiate a 10 μl Cas9 detection system (100 nM SpyCas9-tracrRNA1-crRNA5, 1 μM T 13 The fluorescence intensity of the cells was analyzed using an unpaired t-test (Graphpad Prism 9.0) with a 1× reaction buffer (20 mM Tris pH 7.5, 150 mM NaCl, 10 mM MgCl 2 , and 2 mM TCEP).

[0121] In the respiratory syncytial virus A simulation test, RSV-A RNA standards were purchased from the National Institute of Metrology (No. NIM-RM4057) with a concentration of (6.1±1.40)×10 4Copies / μl. This method is similar to the B6R pseudovirus detection, except that a reverse transcription step is required. RNA amplification uses the RT-RAA Nucleic Acid Amplification Kit (Qitian Gene Biotechnology Co., Ltd., Cat. No.: B00R00). The reaction mixture contains 20μl of resuspended RT-RAA solution (one tube of RT-RAA lyophilized powder dissolved in 25μl buffer V and 14μl ddH2O provided in the kit), 1μl RVA_F1 (10μM), 1μl RVA_R1 (10μM), 1μl of serial five-fold diluted template and 2.5μl magnesium acetate I. The final reaction volume is 25.5μl, and the reaction is initiated at 37°C for 30 minutes. crRNA6 is used in the Cas9 detection step.

[0122] When detecting the EGFR T790M mutant, human genomic DNA extracted from HEK293T cells was amplified by PCR using primers EGFR_F1 and EGFR_R1 to a 532bp gene fragment containing the wild-type (WT) EGFR T790 site and subcloned into the pETDuet vector. The T790M mutant was obtained by QuickChange site-directed mutagenesis. A simulated substrate of circulating tumor DNA containing the EGFR (T790M) mutation was prepared by mixing a certain ratio (0.1%, 0.5%, 1%, 100% T790M mutant and 100% WT) of a 142bp gene fragment containing the target mutation amplified by PCR from the 532bp gene fragment using primers EGFR_F2 and EGFR_R2 and fragmented wild-type genomic nucleic acid. The concentrations of the WT and T790M mutant 142bp gene fragments before mixing were determined by spectrophotometry. 0.06 ng of the simulated substrate was placed in a 25 μl PCR reaction system containing 0.2 μM primers EGFR_F2 and EGFR_R2. After purification by spin column, 200 ng of the purified DNA template was assembled into a 60 μl T7 transcription reaction. Transcription was performed at 37 ° C for 2 hours. Then, 8 μl of the sample in the 30 μl eluate was mixed with 10 μl of Cas9 detection system (500 nM SpyCas9-tracrRNA1-crRNA7, 1 μM T 13 -FQ probe and 1× reaction buffer) were mixed at 37° C. The net fluorescence intensity at 38.5 min was analyzed for differences using unpaired t-test analysis (Graphpad Prism 9.0).

[0123] Example 1: Cas9 exhibits trans-ssDNA cleavage activity

[0124] In order to study the trans-ssDNA cleavage activity of Cas9, the nonspecific ssDNA binding ability of Cas9 was first verified by structural analysis and micro-thermophoresis (MST) assay (Figure 1a, b). Previous studies have determined the nonspecific ssDNA binding structure of AacCas12b, and by superimposing this structure with the structure of the Streptococcus pyogenes Cas9 (SpyCas9) complex, the binding of ssDNA substrates in the RuvC catalytic site of SpyCas9 was simulated (Figure 1a), indicating that the RuvC catalytic site of SpyCas9 can also accommodate nonspecific ssDNA. Cas12 and Cas13 showed deviations for different homopolymeric reporter genes used for DNA detection, indicating that Cas9 may also have nonspecific ssDNA substrate binding and cutting preferences. The binding preference of the SpyCas9-sgRNA-target ssDNA complex on nonspecific homopolymeric ssDNA substrates was first analyzed, and it was found that SpyCas9 prefers poly T and poly C (Figure 1b). SpyCas9 showed the strongest binding affinity for Poly T, but almost no binding affinity for Poly A and Poly G. Next, the cleavage preference of the Cas9-sgRNA-target ssDNA complex for Cy5-labeled non-specific homopolymer ssDNA substrates was analyzed. The results showed that SpyCas9, Francisella Novicida Cas9 (FnCas9) and Staphylococcus aureus Cas9 (SauCas9) all exhibited cleavage activity against poly T and poly C, but almost no cleavage activity against poly A and poly G (Figure 1c and Figure 6). Like the Cas12b enzyme, Cas9 orthologs showed optimal cleavage for poly T (Figure 1e). In addition to ssDNA substrates, the cleavage preference of the Cas9 complex was examined using dsDNA substrates formed by poly A and poly T, as well as poly C and poly G. The results showed that these dsDNA substrates were difficult to be trans-cleaved by Cas9 (Figure 1d). It was shown that Cas9 could only efficiently trans-cleave T- or C-rich ssDNA substrates, but not dsDNA substrates, similar to Cas12a and Cas12b enzymes.

