Production and secretion of recombinant proteins in yeast

Abstract

According to one broad aspect of this disclosure, herein provided is a method for producing a recombinant protein, the method comprising culturing a recombinant yeast cell comprising a polynucleotide encoding a polypeptide comprising at least one heterologous secretion signal selected from secretion signal of Kluyveromyces marxianus, S. cerevisiae, mutated variant thereof, and combinations thereof. The disclosure also provided a food protein, which is useful as, or as a component of, a food ingredient or a food product. The disclosure also provided an isolated nucleic acid, a polypeptide, and a recombinant yeast cell, which are useful as, or as components of, materials relating to production of recombinant proteins.

Description

PRODUCTION AND SECRETION OF RECOMBINANT PROTEINS IN YEASTRelated Application

[0001] This disclosure claims benefit and priority of United States Provisional Patent Application serial no. 63 / 539,856 filed September 22, 2024, 2023, which is incorporated herein by reference in its entirety.Incorporation of Sequence Listing

[0002] A computer readable form of the Sequence Listing “30130- P71814PC00_SequenceListing.XML” (119,765 bytes) was created on September 19, 2024, is filed herewith by electronic submission and is incorporated by reference herein.Field

[0003] The field of the invention relates to methods and compositions useful in the production and secretion of recombinant proteins in yeast.Background

[0004] Recombinant protein production at large volumes is essential to numerous sectors including biotechnology, pharmaceuticals, and the food and beverage industries. This involves using various cells such as mammalian, fungi, yeast, and bacterial cells, with microbial systems displaying certain benefits over mammalian cells. Despite these benefits, the process is not straightforward and can be challenging. In addition, turning to less commonly used yeast strains for efficient recombinant protein production can have unforeseen complications.

[0005] The process of producing recombinant proteins can be demanding. It involves creation of recombinant host organism, fermentation of the host organism to generate a crude product, followed by labor-intensive purification processes to extract the desired recombinant protein. Isolation of secreted recombinant proteins require precise and careful isolation from the medium in which they are grown. Furthermore, this process necessitates managing the growth burden imposed on the host cells. Moreover, high levels of recombinant protein can lead to protein misfolding, causing a decline in production over time. The difficulty of these challenges underscores the complexity of recombinant protein production, making it a nuanced and intricate field.Summary

[0006] The following is intended to introduce the reader to the more detailed discussion to follow. The summary is not intended to limit or define the claims.

[0007] According to one broad aspect of this disclosure, a method is provided for producing a recombinant protein, the method comprising culturing a recombinant yeast cellcomprising a polynucleotide encoding a polypeptide comprising at least one heterologous secretion signal selected from secretion signal of Kluyveromyces marxianus, S. cerevisiae, mutated variant thereof, and combinations thereof. In an embodiment, the at least one secretion signal comprises a secretion signal comprising M R X3 S X5 X6 X7 X8 X9 T L L A A X13 S A L A, where X3 is Y or F, X5 is T, S, V or L, X6 is L, I, V, or A, X7 is V, F, L, A, or G, X8, is S, T, or V, X9, is A, D, or E, and X15 is S or A, or has at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to an amino acid sequence selected from SEQ ID NOs: 8-14, 19-36, 55-61 , and 86-102. In an embodiment, the at least one secretion signal has 100% sequence identity to an amino acid sequence selected from SEQ ID NOs: 8-14, 19-36, 55- 61 , and 86-102. In an embodiment, the at least one secretion signal has 100% sequence identity to an amino acid sequence selected from SEQ ID NOs: 8-14 and 19-36. In an embodiment, the polynucleotide is operably linked to a promoter and / or comprises a terminator having a nucleic acid sequence of SEQ ID NO: 76. In an embodiment, the promoter is selected from GAL1 , LAC4, NC-1 , TDH3, TEF3, BGL2, and SPL1755. In an embodiment, the promoter comprises a nucleotide sequence selected from SEQ ID NOs: 69-75. In an embodiment, the recombinant protein is or comprises a food protein or a therapeutic protein. In an embodiment, the food protein is or comprises a sweet protein or the therapeutic protein is or comprises a nanobody. In an embodiment, the sweet protein is or comprises brazzein, thaumatin, monellin, mabinlin, curculin, pentadin, or miraculin. In an embodiment, the sweet protein is or comprises brazzein. In an embodiment, the brazzein has an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 17, 18, 105, or 106. In an embodiment, the brazzein has the amino acid sequence of 100% sequence identity to SEQ ID NO: 17, 18, 105, or 106. In an embodiment, the polynucleotide comprises a nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to nucleotide sequence of SEQ ID NO: 84. In an embodiment, the polynucleotide comprises a nucleotide sequence having 100% sequence identity to nucleotide sequence of SEQ ID NO: 84. In an embodiment, the polynucleotide is provided on a vector. In an embodiment, the vector is a plasmid. In an embodiment, the recombinant yeast cell is selected from Saccharomyces, Pichia, Kluyveromyces and Hansenula. In an embodiment, the recombinant yeast cell is selected from Saccharomyces cerevisiae, Pichia pastoris, Hansenula polymorpha, Kluyveromyces lactis, and Kluyveromyces marxianus. In an embodiment, the yeast cell is Kluyveromyces marxianus. In an embodiment, the method further comprising isolating the food protein.

[0008] Also provided is a food protein produced by the method described herein, wherein the food protein is or comprises brazzein for use as a sweetener. In an embodiment, the food protein is for use as an emulsifier, colorant, flavoring, mouthfeel improvement agent, texture improvement agent, sugar replacement, binding agent, or any combination thereof. In anembodiment, the food protein is or comprises brazzein. In an embodiment, the brazzein is for use as a food additive, for use as an ingredient in a food or beverage product, for use in a pharmaceutical or a nutraceutical product, for use with a vitamin, for use as a natural supplement, or for use as a functional food ingredient.

[0009] Also provided is a food product comprising the food protein produced by the method described herein, wherein the food protein is or comprises brazzein. In an embodiment, the food product is selected from the group consisting of a baked goods product, a beverage product, a candy or confectionery, a dairy product, a dietary supplement, an edible gel composition, a food product, a frozen dessert, a functional food, a health supplement, a nutraceutical, a packaged snack, a processed meat product, a seasoning or condiment, a soup or broth, and a tabletop flavoring. In an embodiment, the beverage product is selected from the group consisting of a carbonated beverage, coffee, an energy drink, a flavored water, a fountain beverage, a fruit juice, a fruit juice flavored drink, a frozen and ready-to-drink beverage, a frozen beverage, a functional beverage, a health-focused beverage, a herbal infusion, a liquid concentrate, a milk-based beverage, a non-alcoholic beer, a nutritional drink, a powdered soft drink, a ready-to-drink beverage, a soft drink, a sports drink, and tea.

