Genetically modified NK cells and methods of use

Abstract

In one aspect, an engineered cell includes a mutation to the DUSP2 gene, the DUSP4 gene, and / or the KLF2 gene of the cell. In one or more embodiments, the engineered cell is an NK cell. In one or more embodiments, the engineered cell includes a mutation that decreases expression of DUSP2. In one or more embodiments, the engineered cell includes a mutation that decreases expression of DUSP4. In one or more embodiments, the engineered cell includes a mutation that decreases expression of DUSP2 and a mutation that decreases expression of DUSP4. In one or more embodiments, the engineered cell includes a mutation that decreases expression of KLF2. In one or more embodiments, the engineered cell includes a mutation that increases expression of KLF2.

Description

[0001] GENETICALLY MODIFIED NK CELLS AND METHODS OF USE

[0002] CROSS-REFERENCE TO RELATED APPLICATION

[0003] This application claims the benefit of U.S. Provisional Patent Application No. 63 / 537,953, filed September 12, 2023, which is incorporated herein by reference in its entirety.

[0004] SEQUENCE LISTING

[0005] This application contains a Sequence Listing electronically submitted via EFS-Web to the United States Patent and Trademark Office as an XML file entitled “0110.000734W001.xml” having a size of 48,686 bytes and created on September 9, 2024. The information contained in the Sequence Listing is incorporated by reference herein.

[0006] GOVERNMENT FUNDING

[0007] This invention was made with government support under CA197292, CAI 11412, and CA283892 awarded by the National Institutes of Health. The government has certain rights in the invention.

[0008] SUMMARY

[0009] This disclosure describes, in one aspect, an engineered cell including a mutation to the DUSP2 gene (e.g., hDUSP2, SEQ ID NO: 19), the DUSP4 gene(e.g., hDUSP4, SEQ ID NO:20), and / or the KLF2 gene (e.g., hKLF2, SEQ ID NO:21) of the cell. In one or more embodiments, the engineered cell includes an NK cell.

[0010] In one or more embodiments, wherein the engineered cell includes a mutation that decreases expression of DUSP2. In one or more embodiments, the engineered cell includes a mutation that decreases expression of DUSP4. In one or more embodiments, the engineered cell includes a mutation that decreases expression of DUSP2 and a mutation that decreases expression of DUSP4. In one or more embodiments, the engineered cell includes a mutation that decreases expression of KLF2. In one or more embodiments, the engineered cell includes a mutation that increases expression of KLF2.

[0011] In one or more embodiments, the engineered cell is derived from bone marrow, whole blood, or umbilical cord blood. In one or more embodiments, the engineered cell is derived from a mammal, such as a human or a mouse.

[0012] In one or more embodiments, the engineered cell includes a lower level of pERKl / 2 relative to a comparable non-engineered cell. In one or more embodiments, the engineered cell includes an increased level of CXCR1, an increased level of CXCR2, and / or an increased level of CXCR3 relative to a comparable non-engineered cell.

[0013] In another aspect, the present disclosure relates to a method of treating a subject including administering the engineered cell of the present disclosure. In one or more embodiments, the subject has or is at risk of having cancer. In one or more embodiments, the cancer is leukemia or lymphoma. In one or more embodiments, the subject is a mammal, such as a human or a mouse.

[0014] In another aspect, the present disclosure relates to a method of preparing an engineered cell including contacting a cell with Cas9 and one or more guide RNAs, wherein the one or more guide RNAs include a sequence substantially similar to a region of the DUSP2 gene, the DUSP4 gene, or the KLF2 gene of the cell.

[0015] In one or more embodiments, the one or more guide RNAs include a sequence having at least 70% sequence identity to:

[0016] 5'-GGCGCGCGAGCUGGAGUGCG-3' (SEQ ID NO: 1), 5'-GGCGGAACGCACGCUGCUGC-3' (SEQ ID NO:2), 5'-CGCCGCAGCAGCGCGUUCCA-3' (SEQ ID NO:3), 5'-UCUGUGGCACUGGGGGGAAC-3' (SEQ ID NO:4), 5'-CCUUUACAGGCGGCUAUGAG-3' (SEQ ID NO:5), 5'-GUCUACCUGGUCGUGUAGUG-3' (SEQ ID NO: 6), 5'-CCGCGGGGGCGCUGUAGGGC-3' (SEQ ID NO:7), 5'-CGCGCCGAACCCGAGUCCGG-3' (SEQ ID NO: 8), or 5'-GCUGGAUGGCCUGGGCGCCG-3' (SEQ ID NO:9). In one or more embodiments, the one or more guide RNAs include: (i) a guide RNA including SEQ ID NO: 1, a guide RNA including SEQ ID NO:2, and a guide RNA including SEQ ID NO:3; (ii) a guide RNA including SEQ ID NO:4, a guide RNA including SEQ ID NO:5, a guide RNA including SEQ ID NO:6; or (iii) a guide RNA including SEQ ID NO:7, a guide RNA including SEQ ID NO: 8, and a guide RNA including SEQ ID NON.

[0017] In one or more embodiments, the engineered cell is an NK cell. In one or more embodiments, contacting the cell with Cas9 and one or more guide RNAs includes electroporating the cell with an assembled ribonucleoprotein.

[0018] The above summary is not intended to describe each disclosed embodiment or every implementation of the present invention. The description that follows more particularly exemplifies illustrative embodiments. In several places throughout the application, guidance is provided through lists of examples, which examples can be used in various combinations. In each instance, the recited list serves only as a representative group and should not be interpreted as an exclusive list.

[0019] BRIEF DESCRIPTION OF THE FIGURES

[0020] FIG. 1. A schematic summary of pathways downregulated in exhausted NK cells. Categories of pathways were generated using Gene Ontology.

[0021] FIG. 2. A plot of differentially expressed genes in exhausted and non-exhausted NK cells. Expression levels of DUSP2, DUSP4, CXCR1, CXCR2, CXCR3, and KLF2 are annotated.

[0022] FIG. 3. A plot of differentially expressed genes in exhausted and non-exhausted NK cells. Expression levels of DUSP2, DUSP4, CXCR1, CXCR2, CXCR3, and KLF2 are annotated.

[0023] FIG. 4. Expression of DUSP2, DUSP4, phosphorylated ERK1 / 2 (pERKl / 2), and unphosphorylated ERK1 / 2 in isotype and exhausted NK cells after 4 or 10 days of stimulation, a-tubulin expression was also measured as a control.

[0024] FIG. 5. sequencing traces from cells treated with DUSP2 guide RNAs.

[0025] FIG. 6. Sequencing traces from cells treated with / NAS’ / U guide RNAs.

[0026] FIG. 7. Fluorescence intensity data from DUSP2 KO, DUSP4 KO, and Cas9 only cells stimulated with PMA for 30 minutes. Intracellular flow cytometry was used to determine pERKl / 2 abundance. (n=6) Two-way ANOVA performed with Dunnett’s multiple comparisons test. FIG. 8. Protein expression in DUSP2 KO, DUSP4 KO, and Cas9 only cells following stimulation with effectors and K562 leukemia target cells in a 5-hour function assay. Flow cytometry was used to detect protein expression following incubation (n=4) Two-way ANOVA performed with Sidak’s multiple comparisons test. (A) Expression of CD107a, which is related toNK cell degranulation. (B) Expression of IFNy, which is related to cytokine production.

[0027] FIG. 9. Fluorescence intensity data used to quantify protein expression in DUSP2 KO, DUSP4 KO, and Cas9 only cells following stimulation with effectors and MA 148 cells. (A) IFNy expression. (B) CD 107a expression.

[0028] FIG. 10. Fluorescence intensity data used to quantify protein expression in DUSP2 KO, DUSP4 KO, and Cas9 only cells following stimulation with effectors and OVCAR8 cells. (A) IFNy expression. (B) CD 107a expression.

[0029] FIG. 11. The number of cells positive for expression of KLF2, KLF3, S1PR1, S1PR5, SELL (CD62L), and CX3CR1 following four or ten days of activation.

[0030] FIG. 12. The level of KLF2 expression in NK cells from peripheral blood (p.b.) and expanded NK cells normalized to fold-change.

[0031] FIG. 13. The average ratio of KO median fluorescent intensity (MFI):Cas9 control MFI was calculated and plotted (y) by the average MFI of all samples (x) for Primary human NK cells modified to delete KLF2 from the genome (n=3). The PE LEGENDSCREEN (BioLegend, San Diego, CA) was used to perform detect select surface antigens using flow cytometry.

[0032] FIG. 14. The ratios from FIG. 11 plotted as a bar graph in ascending order.

[0033] FIG. 15. Experimental scheme. Bone marrow from congenic WT C57BL / 6 (CD45.1 / .2) and KLF2M-NCRl-CreERT2(CD45.2 / .2) mice was harvested and a 1 : 1 ratio (2.5x 106:2.5* 106) of T cell depleted bone marrow (TCD) cells was injected (i.v.) into congenic (CD45.1 / .1) irradiated WT C57BL / 6 mice. Five weeks after irradiation, tamoxifen was delivered (i.p.) once per day for five days to induce deletion of Klf2 in NCR! -expressing cells. Two weeks later mice were sacrificed and tissues were harvested.

[0034] FIG. 16. KLF2 deficiency drives NK cells towards tissue resident-like phenotypes in vivo. (A) Expression of CD62L was quantified in both WT and KLF2 KO NK cell populations across tissues. (B) Expression of CD49a was quantified in both WT and KLF2 KO NK cell populations across tissues. FIG. 17. The percentage of WT and KLF2 KO NK cells in various maturity states (R1 : CD lib-negative CD27+; R2: CDllb+CD27+); R3: CDllb+CD27-negative). (A) Blood. (B) bone marrow. (C) Liver. Data are representative of two independent experiments with n = 9 (C-G) mice per group. Error bars indicate mean + SEM. p values were calculated by paired one-way ANOVA (B), paired two-way ANOVA (E-G) or multiple Student’s paired t-tests (C and D). **p < 0.01, ***p < 0.001, ****p < 0.0001; n.s., not significant.

[0035] FIG. 18. Experimental design. Freshly isolated human donor NK cells were stimulated with agonists of NKp46 and NKG2D (NKAR) or isotype IgG for ten days, with or without a reduced concentration of IL- 15 during the middle two days.

[0036] FIG. 19. NK cells were cultured with a chronic myeloid leukemia cell line (K562) expressing NucLight Red (NLR) for 24 hours (2: 1 effector / target ratio). Cytotoxicity was measured using the Incucyte platform. K562 viability in experimental wells, normalized to viability of K562 targets alone, was calculated on the basis of fluorescent cells that were not Caspase 3 / 7+. Data depict a representative donor (top) and a group of donors (bottom). Data are representative of two independent experiments with n = 6 donors per group. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001; n.s., not significant.

[0037] FIG. 20. NK cells were cultured for five hours with K562 leukemia targets. (2: 1 effector / target ratio.) NK cell (CD3‘ CD56+) degranulation (CD 107a) and cytokine accumulation (IFNy and TNFa) was assessed using flow cytometry. Apoptosis (Annexin V+) was measured using flow cytometry and viability was measured using an automated cell counter. Data are representative of two (Annexin V and Viability) or three (CD 107a, IFNY,and TNFa) independent experiments with n = 6 (Annexin V and Viability), n = 10 (IFNY and TNFa), or n = 12 (CD107a) donors per group. Violin plots depict mean, upper / lower quartiles, and min / max values. Error bars indicate mean + SEM (B) or mean + SD (H). p values were calculated by paired one-way ANOVA (D-H) or paired two-way ANOVA (C). *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001; n.s., not significant.

[0038] FIG. 21. Chronic NKAR stimulation induces a dysfunctional, tissue resident-like gene signature on NK cells. (A) Principal component analysis depicting differences in transcriptional signatures between the two day 4 groups and the four day 10 groups. (B) Differentially expressed genes (DEGs) (log2FC >\, FDR < 0.05) between groups at various time points. FIG. 22. Chronic NKAR stimulation dysregulates the DNA methylation patterns of NK cells. Scatterplot of differentially methylated probes (DMPs) and their associated degree of differential gene expression for the Control vs. NKAR comparison (day 10).

[0039] FIG. 23. Differentially methylated genes (DMGs) with highest percentage of their CpGs differentially methylated for either less (top) or more (bottom) methylated genes in the Control vs. NKAR comparison (day 10).

[0040] FIG. 24. KLF2 overexpression restores chemotaxis in chronically activated NK cells. Average MFI fold change between WT and KLF2 KO NK cells. Mean Log MFI (x-axis) represents average abundance of surface antigen.

[0041] FIG. 25. KLF2 expression and CX3CR1 expression were measured at various points (using qPCR and flow cytometry, respectively) before (day 0), during (day 7), and after (day 14) NK cell expansion with C9 feeders (i.e., K562 expressing membrane bound IL-21 and 41BB-L.) Representative pseudocolor plots for CX3CR1 shown on right.

[0042] FIG. 26. Chemokine receptor expression of KLF2-AAV transductants was evaluated using flow cytometry. Controls = electroporation only (Zap) and mNeonGreen only (mNG).

[0043] FIG. 27. TRANSWELL (Corning, Inc., Corning, NY migration assay. (A) Schematic diagram of assay design. (B) KLF2-AAV transductants were plated in the top chamber of 5 pM TRANSWELL plates with recombinant chemokine loaded in the bottom chamber. Cells were incubated at 37 °C for 1.5 hours and counted using flow cytometry (using beads). 100 ng / mL of recombinant chemokine was used for all conditions.

[0044] FIG. 28. KLF2 overexpression inhibits the acquisition of tissue resident genes and activation- induced dysfunction. Pathway analysis (GO Biological terms, DAVID enrichment tool) was performed on differentially expressed genes in KLF2-transduced (KLF2-mNG) NK cells. (A) Control. (B) NKAR-stimulated.

[0045] FIG. 29. Normalized CPM (counts per million) data for specific genes from the comparison in (A) were chosen to highlight differential expression of tissue residency genes.

[0046] FIG. 30. Control-stimulated and NKAR-stimulated mNG and KLF2-mNGNK cells were cultured with K562 for five hours after which degranulation (CD 107a) and cytokine accumulation (fFNy and TNFa) were measured using flow cytometry. (2:1 eflfector / target ratio.) Parent populations are GFP+NK cells (CD3‘ CD56+). FIG. 31 . The viability (left) of stimulated cells was measured prior to running the function assay. Normalized CPM (counts per million) for Tox expression (right) between stimulated mNG and KLF2-mNGNK cells

[0047] FIG. 32. Transductants were cultured in complete medium supplemented with varying concentrations of IL-15 for four days after which they were used in K562 function assays. (A) Degranulation (CD107a) and cytokine (TFNy and TNFa) accumulation were measured using flow cytometry (2: 1 effector / target ratio). Parent populations are GFP+NK cells (CD3‘ CD56+). (B) Data depict % NK cells expressing IF y and TNFa.