[0125] Example 2, crRNA and tracrRNA-dependent trans-cleavage

[0126] sgRNA is a chimera of truncated crRNA and tracrRNA, and is designed to guide sequence-specific cis-cutting of target DNA. Compared with cis-cutting guided by crRNA and tracrRNA, cis-cutting guided by a single sgRNA exhibits almost the same working efficiency. Although the chimeric sgRNA has little effect on cis-cutting of target DNA, it is not clear whether it has an effect on trans-cutting of non-specific DNA. Then, the trans-cutting activity of SpyCas9 on ssDNA was first detected using crRNA and tracrRNA dual RNA. It was found that SpyCas9 guided by crRNA and tracrRNA had strong cutting activity on poly T and poly C, weaker cutting activity on poly A, and almost no cutting activity on poly G (Figure 2a, b). It is worth noting that the time required for sgRNA-guided SpyCas9 to completely digest poly T is about 30 minutes, while the time required for crRNA and tracrRNA-guided Cas9 to completely cut poly T is only about 4 minutes (Figure 1b and Figure 2a). These observations suggest that crRNA- and tracrRNA-guided trans-cleavage may be more efficient than sgRNA-guided trans-cleavage.

[0127] Next, the catalytic efficiency (kcat / Km) of crRNA and tracrRNA-guided trans-cleavage and sgRNA-guided trans-cleavage using ssDNA reporter substrates labeled with fluorophore quenchers (FQ) and various ssDNA and dsDNA activators was calculated. The results showed that when ssDNA activators or dsDNA activators were used, the catalytic efficiency of trans-cleavage induced by crRNA and tracrRNA was approximately 7-12 times that of trans-cleavage induced by sgRNA (Figure 2c and Figure 7). When using ssDNA activators, the maximum catalytic efficiency (kcat / Km) of trans-cleavage guided by crRNA and tracrRNA was 8.80×10 3 s -1 M -1 , while the maximum catalytic efficiency of sgRNA-guided trans-cleavage was 9.30×10 2 s -1 M -1 It was also found that the catalytic efficiency of ssDNA-activated Cas9 trans-cleavage was better than that of dsDNA-activated Cas9 trans-cleavage, regardless of whether sgRNA or crRNA and tracrRNA were used as guide RNAs. This result is inconsistent with the observations of ssDNA and dsDNA-activated Cas12a trans-cleavage.

[0128] In addition, the trans-cleavage activity of Cas9 was tested using M13 phage DNA substrate. Although the Cas9 guided by sgRNA cannot catalyze the trans-degradation of M13 and ssDNA activator under given conditions, it was surprisingly found that when crRNA, tracrRNA and ssDNA activator are present under the same conditions, M13 can be completely degraded by Cas9. Conditions (Fig. 2d and Fig. 8a). Cy5-labeled oligonucleotide ssDNA and dsDNA substrates containing random sequences were also used to verify the trans-cleavage of crRNA and tracrRNA-guided Cas9. It was found that although the dsDNA substrate remained intact, the ssDNA substrate was rapidly degraded by Cas9 (Fig. 2e and Fig. 8b, c). These results show that Cas9 also has crRNA and tracrRNA dependency, target DNA-activated ssDNA trans-cleavage activity.