[0010] Also provided is an isolated nucleic acid comprising at least one nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to at least one of SEQ ID NOs: 1-7, 37-54, 62-68, and 84. In an embodiment, the isolated nucleic acid comprises at least one nucleotide sequence having 100% sequence identity to at least one of SEQ ID NOs: 1-7, 37-54, 62-68, and 84.

[0011] Also provided is a polypeptide comprising at least one amino acid sequence comprising M R X3 S X5 X6 X7 X8 X9 T L L A A X13 S A L A, where X3 is Y or F, X5 is T, S, V or L, X6 is L, I, V, or A, X7 is V, F, L, A, or G, X8, is S, T, or , X9, is A, D, or E, and X15 is S or A, or that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to any one of SEQ ID NOs: 8-14, 19-36, 55-61 , and 86-102. In an embodiment, the polypeptide comprises M R X3 S X5 X6 X7 X8 X9 T L L A A X13 S A L A, where X3 is Y or F, X5 is T, S, V or L, X6 is L, I, V, or A, X7 is V, F, L, A, or G, X8, is S, T, or V, X9, is A, D, or E, and X15 is S or A. In an embodiment, the polypeptide comprises at least one amino acid sequence having 100% identity to any one of SEQ ID NOs: 8-14, 19-36, 55-61 , and 86-102. In an embodiment, the polypeptide comprises an amino acid sequence that least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 17, 18, 105, or 106. In an embodiment, the polypeptide comprises an amino acid sequence having 100% sequence identity to SEQ ID NO: 17, 18, 105, or 106.

[0012] Also provided is a recombinant yeast cell comprising a polynucleotide encoding a polypeptide described herein. In an embodiment, the recombinant yeast cell comprises a polynucleotide comprising at least one nucleotide sequence having at least 75%, 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any one of SEQ ID NOs: 1-7, 37-54, 62-68, and 84. In an embodiment, the recombinant yeast cell comprises a polynucleotide comprising at least one nucleotide sequence having at 100% sequence identity to at least one of SEQ ID NOs: 1-7, 37-54, 62-68, and 84.

[0013] Other features and advantages of the present disclosure will become apparent from the following detailed description. It should be understood, however, that the detailed description, while indicating preferred implementations of the present disclosure, is given by way of illustration only, since various changes and modification within the spirit and scope of the disclosure will become apparent to those of skill in the art from the detailed description.Brief Description of the Drawings

[0014] Embodiments of the disclosure will be described in relation to the drawings in which:

[0015] FIG. 1 shows a flow chart representation of plasmid generation in an exemplary embodiment of the disclosure.

[0016] FIG. 2A shows a schematic of the plasmid map of pBF01.1 from FIG 1. The plasmid is composed of 9,621 bp, and contains a GAL1 promoter, a selected secretion signal peptide fused to brazzein, and a CYC1 terminator. The plasmid allows growth for auxotrophic selection.

[0017] FIG. 2B shows a schematic of the plasmid map of pBF01.1.1 from FIG 1 , in an exemplary embodiment of the disclosure. The plasmid is composed of 13,241 bp, and contains 3 copies of the brazzein expression.

[0018] FIG. 3 shows a schematic map of pBF01.2 from FIG. 1 , in an exemplary embodiment of the disclosure. The plasmid is composed of 10,167bp, and contains a GAL1 promoter, a selected secretion signal peptide fused to thaumatin, and a CYC1 terminator. The plasmid allows growth for auxotrophic selection.

[0019] FIG. 4 shows a bar graph of recombinant brazzein expression levels in Kluyveromyces Marxianus, in an exemplary embodiment of the disclosure. Quantification of a Coomassie gel showing brazzein secretion using the modified signal peptides (SP1 - SEQ ID NO: 19; SP3 - SEQ ID NO: 21 ; SP4 - SEQ ID NO: 22; SP5 - SEQ ID NO: 23; SP6 - SEQ ID NO: 24; SP15 - SEQ ID NO: 33) relative to Saccharomyces cerevisiae o-mating factor alpha secretion signal (SEQ ID NO: 57).

[0020] FIG. 5 shows the results of Kluyveromyces Marxianus cells containing pKD1-SP5- GFP induced with lactose for 24 hours, in an exemplary embodiment of the disclosure. Cells were sedimented by centrifugation and the resulting supernatant was collected and exposed under UV light to visualize secreted GFP protein. Left tube shows untransformed Kluyveromyces Marxianus wild type. Right tube shows Kluyveromyces Marxianus transformed with pKD1-SP5-GFP demonstrating phenotypic changes associated with the Kluyveromyces strain containing pKD1- SP5-GFP.

[0021] FIG.6 shows the results of Kluyveromyces Marxianus cells containing pKD1-SP5-GFP induced with lactose for 24 hours, in an exemplary embodiment of the disclosure. The results from from FIG. 5 was measured and shown as relative fluorescence units of GFP using a microplate reader (excitation: 360 / 40nm, emission: 528 / 20nm) to measure the levels of GFP secretion.

[0022] Further aspects and features of the example embodiments described herein will appear from the following description taken together with the accompanying drawings.Detailed Description of the DisclosureL Definitions

[0023] Throughout the disclosure, a reference may be made using an abbreviation of a gene name or a polypeptide name, and it is understood that such an abbreviated gene or polypeptide name represents the genus of genes or polypeptides, respectively. Such gene names include all genes encoding the same polypeptide and analogous polypeptides having the same physiological function.

[0024] In understanding the scope of the present disclosure, the term "comprising" and its derivatives, as used herein, are intended to be open ended terms that specify the presence of the stated features, elements, components, groups, integers, and / or steps, but do not exclude the presence of other unstated features, elements, components, groups, integers and / or steps. The foregoing also applies to words having similar meanings such as the terms, "including", "having" and their derivatives. The term “consisting” and its derivatives, as used herein, are intended to be closed terms that specify the presence of the stated features, elements, components, groups, integers, and / or steps, but exclude the presence of other unstated features, elements, components, groups, integers and / or steps. The term “consisting essentially of’, or a derivative thereof as used herein, is intended to specify the presence of the stated features, elements, components, groups, integers, and / or steps as well as those that do not materially affect the basic and novel characteristic(s) of features, elements, components, groups, integers, and / or steps. Finally, terms of degree such as "substantially", "about" and "approximately", or a derivative thereof as used herein mean a reasonable amount of deviation of the modified term such that the end result is not significantly changed. These terms of degree should be construedas including a deviation of at least ±5% of the modified term if this deviation would not negate the meaning of the word it modifies.