[0048] FIG. 33. Expression of Granzyme B, Perforin, and T-bet in mNG and KLF2-mNGNK cells was measured following 4-day culture in varying concentrations of IL-15.

[0049] FIG. 34. Expression of CX3CR1 in mNG and KLF2-mNGNK cells was measured following four-day culture in varying concentrations of IL-15.

[0050] FIG. 35. KLF2 expression across Group 1 ILCs differentiates NK cells from ILCls. KLF2 expression between liver NK cells and ILC1 was visualized using flow cytometry. Associated phenotypes are listed for a representative contour plot (left) and pooled data are depicted (right).

[0051] DETAILED DESCRIPTION OF ILLUSTRATIVE EMBODIMENTS

[0052] Cell therapy, or the use of cells to treat disease, has been successful in treating diseases such as cancer, infection, and genetic disorders. In particular, interest in immunotherapy, wherein immune cells from a patient or donor are used to invigorate and support the patient’s own immune system, has grown in recent years. One type of immune cells, “natural killer” or “NK” cells, natively target and destroy cells recognized as foreign, such as cancer cells, bacteria, or cells infected with a virus such as HIV. Upon chronic exposure to activating stimuli, NK cells often become exhausted and lose function. Preventing and reversing NK exhaustion have been proposed as methods of extending the activity and efficacy of immunotherapy using NK cells. However, the complex and diverse cellular pathways that lead to NK cell exhaustion make it challenging to prevent or reverse exhaustion.

[0053] This disclosure describes using a chronic NK cell stimulation model to identify genetic and epigenetic factors underlying the dysfunction of continuously activated NK cells. For example, KLF2 deficiency was identified as a mediator of this process. KLF2 is a transcription factor expressed in circulating lymphocytes, whose downregulation drives tissue residency in T cells and is associated with T cell exhaustion. KLF2 is among the top downregulated genes in tumor-infdtrating NK cells. Using a novel genetic knock-in approach, KLF2 was established as a promoter of NK cell chemotaxis, effector responses, and resistance to activation-induced dysfunction. Through use of KLF2 reporter mice and NCRl-Cre conditional knockout systems, KLF2 expression is identified as a feature that distinguishes circulating lymphocytes from tissue resident innate lymphocytes. Further, inducible deletion of KLF2 results in a transition towards tissue resident phenotypes and dysregulated NK cell homing. Together, these results elucidate mechanisms driving NK cells towards a dysfunctional, tissue resident-like state during chronic activation and present KLF2 as promoting and maintaining effector NK cells throughout this process.

[0054] Example 1 describes a model of chronic NK cell activation and exhaustion that mimics chronic NK cell activation by tumor cells. (Myers et al., 2022, JCI Insight 7:el50079). To determine how NK cells respond to chronic activation, gene expression was quantified in exhausted and non-exhausted NK cells (See Example 1). Several differentially expressed genes were identified. For example, levels of CXCR1, CXCR2, CXCR3, and KLF2 transcripts were lower in exhausted NK cells than in non-exhausted NK cells.

[0055] The present disclosure describes how differentially expressed genes may be engineered to reduce or resolve chronic NK cell exhaustion. Thus, the present disclosure relates to engineered NK cells that are less susceptible to exhaustion than non-engineered NK cells. In particular, the present disclosure relates to NK cells that have one or more edited genes that result in decreased exhaustion, even upon extended exposure to activating stimuli. In another aspect, the present disclosure relates to methods of engineering NK cells to decrease exhaustion. In another aspect, the present disclosure relates to methods of using engineered NK cells to treat a subject.

[0056] Chronic NKAR and IL-15 stimulation drive immune dysfunction in human NK cells

[0057] An in vitro model that leverages plate-bound agonists of NKp46 and NKG2D was used to investigate the effects of chronic NK cell activation receptor (NKAR) stimulation. The model was a modified version of a previously described model (Myers et al., 2022, JCI Insight 7:el 50079). Briefly, peripheral blood NK cells enriched from healthy donors were cultured for 10 days on plates coated with either a combination of anti-NKp46, recombinant MHC class I chain-related protein A (MICA) and MHC class I chain-related protein B (MICB), or isotype IgG (control) (FIG. 18). Because chronic IL-15 exposure can be detrimental to NK function, the concentration of IL- 15 was temporarily reduced mid-culture to mitigate loss of function. By culturing NKAR-stimulated and control cells with or without a reduction in IL- 15, a system was created in which one can separate the contributions of continuous IL- 15 stimulation from the contributions of continuous NKAR stimulation. Four groups were prepared and studied after 10 days: no chronic stimulation (“Control”), chronic IL-15 (“IL-15”), chronic NKAR (“NKAR”), and combination chronic NKAR and chronic IL- 15 (“NKAR + IL- 15”) (FIG. 18).

[0058] After 10 days, both continuous NKAR and continuous IL-15 stimulation significantly weakened the cytotoxicity of NK cells (FIG. 19). Furthermore, when stimulated in combination, the two induce more severe dysfunction than either one alone. Through use of K562 degranulation / cytokine accumulation assays, a similar trend of dysfunction was demonstrated, with chronic stimulation resulting in lower levels of degranulation and weakened production of the inflammatory cytokines IFNy and TNFa (FIG. 20). Additionally, while loss of function was observed as early as day 4 of NKAR stimulation, the killing defect was not as robust compared to the killing defect observed on day 10. NK cells stimulated with either IL-15 or the combination NKAR + IL-15 had a higher rate of apoptosis than the control. Cells stimulated through NKAR alone did not have a higher rate of apoptosis than the control cells (FIG. 20). Indeed, the viability of NKAR-stimulated cells was not significantly different from unstimulated cells, ruling out cell death as a contributing factor to the dysfunction observed in this condition (FIG. 20). Thus, both NKAR and IL-15 stimulation are sufficient to induce dysfunction in NK cells, with an additive effect when present in combination.

[0059] Chronic NKAR stimulation induces a dysfunctional, tissue-resident transcriptional signature in NK cells

[0060] To investigate the mechanisms governing these different modes of dysfunction, RNA sequencing was performed on NK cells from early (day 4) and late (day 10) timepoints. At the early timepoint, NKAR-stimulated NK cells exhibited robust differential gene expression compared to the control, with a similar number of differentially expressed genes (DEGs) in both directions (FIG. 21). The same trend was observed for NKAR cells on day 10, although the magnitude of this pattern was diminished (i.e., fewer differentially expressed genes in both directions). Continuous IL- 15 stimulation resulted mainly in gene downregulation, rather than balanced up-regulation and down-regulation as observed in the chronic NKAR group (FIG. 2 IB). Similarly, when compared to NKAR-stimulated cells (without continuous IL- 15), NK cells receiving NKAR stimulation with continuous IL-15 also mainly exhibited gene downregulation, highlighting the weakening effect that prolonged IL- 15 exposure has on transcriptional activity.

[0061] Next, when comparing differential expression between the two modes of chronic stimulation (i.e., NKAR and IL-15), very little overlap in differentially expressed genes occurred. Only four of the 207 upregulated genes and two of the 303 downregulated genes in the NKAR-stimulated group were also differentially expressed during chronic IL-15 stimulation, further supporting the idea that these two types of chronic activation impart distinct transcriptional signatures. When making a similar comparison with early and late NKAR stimulation groups, it was also evident that there was considerable overlap in differential expression at these timepoints; 82% of upregulated and 86% of downregulated genes at day 10 of NKAR stimulation were also differentially expressed at day 4, highlighting that most of the transcriptional changes taking place at day 10 had already occurred by day 4. Thus, prolonged activation with NKAR and IL- 15 induce divergent patterns of differential gene expression in human NK cells, while prolonged activation with IL- 15 results in a general downregulation of gene expression.

[0062] To better understand the biological pathways that these transcriptional changes might be influencing, overrepresentation / pathway analysis was performed on the chronic NKAR and IL- 15 groups. Almost all of the top downregulated pathways in NKAR-stimulated NK cells were related to migration / chemotaxis while those from the IL-15-stimulated group were related to cell cycle and mitosis, supporting the notion that these two modes of dysfunction are governed by distinct molecular mechanisms. When this overrepresentation analysis was performed for the NKAR and NKAR + IL-15 groups, strong downregulation of cell cycle pathways was also observed, revealing a dominant effect of IL-15 when cells receive both stimuli simultaneously. Further, many of the differentially expressed genes in the NKAR-stimulated cells relate to tissue resident lymphocytes, aligning with the weakened migratory signature of these cells. These genes include chemokine receptors (e.g., Cx3crl, Cxcrl, Cxcr2, Slprl, Slpr5, and SEI. I.), integrins (e.g., Ilgctl , signaling proteins (e.g., Rgsl and transcription factors (e.g., 7 / 2). The gene Klf2 encodes the protein KLF2, a transcription factor that regulates T cell tissue residency and loss of function during T cell exhaustion. Lending insights to how cytotoxicity might be shut down at the molecular level, many genes promoting tumor cell killing were downregulated, including Gzma Gzmb Gzmh Gzmk, Gnly, and Prf. For the upregulated genes in the NKAR group, several factors may be weakening anti-tumor immunity. These include inhibitory receptors (e.g., Tigit, Haver 3, and CTLA4), transcription factors (e.g., Nr4al, Nr4a2, Nr4a3, and Zbed2 and phosphatases (e.g., Dusp2 and Dusp4 all of which have been implicated in dampening NK cell and / or T cell function. As noted above, chronic IL- 15 exposure resulted in a robust downregulation of cell cycle genes, which was unique to this stimulation group. Specific downregulated genes from this pathway include Cdc6 Cdc20 Cdc45.iCcnd2, an<3Mki67. These initial investigations highlighted how different modes of stimulation can induce remarkably disparate cell states, with chronic IL- 15 stimulation resulting in cell cycle defects and NKAR stimulation generating an exhausted, tissue-resident like phenotype.

[0063] These results were compared to publicly available datasets of tumor infiltrating NK cells and T cells. First, the gene expression signatures of NKAR-stimulated and IL-15-stimulated cells were compared to the gene expression signatures of NK cells found in human cancers. NKAR- stimulated cells — but not IL-15-stimulated cells — are transcriptionally similar to tumor-derived CD56brigbtand CD56dimNK cells. Next, differentially expressed genes of tumor-infiltrating CD56bnghtand CD56dimNK cells were sorted to identify possible commonalities between the two data sets. In both CD56brigbtand CD56dimNK cells, Klf2 was found in the top 10 most downregulated genes compared to matched blood NK cells. When sorting the NKAR-induced differentially expressed genes in the same manner, Klf2 was again among the top downregulated genes. As such, these analyses highlighted Klf2 as a common downregulated gene in both human tumor-infiltrating NK cells and NKAR-stimulated cells and emphasize the relevance of the NK cell gene signatures.

[0064] Chronic NKAR stimulation dysregulates the methylation patterns of NK cells

[0065] DNA methylation analysis was performed to gain insight into the mechanisms controlling transcriptional changes in NKAR-stimulated cells. Specifically, differentially methylated probes (DMPs) in the promoters and coding regions of genes were interrogated. From this analysis, a clear negative correlation emerges between DNA methylation and gene expression, where more methylated loci tend to have less gene expression, and vice versa (FIG. 22). To connect individual DMPs to biological pathways, overrepresentation analysis was performed on the upregulated and downregulated DMPs from NKAR-stimulated cells. Within the upregulated DMPs, the top pathway returned is “Negative regulation of the immune response,” highlighting that many of the previously identified negative regulators of function (e.g., Entpdl, Cila4, Zbed2, Tigit, and Cd96) are potentially downregulated due to DNA methylation. Furthermore, when the same overrepresentation analysis is performed for the significantly upregulated DMPs, an enrichment for pathways related to cell signaling and cell adhesion was observed. Among genes driving this pathway enrichment are the cytoskeleton-regulating genes Pxn and PlekhgS, signaling genes (e.g., Vav3 and Jakl and genes encoding transcription factors that positively regulate NK cell function (e.g., Tbx21 and Nfatc2). Because each gene assessed in the methylation array possesses multiple CpG loci, the genes that had the largest fraction of their CpGs differentially methylated was determined. Among genes with high percentages of their CpGs less differentially methylated in NKAR cells was Zbed21a gene encoding a transcription factor associated with T cell exhaustion. Zbed2 had more than 40% of its CpG loci less differentially methylated, the highest percentage of any gene analyzed (FIG. 23, top). In other words, the fewest number of CpG loci in Zbed2 were differentially methylated in NKAR cells. In contrast, high percentages of CpG methylation were observed in genes from lymphocyte activation pathways such as Fes, Tmigd2, Gzmh, Ifitml, and Bc / 9 (FIG. 23, bottom). In sum, chronic NKAR stimulation induces robust differential methylation within the genome ofNK cells. Further, because methylation negatively effects gene expression, the more methylated genes (including negative regulators of immunity) were likely less highly expressed. Further, the less methylated genes, including mediators of activation and adhesion, were likely more highly expressed.

[0066] KLF2 overexpression rescues the dysregulated chemotaxis of chronically activated NK cells As previously observed, chemotaxis, GPCR signaling, and migration pathways were the most significantly weakened in NKAR-stimulated cells, resulting in a transcriptional resemblance to tissue resident lymphocytes. Since many of the chemokine receptors known to be targets of KLF2 were downregulated in NKAR cells, KLF2 was identified as a possible regulator of chemokine receptor expression. Several proteins, all chemokine receptors (CXCR1, CX3CR1, and L-selectin), emerged as targets of KLF2 transcriptional control using CRISPR-Cas9 deletion of Klf2 using primary human NK cells (FIG. 24). Because KLF2 is a transcription factor, a significant loss of transcripts for several of these chemokine receptors was observed when qPCR was performed using cells matched from the phenotypic screen. The gene deletion in this experiment was validated and Klf2 transcription was abrogated in the knockout population. Thus, KLF2 controls expression of several chemokine receptors in human NK cells, offering a plausible explanation for the weakened migratory signatures previously observed.

[0067] Next, the extent to which NK cell feeder-based expansion altered KLF2 expression was investigated. The commonly used K562 feeders (K562 cells expressing membrane-bound IL-21 and 41BB-L) rely upon robust activation of NK cells for prolonged periods of time. Thus, the effect of these NK cell feeders on KLF2 expression, along with its associated chemokine receptors, was evaluated. A 14-day NK cell expansion using K562 feeders followed by qPCR and flow cytometry revealed that the expansion process robustly downregulated Klf2 at the transcriptional level (FIG. 25). Accordingly, there was also a significant downregulation of the KLF2-controlled chemokine receptors CX3CR1 and CXCR2 on the surface of NK cells (FIG. 25. A significant decrease in transcripts for these receptors was also observed. These data indicate that, in addition to NKAR-stimulated cells, NK cells chronically expanded for clinical use on K562 feeders also exhibit downregulated expression of KLF2 and its associated receptors, raising the possibility that these cells possess chemotaxis defects.