[0129] Example 3. Sequence and structural preferences of trans-cleavage

[0130] Like Cas12 and Cas13, Cas9 also has its own reverse cutting substrate preference. In order to determine the sequence and structural requirements for the best cleavage of ssDNA substrates, the sequence and structural preferences of SpyCas9 were analyzed using a variety of DNA substrates with different sequences and structures. Since previous trans-cleavage experiments showed that Cas9 preferentially cuts ssDNA substrates rich in T or C, we first tried to determine whether there is a sequence length requirement for poly T or poly C in ssDNA substrates to achieve optimal cleavage. The enzyme digestion results showed that the sequence length of poly T or poly C in the substrate had a significant effect on trans-cleavage (Figure 3a, b). Substrates containing more than 10 to 12 consecutive T or C were completely cut by Cas9 within 10 minutes, while substrates containing less than 6 consecutive T or C were less than 50% cut by Cas9 in the same time. Cas9 showed reduced cutting efficiency for substrates containing less than 10 consecutive T or C. Next, we studied whether the secondary structure of the ssDNA substrate affects trans-cleavage. It was found that Cas9 was almost unable to degrade ssDNA substrates that formed stem-loop structures without any nucleotides on the flanks, regardless of whether poly T or poly C was located in the stem or loop region of the substrate (Figure 3c, d). However, Cas9 showed strong cleavage ability for ssDNA substrates containing stem-loops and poly T or poly C in the 5' or 3' flanking region of the stem. These findings suggest that Cas9 may preferentially cleave ssDNA substrates containing multiple consecutive T or C nucleotides that do not participate in the formation of complex secondary structures. The substrate preference of Cas9 was further confirmed by performing cleavage experiments using synthetic phage ssDNA containing poly T with a free single-stranded structure (Figure 3e and Figure 9a). Cas9 exhibited strong degradation activity against these poly T-containing substrates (Figure 3f-h and Figure 9b, c). However, when the poly T in the substrate was replaced by poly A, Cas9 exhibited weaker activity against these mutant substrates.

[0131] In addition, cleavage assays showed that Cas9's trans ssDNA cleavage is RuvC domain-dependent (Figure 10). Since the RuvC domain is also responsible for cis-cleavage of the non-complementary strand of the target dsDNA, it is hypothesized that Cas9 may have the same sequence preference for RuvC domain-dependent trans ssDNA cleavage and cis-cleavage of the non-complementary DNA strand. Four target double-stranded DNA substrates were designed, each containing eight consecutive A, T, C, and G sequences in the cleavage site region. Cleavage experiments using these substrates showed that all complementary strands of these substrates could be rapidly cleaved by Cas9 (Figure 11a), while only the non-complementary strands containing poly T or poly C could be well cleaved by Cas9 (Figures 11a, 11b). Cas9 had little activity against non-complementary strands containing poly A or poly G. Using plasmid DNA substrates, it was also found that the sequence length of the poly T or poly G in the cleavage site region also significantly affected the cleavage of the non-complementary strand (Figure 11c). The longer the poly T sequence, the easier the substrate was to cleave, while the longer the poly G sequence, the more difficult the substrate was to cleave (Figure 11d). Together, these results indicate that RuvC domain-dependent target DNA cis-cleavage prefers T- or C-rich substrates, which is consistent with RuvC domain-dependent ssDNA trans-degradation.

[0132] Example 4: DNA or RNA target binding triggers trans-cleavage

[0133] To determine the requirements for Cas9-catalyzed trans-cleavage activity, an FQ-labeled reporter gene assay was performed using a Cas9 complex assembled from Cas9, its crRNA, tracrRNA, and target ssDNA, target dsDNA, or target ssRNA. The results showed that target ssDNA, dsDNA, and ssRNA could all activate the trans-cleavage activity of Cas9 (Figure 4a). Among the three activators, the activation efficiency of target ssDNA was higher than that of target dsDNA and target ssRNA (Figure 4b). At a concentration of 125 pmolar, target ssDNA was also able to trigger SpyCas9 to rapidly degrade the ssDNA reporter substrate (Figures 12a-c). Notably, in the presence of the activator, Cas9 not only exhibited the activity of cutting the ssDNA-FQ reporter substrate, but also the activity of degrading the ssRNA-FQ reporter substrate (Figures 4c, d). The catalytic efficiency of trans-cleavage of ssDNA-FQ and ssRNA-FQ substrates was compared. The results showed that when target ssDNA and dsDNA were used as activators, the catalytic efficiency of trans-cleavage of ssDNA-FQ substrates was approximately 18-fold and 48-fold that of trans-cleavage of ssRNA-FQ substrates, respectively ( Figure 2 c and Figure 4 e, f ), indicating that the nonspecific ssDNase activity of Cas9 is stronger than the ssRNase activity.