[0025] As used in this specification and the appended claims, the singular forms "a", "an" and "the" include plural references unless the content clearly dictates otherwise. It should also be noted that the term "or" is generally employed in its sense including "and / or" unless the content clearly dictates otherwise.

[0026] The term "food product", or a derivative thereof as used herein refers to any substance or item that is intended for human consumption. This includes a wide variety of items, such as fruits, vegetables, meats, dairy products, grains, snacks, beverages, and more. Food products can be raw, cooked, or processed, and they can be consumed either directly or used as ingredients in cooking or baking. A food product can also refer to any substance that is used in the manufacture, preparation, or treatment of food. A food product can also include nutritional supplements, health supplement, and nutraceuticals.

[0027] The term "therapeutic protein" as used herein refers to a type of protein designed and developed for medical purposes, particularly for the treatment of various diseases or medical conditions. The therapeutic protein can be an antibody that can target specific antigens associated with particular diseases. The term "antibody" as used herein is intended to include monoclonal antibodies, polyclonal antibodies, chimeric antibodies, humanized antibodies, nanobodies, and antigen binding fragments thereof. The term “antigen binding fragment” or "antibody fragment" as used herein is intended to include without limitations Fv (a molecule comprising the VL and VH), single chain Fv (scFV; a molecule comprising the VL and VH connected by a peptide linker), Fab, Fab', F(ab')2, dsFv, ds-scFv, single domain antibodies (sdAB; molecules comprising a single variable domain having 3 or less CDRs, such as VHH, VH, VL, and IgNAR antigen binding variable domain (VNAR)), and multivalent presentations of these. Also included are dimers, minibodies, diabodies, and multimers thereof, bi-specific and multispecific antigen binding fragments, and domain antibodies. The term "nanobody" refers to a recombinant variable domain of a heavy chain-only antibody. Antibodies can be recombinantly generated and then fragmented using conventional techniques. For example, F(ab')2 fragments can be generated by treating the antibody with pepsin. The resulting F(ab')2 fragment can be treated to reduce disulfide bridges to produce Fab' fragments. Papain digestion can lead to the formation of Fab fragments. Nanobodies, Fab, Fab' and F(ab')2, scFv, dsFv, ds-scFv, sdAB, dimers, minibodies, diabodies, bispecific antigen binding fragments and other fragments can also be synthesized by recombinant techniques.

[0028] The term “recombinant”, or a derivative thereof as used herein refers to a cell or a polynucleotide molecule that has been modified by the introduction of a heterologous polynucleotide sequence, or that the cell is derived from a cell so modified. For example,recombinant cells express genes that are not found in identical form within the native (nonrecombinant) form of the cells, or the recombinant cells express, as a result of deliberate human intervention, native genes that are otherwise abnormally expressed, under-expressed or not expressed at all. The terms “recombination,” “recombining,” and generating a “recombined” polynucleotide molecule refer generally to the assembly of two or more polynucleotide fragments wherein the assembly gives rise to a chimeric polynucleotide made from the assembled parts. As such, a person skilled in the art will understand that "recombination" is related to "genetic engineering", which encompasses the development and application of scientific methods, procedures, and technologies that permit direct manipulation of genetic material (e.g., nucleic acids, such as DNA, RNA, etc.) in order to alter the hereditary traits of a cell, organism, or population. A person skilled in the art would also understand that the term “genetic engineering” references a technique that produces unlimited amounts of otherwise unavailable or scarce biological product by introducing nucleic acids (e.g., DNA, RNA or fragments thereof) isolated from animals or plants into a host cell and then harvesting the product from a culture of the host cell.

[0029] The term "transformation", or a derivative thereof as used herein refers to the transfer of a nucleic acid into a host organism or the genome of a host organism. Host organisms as well as their progenies containing the transformed nucleic acid fragments are referred to as "recombinant", "transgenic" or "transformed" organisms. For example isolated polynucleotides of the present disclosure can be incorporated into recombinant constructs, such as DNA constructs, for introduction into and replication in a host cell. Said construct can be a vector that includes a replication system and sequences that are for transcription and translation of a polypeptide- encoding sequence in a host cell. Expression vectors include, for example, one or more cloned genes under the transcriptional control of 5' and 3' regulatory sequences and optionally a selectable marker. Useful vectors also can contain a promoter regulatory region that, for example, regulates expression environmentally, developmentally, or locally, and can be constitutive or inducible. The vector can also possess a transcription initiation start site, a ribosome binding site, a transcription termination site, and / or a polyadenylation signal. A cell can also be transformed with a single genetic element, for example a promoter, which can result in genetically stable inheritance when it integrates into the host organism's genome through processes such as homologous recombination.

[0030] The term “operably linked”, or a derivative thereof as used herein in the context of a polynucleotide sequence, refers to an arrangement of two or more components, wherein the components so described are in a relationship permitting them to function in a coordinated manner, for instance, the placement of one polynucleotide sequence into a functional relationship with another polynucleotide sequence. For example, a transcriptional regulatory sequence or a promoter is operably linked to a coding sequence if the transcriptional regulatory sequence orpromoter facilitates aspects of the transcription of the coding sequence. A ribosome binding site is operably linked to a coding sequence if it is positioned so as to facilitate translation. Aspects of the transcription process include, but not limited to, initiation, elongation, attenuation and termination. In general, an operably linked transcriptional regulatory sequence joined in cis with the coding sequence, but it is not necessarily directly adjacent to it, and the polynucleotide sequences being linked are contiguous and in the same reading frame.

[0031] The term “promoter” as used herein refers to a polynucleotide sequence that functions to direct transcription of a downstream gene. In an embodiment, the promoter is appropriate to a host cell, such as a bacterial cell, in which the target gene is being expressed. The promoter, together with other transcriptional and translational regulatory polynucleotide sequences (also termed “control sequences”) is necessary to express a given gene. In general, the transcriptional and translational regulatory sequences include, but are not limited to, promoter sequences, ribosomal binding sites, transcriptional start and stop sequences, translational start and stop sequences, and enhancer or activator sequences.

