Method for improving efficiency of CAS9 enzymatic cleavage in vitro

Abstract

Provided is a method for improving the efficiency of Cas9 enzymatic cleavage in vitro, belonging to the technical field of gene editing. The method comprises the following steps: preparing a Cas9 enzymatic cleavage system: mixing 6 μL of 3.1 buffer, 3000-5000 ng of sgRNA and 1-2 μL of Cas9 nuclease, adding RNase Free Water up to 60 μL, incubating at 37°C for 10 min, adding 1-2 ug of a plasmid, incubating at 37°C for 1-1.5 h, and performing enzymatic cleavage on the plasmid. The method synthesizes high-quality sgRNA in vitro, and the sgRNA can carry the CAS9 nuclease to a designated site to provide targeted cleavage functionality. Using this tool, any gene can be edited and modified for a vector plasmid very conveniently and quickly, so as to achieve the purpose of improving the efficiency of CRISPR / Cas9 gene editing.

Description

A method to improve the efficiency of Cas9 enzyme cleavage in vitro Technical Field

[0001] The present invention belongs to the field of gene editing technology, and specifically relates to a method for improving the efficiency of Cas9 enzymatic cleavage in vitro. Background Art

[0002] CRISPR / Cas is an adaptive immune defense system developed over the long course of evolution by bacteria and archaea, specifically designed to cleave foreign viruses and DNA to combat invasion. The engineered Cas9 / gRNA system uses sgRNA (short guide RNA) to direct the Cas9 protein to recognize and cleave double-stranded DNA containing the sgRNA target, enabling manipulations such as gene knockout and precise DNA editing. Using artificially expressed Cas9 protein and in vitro-transcribed sgRNA, double-stranded DNA, such as plasmids and PCR products, can be cleaved in vitro. This allows for rapid detection of CRISPR targets.

[0003] CRISPR / Cas9 has broad clinical application prospects. When using the CRISPR / Cas9 system for gene therapy, Cas9 and sgRNA need to be introduced into the body. Currently, the most effective delivery vector for gene therapy is AAV virus. However, the DNA packaged by AAV virus generally does not exceed 4.5kb. SpCas9 is widely used because of its simple PAM sequence (recognizing NGG) and high activity. However, the SpCas9 protein has 1367 amino acids, plus sgRNA and promoter, and cannot be effectively packaged into the AAV virus, resulting in low efficiency of CRISPR / Cas9 gene editing, which limits its application in clinical practice.

[0004] Summary of the Invention

[0005] The purpose of the present invention is to provide a method for improving the efficiency of Cas9 enzymatic cleavage in vitro to solve the problem of low efficiency of CRISPR / Cas9 gene editing.

[0006] The purpose of the present invention can be achieved through the following technical solutions:

[0007] A method for improving the efficiency of Cas9 enzyme cleavage in vitro, comprising the following steps:

[0008] Prepare the Cas9 enzyme digestion system: mix 6 μL of 3.1 buffer, 3000-5000 ng of sgRNA, 1-2 μL of Cas9 nuclease, and RNase-free water up to 60 μL, incubate at 37°C for 10 min, add 1-2 μg of plasmid, and incubate at 37°C for 1-1.5 h to digest the plasmid.

[0009] Furthermore, the sgRNA is obtained by the following process: sgDNA template for synthesizing sgRNA is obtained by designing sgDNA primers and PCR amplification, and then sgRNA is synthesized using T7RNA in vitro transcriptase; wherein the sgRNA target sequence is: tcgcgaatgcatctagatat.

[0010] Furthermore, the PCR amplification system is as follows:

[0011] Primer F 1.5 μL; Primer R 1.5 μL; Promoter T7-20 1 μL; Enzyme 1 μL; Working solution 45 μL;

[0012] PCR amplification was performed to obtain the sgDNA template for synthesizing sgRNA. The PCR procedure was as follows:

[0013] Furthermore, the process of synthesizing sgRNA using T7 RNA in vitro transcriptase includes the following steps:

[0014] 10×Transcription Buffer 2μL, ATP / GTP / CTP / UTP Mix 2μL each, sgDNA template 100ng-1ug, T7 RNA in vitro transcriptase 2μL; RNase Free Water up to 20μL to obtain sgRNA.