[0134] To determine whether target binding is required for activation, the trans-cleavage activity of Cas9 was first tested using various truncated and mismatched target DNA activators. When a mismatch occurred between positions 13-18 of the target DNA, Cas9 exhibited very little trans-cleavage activity (Figure 12d), indicating that nucleotide recognition at positions 13-18 of the target DNA is important for trans-activation. In addition, complete activation of trans-cleavage requires at least 18 nucleotides of the target DNA to be complementary to crRNA (Figure 12e, f). When the target DNA contained only 17 nucleotides complementary to crRNA, the trans-cleavage activity was significantly reduced. Target DNA containing less than 17 nucleotides had almost no ability to trigger trans-cleavage. These observations suggest that nucleotides at positions 16-18 of the target DNA may play a key role in Cas9 activation. Next, the crystal structures of the SpyCas9-guide RNA complex bound to 16-nt, 17-nt or 18-nt complementary target DNA were determined (Figure 13a, b). The conformation of Cas9 in the three target DNA binding structures of different lengths showed little change, indicating that recognition of nucleotides 16-18 of the target DNA does not seem to directly induce conformational activation of Cas9. In addition to the formation of the 18-nt guide DNA duplex, the activation of trans-cleavage definitely requires Mg. 2+ coordination, because Mg 2+ It is crucial for the conformational activation of the Cas9 nuclease domain.

[0135] To explore why the target RNA is less capable of triggering the trans-catalytic activity of Cas9 than the target ssDNA, the crystal structure of SpyCas9 in complex with guide RNA and target RNA was determined (Figure 4g-I). SpyCas9 adopts a bio-lobed structure consisting of a recognition (REC) lobe and a nuclease (NUC) lobe, and the guide-target RNA duplex is accommodated in the channel between the REC and NUC lobes. Structural superposition shows that the REC2, REC3, and HNH domains in Cas9 undergo significant conformational changes after binding to the target ssDNA (Figure 14a), while only the REC3 domain in Cas9 undergoes significant conformational changes after binding to the target RNA (Figure 14b-e). The guide-target duplex binding channel is mainly formed by the REC2, REC3, and HNH domains. Compared to the guide-target RNA duplex binding channel, Cas9 has a more compact guide-target ssDNA duplex binding channel (Figure 14e) because target ssDNA binding induces larger conformational changes in the REC2 and HNH domains than target RNA binding. In addition, structural comparison of the SpyCas9-guide RNA-target RNA complex with the SpyCas9-guide RNA-target ssDNA complex showed that there are significant conformational differences between the guide-target DNA and guide-target RNA duplexes (Figure 14f). Notably, the guide-target DNA heteroduplex adopts a distorted A-type RNA duplex conformation, while the guide-target RNA duplex forms a typical B-type RNA duplex conformation (Figure 14g).

[0136] Example 5: Nucleic Acid Detection Using CRISPR-Cas9

[0137] Next, we explored whether the target-activated trans-cleavage activity makes it possible for Cas9 to be developed as a universal, highly specific nucleic acid detection platform based on Cas9. Based on nucleic acid amplification technology and the target DNA-activated trans-cleavage activity of Cas9, we first developed a method for target nucleic acid detection, called DNA-activated Cas9 detection (DACD) (Figure 5a). The sensitivity of this method for detecting the monkeypox virus extracellular envelope protein B6R gene was studied. The results showed that using DACD detection, the target B6R gene could be detected at a concentration of 0.3 copies / μl (Figures 5b, c).