[0032] The term "mutation" or a derivative thereof as used herein refers to a change in the sequence of the genetic material (DNA or RNA) of an organism, or a recombinant, artificial, or synthetic nucleic acid that possesses a change in reference to a wildtype. These mutations occur in the nucleic acid, and they can lead to changes in the physical and functional property of the encoded polypeptide as well as the traits of an organism. The mutation can be a substitution, insertion, deletion, duplication, or inversion. Substitution occurs when one base pair is replaced by another. Substitutions can be "silent" (not affecting the resulting protein), "missense" (changing one amino acid in a protein), or "nonsense" (creating a premature stop codon). “Substitution” can also refer to a change in an amino acid sequence by which an amino acid in a sequence is replaced with another amino acid at a particular position, resulting in a mutant of the polypeptide, as further described below. The amino acid used as a substitute can be a naturally- occurring amino acid, or can be a synthetic or non-naturally occurring amino acid. Insertion occurs when one or more base pairs are added to the DNA sequence, causing what's known as a "frameshift". This changes the way the sequence is read, which can dramatically affect the resulting protein. Deletion occurs when one or more base pairs are removed from the DNA sequence, also causing a frameshift. Duplication occurs when a segment of DNA is copied one or more times in a reference nucleic acid, such as in the genome. Inversion occurs when a segment of DNA is reversed within a reference nucleic acid, such as in the genome. Regarding mutations introduced by recombinant means, the changes can be introduced into nucleic acid coding sequences by, for example, using mutagenesis (e.g., site-directed mutagenesis, PCR- mediated mutagenesis) or by chemically synthesizing a nucleic acid molecule having such changes. Such nucleic acid changes can lead to conservative and / or non-conservative amino acid substitutions at one or more amino acid residues. A “conservative amino acid substitution”is one in which one amino acid residue is replaced with a different amino acid residue having a similar side chain (see, for example, Dayhoff et al. (1978, in Atlas of Protein Sequence and Structure, 5(Suppl. 3):345-352; herein incorporated by reference), which provides frequency tables for amino acid substitutions), and a non-conservative substitution is one in which an amino acid residue is replaced with an amino acid residue that does not have a similar side chain. Nucleic acid and / or polypeptide sequences can be modified as described herein to improve one or more properties including, without limitation, increased expression (e.g., transcription and / or translation), tighter regulation, deregulation, loss of catabolite repression, modified specificity, secretion, thermostability, solvent stability, oxidative stability, protease resistance, catalytic activity, and / or color.

[0033] The term “wildtype”, or a derivative thereof as used herein means, in the context of gene or protein, a polynucleotide or protein sequence that occurs in nature. In an embodiment, the wildtype sequence refers to a sequence of interest that is a starting point for recombinant protein engineering.

[0034] The term "native" or a derivative thereof as used herein refers to a composition of a cell or parent cell prior to a recombinant or transformation event. A "native gene" or an "endogenous gene" refers to a nucleotide sequence that encodes a polypeptide that has not been introduced into a cell by a recombinant or transformation event. A "native protein" or an "endogenous protein" refers to a polypeptide, i.e. an amino acid sequence, that is encoded by a native gene.

[0035] The term “polypeptide” as used herein encompasses both peptides and proteins, unless indicated otherwise. The 3-letter code as well as the 1 -letter code for amino acid residues as defined in conformity with the IUPAC-IUB Joint Commission on Biochemical Nomenclature (JCBN) is used throughout this disclosure. It is also understood that a polypeptide may be coded for by more than one polynucleotide sequence due to the degeneracy of the genetic code.

[0036] The term "nucleic acid" or "nucleic acid molecule" or its derivatives thereof as used herein, is intended to include unmodified DNA or RNA or modified DNA or RNA. For example, the nucleic acid molecules of the disclosure can be composed of single- and double-strandedDNA, DNA that is a mixture of single- and double-stranded regions, single- and double-stranded RNA, and RNA that is a mixture of single- and double-stranded regions, hybrid molecules comprising DNA and RNA that may be single-stranded or, more typically double-stranded or a mixture of single- and double-stranded regions. In addition, the nucleic acid molecules can be composed of triple-stranded regions comprising RNA or DNA or both RNA and DNA. The nucleic acid molecules of the disclosure may also contain one or more modified bases or DNA or RNA backbones modified for stability or for other reasons. "Modified" bases include, for example, tritiated bases and unusual bases such as inosine. A variety of modifications can be made to DNA and RNA; thus "nucleic acid molecule" embraces chemically, enzymatically, or metabolically modified forms. The term "polynucleotide" shall have a corresponding meaning. Nucleic acid and polypeptide can be described as having at least 50% sequence identity (e.g., at least 55%, 60%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 92%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity) to a given nucleic acid or polypeptide sequence. Sequence identity is determined by standard algorithms by which two sequences are aligned and the number of identical matches of nucleotide or amino acid residues between the two sequences is determined. The number of identical matches is divided by the length of the aligned region ( / .e., the number of aligned nucleotides or amino acid residues) and multiplied by 100 to arrive at a percent sequence identity value. It will be appreciated that the length of the aligned region can be a portion of one or both sequences up to the full-length size that the length of the shortest sequence. It also will be appreciated that a single sequence can align with more than one other sequence and hence, can have different percent sequence identity values over each aligned region. The alignment of two or more sequences to determine percent sequence identity can be performed using the computer program ClustalW and default parameters, which allows alignments of nucleic acid or polypeptide sequences to be carried out across their entire length (global alignment). See Chenna et al., 2003, Nucleic Acids Res., 31(13):3497-500, herein incorporated by reference. ClustalW calculates the best match between a query and one or more subject sequences, and aligns them so that identities, similarities and differences can be determined. Gaps of one or more residues can be inserted into a query sequence, a subject sequence, or both, to maximize sequence alignments. For fast pairwise alignment of nucleotide sequences, the default parameters can be used ( / .e., word size: 2; window size: 4; scoring method: percentage; number of top diagonals: 4; and gap penalty: 5); for an alignment of multiple nucleotide sequences, the following parameters can be used: gap opening penalty: 10.0; gap extension penalty: 5.0; and weight transitions: yes. For fast pairwise alignment of polypeptide sequences, the following parameters can be used: word size: 1 ; window size: 5; scoring method: percentage; number of top diagonals: 5; and gap penalty: 3. For multiple alignment of polypeptide sequences, the following parameters can be used: weight matrix: blosum; gap opening penalty: 10.0; gap extension penalty: 0.05; hydrophilic gaps: on; hydrophilic residues: Gly, Pro, Ser, Asn, Asp, Gin, Glu, Arg, and Lys; and residue-specific gap penalties: on. ClustalW can be run, forexample, at the Baylor College of Medicine Search Launcher website or at the European Bioinformatics Institute website on the World Wide Web.