[0068] After gaining an understanding of the effects chronic activation and KLF2 deficiency on NK cell chemokine receptor expression, the effect of forced expression of KLF2 on chemokine receptor expression in NK cells was determined using a highly efficient transgene knock-in technology termed SLEEK (Selection by Essential Gene Exon Knock-In; Allen et al., 2024, Nat Biotechnol 42:458-469). In brief, primary human NK cells were transfected with GAPDH- targeting Casl2a ribonucleoprotein (RNP) and simultaneously transduced with AAV carrying a synthetic gene encoding KLF2 and a recoded fragment of glyceraldehyde 3-phosphate dehydrogenase (GAPDH). As a result, any NK cells with non-productive indels underwent cell death (due to lethal GAPDH knockout), producing a highly efficient knock-in product. Using an inhibitor of the DNA damage response protein DNA-PK, greater than 90% knock-in efficiency is achievable.

[0069] The robust overexpression system SLEEK allows one to ascertain whether KLF2 is sufficient to restore chemokine receptor expression to expanded NK cells. Compared to both the electroporation only (“Zap”) and mNeonGreen (“mNG”) controls, NK cells expressing KLF2 expressed significantly higher levels of CX3CR1, CD62L, CXCR1, and CXCR2 — receptors whose expression levels were all reduced in KLF2 KO cells (FIG. 26). The next test was whether this enhanced chemokine receptor expression translated into enhanced migration towards chemokine gradients. To investigate this, a chemotaxis assay was used (TRANSWELL, Corning, Inc., Coming, NY) with recombinant CX3CL1 and CXCL8 (IL-8), the ligands for CX3CR1 and CXCR1 / CXCR2, respectively (FIG 27A). KLF2-expressing NK cells migrated towards chemokine gradients in significantly higher numbers than the control cells. Furthermore, when present in combination, CX3CL1 and IL-8 attracted more KLF2-expressing cells than either chemokine alone (FIG. 27B). These results indicate that overexpressing KLF2 rescues the dysregulated chemotaxis induced by chronic feeder-based activation.

[0070] KLF2 overexpression inhibits development of tissue resident phenotypes and activation-induced dysfunction in NK cells

[0071] Whether KLF2 was sufficient to prevent the development of other NKAR-mediated defects, such as the previously observed tissue resident phenotypes, was investigated by stimulating mNG and KLF2-mNG cells with NKAR agonists (and control IgG) and performing RNA sequencing. First, pathway analyses were used to examine the broader biological effects of KLF2 knock-in. Here, in control culture conditions, KLF2 overexpression resulted in enrichment of adhesion and chemotaxis pathways relative to mNG cells (FIG. 28A). Driving this enrichment were several integrins and chemokine receptors, such as Itgam, Itgax, Itga5, Cx3crl, and Sell. In chronic NKAR stimulation conditions, KLF2-expressing cells were robustly enriched for cytoplasmic translation and aerobic respiration pathways relative to mNG cells, implying additional roles for KLF2 beyond regulation of trafficking (FIG. 28B).

[0072] Next, the tissue residency profiles of these cells was examined to determine whether KLF2 overexpression influenced the NKAR-induced transcriptional changes. Expression of KLF2 inhibited the upregulation of NK cell tissue residency factors, including adhesion molecules (e.g., Itgal (CD49a) and 77; / / ?), transcription factors (e.g., Prdml (Blimp-1), Rora and Kit (c-Kit)) and chemokine receptors (e.g., Cxcr6). Further, expression of KLF2 promoted the expression of transcripts associated with effector NK cells such as Slpr5 and Gzmb (FIG. 29). Together, these transcriptomic analyses reveal that KLF2 deficiency mediates the transition into a tissue resident like state. Given that Klf2 expression was significantly downregulated in dysfunctional, chronically NKAR-stimulated NK cells, the extent to which forced KLF2-expression sustained effector function throughout NKAR stimulation was investigated. Using the previously described K562 degranulation / cytokine accumulation assays, KLF2-mNG cells were significantly more functional than mNG control cells in response to missing-self targets (FIG. 30). Except for a modest rescue in TNFa production, KLF2 expression failed to confer a benefit to NK cells in the NKAR group (FIG. 30). Further, KLF2 expression inhibited NK cells from activation-induced cell death and inhibited upregulation of the canonical T cell exhaustion-mediating transcription factor Tox (FIG. 31). GFP-negative cells in the KLF2-transduced population, but not the mNG- transduced population, were more functional and better resisted NKAR-mediated loss of degranulation. This raised the possibility that KLF2-expressing cells within this mixed culture were enhancing the function of bystander NK cells.

[0073] Because IL- 15 enhances NK cell function but also induces dysfunction when present at high concentrations for long periods of time, the ability of KLF2 to inhibit dysfunction during IL- 15 activation was investigated. Using the previously mentioned K562 coincubation assays, KLF2-expressing cells were significantly more functional — especially at 10 ng / mL IL- 15 — relative to the mNG control population and resisted the effects of activation-induced cell death (FIG. 32). Given the increased degrees of degranulation and cytokine production in these function assays, the extent to which KLF2 increased expression of NK cell effector molecules was investigated. Here, at higher concentrations of IL- 15, KLF2 significantly increased expression of granzyme B, perforin, and T-bet, further establishing the role of KLF2 in promoting the effector qualities of NK cells (FIG. 33). Lastly, because IL-15 negatively regulates CX3CR1 expression on NK cells, expression of CX3CR1 following culture in IL-15 was evaluated. As expected, the control cells lost expression of CX3CR1 at higher concentrations of IL-15. However, KLF2-expressing cells maintained levels of CX3CR1 across all conditions (FIG. 34). Taken together, these results demonstrate that expression of KLF2 inhibits the induction of several aspects of NK cell dysfunction.

[0074] KLF2 expression differentiates tissue resident and circulating innate lymphoid cells

[0075] Given the data demonstrating that KLF2 deficiency is associated with the adoption of tissue resident-like features in NK cells, in vivo models were used to directly study the role of KLF2 in regulating tissue-specific residency in fully immune-competent animals. Specifically, KLF2 expression among group 1 innate lymphoid cells (i.e., NK cells and ILCls) was studied across different tissues using the KLF2-GFP reporter mouse, a model that has been used to study KLF2 in several lymphocyte populations, but not NK cells or ILCls. By harvesting a range of tissues in naive mice, group 1 ILCs (i.e., CD3-negative NKp46+NKl. l+cells) express KLF2 at considerably lower levels in non-lymphoid tissues (e.g., the salivary glands and female reproductive tract (FRT)) compared with blood and lymphoid tissues. Furthermore, CD62L expression among cells in these tissues tracked closely with KLF2 expression, matching the KLF2-CD62L connection in human NK cells. This correlation was also apparent for T cells in this model. Because KLF2 expression was lower in group 1 ILCs in non-lymphoid tissues, the extent to which this observation was connected to the tissue residency status of these lymphocytes was evaluated. IV-labeling revealed that tissue resident populations of group 1 ILCs were predominantly KLF2-negative. In contrast, IV+cells (i.e., circulating cells within these tissues) were predominantly KLF21, establishing a stark contrast in expression patterns between KLF2' cells and KLF2+cells, and echoing the expression patterns observed for memory CD8+T cells. Furthermore, using CD49a, CD49b, and CD200R1 as markers to distinguish NK cells (CD49a-negative CD49b+CD200R1 -negative) from ILCls (CD49a+CD49-negative CD200Rl+), ILCls are the KLF2-negative population while NK cells are predominantly KLF2+(FIG. 35). In sum, these data highlight the stark contrast in KLF2 expression between circulating and tissue-resident NK cells and raise the possibility that KLF2 mediates the establishment of tissue residency features in murine NK cells.

[0076] KLF2 deficiency induces the development of tissue resident features in vivo and alters NK cell homing

[0077] The KLF2 knock-in studies suggested that KLF2 represses the development of tissue resident characteristics. Thus, the role of KLF2 in mediating tissue-specific residency in vivo was examined. To do this, mixed bone marrow chimeras were generated using wild type and KLF2-fl / fl-NCRl-CreERT2mice (Weinreich et al., 2009, Immunity 31 : 122-130). After immune reconstitution of the congenic hosts, an NK cell-specific deletion of KLF2 was induced via tamoxifen injection (i.p.) and tissues were harvested two weeks later (FIG. 15). A significant reduction in the KO / WT ratio (relative to pre-KO blood ratios) was observed in all tissues except the bone marrow, where this ratio was significantly increased, indicating an accumulation of KLF2-deficient NK cells in the bone marrow. Furthermore, in the bone marrow, liver, and spleen, KLF2 deficiency resulted in a reduced proportion of CD62L-expressing NK cells, aligning with data indicating positive control of CD62L expression by KLF2 (FIG. 16A). In the liver, in addition to a reduction in CD62L expression, loss of KLF2 resulted in a robust upregulation of the ILCl / tissue residency marker CD49a (FIG. 16B). Again, this mirrors RNAseq data indicating that forced KLF2 expression significantly weakens Itgal (CD49a) expression in human NK cells (FIG. 29). When examining the maturity of NK cells within these tissues using the well described CD1 lb-CD27 expression paradigm, there was a dramatic reduction in mature (CD1 lb+CD27-negative) NK cells in the blood, and a similarly robust accumulation of immature (CD1 Ib-negative, CD27+) NK cells in the bone marrow (FIG. 17). In the liver, there was both a decrease in the percentage of immature NK cells and an increase in mature NK cells, demonstrating the widespread effects of KLF2 in controlling NK cell tissuespecific homeostasis in naive animals (FIG. 17C). As a whole, these studies using KLF2 reporter mice and NK cell-specific KLF2 conditional knockout system uncover a novel role for KLF2 in controlling site-specific tissue residency and promoting the immune development of mature NK cells.

[0078] Thus, this disclosure presents data revealing howNK cells responding to chronic activation lose their effector function and acquire a tissue-resident like phenotype. The transcription factor KLF2 is involved in this transition as evidenced by KLF2 deficiency in vivo resulting in a transition into a tissue resident state. This conversion of effector NK cells into a tissue resident-like population occurs in chronic cancers and is associated with poor patient outcomes. Forced expression of KLF2 during chronic activation inhibits upregulation of features that characterize NK cells as dysfunctional, tissue resident NK cells, including CXCR6, CD49a, Blimp- 1, c-Kit, and RORA (FIG. 29). These genetic studies also reveal that KLF2 inhibits induction of the canonical T cell exhaustion mediator, 7'ox. offering an additional mechanism by which KLF2 may inhibit activation-induced dysfunction (FIG. 31). While KLF2 deficiency is implicated in mediating T cell exhaustion, a similar mechanism for chronically stimulated NK cells has not previously been shown to exist. These insights into the basic biology of NK cells and their response to activation have direct clinical applications since sustaining KLF2 expression in NK cells promotes chemotaxis, anti-tumor function, and resistance to activation- induced cell death.

[0079] The in vivo studies reported in this disclosure also directly implicate KLF2 deficiency as a mediator of the transition into a tissue resident-like state. Although single cell sequencing studies have identified KLF2 as a feature of conventional, circulating NK cells, this disclosure reveals that the absence of KLF2 is a conserved feature of tissue resident group 1 ILCs, with NK cells being largely KLF2+and ILC1 populations (a tissue resident population) being predominantly KLF2-negative (FIG. 35). Mixed bone marrow chimeras using KLF2-fl / fl-NCRl- CreERT2mice take the next step to provide evidence that tissue resident phenotypes are not merely associated with KLF2 deficiency, but that they are causally connected (FIGS. 15-17). Tissue resident innate immune cells have well-appreciated roles in protecting mammalian hosts from infection and this study revealed that targeting KLF2 may be a way to influence a host’s innate response to infection.

[0080] In addition to generating insights into the development of tissue resident-like features, this disclosure unveils novel genetic mechanisms that drive the NK cell response to prolonged cytokine exposure. Sequencing analyses highlighted robust differences in transcriptional signatures between IL-15-stimulated NK cells versus NKAR-stimulated NK cells, with IL-15 stimulation weakening cell cycle gene expression and NKAR stimulation weakening migration pathways. IL- 15 is a promising therapeutic for various malignancies; however, in comparison to the vast body of knowledge on the benefits of IL- 15, there is comparatively very little known about how IL- 15 eventually weakens the NK cell response to cancer. Therefore, it is of high clinical interest to investigate how to mitigate the detrimental effects of IL- 15 on anti -tumor NK cells.

[0081] In another aspect, this disclosure describes novel epigenetic mechanisms associated with NK cell activating receptor-mediated dysfunction. The results of methylation array demonstrate that NKAR-stimulated cells possess differentially methylated genomes, with methylation negatively correlating with gene expression (FIG. 22). Furthermore, pathway analysis from these differentially methylated loci indicate that these epigenetic changes may be increasing expression of negative regulators of immunity like TIGIT, ENTPD1, CTLA4, and EBI3. Thus, epigenetic changes may be linked to changes in gene expression in chronically stimulated human NK cells. Additionally, Foxol — a known positive regulator of Klf2 — is a gene with one of the most highly differentially methylated probes in NKAR-stimulated cells, offering another potential mechanism leading to KLF2 deficiency in chronically stimulated NK cells. Together, these data raise the possibility that there is an epigenetic component to the deterioration of NK cell effector function during chronic stimulation of NK cell activating receptors. Epigenetic modifications are a hallmark of exhausted T cells and there are some data indicating that targeting these changes can lead to resistance to immune exhaustion. Thus, targeting NK cell epigenetic modifications may be a strategy to maintain the potency of NK cell cancer immunotherapies.

[0082] In summary, this disclosure identifies novel genetic and epigenetic mechanisms underlying the transition of effector NK cells into a state of immune dysfunction. This dysfunction is associated with the development of tissue resident-like features and that the transcription factor KLF2 inhibits this process.

[0083] While described in detail herein in the context of an exemplary embodiment in which genetic and epigenetic modifications occur with respect to KLF2 (SEQ ID NO:21), the engineered NK cells and methods described herein can involve NK cells with genetic and / or epigenetics modifications to other genes that control the transition of effector NK cells to a tissue resident-like, dysfunctional state. Exemplary genes in which a genetic modification may be introduced include, but are not limited to, DUSP2 (SEQ ID NO: 19) and / or / 1 / ZS7J- / (SEQ ID NO:20).

[0084] Engineered cells

[0085] In one aspect, the present disclosure relates to an engineered immune cell. Typically, the immune cell is an NK cell. The NK cell may be derived from any suitable source. In one or more embodiments, the NK cell is harvested from a subject. The subject may be a mammal, such as a human, a mouse, a rat, a cow, a cat, a dog, or a ferret. In one or more embodiments, the NK cell is harvested from bone marrow. However, the NK cell may be harvested from any suitable source in a subject. For example, the NK cell may be collected from umbilical cord blood, whole blood, serum, lymph nodes, spleen, tonsil, thymus, or tumor.