[0015] Furthermore, the sequence of primer F (Oligo-F) is:

[0016] TGTAATACGACTCACTATAGGtcgcgaatgcatctagatatGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGC;

[0017] The sequence of primer R (Oligo-R) is:

[0018] The sequence of promoter T7 is:

[0019] Beneficial effects of the present invention:

[0020] The present invention improves the efficiency of CAS9 enzyme cleavage of plasmids by synthesizing high-quality sgRNA in vitro. The CRISPR / Cas9 used in the present invention consists of two parts: the Cas9 nuclease and the sgRNA. In the process of genome editing using the CRISPR / Cas9 system, the sgRNA can carry the CAS9 nuclease to the designated site to play a role in targeted cleavage. Using this tool, it is very convenient and fast to edit and modify any gene in the vector plasmid, such as gene knockout, knock-in, site-directed mutagenesis, site-directed repair, etc. The present invention can achieve the purpose of improving the efficiency of CRISPR / Cas9 gene editing by synthesizing high-quality sgRNA and changing the in vitro enzyme cleavage system. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] The present invention will be further described below with reference to the accompanying drawings.

[0022] Figure 1 is a schematic diagram of the sgRNA target site skeleton construction in Example 1 of the present invention;

[0023] FIG2 is an electrophoresis diagram of sgDNA template amplified by PCR in Example 1 of the present invention;

[0024] FIG3 is a schematic diagram of the electrophoretic structure of sgRNA synthesis in Example 1 of the present invention;

[0025] FIG4 is a map of the plasmid vectors in Table 4 in Example 3 of the present invention;

[0026] FIG5 is a diagram of the enzyme digestion of plasmid sample 1 in Example 3 of the present invention;

[0027] FIG6 is a diagram of the enzyme digestion of plasmid sample 2 in Example 3 of the present invention;

[0028] FIG7 is a graph showing the results of a subsequent transfection experiment using sgRNA-enzyme-cleaved plasmid in Example 3 of the present invention. DETAILED DESCRIPTION

[0029] The following will be combined with the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the embodiments described are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making any creative efforts shall fall within the scope of protection of the present invention.

[0030] Example 1

[0031] In vitro synthesis of sgRNA:

[0032] The sgDNA template for sgRNA synthesis was obtained by designing sgDNA primers and PCR amplification, and then sgRNA was synthesized using T7 RNA in vitro transcriptase; the sgRNA target sequence is: tcgcgaatgcatctagatat. The sgRNA target site skeleton is constructed as shown in Figure 1:

[0033] The PCR system is shown in Table 1 below:

[0034] Table 1

[0035] The sequence of primer F (Oligo-F) is:

[0036] The sequence of primer R (Oligo-R) is:

[0037] The sequence of promoter T7 is:

[0038] PCR amplification was performed to obtain the sgDNA template for synthesizing sgRNA. The PCR program is shown in Table 2 below:

[0039] Table 2

[0040] In Table 2, "-0.8°C" means "0.8°C decrease per cycle".

[0041] The sgDNA template was amplified by PCR. The electropherogram is shown in Figure 2. The sgDNA amplified by PCR has the correct size and clear and single bands.

[0042] Refer to the system in Table 3 below to synthesize sgRNA:

[0043] Table 3

[0044] The electrophoretic pattern of sgRNA synthesis is shown in Figure 3. sgRNA synthesis in vitro has clear and single bands.

[0045] Example 2

[0046] This embodiment provides a method for recovering sgRNA:

[0047] a) Add 30 μL of NF water to 20 μL of the system to make up to 50 μL;

[0048] b) Add 100 μL RNA Cleanup Binding Buffer (NEB);

[0049] c) Add 150 μL (1 volume) of anhydrous ethanol and mix thoroughly with a pipette;

[0050] d) Place the recycling column into a centrifuge tube, add the sample (300 μL), centrifuge for 1 min, and discard the filtrate;

[0051] e) Add 500 μL RNA Cleanup Wash Buffer (NEB), centrifuge for 1 min, and discard the filtrate;

[0052] f): Repeat step e);

[0053] g): Leave in the air for 2 minutes and let it dry for 1 minute;

[0054] h) Place the recovery column in a new centrifuge tube, add 6-100 μL of NF water, let it stand for 1 minute, and centrifuge for 2 minutes;

[0055] Note: The amount of NF water added should be based on the column's loading capacity:

[0056] For a 10ug load, add 6-20μL;

[0057] For a 50ug load, add 20-100μL;

[0058] For a load of 500ug, add 50-100μL.