[0037] The term “vector” or “construct” as used herein refers to a nucleic acid that can be propagated and / or transferred between organisms, cells, or cellular components. The vector can be a plasmid, a linear DNA fragment, a virus, a bacteriophage, a pro-virus, a phagemid, a transposon, and an artificial chromosome. For example, a vector can be a circular doublestranded (ds) DNA construct used as for cloning, and which forms an extrachromosomal selfreplicating genetic element, or integrates into the host chromosome, in a microorganism such as yeast. The plasmid can be part of an expression system. The vector is useful for creating a recombinant yeast cell, for example, that produces recombinant sweet proteins.

[0038] The terms “expression” or “express” refers to the production of mRNA from the polynucleotide sequence of a gene or portion of a gene. The production of any polypeptide which is encoded by the mRNA, gene, or portion of the gene is also included within the scope of the terms.

[0039] The term “encoding” refers to the property of polynucleotide sequences to behave as templates for the production of other macromolecules such as mRNA, polypeptides, and cDNA.

[0040] The term “host strain” or “host cell” refers to a suitable host for an expression vector or genomically-integrated expression cassette comprising polynucleotide of the present disclosure. The host cell can be any eukaryotic or prokaryotic cell, for example, a yeast cell such as Saccharomyces cerevisiae, Pichia pastoris, Hansenula polymorpha, Kluyveromyces lactis, or Kluyveromyces marxianus.

[0041] A “segment” of a nucleotide sequence is a sequence of contiguous nucleotides. A segment can be at least about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 75, 85, 100, 110, 120, 130, 145, 150, 160, 175, 200, 250, 300, 350, 400, 450, 500 or more contiguous nucleotides.

[0042] The term “variant” as used herein in the context of a heterologous secretion signal, refers to an altered version of the original secretion signal that is modified to enhance or change its function. This can involve changes in the nucleotide or amino acid sequence, resulting in differences in how the signal directs proteins for secretion in a host organism that is different from the one in which the signal naturally occurs (heterologous host). These variants, as described herein, are engineered to improve the efficiency of protein secretion, alter targeting within a cell, and / or adapt the signal for compatibility with the machinery of a different species, thus improving protein production.

[0043] The term “purified” or “to purify”, or a derivative thereof as used herein refers to the removal of contaminants from a sample. For example, a sweet protein can be purified by removal of contaminating proteins and other components by a method known in the art.

[0044] The term “substantially free”, or a derivative thereof as used herein refers the complete or near complete lack of an action, characteristic, property, state, structure, item, or result. For example, a medium or a composition that is “substantially free of’ glycerol would either completely lack glycerol, or so nearly completely lack glycerol that the effect would be the same as if it completely lacked glycerol. In other words, a composition that is “substantially free of’ an element may still actually contain such item as long as there is no measurable effect thereof. For example, a medium or a composition that is substantially free of an ingredient or element comprises less than about 1 % by wt or less than about 1 % vol / vol of the ingredient or element in the composition.

[0045] The term (w / v), or a derivative thereof as used herein refers to a measure of the concentration of a solution or mixture obtained by dividing the mass or weight of the solute by the volume of the solution or mixture.

[0046] The term (w / w), or a derivative thereof as used herein refers to a measure of the concentration of a solution or mixture obtained by dividing the mass or weight of the solute by the weight of the solution or mixture.

[0047] The recitation of numerical ranges by endpoints herein includes all numbers and fractions subsumed within that range (e.g. 1 to 5 includes for example 1 , 1.5, 2, 2.75, 3, 3.90, 4, and 5). It is also to be understood that all numbers and fractions thereof are presumed to be modified by the term "about".

[0048] The definitions and embodiments described in particular sections are intended to be applicable to other embodiments herein described for which they are suitable as would be understood by a person skilled in the art.II. Secretion Signals, Nucleic Acids, Recombinant Proteins, Recombinant Host Cells, Methods, and Uses

[0049] Provided herein is the production of synthetic secretion signals and their implementation in engineered cells, such as yeast cells, to enhance exogenous protein expression, including food proteins such as sweet proteins and therapeutic proteins such as nanobodies for therapeutic use. As described herein, pre-region sequences from Saccharomyces cerevisiae or Kluyveromyces marxianus, and pro-region sequences from Saccharomyces cerevisiae o-mating factor alpha, and mutated variants thereof, can be introduced as a heterologous secretion signal to a recombinant protein, thereby facilitating enhanced extracellularprotein production compared to known secretion signals. The secretion signals described herein include, for example, an amino acid sequence comprising at least one of SEQ ID NOs: 8-14, 19- 36, 55-61 , and 86-102, as well as peptides comprising 1 , 2, 3, 4, 5, or more amino acid substitutions relative to any one of SEQ ID NOs: 8-14, 19-36, 55-61 , and 86-102. Fusion of the secretion signal described herein with a food protein such as a sweet protein, including as brazzein and thaumatin, can efficiently enhance secretion of said protein.