[0086] In one or more embodiments, the NK cell is derived from a CD34+hematopoietic progenitor. In one or more embodiments, the NK cell is derived from an induced pluripotent stem cell (iPSC). Methods of deriving NK cells from stem cells and stem-like cells are known to the art. In one or more embodiments, the NK cell is an immortalized NK cell. In one or more embodiments, the NK cell is an NK92 cell.

[0087] In one or more embodiments, the engineered cell includes one or more genomic mutations. As it is used herein, a “genomic mutation” includes one or more changes to the nucleotides of a genome.

[0088] In one or more embodiments, the engineered cell includes one genomic mutation. In one or more embodiments, the engineered cell includes two genomic mutations. The engineered cell may include more than two genomic mutations, such as three, four, five, ten, twenty, or more genomic mutations.

[0089] In one or more embodiments, the engineered cell includes a genomic mutation to DUSP2. The DUSP2 gene encodes the protein dual specificity protein phosphatase 2 (DUSP2). DUSP2 is a phosphoserine / threonine and phosphotyrosine kinase. In particular, DUSP2 inactivates mitogen-activated protein kinase 3 (MAPK3, ERK1) and mitogen activated protein kinase 2 (MAPK2, ERK2), known collectively as ERK1 / 2.

[0090] In one or more embodiments, the engineered cell includes an inactivating mutation to DUSP2. As it is used herein, an “inactivating mutation” refers to a mutation that decreases or completely ablates expression of a gene product. One example of an inactivating mutation is incorporation of a premature stop codon. In one or more embodiments, the engineered cell includes a lower level of DUSP2 protein than a comparable non-engineered cell.

[0091] In one or more embodiments, the engineered cell includes a genomic mutation to DUSP4. " \\c DUSP4 gene encodes the protein dual specificity protein phosphatase 4 (DUSP4). Like DUSP2, DUSP4 negatively regulates members of the MAP kinase superfamily, including ERK1 / 2.

[0092] In one or more embodiments, the engineered cell includes an inactivating mutation to DUSP4. DUSP4 is known to produce two protein isoforms. An inactivating mutation to DUSP4 may decrease expression of one or both protein isoforms.

[0093] In one or more embodiments, the engineered cell includes a genomic mutation to DUSP2 and DUSP4. Mutation to both genes may reduce cell exhaustion to a greater extent than mutation to either DUSP2 or DUSP4 independently. Engineered cells having mutations to both / JL;S7J2 and DUSP4 are sometimes referred to herein as “double knockout” cells. In one or more embodiments, the engineered cell includes a genomic mutation to KLF2. The QRQKLF2 encodes the protein Kriippel-like factor 2 (KLF2). KLF2 is a zinc finger transcription factor that, in relevant part, controls the expression of chemokine receptors in lymphocytes. The precise role of KLF2 in NK cells is not known but is suspected to be related to NK cell exhaustion. As is described herein, increased expression of KLF2 in NK cells decreases exhaustion.

[0094] In one or more embodiments, the engineered cell includes a genomic mutation to KLF2. Interestingly, the present disclosure describes that both increased expression of KLF2 and decreased expression of KLF2 in NK cells may be desirable, depending on the desired clinical effect.

[0095] In one or more embodiments, the genomic mutation to KLF2 results in decreased levels of the KLF2 protein relative to a wild-type KLF2 gene. The present disclosure demonstrates that loss of KLF2 expression results in loss of proinflammatory chemokine receptors including CXCR1, CXCR2, CXCR3, and CD26L. Decreased expression of CD62L may improve retention of NK cells in the blood, ultimately leading to improved treatment.

[0096] In one or more embodiments, the genomic mutation to KLF2 results in increased levels of the KLF2 protein relative to a wild-type KLF2 gene. Increased levels of KLF2 are typically associated with increased levels of proinflammatory chemokine receptors as described herein. Increased levels of such proinflammatory chemokine receptors typically improves homing of NK cells to solid tumor sites, ultimately leading to improved treatment of tumors.

[0097] In one or more embodiments, the engineered cell includes a genomic mutation to DUSP2, a genomic mutation to DUSP4, and a genomic mutation to KLF2. The genomic mutation to each gene is typically consistent with those described herein. For example, the engineered cell may include an inactivating mutation X.oDUSP2, and inactivating mutation to DUSP4, and an activating mutation to KLF2. In one or more alternate embodiments, the engineered cell may include an inactivating mutation to DUSP2, and inactivating mutation to DUSP4, and an inactivating mutation \c>KLF2.

[0098] An engineered cell of the present disclosure may be identified by one or more functional characteristics. For example, an engineered cell of the present disclosure may have increased ERK1 / 2 activity relative to a non-engineered cell. In other words, an engineered cell of the present disclosure may have reduced inactivation of ERK1 / 2. In one or more embodiments, an engineered cell of the present disclosure has differential expression of one or more proinflammatory chemokine receptors. For example, an engineered cell may have increased expression of CXCR1, CXCR2, CXCR3, CD62L, or a combination thereof. Conversely, an engineered cell may have decreased expression of CXCR1, CXCR2, CXCR3, CD62L, or a combination thereof. As is described herein, in different clinical scenarios, either upregulation or downregulation of some proinflammatory chemokine receptors may be beneficial.

[0099] Method of engineering a cell

[0100] In another aspect, the present disclosure relates to methods of engineering a cell. The method typically includes contacting a cell with a sequence-guided gene editor and one or more guide RNAs.

[0101] Methods of introducing genomic mutations include, for example, transcription activatorlike effector nucleases (TALENs), zinc finger nucleases, recombinase systems (e.g., Cre / loxP), transposons, and clustered regularly interspaced short palindromic repeats (CRISPR) / CRISPR- associated protein (Cas) systems. In one or more preferred embodiments of the present disclosure, a genomic mutation to a cell is introduced using CRISPR / Cas9.

[0102] In one or more embodiments, the sequence-guided gene editor includes a Cas protein, such as Cas9. While described herein in the context of Cas9, the methods of the present disclosure may involve alternate Cas proteins or alternate sequence-guided endonucleases.

[0103] While methods of introducing genomic edits are known to the art, design and installation of a desired edit is typically challenging. The efficacy of edit installation at a targeted genetic locus is often unpredictable. In addition, installation of one or more “off-target’ ’ edits at a site other than the targeted locus is common and can introduce unforeseen genetic issues. Thus, the engineered cell of the present disclosure solves at least two problems: (1) identification of an effective genomic mutation and (2) efficient installation of the genomic mutation.

[0104] In one or more embodiments, the method includes using a guide pool including more than one guide RNA. In one or more embodiments, the method includes using three guide RNAs for each gene targeted. For example, in one or more embodiments wherein DUSP2 is targeted, three guide RNAs (e.g., SEQ ID NOT, SEQ ID NO:2, and SEQ ID NOT) are used. In one or more embodiments, the one or more guide RNAs include a sequence substantially similar to a region of the DUSP2 gene. In one or more of these embodiments, the one or more guide RNAs includes a sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% sequence identity to 5'- GGCGCGCGAGCUGGAGUGCG-3' (SEQ ID NO: l),5'-GGCGGAACGCACGCUGCUGC-3' (SEQ ID NO:2), or 5'-CGCCGCAGCAGCGCGUUCCA-3' (SEQ ID NO:3). In one or more of these embodiments, the one or more guide RNAs includes a sequence identical to 5'- GGCGCGCGAGCUGGAGUGCG-3' (SEQ ID NO: 1), 5'-GGCGGAACGCACGCUGCUGC-3' (SEQ ID NO:2), or 5'-CGCCGCAGCAGCGCGUUCCA-3' (SEQ ID NO:3).

[0105] In one or more embodiments, the one or more guide RNAs include a sequence substantially similar to a region of the DUSP4 gene. In one or more of these embodiments, the one or more guide RNAs includes a sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% sequence identity to 5'- UCUGUGGCACUGGGGGGAAC-3 ' (SEQ ID NO:4), 5'-CCUUUACAGGCGGCUAUGAG-3' (SEQ ID NO:5), or 5'-GUCUACCUGGUCGUGUAGUG-3' (SEQ ID NO:6). In one or more of these embodiments, the one or more guide RNAs includes a sequence identical to 5'- UCUGUGGCACUGGGGGGAAC-3 ' (SEQ ID NO:4), 5'-CCUUUACAGGCGGCUAUGAG-3' (SEQ ID NO:5), or 5'-GUCUACCUGGUCGUGUAGUG-3' (SEQ ID NO:6).

[0106] In one or more embodiments, a first guide RNA includes a sequence substantially similar to a region of the DUSP2 gene and a second guide RNA includes a sequence substantially similar to a region of the DUSP4 gene. In one or more such embodiments, a pool of six guide RNAs is used. The pool of six guide RNAs may include sequences having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% sequence identity to SEQ ID NOs: 1-6. The pool of six guide RNAs may include sequences identical to SEQ ID NOs: 1-6.

[0107] In one or more embodiments, the one or more guide RNAs include a sequence substantially similar to a region of the KLF2 gene. In one or more of these embodiments, the one or more guide RNAs includes a sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% sequence identity to 5'- CCGCGGGGGCGCUGUAGGGC-3' (SEQ ID NO:7), 5'-CGCGCCGAACCCGAGUCCGG-3' (SEQ ID NO:8), or 5'-GCUGGAUGGCCUGGGCGCCG-3' (SEQ ID NO:9). In one or more of these embodiments, the one or more guide RNAs includes a sequence identical to 5'- CCGCGGGGGCGCUGUAGGGC-3' (SEQ ID NO:7), 5'-CGCGCCGAACCCGAGUCCGG-3' (SEQ ID NO:8), or 5'-GCUGGAUGGCCUGGGCGCCG-3' (SEQ ID NO:9).

[0108] As used herein “sequence identity” refers to the extent to which two nucleic acid sequences are invariant throughout a window of aligned of nucleotides. “Identity” can be readily calculated by known methods including, but not limited to, those described in: Computational Molecular Biology (Lesk, A. M., ed.) Oxford University Press, New York (1988); Biocomputing: Informatics and Genome Projects (Smith, D. W., ed.) Academic Press, New York (1993); Computer Analysis of Sequence Data, Part I (Griffin, A. M., and Griffin, H. G., eds.) Humana Press, New Jersey (1994); Sequence Analysis in Molecular Biology (von Heinje, G., ed.) Academic Press (1987); and Sequence Analysis Primer (Gribskov, M. and Devereux, J., eds.) Stockton Press, New York (1991).

[0109] As used herein, the term “percent sequence identity” or “percent identity” refers to the percentage of identical nucleotides in a linear polynucleotide sequence of a reference (“query”) nucleic acid (or its complementary strand) as compared to a test (“subject”) nucleic acid (or its complementary strand) when the two sequences are optimally aligned. Percent sequence identity may be determined, when the compared sequences are aligned for maximum correspondence, as measured using a sequence comparison algorithm described below and as known in the art, or by visual inspection.

[0110] For sequence comparison, typically one sequence acts as a reference sequence to which test sequences are compared. When using a sequence comparison algorithm, test and reference sequences are entered into a computer, subsequence coordinates are designated if necessary, and sequence algorithm program parameters are designated. The sequence comparison algorithm then calculates the percent sequence identity for the test sequence(s) relative to the reference sequence, based on the designated program parameters. Methods of optimal alignment of sequences are well known to those skilled in the art and may be conducted by tools such as the local homology algorithm of Smith and Waterman, the homology alignment algorithm of Needleman and Wunsch, the search for similarity method of Pearson and Lipman, and optionally by computerized implementations of these algorithms such as GAP, BESTFIT, FASTA, and TFASTA available as part of the GCG WISCONSIN PACKAGE (Accelrys Inc., San Diego, CA). Alignment of sequences may be analyzed using a Burrows- Wheel er transform such as BOWTIE open-source software available from https: / / github.com / BenLangmead / bowtie. An “identity fraction” for aligned segments of a test sequence and a reference sequence is the number of identical components which are shared by the two aligned sequences divided by the total number of components in the reference sequence segment, i.e., the entire reference sequence or a smaller defined part of the reference sequence. Percent sequence identity is represented as the identity fraction multiplied by 100.

[0111] In one or more embodiments, the sequence-guided gene editor and the one or more guide RNAs are configured to introduce a double-stranded break in the genomic DNA of the cell. Gene editing systems may result in numerous installed edits, such as base transversions, base transitions, deletions, insertions, and template-guided insertions. In one or more embodiments of the present disclosure, the desired edit ultimately disrupts or stops expression of a target gene. One method of disrupting or stopping expression of a target gene is to install a short insertion or deletion that results in a frameshift mutation, or translation of a different, unstable protein from the gene’s reading frame. To install a short insertion of deletion, it is often effective to introduce a double-stranded break in the genomic DNA and allow the cell to repair the break using existing cellular machinery. When repairing double-stranded breaks, particularly blunt ended doublestranded breaks, cellular machinery will often degrade or add one or more nucleotides from one or both ends of the break. Thus, for some methods of the present disclosure, induction of a double-stranded break in the cell’s genomic DNA results in installation of the desired inactivating edit. However, methods of using template-based gene editors such as Prime Editor are also contemplated. (Anzalone et al. 2019, Nature 576 (7785): 149-157).

[0112] In one or more embodiments, contacting the cell with a sequence-guided gene editor and one or more guide RNAs includes contacting the cell with a ribonucleoprotein (RNP) including a sequence-guided gene editor protein and a guide RNA. Typically, the sequence-guided gene editor protein and the guide RNA are assembled in a complex. Many sequence-guided gene editor proteins, such as Cas9, bind to specific regions of guide RNA. When a sequence-guided gene editor protein is assembled in a complex with a guide RNA, it is bound to a region of the guide RNA and forms a stable, non-covalent complex.

[0113] In one or more embodiments, contacting the cell with a sequence-guided gene editor and one or more guide RNAs includes contacting the cell with a nucleic acid encoding the sequence- guided gene editor, the one or more guide RNAs, or both. The nucleic acid may include plasmid DNA, single-stranded RNA such as mRNA, double-stranded DNA, viral DNA, or viral RNA.

[0114] In one or more embodiments, contacting includes transfecting. In one or more embodiments, contacting includes transducing. In one or more embodiments, contacting includes transforming. In one or more embodiments, transforming includes electroporating. A brief electrical pulse may be used to create temporary pores in the cell membrane.

[0115] Notably, while the sequence-guided gene editor and one or more guide RNAs are used to prepare the engineered cell, they are typically not present in the final product.

[0116] In one or more embodiments, the method includes extracting genomic DNA from the engineered cell. The genomic DNA from the engineered cell can be analyzed using sequencing methods to determine whether an edit has been installed. For example, a region of DNA including a target site for installation of an edit may be amplified and sequenced. Methods of sequencing are known to the art and include Sanger sequencing, sequencing by synthesis, and pyrosequencing.

[0117] In one or more embodiments, the method includes expanding the engineered cell. Typically, methods of using engineered cells consistent with the present disclosure require administration of thousands of cells. Therefore, when tens of cells are engineered using the disclosed methods, it may be desirable to expand the cells to provide an amount that is useful for clinical applications.