[0059] sgRNA concentration determination and gel dispensing verification: The concentration of the recovered sgRNA was measured using a UV spectrophotometer. A concentration of 260 / 280 between 1.9 and 2.2 and a concentration of 260 / 230 between 2.0 and 2.2 were considered qualified. Agarose gel electrophoresis bands were clear and without severe tailing.

[0060] Example 3

[0061] This embodiment provides a method for improving the efficiency of Cas9 enzyme cleavage in vitro, comprising the following steps:

[0062] Refer to Table 4 below to configure the Cas9 enzyme digestion system (NEB):

[0063] Table 4

[0064] Sources of sgRNA in Table 4: sgRNA obtained according to the method in Example 1, or sgRNA obtained according to the recovery method in Example 2. The plasmid vector map in Table 4 is shown in Figure 4;

[0065] sgRNA was used to digest the plasmid, and the results are shown in Figures 5 and 6. In Figure 5, 1: plasmid sample 1; 2 / 3: CAS9 digestion; in Figure 6, 4: plasmid sample 2; 5 / 6: CAS9 digestion.

[0066] The sgRNA-digested plasmid was used in subsequent transfection experiments. The results are shown in Figure 7 . It can be seen that positive clone bands can be obtained after PCR colony testing, and the positive rate is high.

[0067] It should be noted that, in this document, relational terms such as first and second, etc., are used only to distinguish one entity or operation from another entity or operation, and do not necessarily require or imply any actual relationship or order between these entities or operations. Moreover, the terms "comprises," "comprising," or any other variations thereof are intended to cover non-exclusive inclusion, such that a process, method, article, or apparatus that includes a list of elements includes not only those elements but also other elements not explicitly listed, or elements inherent to such process, method, article, or apparatus.

[0068] While embodiments of the present invention have been shown and described, it will be appreciated by those skilled in the art that various changes, modifications, substitutions, and variations may be made to these embodiments without departing from the principles and spirit of the invention, and that the scope of the invention is defined by the appended claims and their equivalents.

Claims

1. A method for improving the efficiency of Cas9 in vitro enzyme cleavage, characterized in that: The steps include: Prepare Cas9 enzyme digestion system: mix 6 μL 3.1 buffer, 3000-5000 ng sgRNA, 1-2 μL Cas9 nuclease, RNase Free Water up to 60 μL, incubate at 37°C for 10 min, add 1-2 ug plasmid, incubate at 37°C for 1-1.5 h, and digest the plasmid.

2. A method for improving the in vitro enzyme cleavage efficiency of Cas9 according to claim 1, characterized in that: The sgRNA is obtained by the following process: sgDNA template for synthesizing sgRNA is obtained by designing sgDNA primers and PCR amplification, and then sgRNA is synthesized by T7RNA in vitro transcriptase; wherein the SgRNA target sequence is: tcgcgaatgcatctagatat.

3. A method for improving the in vitro enzyme cleavage efficiency of Cas9 according to claim 2, characterized in that: The PCR amplification system is as follows: Primer F 1.5 μL; Primer R 1.5 μL; Enzyme 1 μL; Working solution 45 μL; PCR amplification was performed to obtain the sgDNA template for synthesizing sgRNA. The PCR procedure is as follows:

4. A method for improving the in vitro enzyme cleavage efficiency of Cas9 according to claim 3, characterized in that: The process of synthesizing sgRNA with T7 RNA in vitro transcriptase includes the following steps: 10×Transcription Buffer 2μL, ATP / GTP / CTP / UTP Mix each 2μL, sgDNA template 100ng-1ug, T7 RNA in vitro transcriptase 2μL; RNase Free Water up to 20μL.

5. A method for improving the in vitro enzyme cleavage efficiency of Cas9 according to claim 3, characterized in that: The sequence of primer F is: TGTAATACGACTCACTATAGGtcgcgaatgcatctagatatGTTTTAGAGCTAGA AATAGCAAGTTAAATAAGGC; The sequence of primer R is: AAATCTCGATCTTTATCGTTCAATTTTATTCCGATCAGGCAATAGTTGAACTTTTTCACCGTGGCTCAGCCACGAAAAAA; The sequence of promoter T7 is: TAATACGACTCACTATAGg.

Images