[0050] The secretion signals described herein are useful for secreting a recombinant protein, for example, a food protein such as a sweet protein. A sweet protein is or comprises a type of protein that can interact with the taste receptors on the tongue to produce a sweet sensation. These proteins are often much sweeter than common table sugar, but do not have the same caloric content or metabolic effects. They are used in a variety of applications, including as sweeteners in foods and beverages, particularly for individuals who wish to avoid the calories or metabolic effects of sugar. Brazzein is a sweet protein that originates from the fruit of the Western African plant Pentadiplandra brazzeana (Oubli berry). This protein is noted for its sweetness, which is approximately 2,000 times that of table sugar. Cultivating the fruit outside of Western African is not viable due to unique environmental growth conditions. Recombinant generation of brazzein can resolve production limitation posed by growing Pentadiplandra brazzeana in its original habitat. Another sweet protein is or comprises thaumatin, which is obtained from the Thaumatococcus daniellii plant, also native to West Africa. Thaumatin is recognized for its remarkably sweet taste, which can be up to 2,000 times sweeter than sugar. Monellin is another example of a sweet protein. It is derived from the fruit of the West African plant known as Dioscoreophyllum cumminsii, and is often used in the food industry due to its intense sweetness that is nearly 3,000 times that of sucrose on a per weight basis. Mabinlin, extracted from the plant Capparis masaikai, found in China, is another sweet protein. It has a sweetness that is about 500 times that of sugar, and it retains its sweetness even when heated, which sets it apart from some other sweet proteins. These are some sweet proteins that can be efficiently expressed by the recombinant host cell described herein using the secretion signals herein disclosed. Other sweet proteins that can be efficiently expressed by the recombinant host cell described herein include curculin and pentadin. Sweet protein can also include taste modifier such as miraculin. In an embodiment, the sweet protein is or comprises brazzein (UniProt database entry P56552), thaumatin (UniProt database entry P02883 and P02884), monellin (UniProt database entry P02881), mabinlin (UniProt database entry P80351 , P30233, P80352, and P80353), curculin (UniProt database entry P19667 and Q6F495), pentadin (UniProt database entry P56552), or miraculin (UniProt database entry P13087). In an embodiment, the sweet protein is or comprises brazzein, thaumatin, monellin, mabinlin, curculin, pentadin, or miraculin. In an embodiment, the sweet protein is or comprises brazzein. In an embodiment, the sweet protein is or comprises thaumatin. In an embodiment, the brazzein is full-length or truncated wildtype brazzein. In anembodiment, the brazzein is a functional variant of wildtype brazzein. In an embodiment, the wildtype brazzein is a Major form brazzein protein or a Minor form brazzein protein. In an embodiment, the brazzein is a mutated brazzein. In an embodiment, the mutated brazzein comprises at least one point mutation. In an embodiment, the mutated brazzein has a more intense perceived sweetness characteristic. In an embodiment, the mutated brazzein comprises at least one mutation selected from H31 R, E36D, and E41 A in the brazzein amino acid sequence comprising SEQ ID NO: 17. In an embodiment, the mutated brazzein comprises at least one mutation selected from H32R, E37D, and E42A in the brazzein amino acid sequence comprising SEQ ID NO: 105. In an embodiment, the mutated brazzein comprises at least one mutation selected from H30R, E35D, and E40A in the brazzein amino acid sequence comprising SEQ ID NO: 18. In an embodiment, the mutated brazzein comprises at least one mutation selected from H31 R, E36D, and E41A in the brazzein amino acid sequence comprising SEQ ID NO: 106. In an embodiment, the mutated brazzein comprises at least one pair of mutations selected from H31 R / E36D, H31 R / E41 A and E36D / E41 A in the brazzein amino acid sequence comprising SEQ ID NO: 17. In an embodiment, the mutated brazzein comprises at least one pair of mutations selected from H32R / E37D, H32R / E42A and E37D / E42A in the brazzein amino acid sequence comprising SEQ ID NO: 105. In an embodiment, the mutated brazzein comprises mutations H31 R and E36D in the brazzein amino acid sequence comprising SEQ ID NO: 17. In an embodiment, the mutated brazzein comprises mutations H32R and E37D in the brazzein amino acid sequence comprising SEQ ID NO: 105. In an embodiment, the mutated brazzein comprises mutations H31 R and E41A in the brazzein amino acid sequence comprising SEQ ID NO: 17. In an embodiment, the mutated brazzein comprises mutations H32R and E42A in the brazzein amino acid sequence comprising SEQ ID NO: 105. In an embodiment, the mutated brazzein comprises mutations E36D and E41A in the brazzein amino acid sequence comprising SEQ ID NO: 17. In an embodiment, the mutated brazzein comprises mutations E37D and E42A in the brazzein amino acid sequence comprising SEQ ID NO: 105. In an embodiment, the mutated brazzein comprises mutations H31 R, E36D, and E41A in the brazzein amino acid sequence comprising SEQ ID NO: 17. In an embodiment, the mutated brazzein comprises mutations H32R, E37D, and E42A in the brazzein amino acid sequence comprising SEQ ID NO: 105. In an embodiment, the mutated brazzein comprises at least one pair of mutations selected from H30R / E35D, H30R / E40A and E35D / E40A in the brazzein amino acid sequence comprising SEQ ID NO: 18. In an embodiment, the mutated brazzein comprises at least one pair of mutations selected from H31 R / E36D, H31 R / E41A and E36D / E41A in the brazzein amino acid sequence comprising SEQ ID NO: 106. In an embodiment, the mutated brazzein comprises mutations H30R and E35D in the brazzein amino acid sequence comprising SEQ ID NO: 18. In an embodiment, the mutated brazzein comprises mutations H31 R and E36D in the brazzein amino acid sequence comprising SEQ ID NO: 106. In an embodiment, the mutated brazzein comprises mutations H30R and E40A in the brazzein amino acid sequence comprising SEQ ID NO: 18. Inan embodiment, the mutated brazzein comprises mutations H31 R and E41A in the brazzein amino acid sequence comprising SEQ ID NO: 106. In an embodiment, the mutated brazzein comprises mutations E35D and E40A in the brazzein amino acid sequence comprising SEQ ID NO: 18. In an embodiment, the mutated brazzein comprises mutations E36D and E41A in the brazzein amino acid sequence comprising SEQ ID NO: 106. In an embodiment, the mutated brazzein comprises mutations H30R, E35D, and E40A in the brazzein amino acid sequence comprising SEQ ID NO: 18. In an embodiment, the mutated brazzein comprises mutations H31 R, E36D, and E41A in the brazzein amino acid sequence comprising SEQ ID NO: 106.

[0051] In an embodiment, the secretion signal is a secretion signal of Kluyveromyces marxianus or S. cerevisiae. In an embodiment, the secretion signal is a heterologous secretion signal. In an embodiment, the secretion signal is a secretion signal of Kluyveromyces marxianus beta-glucanase, S. cerevisiae beta-glucanase, S. cerevisiae alpha-mating factor or combinations thereof. In an embodiment, the secretion signal is a native sequence. In another embodiment, the secretion signal is a mutated sequence. In an embodiment, the mutated sequence is a point mutation. In an embodiment, the secretion signal is a secretion signal of Kluyveromyces marxianus beta-glucanase combined the with a secretion signal of S. cerevisiae pro-alpha mating factor. In an embodiment, the secretion signal is a secretion signal of S. cerevisiae pre-alpha mating factor combined the with a secretion signal of S. cerevisiae pro-alpha mating factor. In an embodiment, the secretion signal is a secretion signal of S. cerevisiae pro-alpha mating factor.