[0118] In one or more embodiments, the method includes clonally separating the engineered cell from other cells. It may be desirable to produce a clonally identical population of cells. Thus, the engineered cell may be clonally isolated and further expanded to produce a population of cells having the same mutation.

[0119] Method of treating a subject

[0120] In another aspect, the present disclosure relates to a method of treating a subject. The method typically includes administering to the subject the engineered cell of the present disclosure.

[0121] The subject can be a human or a non-human animal such as, for example, a livestock animal, a laboratory animal, or a companion animal. Exemplary non-human animal subjects include, but are not limited to, animals that are hominid (including, for example chimpanzees, gorillas, or orangutans), bovine (including, for instance, cattle), caprine (including, for instance, goats), ovine (including, for instance, sheep), porcine (including, for instance, swine), equine (including, for instance, horses), members of the family Cervidae (including, for instance, deer, elk, moose, caribou, or reindeer), members of the family Bison (including, for instance, bison), feline (including, for example, domesticated cats, tigers, lions, etc.), canine (including, for example, domesticated dogs, wolves, etc.), avian (including, for example, turkeys, chickens, ducks, geese, etc.), a rodent (including, for example, mice, rats, etc.), a member of the family Leporidae (including, for example, rabbits or hares), members of the family Mustelidae (including, for example ferrets), or member of the order Chiroptera (including, for example, bats).

[0122] In one or more embodiments, the engineered cell is derived from the subject. Extraction, engineering, and re-administration of a subject’s cell is typically referred to as an autologous procedure. In one or more embodiments, the engineered cell is not derived from the subject, but is derived from a third-party donor. Administration of cells from a donor is typically referred to as an allogeneic procedure.

[0123] In one or more embodiments, the subject has or is at risk of having cancer. Cancers that may be suitable for treatment using methods of the present disclosure include immune cancers, such as leukemia, lymphoma, and myeloma; prostate cancer; pancreatic cancer; colorectal cancer; lung cancer, such as non-small cell lung cancer, small-cell carcinoma, adenocarcinoma, or mesothelioma; head and neck cancer, such as laryngeal cancer, nasopharyngeal cancer, or salivary gland cancer; breast cancer; bladder cancer; and skin cancer, such as basal cell carcinoma, melanoma, and squamous cell carcinoma.

[0124] The present disclosure describes that both increased expression of KLF2 and decreased expression of KLF2 in NK cells may be desirable, depending on the desired clinical effect. In particular, increased expression of KLF2 in NK cells may be desirable for methods wherein a patient having a tumor is treated. Decreased expression of KLF2 in NK cells may be desirable for methods wherein a patient having a type of cancer that typically does not form tumors, such as leukemia.

[0125] In one or more embodiments, the method can include administering sufficient engineered cells to provide a dose of, for example, from about 2* 106cells / kg to about 3 * 107cells / kg to the subject, although in one or more embodiments the methods may be performed by administering engineered cells in a dose outside this range. In some of these embodiments, the method includes administering sufficient engineered cells to provide a dose of from about 1 x 106cells / kg to about 1 * 108cells / kg to the subject, for example, a dose of from about 1 x 107cells / kg to about 5x 107cells / kg, or a dose of 2x 107cells / kg to about 3 x 107cells / kg. In one or more embodiments, the dose may be calculated using actual body weight obtained just prior to the beginning of a treatment course. In one or more embodiments, a method includes administering about 2x 106cells / kg to 3 x 106cells / kg to a subject. In one or more embodiments, a method includes administering about 2x l07cells / kg to 3xl07cells / kg to a subject.

[0126] A single dose may be administered all at once, continuously for a prescribed period of time, or in multiple discrete administrations. When multiple administrations are used, the amount of each administration may be the same or different. For example, a dose of 107cells per day may be administered as a single administration of 107cells, continuously over 24 hours, as two or more equal administrations (e.g., two 5x 106cells administrations), or as two or more unequal administrations (e.g., a first administration of 7x l06cells followed by a second administration of 3x l06cells). When multiple administrations are used to deliver a single dose, the interval between administrations may be the same or different.

[0127] Additionally or alternatively, the dose of cells administered to a subject may be described by the total number of cells administered. In one or more embodiments, a method includes administering a dose of 100 million to 500 million cells to a subject. In one or more embodiments, a method includes administering a dose of at least 50 million, at least 100 million, at least 150 million, at least 200 million, at least 250 million, or at least 300 million cells to a subject. In one or more embodiments, a method includes administering a dose of at most 900 million, at most 800 million, at most 700 million, at most 600 million, at most 500 million, or at most 400 million cells to a subject.

[0128] In one or more embodiments, the cells of the present disclosure are administered to a subject at a lower dose than a comparable traditional engineered cell product. In one or more embodiments, the cells of the present disclosure are administered to a subject at a lower frequency than a comparable traditional engineered cell product. As is described herein, the engineered cells of the present disclosure exhibit reduced exhaustion as compared to traditional engineered cells. Accordingly, a lower dose of engineered cells may be used to achieve a comparable result. In one or more embodiments, the active agent may be administered, for example, from a single dose to multiple doses per week, although in one or more embodiments the method can involve a course of treatment that includes administering doses of the active agent at a frequency outside this range. When a course of treatment involves administering multiple doses within a certain period, the amount of each dose may be the same or different. For example, a course of treatment can include an initial loading dose, followed by a maintenance dose that is lower than the loading dose. Also, when multiple doses are used within a certain period, the interval between doses may be the same or be different.

[0129] In certain embodiments, engineered cells may be administered from about once per month to about five times per week. In one or more embodiments, the engineered cells are administered daily, weekly, monthly, or quarterly. The engineered cells may be administered daily for at least one day, such as for three days, five days, or seven days, and then not administered for a period of time. For example, the engineered cells may be administered for a block of three days, quarterly for one or more years. In one or more embodiments, a method includes administering engineered cells to a subject monthly for three months. In one or more embodiments, a method includes administering cells to a subject quarterly following an initial treatment schedule.

[0130] “Treat” or variations thereof refer to reducing, limiting progression, ameliorating, or resolving, to any extent, the symptoms or clinical signs related to a condition. As used herein, “symptom” refers to any subjective evidence of disease or of a subject’s condition. Also as used herein, “sign” or “clinical sign” refers to an objective physical finding relating to a particular condition capable of being found by one other than the subject. A “treatment” may be therapeutic or prophylactic. “Therapeutic” and variations thereof refer to a treatment that ameliorates one or more existing symptoms or clinical signs associated with a condition. “Prophylactic” and variations thereof refer to a treatment that limits, to any extent, the development and / or appearance of a symptom or clinical sign of a condition. Generally, a “therapeutic” treatment is initiated after the condition manifests in a subject, while “prophylactic” treatment is initiated before a condition manifests in a subject.

[0131] Treating a condition can be prophylactic or, alternatively, can be initiated after the subject exhibits one or more symptoms or clinical signs of the condition. Treatment that is prophylactic — e.g., initiated before a subject manifests a symptom or clinical sign of the condition such as, for example, while development of a tumor remains subclinical — is referred to herein as treatment of a subject that is “at risk” of having the condition. As used herein, the term “at risk” refers to a subject that may or may not actually possess the described risk. Thus, for example, a subject “at risk” of a non-infectious condition (e.g., a cancer) is a subject possessing one or more risk factors associated with the condition such as, for example, genetic predisposition, ancestry, age, sex, geographical location, lifestyle, or medical history. Treatment may also be continued after symptoms have resolved, for example to prevent or delay their recurrence.

[0132] Accordingly, a composition can be administered before, during, or after the subject first exhibits a symptom or clinical sign of the condition. Treatment initiated before the subject first exhibits a symptom or clinical sign associated with the condition may result in decreasing the likelihood that the subject experiences clinical evidence of the condition compared to a subject to which the composition is not administered, decreasing the severity of symptoms and / or clinical signs of the condition, and / or completely resolving the condition. Treatment initiated after the subject first exhibits a symptom or clinical sign associated with the condition may result in decreasing the severity of symptoms and / or clinical signs of the condition compared to a subject to which the composition is not administered, and / or completely resolving the condition.

[0133] Thus, the method includes administering an effective amount of the composition to a subject having, or at risk of having, a particular condition. In this aspect, an “effective amount” is an amount effective to reduce, limit progression, ameliorate, or resolve, to any extent, a symptom or clinical sign related to the condition.

[0134] In the preceding description and following claims, the term “and / or” means one or all of the listed elements or a combination of any two or more of the listed elements. Unless otherwise specified, “a,” “an,” “the,” and “at least one” are used interchangeably and mean one or more than one; and the recitations of numerical ranges by endpoints include all numbers subsumed within that range (e.g., 1 to 5 includes 1, 1.5, 2, 2.75, 3, 3.80, 4, 5, etc.).

[0135] As used herein, “have,” “has,” “having,” “include,” “includes,” “including,” “comprise,” “comprises,” “comprising” or the like are used in their open-ended inclusive sense, and generally mean “include, but not limited to,” “includes, but not limited to,” or “including, but not limited to.” Further, wherever embodiments are described herein with the language “have,” “has,” “having,” “include,” “includes,” “including,” “comprise,” “comprises,” “comprising” and the like, otherwise analogous embodiments described in terms of “consisting of’ and / or “consisting essentially of’ are also provided. The term “consisting of’ means including, and limited to, that which follows the phrase “consisting of.” That is, “consisting of’ indicates that the listed elements are required or mandatory, and that no other elements may be present. The term “consisting essentially of’ indicates that any elements listed after the phrase are included, and that other elements than those listed may be included provided that those elements do not interfere with or contribute to the activity or action specified in the disclosure for the listed elements.

[0136] As used herein, the word “exemplary” means to serve as an illustrative example and should not be construed as preferred or advantageous over other embodiments.

[0137] As used herein, the terms “preferred” and “preferably” refer to embodiments of the invention that may afford certain benefits under certain circumstances. However, other embodiments may also be preferred under the same or other circumstances. Furthermore, the recitation of one or more preferred embodiments does not imply that other embodiments are not useful and is not intended to exclude other embodiments from the scope of the invention.

[0138] In the preceding description, particular embodiments may be described in isolation for clarity. Reference throughout this specification to “one embodiment,” “an embodiment,” “certain embodiments,” “one or more embodiments,” or “some embodiments,” etc., means that a particular feature, configuration, composition, or characteristic described in connection with the embodiment is included in at least one embodiment of the disclosure. Thus, the appearances of such phrases in various places throughout this specification are not necessarily referring to the same embodiment of the disclosure. Furthermore, the particular features, configurations, compositions, or characteristics may be combined in any suitable manner in one or more embodiments. Thus, features described in the context of one embodiment may be combined with features described in the context of a different embodiment except where the features are necessarily mutually exclusive.

[0139] In several places throughout the above description, guidance is provided through lists of examples, which examples can be used in various combinations. In each instance, the recited list serves only as a representative group and should not be interpreted as an exclusive list. For any method disclosed herein that includes discrete steps, the steps may be performed in any feasible order. And, as appropriate, any combination of two or more steps may be performed simultaneously.

[0140] EXEMPLARY EMBODIMENTS

[0141] Embodiment 1 is an engineered cell including a mutation to the DUSP2 gene, the DUSP4 gene, and / or the KLF2 gene of the cell.

[0142] Embodiment 2 is the engineered cell of Embodiment 1, wherein the engineered cell includes an NK cell.

[0143] Embodiment 3 is the engineered cell of Embodiment 1 or Embodiment 2, wherein the engineered cell includes a mutation that decreases expression of DUSP2.

[0144] Embodiment 4 is the engineered cell of Embodiment 1 or Embodiment 2, wherein the engineered cell includes a mutation that decreases expression of DUSP4.

[0145] Embodiment 5 is the engineered cell of Embodiment 1 or Embodiment 2, wherein the engineered cell includes a mutation that decreases expression of DUSP2 and a mutation that decreases expression of DUSP4.

[0146] Embodiment 6 is the engineered cell of Embodiment 1 or Embodiment 2, wherein the engineered cell includes a mutation that decreases expression of KLF2.

[0147] Embodiment 7 is the engineered cell of Embodiment 1 or Embodiment 2, wherein the engineered cell includes a mutation that increases expression of KLF2.

[0148] Embodiment 8 is the engineered cell of any preceding Embodiment, wherein the engineered cell is derived from bone marrow, whole blood, or umbilical cord blood.

[0149] Embodiment 9 is the engineered cell of any preceding Embodiment, wherein the engineered cell is derived from a mammal, such as a human or a mouse. Embodiment 10 is the engineered cell of any preceding Embodiment, wherein the engineered cell includes a lower level of pERKl / 2 relative to a comparable non-engineered cell.

[0150] Embodiment 11 is the engineered cell of any preceding Embodiment, wherein the engineered cell includes an increased level of CXCR1, an increased level of CXCR2, and / or an increased level of CXCR3 relative to a comparable non-engineered cell.

[0151] Embodiment 12 is a method of treating a subject including administering the engineered cell of any one of Embodiments 1 to 11.

[0152] Embodiment 13 is the method of Embodiment 12, wherein the subject has or is at risk of having cancer.

[0153] Embodiment 14 is the method of Embodiment 13, wherein the cancer is leukemia or lymphoma.

[0154] Embodiment 15 is the method of any one of Embodiments 12 to 14, wherein the subject is a mammal, such as a human or a mouse.

[0155] Embodiment 16 is a method of preparing an engineered cell including contacting a cell with Cas9 and one or more guide RNAs, wherein the one or more guide RNAs include a sequence substantially similar to a region of the DUSP2 gene, the DUSP4 gene, or the KLF2 gene of the cell.

[0156] Embodiment 17 is the method of Embodiment 16, wherein the one or more guide RNAs include a sequence having at least 70% sequence identity to:

[0157] 5'-GGCGCGCGAGCUGGAGUGCG-3' (SEQ ID NO:1), 5'-GGCGGAACGCACGCUGCUGC-3' (SEQ ID NO:2), 5'-CGCCGCAGCAGCGCGUUCCA-3' (SEQ ID NO:3), 5'-UCUGUGGCACUGGGGGGAAC-3' (SEQ ID NO:4), 5'-CCUUUACAGGCGGCUAUGAG-3’ (SEQ ID NO:5), 5'-GUCUACCUGGUCGUGUAGUG-3' (SEQ ID NO:6), 5'-CCGCGGGGGCGCUGUAGGGC-3' (SEQ ID NO: 7), 5'-CGCGCCGAACCCGAGUCCGG-3' (SEQ ID NO:8), or 5'-GCUGGAUGGCCUGGGCGCCG-3' (SEQ ID NO:9). Embodiment 18 is the method of Embodiment 16 or claim 17, wherein the one or more guide RNAs include: (i) a guide RNA including SEQ ID NO:1, a guide RNA including SEQ ID NO:2, and a guide RNA including SEQ ID NO:3; (ii) a guide RNA including SEQ ID NO:4, a guide RNA including SEQ ID NO:5, a guide RNA including SEQ ID NO:6; or (iii) a guide RNA including SEQ ID NO:7, a guide RNAincluding SEQ ID NO:8, and a guide RNAincluding SEQ ID NO:9.