[0138] Because in addition to target dsDNA, target RNA can also activate the trans-cleavage activity of Cas9. By combining the target RNA-activated trans-cleavage activity of Cas9, recombinase-assisted amplification (RAA), and T7 polymerase-dependent RNA transcription, another nucleic acid detection platform, called RNA-activated Cas9 detection (RACD), was developed (Figure 5d). The effectiveness and detection limit of the RACD system with the B6R gene were evaluated. The RACD system showed a continuous fluorescence signal, indicating that the trans-cleavage activity of Cas9 was effectively activated by the target RNA (Figure 5e). When the target B6R gene concentration was 0.75 copies / μl, a significant fluorescence signal was still observed (Figure 5f), indicating that RACD has high sensitivity for B6R gene detection. Moreover, since RACD is completely independent of the PAM sequence, it is more compatible with commonly used isothermal amplification techniques. Monkeypox virus B6R-pseudovirus was further used to detect monkeypox virus by RACD. RACD detection achieved a significant signal-to-noise ratio within 5 minutes, and the detection sensitivity reached 0.145 copies / μl within 2 hours (Figure 5g). The ability of RACD to detect RNA viruses was also tested. The results showed that RACD was able to detect 3.83 copies / μl of pre-purified RSV AN gene RNA within 2.5 hours (Figure 5h).

[0139] Next, we explored the specificity of Cas9 detection activated by dsDNA or RNA activators. Monkeypox-specific detection is difficult to achieve due to the high sequence similarity with other orthopoxviruses. To verify the species-specific recognition of monkeypox virus by the Cas9 detection platform, target sequences for RACD and DACD detection were selected. This target sequence is derived from the B6R gene and differs by 3 bases between monkeypox and cowpox in the 18-nt guide complementary region (Figure 5i). Both RACD and DACD detection showed significantly different fluorescence signals for the monkeypox and cowpox target sequences (Figure 5h and Figure 15a), indicating that both RACD and DACD detection can distinguish monkeypox from cowpox.

[0140] Mismatch analysis of three target sequences revealed that when there was an 18-nt complementary sequence between the target DNA and crRNA, a mismatch at position 17 of the target sequence significantly reduced the trans-cleavage activity of Cas9 (Figure 15b). Based on this finding, a precise universal single nucleotide polymorphism (SNP) detection method based on Cas9 was established to distinguish single-base mutations by introducing a mismatched base at position 17 of the 18-nt target sequence. We further investigated whether Cas9 detection can be used to distinguish between two genetic branches of monkeypox virus: the Congo Basin (CB) branch and the West African (CA) branch, which have single-base differences in the selected target region (Figure 5i). In both DACD and RACD assays, crRNA designed for the CB clade triggered a strong fluorescent signal when detecting the CB clade, but triggered a particularly weak fluorescent signal when detecting the CA clade, indicating that Cas9 detection can effectively distinguish between the CB clade and the CA clade. We also tested whether Cas9 detection can be used for targeted diagnosis of low-frequency cancer mutations in high-level wild-type samples. We examined the EGFR T790M mutation, the most common mechanism of resistance to tyrosine kinase inhibitors (TKIs) in non-small cell lung cancer (NSCLS). We found that SNP detection was able to detect T790M mutations in 0.1% of wild-type DNA samples (Figure 5j). Together, these observations suggest that Cas9-based diagnostic platforms can be used to detect any DNA and RNA with high sensitivity and specificity.

[0141] Example 6: Effects of different reaction buffers on Cas9 trans-cleavage activity

[0142] This example tests the effects of the following six different buffers on the trans-cleavage activity of Cas9:

[0143] ·Buffer1: 50mM NaCl, 10mM Tris pH 7.9, 10mM MgCl2, 1mM DTT

[0144] ·Buffer2: 50mM NaCl, 10mM Tris pH 7.9, 10mM MgCl2, 100μg / mL BSA

[0145] Buffer 3: 50 mM potassium acetate, 10 mM Tris pH 7.9, 10 mM magnesium acetate, 100 μg / mL BSA

[0146] ·Buffer4: 150mM NaCl, 20mM Tris pH 7.9, 10mM MgCl2, 3mM DTT

[0147] ·Buffer5:100mM NaCl, 20mM Tris pH 7.9, 10mM MgCl2, 3mM DTT

[0148] ·Buffer6: 150mM NaCl, 20mM Tris pH 7.5, 10mM MgCl2, 2mM TCEP

[0149] The experimental method was similar to the previous example.