[0052] As described in various embodiments in reference to a characteristic sequence described herein, each instance of "X" is independently any canonical or non-canonical amino acid. In some embodiments, each X is independently selected from a canonical or non-canonical amino acid known to the skilled person. As also described herein, "Xn" (e.g., X3, X4, X5, etc.), refers to an amino acid "X" at site "n" within a characteristic sequence. For example, X3 refers to an amino acid that is the third residue in the characteristic sequence, X4 refers to an amino acid that is the fourth residue in the characteristic sequence, etc. In an embodiment, the secretion signal comprises M R X3 S X5 X6 X7 X8 X9 T L L A X13 S A L A (SEQ ID NO: 85), where X3 is Y or F, X5 is T, S, V or L, X6 is L, I, V, or A, X7 is V, F, L, A, or G, X8, is S, T, or V, X9, is A, D, or E, and X15 is S or A. In an embodiment, the secretion signal is encoded by the nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to a nucleotide sequence selected from SEQ ID NOs: 1-7, 37-54, and 62-68. In an embodiment, the secretion signal is encoded by the nucleotide sequence having 100% sequence identity to a nucleotide sequence selected from SEQ ID NOs: 1-7, 37-54, and 62-68. In an embodiment, the secretion signal is encoded by the nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 1. In an embodiment, the secretion signal is encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 1. In an embodiment, the secretionsignal is encoded by the nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 2. In an embodiment, the secretion signal is encoded by the nucleotide sequence having 100% sequence identity to to SEQ ID NO: 2. In an embodiment, the secretion signal is encoded by the nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 3. In an embodiment, the secretion signal is encoded by the nucleotide sequence having 100% sequence identity to to SEQ ID NO: 3. In an embodiment, the secretion signal is encoded by the nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 4. In an embodiment, the secretion signal is encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 4. In an embodiment, the secretion signal is encoded by the nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity as shown in SEQ ID NO: 5. In an embodiment, the secretion signal is encoded by the nucleotide sequence having 100% sequence identity SEQ ID NO: 5. In an embodiment, the secretion signal is encoded by the nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity as shown in SEQ ID NO: 6. In an embodiment, the secretion signal is encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 6. In an embodiment, the secretion signal is encoded by the nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 7. In an embodiment, the secretion signal is encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 7. In an embodiment, the secretion signal is encoded by the nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 37. In an embodiment, the secretion signal is encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 37. In an embodiment, the secretion signal is encoded by the nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 38. In an embodiment, the secretion signal is encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 38. In an embodiment, the secretion signal is encoded by the nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 39. In an embodiment, the secretion signal is encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 39. In an embodiment, the secretion signal is encoded by the nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 40. In an embodiment, the secretion signal is encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 40. In an embodiment, the secretion signal is encoded by the nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 41 . In an embodiment, the secretion signal is encodedby the nucleotide sequence having 100% sequence identity to SEQ ID NO: 41 . In an embodiment, the secretion signal is encoded by the nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 42. In an embodiment, the secretion signal is encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 42. In an embodiment, the secretion signal is encoded by the nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 43. In an embodiment, the secretion signal is encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 43. In an embodiment, the secretion signal is encoded by the nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 44. In an embodiment, the secretion signal is encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 44. In an embodiment, the secretion signal is encoded by the nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 45. In an embodiment, the secretion signal is encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 45. In an embodiment, the secretion signal is encoded by the nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 46. In an embodiment, the secretion signal is encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 46. In an embodiment, the secretion signal is encoded by the nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 47. In an embodiment, the secretion signal is encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 47. In an embodiment, the secretion signal is encoded by the nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 48. In an embodiment, the secretion signal is encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 48. In an embodiment, the secretion signal is encoded by the nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 49. In an embodiment, the secretion signal is encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 49. In an embodiment, the secretion signal is encoded by the nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 50. In an embodiment, the secretion signal is encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 50. In an embodiment, the secretion signal is encoded by the nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 51 . In an embodiment, the secretion signal is encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 51. In an embodiment, the secretion signal is encoded by the nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 52. In anembodiment, the secretion signal is encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 52. In an embodiment, the secretion signal is encoded by the nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 53. In an embodiment, the secretion signal is encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 53. In an embodiment, the secretion signal is encoded by the nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 54. In an embodiment, the secretion signal is encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 54. In an embodiment, the secretion signal is encoded by the nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 62. In an embodiment, the secretion signal is encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 62. In an embodiment, the secretion signal is encoded by the nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 63. In an embodiment, the secretion signal is encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 63. In an embodiment, the secretion signal is encoded by the nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 64. In an embodiment, the secretion signal is encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 64. In an embodiment, the secretion signal is encoded by the nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 65. In an embodiment, the secretion signal is encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 65. In an embodiment, the secretion signal is encoded by the nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 66. In an embodiment, the secretion signal is encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 66. In an embodiment, the secretion signal is encoded by the nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 67. In an embodiment, the secretion signal is encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 67. In an embodiment, the secretion signal is encoded by the nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 68. In an embodiment, the secretion signal is encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 68. In an embodiment, the secretion signal comprises the amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to an amino acid sequence selected from SEQ ID NOs: 8-14, 19-36, 55-61 , and 86-102. In an embodiment, the secretion signal comprises the amino acid sequence having 100% sequence identity to an amino acid selected from SEQ ID NOs: 8-14, 19-36, 55-61 , and 86-102. In an embodiment, the secretionsignal comprises the amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 8. In an embodiment, the secretion signal comprises the amino acid sequence having 100% sequence identity to SEQ ID NO: 8. In an embodiment, the secretion signal comprises the amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 9. In an embodiment, the secretion signal comprises the amino acid sequence having 100% sequence identity to SEQ ID NO: 9. In an embodiment, the secretion signal comprises the amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 10. In an embodiment, the secretion signal comprises the amino acid sequence having 100% sequence identity to SEQ ID NO: 10. In an embodiment, the secretion signal comprises the amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 11. In an embodiment, the secretion signal comprises the amino acid sequence having 100% sequence identity to SEQ ID NO: 11. In an embodiment, the secretion signal comprises the amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 12. In an embodiment, the secretion signal comprises the amino acid sequence having 100% sequence identity to SEQ ID NO: 12. In an embodiment, the secretion signal comprises the amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 13. In an embodiment, the secretion signal comprises the amino acid sequence having 100% sequence identity to SEQ ID NO: 13. In an embodiment, the secretion signal comprises the amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 14. In an