[0158] Embodiment 19 is the method of any one of Embodiments 16 to 18, wherein the engineered cell is an NK cell.

[0159] Embodiment 20 is the method of any one of Embodiments 16 to 19, wherein contacting the cell with Cas9 and one or more guide RNAs includes electroporating the cell with an assembled rib onucl eoprotein .

[0160] EXAMPLES

[0161] The present invention is illustrated by the following examples. It is to be understood that the particular examples, materials, amounts, and procedures are to be interpreted broadly in accordance with the scope and spirit of the invention as set forth herein.

[0162] Example 1

[0163] In this Example, RNA from exhausted and non-exhausted NK cells was sequenced. The levels of expression of transcripts in exhausted and non-exhausted NK cells was quantified. Transcript expression levels were compared between exhausted and non-exhausted NK cells to identify genes that were differentially regulated between the two populations.

[0164] Genes were grouped using Gene Ontology. Associated groups that were found to be differentially expressed are shown in FIG. 1. Notably, intracellular signaling, particularly kinase- mediated signaling, and chemotactic migration were found to be significantly weakened in exhausted NK cells. The genes DUSP2, DU P4, and KLF2 were found to be differentially expressed. (FIG. 2, FIG. 3).

[0165] The genes DUSP2 and DUSP4 were found to be expressed at increased levels in exhausted NK cells. To determine whether the protein products of DUSP2 and DUSP4 were also differentially regulated, protein was extracted from NK cells after 4 and 10 days of exposure to either an isotype stimulus or exposure to a mixture of antigens intended to induce exhaustion, including aNKp46, MICA, and MICB. Levels of DUSP2 and DUSP4 were measured via Western blot (FIG. 4). In addition, phosphorylation of ERK1 / 2 was quantified by measuring levels of phosphorylated ERK1 / 2 (pERKl / 2) and total ERK1 / 2. All protein levels were normalized to levels of a-tubulin.

[0166] Thus, levels of DUSP2 and DUSP4, and their protein products DUSP2 and DUSP4, were higher in exhausted NK cells than in non-exhausted NK cells. In addition, levels of CXCR1, CXCR2, CXCR3, and KLF2 transcripts were lower in exhausted NK cells than in non-exhausted NK cells.

[0167] Example 2

[0168] In this Example, NK cells were treated with CRISPR / Cas9 reagents to install inactivating edits to DUSP2, DUSP4, and / or KLF2.

[0169] Guide RNAs (Synthego Corp., Redwood City, CA) were resuspended in TE buffer to a concentration of 100 pM. Guide RNA sequences are shown in Table 1.

[0170] Table 1. Guide RNA sequences

[0171] Enriched NK cells were seeded at 1 x 106cells / ml per well of 24-well plate in BO medium supplemented with 5 ng / ml IL-15. Cells were incubated at 37 °C in 5% CO2 overnight.

[0172] The following day, cells and an RNP mixture were prepared. BO complete medium was prepared by adding IL-15 at a final concentration of 5 ng / mL. Media was pre-warmed to 37 °C for at least 15 minutes. To prepare the RNP mixture for each well, Cas9 was mixed with gRNA at a ratio of 1 :2 Cas9:gRNA. Briefly, 0.8 pL of 100 pM gRNA (80 pmol total) was added to PCR strip tubes. An equal volume of TE buffer was added separately to Cas9 only control. Next, 0.65 pL of Cas9 (40 pmol total) was slowly added to each tube by swirling, avoiding creating of bubbles. The mixture was incubated in a thermocycler at 37 °C for 15 minutes to create the RNP complex. The RNP mixture was used immediately or stored on ice until it was used.

[0173] Appropriate cell density is determined, and cells are centrifugated at 1600 rpm for four minutes. Residual media was removed, and cells were not washed. Each pellet was gently resuspended in appropriate volume of electroporation buffer. 5* 105NK cells per well were added to the RNP mixture by pipetting by flicking and once or twice gently pipetting up and down, avoiding bubbles. 20 pL of the mixture of cells and RNP mixture was transferred into wells of a 16-well NUCLEOFECTOR strip (Lonza Cologne GmbH, Koln, Germany), avoiding bubbles.

[0174] The AMAXA 4D instrument (Lonza Cologne GmbH, Koln, Germany) was used to electroporate the NK cells with the RNP mixture. The settings used were “CM137” and buffer “P3.” Following electroporation, 100 pL of pre- warmed B0 complete medium is added to each well of the 16-well strip. The cells were incubated at 37 °C for 15 minutes. Cells were homogenized by gently pipetting up and down, then gently transferred to individual wells of a 96-well U-bottom plate.

[0175] 100 pL of prewarmed B0 complete medium was added to each well of the 16-well NUCLEOFECTOR strip and gently pipetted up and down to obtain residual cells. This 100 pL was added to the cells in 96-well plate to bring the final volume up to 200 pL. Cells were incubated at 37 °C and 5% CO2 for 72 hours.

[0176] 72 hours following nucleofection, cells were harvested, and DNA was extracted. DNA was sequenced. Inference of CRISPR Edits (ICE) sequencing analysis was performed to determine knockout efficiency. Briefly, Q5 HOT START (New England Biolabs, Inc., Ipswich, MA) reactions were prepared following manufacturer’s instructions. Primers used for amplification (FWD / REV) are shown in Table 2. An annealing temperature of 69 °C was used for DUSP2 and DUSP4 primers. An annealing temperature of 68 °C was used for KLF2 primers.

[0177] Table 2. Primers used for amplification and sequencing

[0178] PCR products were purified using Qiagen PCR cleanup kit according to manufacturer’s instructions. PCR templates were sent for sequencing using GENEWIZ services (Azenta US, Inc., Burlington, MA). The sequencing primer used for each target are shown in Table 2. Sequencing data was analyzed using Inference of CRISPR Edits (ICE) analysis (Synthego Corp., Redwood City, CA).

[0179] Cells treated with each pooled guide had the intended edits. Sequencing traces for knockout of DUSP2 and DUSP4 are shown in FIGs. 5 and 6.

[0180] Example 3

[0181] In this Example, the DUSP2 knockout, DUSP4 knockout, and DUSP2 / DUSP4 double knockout engineered cells created in Example 2 were analyzed using flow cytometry to measure phosphorylation of ERK1 / 2.

[0182] A 96-well plate was prepared with 0.1 x 106NK cells in each well. For each treatment, duplicate wells were prepared. Cells were stained with LIVE / dead™ Aqua stain (Thermo Fisher Scientific, Inc., Waltham, MA) for 15 minutes. Cells were spun down and washed once with PBS. 100 pL of complete medium was added to each well and cells were incubated at 37 °C for 30 minutes. 50 pL of 3x PMA / Iono solution (75 ng / mL PMA, 3 pM lonomycin) was added to each well for “PMA” treatment. 50 pL of media was added to each well of cells serving as an “untreated” control. Cells were incubated at 37 °C for 15 minutes. Immediately following the 15 min incubation, 150 pL of CYTOFIX (Pharmingen Corp., San Diego, CA) was added to each well. Cells were further incubated at 37 °C for 15 minutes. Cells were pelleted by centrifuging for 4 minutes at 1,600 rpm. Cells were washed twice with flow buffer (Ca / Mg-free phosphate buffered saline with 1% human AB serum and 5 mM EDTA).

[0183] First, cells were incubated with antibodies to stain surface markers to identify NK cells. The antibodies included aCD56 labeled with PE-Cy7, aCD3 labeled with PE-CF594, and aCD14 labeled with Brilliant Violet 421. Cells were incubated at 4 °C for 15 minutes. Cells were washed twice with flow buffer and resuspended in 100 pL cold permeabilization buffer. Cells were incubated for 30 minutes. The permeabilized cells were then incubated with an apERKl / 2 antibody labeled with Alexa Fluor 647 (Molecular Probes, Inc., Eugene, OR). Cells were incubated at 4 °C for 30 minutes Cells were washed twice with flow buffer and resuspended in 200 pL of flow buffer and transferred to tubes for flow cytometry. Cells were run on a flow cytometer and expression of each marker was quantified for each cell. The median fluorescence intensity of pERKl / 2 is shown in FIG. 7. Cells treated with PMA / Iono solution showed increased levels of pERKl / 2. Both single and dual knockout cells had significantly higher levels of pERKl / 2 than cells treated with Cas9 only.

[0184] From this Example, it was learned that knockout of DUSP2, DUSP4, or both DUSP2 and DUSP4 significantly increased levels of pERKl / 2 in cells stimulated with PMA / ionomycin.

[0185] Example 4

[0186] In this Example, the DUSP2 knockout, DUSP4 knockout, and DUSP2 / DUSP4 double knockout engineered NK cells created in Example 2 were incubated with different cancer cell lines. Following incubation, NK cells were stained for expression of IFNy and CD107a. Expression of IFNy and CD107a was measured using flow cytometry.

[0187] NK cells from transfection were harvested and counted. At least 100,000 cells were used per well for function assays. NK cells were incubated with or without cancerous cell lines. The cancerous cell lines tested were K562 cells, MA148 cells, and OVCAR8 cells.

[0188] NK cells were cocultured for 5 hours with a cancerous cell line target at 2:1 E / T ratio. At the beginning of the incubation, a-CD107a-FITC antibody (BioLegend, San Diego, CA) was added to the cells. GOLGISTOP, and GOLGIPLUG (Pharmingen Corp., San Diego, CA) were added to the cells after the first hour of incubation. Cells were washed with PBS, stained with LIVE / Dead™ fixable viability stain (Thermo Fisher Scientific, Inc., Waltham, MA), stained with surface antibodies, fixed, permeabilized, and stained intracellularly with anti-IFN-y-BV650 (BioLegend, San Diego, CA) and anti-TNF-a-BV421 (BioLegend, San Diego, CA). An LSR II (BD Biosciences, Franklin Lakes, NJ) flow cytometer was used for flow cytometric analyses.

[0189] Engineered NK cells incubated with K562 cells showed significantly higher levels of both IFNy and CD 107a. In particular, both single and dual knockout cells had significantly higher levels of both IFNy and CD 107a than cells treated with Cas9 only. Interestingly, the double knockout cells did not have significantly higher levels of IFNy or CD 107a than single knockout cells. (FIG. 8).

[0190] Engineered NK cells incubated with MA148 cells did not show significantly different levels of IFNy. However, CD107a both single and dual knockout cells had significantly higher levels of CD 107a than cells treated with Cas9 only. (FIG. 9).

[0191] Engineered NK cells incubated with OVCAR8 cells did not show significantly different levels of IFNy. However, CD 107a both single and dual knockout cells had significantly higher levels of CD 107a than cells treated with Cas9 only. (FIG. 10).

[0192] Thus, engineered NK cells having single knockout of DUSP2 or DUSP4 or dual knockout of both DUSP2 ?m DUSP4 showed increased levels of CD 107a after incubation with K562 cells, MA148 cells, an OVCAR8 cells. Interestingly, engineered NK cells only showed increased expression of IFNy after incubation with K562 cells, but not after expression of MA148 cells or OVCAR8 cells.

[0193] Example 5

[0194] NK cells from peripheral blood were expanded using conditions described (Zhu et al. Blood. 2020 Feb 6;135(6):399-410). Briefly, NK cells were expanded using irradiated K562 feeder cells that express membrane-bound IL-21 and 41BB-L. Non-adherent cells were removed and analyzed by flow cytometry to determine the purity of CD56+NK cells. These cells were the stimulated with a 2: 1 ratio of artificial antigen-presenting cells (aAPCs) to NK cells in media (RPMI 1640, 1% pen / strep, 2 mM L-glutamine, 1% non-essential amino acids, and 10% FBS supplemented with 50-100 U / mL IL2).

[0195] Genomic DNA was extracted from NK cells prior to and following expansion. KLF2 transcription abundance was measured using qPCR. Following expansion, NK cells had significantly reduced levels of KLF2 transcripts (FIG.

[0196] 12).

[0197] Example 6

[0198] In this Example, RNA from KLF knockout NK cells was collected and sequenced. Transcript abundance of genes of interest was measured.

[0199] The KLF knockout NK cells from Example 2 were incubated for four or ten days with either an isotype stimulus or exposure to a mixture of antigens intended to induce exhaustion, including aNKp46, MICA, and MICB. Following incubation, cells were harvested, and RNA was collected. RNA sequencing completed and sequencing results were analyzed. Expression levels of transcripts from several genes of interest, including KLF2, KLF3, S1PR1, S1PR5, SELL (CD62L), and CX3CRI in engineered NK cells is shown in FIG. 11. Each of these transcripts was present at a lower level in cells exposed to the exhaustion-inducing antigens.

[0200] Data showing expression of different transcripts in KLF2 knockout cells is shown in FIG. 13 and FIG. 14.

[0201] Example 7 Study Design

[0202] This study was designed to characterize the detrimental effects of chronic NK cell stimulation. In vitro stimulation systems were used to model chronic activation via NKAR agonists and IL- 15 signaling and performed RNA sequencing and EPIC Methylation (Illumina, Inc., San Diego, CA) array to examine the precise effects of these divergent modes of activation. For loss-of-function studies on KLF2, a CRISPR-Cas9 genetic knock-in was used; for gain-of- function studies on KLF2, an AAV-mediated genetic knock-in was used. Flow cytometry was used to evaluate the changes to NK cell phenotype and function following KLF2 deletion and overexpression. TRANSWELL migration assays (Corning Inc., Corning NY) were used to study the effects of KLF2 overexpression on NK cell chemotaxis towards CX3CL1 and IL-8 gradients. Mixed bone marrow chimeras were performed using WT and NCRl-Cre;KLF2 fl / fl mice to demonstrate that KLF2 deficiency in vivo results in alterations to NK cell homing and phenotype. Mice

[0203] C57BL6 mice were purchased from The Jackson Laboratory (Bar Harbor, ME) The KLF2fl / fland KLF2-GFP reporter mice have been previously described (Weinreich et al., 2009, Immunity 31, 122-130). NCRl-CreERT2mice have been previously described (Nabekura, T. & Lanier, L. L., 2016, Journal of Experimental Medicine 213, 2745-2758). Animals were maintained under specific pathogen free conditions at the University of Minnesota. All experimental procedures were approved by the Institutional Animal Care and Use Committee at the University of Minnesota.