[0150] The results are shown in FIG16 . For the T13-FQ probe, Buffer 2 has the best effect; for the U13-FQ probe, Buffer 2 and Buffer 3 have the best effect.

[0151] When Buffer 2 was used for DACD and RACD, using the T13-FQ probe, the detection limit was not significantly different from the previous example using Buffer 6, but the enzyme and probe concentrations could be significantly reduced. Furthermore, using Buffer 2, Cas9-sgRNA can also be used as a detection tool.

[0152] Sequences covered in this article:

[0153] SEQ ID NO: 1 SpyCas9 amino acid sequence

[0154] SEQ ID NO:2 SauCas9 amino acid sequence

[0155] SEQ ID NO:3 FnCas9 amino acid sequence

[0156] SEQ ID NO:4 SpyCas9 crRNA

[0157] SEQ ID NO:5 FnCas9 crRNA

[0158] SEQ ID NO:6 SauCas9 crRNA

[0159] SEQ ID NO:7 SpyCas9 tracrRNA

[0160] SEQ ID NO:8 tracrRNA of FnCas9

[0161] SEQ ID NO:9 SauCas9 tracrRNA

[0162] SEQ ID NO:10 SpyCas9's sgRNA

[0163] SEQ ID NO:11 FnCas9's sgRNA

[0164] SEQ ID NO:12 SauCas9 sgRNA

Claims

1. A method for detecting the presence and / or amount of a target nucleic acid molecule in a sample, the method comprising the following steps: (a) contacting the sample with: i) a Cas9 protein, ii) a gRNA directed against a target sequence in the target nucleic acid molecule, and iii) a nucleic acid reporter molecule capable of generating a detectable signal, thereby forming a reaction mixture; (b) detecting the presence and / or level of a detectable signal produced in the reaction mixture, The presence and / or level of the detectable signal represents the presence and / or amount of the target nucleic acid molecule.

2. The method of claim 1, wherein the target nucleic acid molecule is a double-stranded DNA molecule, a single-stranded DNA molecule or a single-stranded RNA molecule.

3. The method of claim 1 or 2, wherein the Cas9 protein is from a Streptococcus species, from a Staphylococcus species or from a Francisella species.

4. The method of claim 3, wherein the Cas9 protein is spyCas9 from Streptococcus pyogenes, Cas9 from Staphylococcus aureus (SauCas9), or Cas9 from Francisella novicida (FnCas9).

5. The method of any one of claims 1-4, wherein the Cas9 protein comprises an amino acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, at least 99.9% sequence identity to any one of SEQ ID NOs: 1-3, for example, the Cas9 protein comprises the amino acid sequence shown in any one of SEQ ID NOs: 1-3.

6. The method of any one of claims 1 to 4, wherein i) the gRNA is a sgRNA, or ii) The gRNA is formed by a crRNA molecule and a tracrRNA molecule through partial complementarity. Preferably, the crRNA molecule and the tracrRNA molecule in the gRNA are not covalently linked.

7. The method of claim 6, wherein the crRNA molecule comprises the sequence shown below: 5'-N x -GUUUCAGUUGCUGAAUUAUUUGGUAAAC-3', 5'-N x -GUUUCAGUUGCUGAAUUAUUUGGUAAAC-3', or 5'-N x -GUUUUAGUACUCUGUAAU-3', Where N x It represents a nucleotide sequence consisting of X consecutive nucleotides, wherein N is independently selected from A, G, C and T; X is an integer greater than or equal to 17, preferably, X=18.

8. The method of claim 7, wherein N x It is a spacer sequence, preferably, the spacer sequence is configured to completely match with the target sequence or its complementary sequence.

9. The method of any one of claims 6-8, wherein the tracrRNA molecule comprises the sequence shown below: 5'-UUCAAAACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAGUGGCACCGAGUCCGGUGCUUC-3', 5'-AUGUACCAAAUAAUUAAUGCUCUGUAAUCAUUUAAAAGUAUUUUUGAACGGACCUCUGUUUGACACGUCUG-3'; or 5'-GGUAUACCUAAAAUUACAGAAUCUACUAAAACAAGGCAAAAUGCCGUGUUUAUCUCGUCAACUUGUUGGCGAGAUC-3'.