[0204] NK cell isolation

[0205] Peripheral blood samples were obtained from the Memorial Blood Bank (Minneapolis, Minnesota). Isolation of PBMCs was carried out via density gradient centrifugation using Ficoll- Paque (Cytiva Sweden AB, Uppsala, Sweden). NK cells were enriched using NK cell negative selection enrichment kits (StemCell Technologies Inc., Vancouver, Canada). Immediately following enrichment, NK cells were plated for assays in either B0 media (DMEM plus Ham’s F12 medium, 2: 1, supplemented with 10% heat-inactivated human AB sera; 1% penicillinstreptomycin; 25 mM 2-ME; and 0.5 mg / mL sodium selenite) or RPML1640 supplemented with 10% fetal bovine serum.

[0206] Cell culture

[0207] K-562 (ATCC, CCL-243) and K562-Nuclight Red (NLR) cell lines were cultured in RPML1640 supplemented with 10% fetal bovine serum and 1% penicillin-streptomycin.

[0208] In vitro exhaustion assays

[0209] Receptor agonists were adsorbed onto tissue culture plates for 24 hours prior to NK cell harvesting and plating. A total of 300 pL of PBS containing 5 pg / mL anti-NKp46 (R&D Systems; catalog MAB1850), 1.25 pg / mL recombinant MICA Fc-chimera (R&D Systems, Inc., Minneapolis, MN), and 1.25 pg / mL recombinant MICB Fc-chimera (R&D Systems, Inc., Minneapolis, MN) was added to 24-well plates and incubated at 4 °C overnight. For the unstimulated condition, 300 pL of isotype solution (5 pg / mL; IgG2b) in PBS was added in parallel. After 24 hours, plates were washed twice with PBS and NK cells were added; NK cells were counted and resuspended in BO medium supplemented with 1 ng / mL IL-15 (R&D Systems, Inc., Minneapolis, MN) at a density of 1 x 106cells / mL. Then 1 mL (1 x 106NK cells) was added to each well of the previously prepared 24-well plates. After four days, NK cells were harvested, washed with PBS, counted, and cultured for two days on pre-coated stimulatory (and control) plates with either 0.2 ng / mL IL- 15 or 1 ng / mL IL-15. After two days, NK cells were harvested, washed with PBS, counted, and cultured for four days on pre-coated stimulatory (and control) plates with 1 ng / mL IL-15.

[0210] NK cell function assays

[0211] NK cells were cocultured for five hours with K-562 tumor targets at 2: 1 E / T ratio (500,000:250,000). Anti-CD107a-FITC antibody (BioLegend, San Diego, CA) was added at the start of incubation, followed by GOLGISTOP and GOLGIPLUG (BD Biosciences, Franklin Lakes, NJ) after the first hour of incubation. Cells were washed with PBS, stained with Live / Dead™ fixable viability stain (Thermo Fisher Scientific, Inc., Waltham, MA), stained with surface antibodies, fixed, permeabilized, and stained intracellularly with anti-fFN-y-BV650 (BioLegend, San Diego, CA) and anti-TNF-a-BV421 (BioLegend, San Diego, CA). An FACSymphony A3 was used for flow cytometric analyses. Permeabilization for intracellular staining was performed using 0.1% TritonX-100.

[0212] Flow cytometry

[0213] Fluorochrome-conjugated antibodies were purchased from BioLegend (San Diego, CA): CD3 [catalog 317330], CD56 [catalog 362510], Granzyme B [catalog 515408], Perforin [catalog 308112], LFN-y [catalog 502538], TNF-a [catalog 502932], CD107a [catalog 328606], CD107a [catalog 328616], CX3CR1 [catalog 341603], CXCR1 [catalog 320608], CXCR2 [catalog 320710], CD62L [catalog 304820], and T-bet [catalog 644814], Intracellular staining was performed using a FoxP3 kit (Thermo Fisher Scientific, Inc., Waltham, MA).

[0214] IncuCyte live cell imaging

[0215] Target cells (K562-NLR; see note below) were immobilized on poly-1- ornithine-coated 4

[0216] (Millipore Sigma, Burlington, MA) clear 96-well flat-bottom plates (1x 10 cells / well). NK cells 4 were added to each well (2* 10 ) for an E / T ratio of 2: 1. All cocultures were performed in BO media supplemented with caspase-3 / 7 reagent (Essen BioScience, Ann Arbor, MI). The viable target cells per well were imaged hourly over 24 hours using the IncuCyte Live Cell Analysis System (Essen BioScience, Ann Arbor, MI). Live cell numbers were quantified using IncuCyte Zoom or S3 software and normalized to the number of live cells in the target only control group.

[0217] RNA sequencing analysis

[0218] Raw fastq reads were processed to gene-level counts matrices using CHURP-PURR. Briefly, this trimmed adaptors using trimmomatic, mapped to GRC38.pl3 (Ensembl release) using HiSat2, and produced the counts matrices using featureCounts applied to the GRC38.pl 3 Ensembl gtf. For each sample, approximately 30M fragments were analyzed, and the majority (>90%) of these uniquely mapped to the genome. Less than 1% of fragments were rRNA. Average read quality was ~37.

[0219] Counts matrices were loaded into R for analysis. The edgeR package was used to process the counts and conduct differential expression testing. Normalization factors were calculated using cal cNormF actors, and genes were removed if fewer than 70% of samples in at least one treatment reached CPM > 200. This threshold was chosen to focus the analysis on more highly expressed genes and resulted in 9995 analyzable genes. A quasi-likelihood model was fit to the data using glmQLFit. The model design was “0 + trt + Donor”, meaning it was an intercept-free model with all treatment levels (day 10 iso continuous, day 10 iso gapped, day 10 X continuous, day 10 X gapped, day 4 iso, day 4 X) as a factor of trt, and the model was blocked by Donor source. Specific contrasts were tested using glmQLFTest, and multiple-comparisons adjustments were made using Benjamini -Hochberg to control the false discovery rate. Genes were considered differentially expressed if FDR < 0.05 and abs(log2FC) > 1.

[0220] Principal components were found by applying prcomp (in R) to log2 CPM data with no further normalization. Clustered heatmaps were made by using the pheatmap package applied to the log2 CPM data. These were z-scaled by gene to emphasize treatment differences. All other plots were generated using ggplot2. Over-representation and gene set enrichment analysis

[0221] The clusterProfiler package in R was used to conduct over-representation (ORA) and gene set enrichment analyses (GSEA). For ORA, we downloaded all human gene sets in msigdb using msigdbr on 2023-01-30, and kept gene sets with one of the following strings in its term: “ERK”, “APOPTOSIS”, “INFLAMM”, “SURVIV”, “CYCL” All hallmark gene sets were retained and the full biological processes category of GO terms. Enrichment within upregulated (FDR < 0.05, log2FC > 1) and downregulated (FDR < 0.05, log2FC < -1) gene lists were evaluated from the statistical contrasts. Enrichment was evaluated using enricher (msigdb genesets) and enrichGO (GO terms) with default settings. Output from enrichGO was simplified to reduce redundant terms using clusterProfiler:: simplify. The background universe used was the 9995 analyzable genes described above. Significant terms were those with FDR < 0.05.

[0222] For gene-set enrichment analysis, enrichment of specific gene sets pulled from the literature was tested. The sorted log2FC lists from the contrasts was used as input. The gene sets tested against were the significant differentially expressed genes (FDR < 0.05), up-regualted or down-regulated (abs(logFC) > 1) as previously described (Tang et al, 2023, Cell 186:4235- 4251.e20; Bai et al., 2021, Front. Immunol. 12:767070; Kumar et al., 2017, Cell Rep 20:2921- 2934; Dogra et al., 2020, Cell 180:749-763. el3). The GSEA function was sued to test for enrichment with exponent = 1 and BH FDR corrections.

[0223] Also, log2FC results were scattered against literature data. For these scatterplots, significant correlations were determined using linear regression in R. Only the differentially expressed genes from each dataset were included in the linear regression. Scripts to reproduce analyses are available on github.

[0224] Methylation analysis

[0225] EPIC methylation array data (Illumina, Inc., San Diego, CA) were analyzed using multiple R packages. The IlluminaHumanMethylationEPICanno.ilml0b4.hgl9 package was used for annotation of the CpG probes. The minfi package was used to load .idat files, perform QC, and map the CpG data to the annotation. The data were normalized using preprocessQuantile, which produced better apparent normalization (higher peaks and deeper trough) than other normalization functions in minfi. Prior to differential methylation analysis, we removed probes associated with biological sex, SNPs, and any probe which failed a detection test (p > 0.01) for any sample. The latter removal only removed 2727 probes (of > 800k).

[0226] The EPIC data were repeated measures. Therefore, Illumina’s duplicatecorrelation function was used to nest each day within donor in a mixed-effects model. Specifically, the donor was “block” in duplicatecorrelation, and then ImFit was used to model the data using the duplicatecorrelation results. The data were collected on two slides which were confounded with sampling date. Significantly differentially methylated probes were those with FDR < 0.05.

[0227] Overrepresentation analysis

[0228] Overrepresentation of DMPS was evaluated in GO terms using the missMethyl package. Up-methylated probe sets and down-methylated probe sets were separately tested (FDR < 0.05). The universe (all.cpg) was the filtered probe set tested, containing ~800k probes. The gometh function was used to conduct ORA and correct for the bias occurring when different numbers of probes are in different genes. Gene sets were considered overrepresented if FDR < 0.05.

[0229] Comparisons between RNASeq and EPIC methylation data were made by collected log2FC (RNASeq) and the change in beta (methylation) per probe, per gene, and scattering these results.

[0230] CRISPR-Cas9 gene editing

[0231] Cas9 RNP complexes were assembled immediately before nucleofection, by mixing equal volumes of 40 pM of Cas9 protein (Integrated DNA Technologies, Inc., Coralville, IA) Alt-R S.p. Cas9 Nuclease V3; catalog 1081058) and 80 pM of sgRNA at molar ratio of 1 :2 and incubating at 37 °C for 15 minutes in a PCR thermocycler. The final concentration of Cas9 RNP was defined as 20 pM. A nucleofection reaction consisted of 0.5* 10'6enriched NK cells in 20 pl of nucleofection buffer (5 mM KC1, 15 mM MgCh, 120 mM Na2HPO4 / NaH2PO4, pH 7.2) and 2 pl of Cas9 RNP (equivalent to 40 pmol). Nucleofection mixtures were then transferred into 16- well strip for nucleofection in the 4D NUCLEOFECTOR (Lonza Cologne GmbH, Koln, Germany) using the CM137 pulse code. Air bubbles were removed from the wells via gentle pipetting. Immediately after nucleofection, 80 pl of pre-warmed B0 culture medium (supplemented with 5 ng / mL IL-15) was added to each well for cell recovery in 37 °C incubator for 15 minutes The cells were then transferred to the culture plate filled with pre-warmed B0 culture medium (supplemented with 5 ng / mL IL-15) AH analyses were performed 72 hours after nucleofection.

[0232] For KLF2 deletion, pooled gRNA were purchased from Synthego Corp. (Redwood City, CA). Pooled sgRNA sequences were as follows: CCGCGGGGGCGCUGUAGGGC (SEQ ID NO:7), CGCGCCGAACCCGAGUCCGG (SEQ ID NO:8), GCUGGAUGGCCUGGGCGCCG (SEQ ID NO:9). Primers used to amplify target region for Sanger sequencing: GCTCGGGGTAGTAGAACGTG (F, SEQ ID NO: 16), GGACCTCGCATGCACGAA (R, SEQ ID NO: 17), amplicon size: 584 bp. PCR products were resolved on 2% TAE agarose gels. Genomic PCR products were purified the using QIAquick PCR Purification Kit. Purified samples were sequenced by the reverse primer of each genomic PCR primer set. ICE analysis was performed on the Synthego website.

[0233] BioLegend PE screen

[0234] Kit with catalog no. 700011 was used for WT and KLF2 KO NK cells from three donors. Cells were stained according to the manufacturer’s instruction, fixed with 2% PF A, and analyzed on a FAC Symphony A3.

[0235] C9 feeder expansion

[0236] NK cells were combined with C9 feeder cells (irradiated K562 expressing membranebound IL-21 and 4-1BBL) at a 1 :2 ratio (0.5>< 106: l x l06) in 10 mL of BO (supplemented with 50 U / mL IL-2) of a 24-well culture plate (G-REX, Wilson Wolf Manufacturing, St. Paul, MN). After four days, 4 mL media was removed from each well and replenished with 4 mL fresh B0 (supplemented with 50 U / mL IL-2). On day 7 cells were harvested, counted, and reseeded with C9 feeder cells at a 1 : 1 ratio (0.5x l06:0.5x 106) in 10 mL of B0 (supplemented with 50 U / mL IL- 2) of a 24-well culture plate (G-REX, Wilson Wolf Manufacturing, St. Paul, MN). After four days, 4 mL media was removed from each well and replenished with 4 mL fresh B0 (supplemented with 50 U / mL IL-2). On day 14 cells were harvested, counted, and used in downstream analyses. qPCR

[0237] RNA was isolated from NK cells using a kit (RNEASY MINI kit, Qiagen, Hilden, Germany). cDNA was synthesized using a kit (HIGH-CAPACITY RNA-to-cDNA, Thermo Fisher Scientific, Inc., Waltham, MA). Gene expression assays were carried out using TaqMan Fast Advanced Master Mix (2X) on the QUANTSTUDIO 5 real-time instrument platform (Thermo Fisher Scientific, Inc., Waltham, MA). TaqMan probes (20X) targeted Klf2 (Hs00360439_gl), Actb (Hs01060665_gl), Cx3crl (Hs01922583_sl), Cxcrl (Hs01921207_sl), Cxcr2 (Hs01891184_sl), Slpr5 (Hs00928195_sl), Slprl (Hs01922614_sl), and Sell (Hs00174151_ml). 20 pL reaction volumes were used in 384-well plates. Delta-Ct and deltadelta Ct were calculated using Actb as a housekeeping control. Results depict fold-change relative to day 0 timepoint.

[0238] TRANSWELL Migration Assay

[0239] NK cells were harvested, counted, and resuspend at a cell density of 0.5* 106NK cells per 100 pL (5*106 / mL) in complete medium (RPML1640 + 10% FBS). 100 pL (0.5* 106NK cells) of NK cells was added to the top chamber of a 24-well TRANSWELL plate with 5 pM pores (Corning, Inc., Corning, NY). 650 pL complete media (RPML1640 + 10% FBS) supplemented with 100 ng / mL recombinant chemokine (CX3CL1, R&D Systems, Inc., Minneapolis, MN; CXCL8, BioLegend, San Diego, CA). Plates were incubated at 37 °C for 1.5 hours. 600 pL of NK cells in media was collected from the bottom wells and NK cells were quantified via flow cytometry using absolute counting beads (COUNTBRIGHT, Life Technologies Corp., San Diego, CA).

[0240] AAV transfer vector cloning and AAV6 viral particle preparation

[0241] All cloning was conducted using a kit (NEBUILDER HiFi DNA Assembly, New England Biolabs, Inc., Ipswich, MA). For PCR amplification, all reaction was performed using PLATINUM SUPERFI II GREEN PCR master mix (Thermo Fisher Scientific, Inc., Waltham, MA) as per manufacturer’s instructions and amplified products were purified using a kit (ZYMOCLEAN gel DNA recovery kit, Zymo Research Corp., Irvine, CA). The AAV vector backbone was PCR-amplified from pAAV-CAG-GFP (Addgene, Watertown, MA).

[0242] Forward and reverse primers for AAV backbone amplification are, Forward: GGATCTTCCTAGAGCATGGCTACGT (SEQ ID NO 22), Reverse: TATGATACACTTGATGTACTGCCAAG (SEQ ID NO:23).

[0243] The fragments of mNeonGreen and KLF2-mNeonGreen flaked by GAPDH homology arms were chemically synthesized by Twist Biosciences and cloned into the pUC19 vector. For insert preparation, mNeonGreen and KLF2-mNeonGreen knock-in templates for AAV transfer vector cloning were PCR amplified from the cloned pUC19 vector. The PCR primers for insert amplification are, Forward: CTTGGCAGTACATCAAGTGTATCATAAAGCTTGCCTCCTGCACCACCAACTG (SEQ ID NO:24), Reverse: ACGTAGCCATGCTCTAGGAAGATCCAAGCTTGGGCATGGTTTTAGGTACTTGG (SEQ ID NO:25.

[0244] The PCR-amplified AAV vector backbone and insert were cloned and transformed into competent cells (NEB STABLE, New England Biolabs, Inc., Ipswich, MA). All bacterial culture steps were performed at 30 °C to prevent recombination of AAV-ITR. Transformed colonies are sequence verified by nanopore long-reads sequencing (Azenta US, Inc., Burlington, MA). The integrity of AAV-ITR was confirmed by AAV-ITR Sanger sequencing (Azenta US, Inc., Burlington, MA). The identified colonies were stored as glycerol stock and used for inoculation. For transfection-grade AAV transfer vector preparation, the glycerol stocks were inoculated into 6 mL of 2X YT medium, and the initial culture was established by culture at 30 °C for eight hours. The initial culture was then expanded into 300 mL of 2X YT medium and incubated at 30 °C for 18-20 hours. Next day, the plasmids were extracted using ZYMOPURE II Plasmid maxiprep kit (Zymo Research Corp., Irvine, CA) with low-copy number protocol as per manufacturer’s instructions. After purification, the plasmids were formulated in TE buffer (10 mM Tris, 0.1 mM EDTA, pH = 7.5) and adjusted to 2 pg / pL. The transfer plasmids were sent to OriGene Technologies, Inc. (Rockville, MD) for AAV6 viral particles production. The AAV6 viral particles were purified by iodixanol gradient ultracentrifugation and formulated in PBS with 0.001% Pluronic F68. Upon receiving, the AAV6 viral particles are immediately stored at -80 °C and aliquoted into small single-use vials before electroporation. Overexpression of mNeonGreen and KLF2-mNeonGreen using AAV6-mediated knock-in

[0245] The chemically-synthesized crRNA and Cpfl electroporation enhancer (Integrated DNA Technologies, Inc., Coralville, IA) were reconstituted in TE buffer (10 mM Tris, 0.1 mM EDTA, pH = 7.5) at concentration of 120 pM and 100 pM. GAPDH guide sequence: ATCTTCTAGGTATGACAACGA (SEQ ID NO 26). The Casl2a RNP was prepared at an approximate 1 :2 molar ratio of Casl2a:crRNA. For RNP assembly, 1 pL of crRNA was mixed with 1 pL of Cpfl electroporation enhancer, followed by addition of 1 pL of 67 pM (Integrated DNA Technologies, Inc., Coralville, IA) or 1.5 pL of 40 pM (QB3 MacroLab, University of California, Berkeley) recombinant Casl2a protein using slowly swirly pipetting. The mixture was then incubated at 37 °C for 15 minutes to facilitate the assembly. After incubation, the assembled AsCasl2a RNP was stored at room-temperature until electroporation. The AAV transduction medium was prepared as DMEM:F-12 (2: 1) supplemented with 5% CTS Immune Cell SR (Thermo Fisher Scientific, Inc., Waltham, MA), 20 pM P-mercaptoethanol, 50 pM ethanolamine, 20 pg / mL ascorbic acid, 5 ng / mL sodium selenite, and 50 lU / mL IL-2. The IL-2 was freshly supplemented before electroporation. For electroporation, one million of Day 7 feeder-expanded NK cells were pelleted at 400*g for five minutes, followed by one wash with AAV transduction medium. The cell pellet was resuspended in 19 pL of P3 electroporation buffer (Lonza Cologne GmbH, Kbln, Germany) and mixed with assembled AsCasl2a RNP. The mixture was then transferred to 16-well nucleofection strip (Lonza Cologne GmbH, Kbln, Germany) and pulsed on 4D NUCLEOFECTOR (Lonza Cologne GmbH, Kbln, Germany) with CM-137 program. Immediately after electroporation, 80 pL of pre-warmed AAV transduction medium was added and the 16-well nucleofection strip was incubated at 37 °C for 15-20 minutes. After incubation, the pulsed NK cells were seeded into 24-well plates containing 900 pL of AAV transduction medium and mixed with 5x 1010AAV6 viral particles (MOI = 5* 104). 1 pM M3814 was supplemented to facilitate the knock-in. The pulsed NK cells were then incubated at 37 °C overnight. Next day, the NK cells were centrifuged at 400*g for five minutes and resuspended in B0 medium supplemented with 50 lU / mL IL-2. The NK cells were allowed to expand for 48 hours before downstream analysis. In vitro stimulation assays

[0246] Splenic NK cells were isolated using the MAGNISORT NK cell enrichment kit (Affymetrix, Inc., Santa Clara, CA) and cultured in varying concentrations of RPMI (+ 10% FBS) supplemented with recombinant IL-15 (PeproTech, Inc., Cranbury, NJ). Anti-NKl.l (clone PK136) was adsorbed onto tissue culture plates in PBS (1 pg / mL) overnight, after which NK cells were plated at a density of 1 x 106 / mL in RPMI (+ 10% FBS). Copanlisib was purchased from MedChemExpress (Monmouth Junction, NJ).

[0247] Mixed Bone Marrow Chimera

[0248] WT C57BL / 6 (CD45.1 / .1) mice were irradiated twice (12 hours apart) with 500 cGy doses. Bone marrow cells from WT C57BL / 6 (CD45.1 / .2) and KLF2fl / flNCRl-CreERT2(CD45.2 / .2) mice were T cell depleted using anti-Thyl.2 antibodies and transferred in a 1 : 1 ratio (2.5e6:2.5e6) into irradiated hosts by tail-vein injection. Five weeks later, 2 mg tamoxifen was administered intraperitoneally in com oil once per day for five days. Mice were euthanized and tissues were harvested 14 days later.

[0249] Statistics

[0250] All statistical tests were performed and analyzed with GraphPad Prism software. Two- tailed t tests were used for comparisons of two groups. One-way ANOVA was used for comparisons of three or more groups. All error bars represent the mean ± SD, save for FIG. 29, where they represent SEM. Statistical significance was determined with the following thresholds: *P < 0.05; **P < 0.01; ***P < 0.001; ****p < 0.0001.

[0251] The complete disclosure of all patents, patent applications, and publications, and electronically available material (including, for instance, nucleotide sequence submissions in, e.g., GenBank and RefSeq, and amino acid sequence submissions in, e.g., SwissProt, PIR, PRF, PDB, and translations from annotated coding regions in GenBank and RefSeq) cited herein are incorporated by reference in their entirety. In the event that any inconsistency exists between the disclosure of the present application and the disclosure(s) of any document incorporated herein by reference, the disclosure of the present application shall govern. The foregoing detailed description and examples have been given for clarity of understanding only. No unnecessary limitations are to be understood therefrom. The invention is not limited to the exact details shown and described, for variations obvious to one skilled in the art will be included within the invention defined by the claims.

[0252] Unless otherwise indicated, all numbers expressing quantities of components, molecular weights, and so forth used in the specification and claims are to be understood as being modified in all instances by the term “about.” Accordingly, unless otherwise indicated to the contrary, the numerical parameters set forth in the specification and claims are approximations that may vary depending upon the desired properties sought to be obtained by the present invention. At the very least, and not as an attempt to limit the doctrine of equivalents to the scope of the claims, each numerical parameter should at least be construed in light of the number of reported significant digits and by applying ordinary rounding techniques.

[0253] Notwithstanding that the numerical ranges and parameters setting forth the broad scope of the invention are approximations, the numerical values set forth in the specific examples are reported as precisely as possible. All numerical values, however, inherently contain a range necessarily resulting from the standard deviation found in their respective testing measurements.

[0254] All headings are for the convenience of the reader and should not be used to limit the meaning of the text that follows the heading, unless so specified.

[0255] Sequence Listing Free Text

[0256] SEQ ID N0 1

[0257] GGCGCGCGAGCUGGAGUGCG

[0258] SEQ ID NO: 2

[0259] GGCGGAACGCACGCUGCUGC

[0260] SEQ ID NO: 3

[0261] CGCCGCAGCAGCGCGUUCCA

[0262] SEQ ID NO: 4

[0263] UCUGUGGCACUGGGGGGAAC SEQ ID NO: 5

[0264] CCUUUACAGGCGGCUAUGAG

[0265] SEQ ID NO: 6

[0266] GUCUACCUGGUCGUGUAGUG

[0267] SEQ ID NO: 7

[0268] CCGCGGGGGCGCUGUAGGGC

[0269] SEQ ID NO: 8

[0270] CGCGCCGAACCCGAGUCCGG

[0271] SEQ ID NO: 9

[0272] GCUGGAUGGCCUGGGCGCCG

[0273] SEQ ID NO: 10

[0274] AGCAGCACATGAGCCGG

[0275] SEQ ID NO: 11

[0276] TGCTCTGCCCTTGTATGGTG

[0277] SEQ ID NO: 12

[0278] GTCGGGCCGGAGCTCCGCCACCGAGGCACT

[0279] SEQ ID NO: 13

[0280] CCCAATACTCCGGGTTCACC

[0281] SEQ ID NO: 14

[0282] CAGTCCTGACGAGTGTGTCC

[0283] SEQ ID NO: 15 CTCCATGGCCATTCTCTAGGTC

[0284] SEQ ID NO: 16

[0285] GCTCGGGGTAGTAGAACGTG

[0286] SEQ ID NO: 17

[0287] GGACCTCGCATGCACGAA

[0288] SEQ ID NO: 18

[0289] AGACTCAGGAGAGGAGGATGC

[0290] SEQ ID NO 22

[0291] GGATCTTCCTAGAGCATGGCTACGT

[0292] SEQ ID NO: 23

[0293] TATGATACACTTGATGTACTGCCAAG

[0294] SEQ ID NO: 24

[0295] CTTGGCAGTACATCAAGTGTATCATAAAGCTTGCCTCCTGCACCACCAACTG

[0296] SEQ ID NO:25

[0297] ACGTAGCCATGCTCTAGGAAGATCCAAGCTTGGGCATGGTTTTAGGTACTTGG

[0298] SEQ ID NO: 26

[0299] ATCTTCTAGGTATGACAACGA

Claims

What is claimed is:

1. An engineered cell comprising a mutation to the DUSP2 gene, the DUSP4 gene, and / or the KLF2 gene of the cell.

2. The engineered cell of claim 1, wherein the engineered cell comprises an NK cell.

3. The engineered cell of claim 1 or claim 2, wherein the engineered cell comprises a mutation that decreases expression of DUSP2.

4. The engineered cell of claim 1 or claim 2, wherein the engineered cell comprises a mutation that decreases expression of DUSP4.

5. The engineered cell of claim 1 or claim 2, wherein the engineered cell comprises a mutation that decreases expression of DUSP2 and a mutation that decreases expression of DUSP4.

6. The engineered cell of claim 1 or claim 2, wherein the engineered cell comprises a mutation that decreases expression of KLF2.

7. The engineered cell of claim 1 or claim 2, wherein the engineered cell comprises a mutation that increases expression of KLF2.

8. The engineered cell of any preceding claim, wherein the engineered cell is derived from bone marrow, whole blood, or umbilical cord blood.

9. The engineered cell of any preceding claim, wherein the engineered cell is derived from a mammal, such as a human or a mouse.

10. The engineered cell of any preceding claim, wherein the engineered cell comprises a lower level of pERKl / 2 relative to a comparable non-engineered cell.

11. The engineered cell of any preceding claim, wherein the engineered cell comprises an increased level of CXCR1, an increased level of CXCR2, and / or an increased level of CXCR3 relative to a comparable non-engineered cell.

12. A method of treating a subject comprising administering the engineered cell of any one of claims 1 to 11.

13. The method of claim 12, wherein the subject has or is at risk of having cancer.

14. The method of claim 13, wherein the cancer is leukemia or lymphoma.

15. The method of any one of claims 12 to 14, wherein the subject is a mammal, such as a human or a mouse.

16. A method of preparing an engineered cell comprising contacting a cell with Cas9 and one or more guide RNAs, wherein the one or more guide RNAs comprise a sequence substantially similar to a region of the DUSP2 gene, the DUSP4 gene, or the KLF2 gene of the cell.

17. The method of claim 16, wherein the one or more guide RNAs comprise a sequence having at least 70% sequence identity to:5'-GGCGCGCGAGCUGGAGUGCG-3' (SEQ ID NO: 1), 5'-GGCGGAACGCACGCUGCUGC-3' (SEQ ID NO:2), 5'-CGCCGCAGCAGCGCGUUCCA-3' (SEQ ID NO:3), 5'-UCUGUGGCACUGGGGGGAAC-3' (SEQ ID NO:4), 5'-CCUUUACAGGCGGCUAUGAG-3’ (SEQ ID NO:5), 5'-GUCUACCUGGUCGUGUAGUG-3' (SEQ ID NO: 6), 5'-CCGCGGGGGCGCUGUAGGGC-3' (SEQ ID NO: 7), 5'-CGCGCCGAACCCGAGUCCGG-3' (SEQ ID NO: 8), or 5'-GCUGGAUGGCCUGGGCGCCG-3' (SEQ ID NO:9).

18. The method of claim 16 or claim 17, wherein the one or more guide RNAs comprise: (i) a guide RNA comprising SEQ ID NO: 1, a guide RNA comprising SEQ ID NO:2, and a guide RNA comprising SEQ ID NO:3; (ii) a guide RNA comprising SEQ ID NO:4, a guide RNA comprising SEQ ID NO:5, a guide RNA comprising SEQ ID NO:6; or (iii) a guide RNA comprising SEQ ID NO:7, a guide RNA comprising SEQ ID NO:8, and a guide RNA comprising SEQ ID NO:9.

19. The method of any one of claims 16 to 18, wherein the engineered cell is an NK cell.

20. The method of any one of claims 16 to 19, wherein contacting the cell with Cas9 and one or more guide RNAs comprises electroporating the cell with an assembled ribonucleoprotein.

Images