10. The method of any one of claims 1-9, wherein the nucleic acid reporter molecule may comprise a detectable label, for example, the detectable label is selected from a fluorophore and / or a quencher group thereof, a chromophore, a detectable enzyme label, a biotin label, a radioactive label.

11. The method of any one of claims 1-10, wherein the nucleic acid reporter molecule produces a detectable signal after being cleaved.

12. The method of any one of claims 1 to 11, wherein the nucleic acid reporter molecule is a single-stranded nucleic acid reporter molecule such as a single-stranded DNA reporter molecule or a single-stranded RNA reporter molecule.

13. The method of claim 12, wherein the single-stranded nucleic acid reporter molecule comprises a fluorophore and a quencher group thereof at both ends of a single-stranded nucleic acid molecule such as a single-stranded DNA or a single-stranded RNA molecule, respectively, for example, the fluorophore is selected from FAM, TEX, HEX, Cy3 or Cy5, and the quencher group is selected from BHQ1, BHQ2, BHQ3 or TAMRA, Preferably, the fluorophore is FAM and the quencher is BHQ1.

14. The method of claim 12 or 13, wherein the length of the single-stranded nucleic acid in the single-stranded nucleic acid reporter molecule can be about 2 to about 500 nucleotides. 15 . The method according to claim 12 , wherein the single-stranded nucleic acid in the single-stranded nucleic acid reporter molecule is not polyA (polyadenylic acid) and polyG (polyguanylic acid).

16. The method of any one of claims 12-15, wherein the single-stranded nucleic acid in the single-stranded nucleic acid reporter molecule is polyC (polycytidylic acid), polyT (polythymidylic acid) or polyU (polyuridylic acid), or wherein the single-stranded nucleic acid in the single-stranded nucleic acid reporter molecule comprises a random sequence.

17. The method of any one of claims 12-15, wherein the single-stranded nucleic acid in the single-stranded nucleic acid reporter molecule contains multiple consecutive Ts, multiple consecutive Cs or multiple consecutive Us; preferably, the single-stranded nucleic acid in the single-stranded nucleic acid reporter molecule contains at least about 8 consecutive Ts, consecutive Cs or consecutive Us.

18. The method of claim 17, wherein the multiple consecutive Ts, multiple consecutive Cs or multiple consecutive Us are not located on the complex secondary structure of the single-stranded nucleic acid in the single-stranded nucleic acid reporter molecule; for example, the multiple consecutive Ts, multiple consecutive Cs or multiple consecutive Us are not located within the stem-loop structure in the single-stranded nucleic acid; preferably, the single-stranded nucleic acid in the single-stranded nucleic acid reporter molecule does not contain a complex secondary structure such as a stem-loop structure.

19. The method of any one of claims 12-18, wherein the single-stranded nucleic acid in the single-stranded nucleic acid reporter molecule comprises a nucleotide sequence selected from one of SEQ ID NOs: 203-204, 216-219, 222-225, 231-232, 236-238, 242, 244, 259-262, preferably, the single-stranded nucleic acid in the single-stranded nucleic acid reporter molecule comprises the nucleotide sequence shown in SEQ ID NO:

259.

20. The method according to any one of claims 1 to 19, further comprising a step of amplifying the nucleic acid molecules in the sample before step (a), for example, amplifying the nucleic acid molecules or fragments thereof comprising the target sequence.

21. The method of claim 20, wherein the amplification is selected from PCR amplification, recombinase polymerase amplification (RPA), recombinase-aid amplification (RAA), LAMP amplification, ligase chain reaction, branched DNA amplification, NASBA, SDA, rolling circle amplification, HDA, SPIA, NEAR, TMA and SMAP2; preferably, the amplification is isothermal amplification, such as RPA or RAA amplification.

22. The method of any one of claims 20-21, wherein if the target nucleic acid molecule is RNA, the method further comprises a reverse transcription step prior to amplification.

23. The method of any one of claims 1-22, wherein the Cas9 protein has been pre-complexed with the gRNA to form a Cas9-gRNA complex before contacting with the sample.

24. The method of any one of claims 1 to 23, wherein step (a) comprises incubating the reaction mixture for a period of time, such as incubating the reaction mixture for about 2 minutes to about 180 minutes.

25. The method of claim 24, wherein the incubation is performed at about 25°C to about 45°C, preferably at about 37°C.

26. The method of any one of claims 1 to 25, wherein the reaction mixture of step (a) comprises a buffer, e.g., containing Mg 2+ of buffer.

27. The method of claim 26, wherein The buffer comprises a final concentration of about 50 mM NaCl, about 10 mM Tris pH 7.9, about 10 mM MgCl2, and about 1 mM DTT; The buffer comprises a final concentration of about 150 mM NaCl, about 20 mM Tris pH 7.9, about 10 mM MgCl2, and about 3 mM DTT; The buffer comprises a final concentration of about 100 mM NaCl, about 20 mM Tris pH 7.9, about 10 mM MgCl2, and about 3 mM DTT; The buffer comprises a final concentration of about 150 mM NaCl, about 20 mM Tris pH 7.5, about 10 mM MgCl2, and about 2 mM TCEP; The buffer comprises a final concentration of about 50 mM NaCl, about 10 mM Tris, about 10 mM MgCl2, about 100 μg / ml BSA, pH 7.9; or The buffer contained a final concentration of about 50 mM potassium acetate, about 10 mM Tris, about 10 mM magnesium acetate, about 100 μg / ml BSA, pH 7.

9.

28. The method of any one of claims 1-27, wherein the concentration of the Cas9 in the reaction mixture is about 1 pm to about 500 nM.

29. The method of any one of claims 1-28, wherein the concentration of the nucleic acid reporter molecule in the reaction mixture is about 50 nM to about 800 nM.

30. The method of any one of claims 1-29, wherein the concentration of the target nucleic acid molecule in the reaction mixture is at least about 0.3 copies / μl.

31. The method of any one of claims 1-30, wherein the sample is a biological sample or an environmental sample, for example, the biological sample is selected from whole blood, blood plasma, serum, cerebrospinal fluid, urine, feces, cell or tissue extract, or the biological sample is a nucleic acid sample extracted from a cell or tissue; or the environmental sample is a nucleic acid sample extracted from an environment such as water or soil.

32. A kit for detecting the presence and / or amount of a target nucleic acid molecule in a sample, for example, for detecting the presence and / or amount of a target nucleic acid molecule in a sample by the method described in any one of claims 1-31, the kit comprising at least a Cas9 protein as defined in any one of claims 1-31, a gRNA as defined in any one of claims 1-31, and a nucleic acid reporter molecule as defined in any one of claims 1-31.

33. The kit of claim 32, further comprising a buffer as defined in any one of claims 1 to 31.

34. Use of Cas9 protein in preparing a kit for detecting the presence and / or amount of a target nucleic acid molecule in a sample.

35. A method for identifying the type of nucleotide at at least one nucleotide position in a target nucleic acid molecule in a sample, the method comprising: a) detecting the presence of a target nucleic acid molecule comprising a first type of nucleotide at said at least one nucleotide position in a sample by the method of any one of claims 1 to 31; and b) detecting the presence of a target nucleic acid molecule comprising a nucleotide of the second type at said at least one nucleotide position in the sample by the method of any one of claims 1 to 31 .

36. The method of claim 35, wherein the at least one nucleotide position is set to any one or more nucleotides corresponding to positions 13-17 in the 3' to 5' direction of the spacer sequence of the gRNA.

37. The method of claim 35, wherein the spacer sequence of the gRNA comprises 18 nucleotides, and the at least one nucleotide position is set to correspond to the 17th nucleotide in the 3' to 5' direction of the spacer sequence of the gRNA.

38. The method of any one of claims 35-37, wherein the target nucleic acid molecule comprises a single nucleotide polymorphism (SNP) at the at least one nucleotide position; or, the target nucleic acid molecule comprises a disease-associated mutation at the at least one nucleotide position, such as a mutation in the nucleotide resulting in a T790M mutation in EGFR.

Images