embodiment, the secretion signal comprises the amino acid sequence having 100% sequence identity to SEQ ID NO: 14. In an embodiment, the secretion signal comprises the amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 19. In an embodiment, the secretion signal comprises the amino acid sequence having 100% sequence identity to SEQ ID NO: 19. In an embodiment, the secretion signal comprises the amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 20. In an embodiment, the secretion signal comprises the amino acid sequence having 100% sequence identity to SEQ ID NO: 20. In an embodiment, the secretion signal comprises the amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 21. In an embodiment, the secretion signal comprises the amino acid sequence having 100% sequence identity to SEQ ID NO: 21. In an embodiment, the secretion signal comprises the amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 22. In an embodiment, the secretion signal comprises the amino acid sequence having 100% sequence identity to SEQ ID NO: 22. In an embodiment, thesecretion signal comprises the amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 23. In an embodiment, the secretion signal comprises the amino acid sequence having 100% sequence identity to SEQ ID NO: 23. In an embodiment, the secretion signal comprises the amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 24. In an embodiment, the secretion signal comprises the amino acid sequence having 100% sequence identity to SEQ ID NO: 24. In an embodiment, the secretion signal comprises the amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 25. In an embodiment, the secretion signal comprises the amino acid sequence having 100% sequence identity to SEQ ID NO: 25. In an embodiment, the secretion signal comprises the amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 26. In an embodiment, the secretion signal comprises the amino acid sequence having 100% sequence identity to SEQ ID NO: 26. In an embodiment, the secretion signal comprises the amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 27. In an embodiment, the secretion signal comprises the amino acid sequence having 100% sequence identity to SEQ ID NO: 27. In an embodiment, the secretion signal comprises the amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 28. In an embodiment, the secretion signal comprises the amino acid sequence having 100% sequence identity to SEQ ID NO: 28. In an embodiment, the secretion signal comprises the amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 29. In an embodiment, the secretion signal comprises the amino acid sequence having 100% sequence identity to SEQ ID NO: 29. In an embodiment, the secretion signal comprises the amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 30. In an embodiment, the secretion signal comprises the amino acid sequence having 100% sequence identity to SEQ ID NO: 30. In an embodiment, the secretion signal comprises the amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 31. In an embodiment, the secretion signal comprises the amino acid sequence having 100% sequence identity to SEQ ID NO: 31. In an embodiment, the secretion signal comprises the amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 32. In an embodiment, the secretion signal comprises the amino acid sequence having 100% sequence identity to SEQ ID NO: 32. In an embodiment, the secretion signal comprises the amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 33. In an embodiment, the secretion signal comprises the amino acid sequence having 100% sequenceidentity to SEQ ID NO: 33. In an embodiment, the secretion signal comprises the amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 34. In an embodiment, the secretion signal comprises the amino acid sequence having 100% sequence identity to SEQ ID NO: 34. In an embodiment, the secretion signal comprises the amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 35. In an embodiment, the secretion signal comprises the amino acid sequence having 100% sequence identity to SEQ ID NO: 35. In an embodiment, the secretion signal comprises the amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 36. In an embodiment, the secretion signal comprises the amino acid sequence having 100% sequence identity to SEQ ID NO: 36. In an embodiment, the secretion signal comprises the amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 55. In an embodiment, the secretion signal comprises the amino acid sequence having 100% sequence identity to SEQ ID NO: 55. In an embodiment, the secretion signal comprises the amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 56. In an embodiment, the secretion signal comprises the amino acid sequence having 100% sequence identity to SEQ ID NO: 56. In an embodiment, the secretion signal comprises the amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 57. In an embodiment, the secretion signal comprises the amino acid sequence having 100% sequence identity to SEQ ID NO: 57. In an embodiment, the secretion signal comprises the amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 58. In an embodiment, the secretion signal comprises the amino acid sequence having 100% sequence identity to SEQ ID NO: 58. In an embodiment, the secretion signal comprises the amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 59. In an embodiment, the secretion signal comprises the amino acid sequence having 100% sequence identity to SEQ ID NO: 59. In an embodiment, the secretion signal comprises the amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 60. In an embodiment, the secretion signal comprises the amino acid sequence having 100% sequence identity to SEQ ID NO: 60. In an embodiment, the secretion signal comprises the amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 61. In an embodiment, the secretion signal comprises the amino acid sequence having 100% sequence identity to SEQ ID NO: 61. In an embodiment, the secretion signal comprises the amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 86. In an embodiment, the secretion signal comprises the aminoacid sequence having 100% sequence identity to SEQ ID NO: 86. In an embodiment, the secretion signal comprises the amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 87. In an embodiment, the secretion signal comprises the amino acid sequence having 100% sequence identity to SEQ ID NO: 87. In an embodiment, the secretion signal comprises the amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 88. In an embodiment, the secretion signal comprises the amino acid sequence having 100% sequence identity to SEQ ID NO: 88. In an embodiment, the secretion signal comprises the amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 89. In an embodiment, the secretion signal comprises the amino acid sequence having 100% sequence identity to SEQ ID NO: 89. In an embodiment, the secretion signal comprises the amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 90. In an embodiment, the secretion signal comprises the amino acid sequence having 100% sequence identity to SEQ ID NO: 90. In an embodiment, the secretion signal comprises the amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 91. In an embodiment, the secretion signal comprises the amino acid sequence having 100% sequence identity to SEQ ID NO: 91. In an embodiment, the secretion signal comprises the amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 92. In an embodiment, the secretion signal comprises the amino acid sequence having 100% sequence identity to SEQ ID NO: 92. In an embodiment, the secretion signal comprises the amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 93. In an embodiment, the secretion signal comprises the amino acid sequence having 100% sequence identity to SEQ ID NO: 93. In an embodiment, the secretion signal comprises the amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 94. In an embodiment, the secretion signal comprises the amino acid sequence having 100% sequence identity to SEQ ID NO: 94. In an embodiment, the secretion signal comprises the amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 95. In an embodiment, the secretion signal comprises the amino acid sequence having 100% sequence identity to SEQ ID NO: 95. In an embodiment, the secretion signal comprises the amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 96. In an embodiment, the secretion signal comprises the amino acid sequence having 100% sequence identity to SEQ ID NO: 96. In an embodiment, the secretion signal comprises the amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 97. In anembodiment, the secretion signal comprises the amino acid sequence having 100% sequence identity to SEQ ID NO: 97. In an embodiment, the secretion signal comprises the amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 98. In an embodiment, the secretion signal comprises the amino acid sequence having 100% sequence identity to SEQ ID NO: 98. In an embodiment, the secretion signal comprises the amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 99. In an embodiment, the secretion signal comprises the amino acid sequence having 100% sequence identity to SEQ ID NO: 99. In an embodiment, the secretion signal comprises the amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 100. In an embodiment, the secretion signal comprises the amino acid sequence having 100% sequence identity to SEQ ID NO: 100. In an embodiment, the secretion signal comprises the amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 101. In an embodiment, the secretion signal comprises the amino acid sequence having 100% sequence identity to SEQ ID NO: 101. In an embodiment, the secretion signal comprises the amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 102. In an embodiment, the secretion signal comprises the amino acid sequence having 100% sequence identity to SEQ ID NO: 102.

[0053] In an aspect of the disclosure is a recombinant polypeptide comprising a secretion signal encoded by a nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to a sequence selected from SEQ ID NOs: 1-7, 37-54, and 62-68. In an embodiment, the recombinant polypeptide comprises a secretion signal encoded by the nucleotide sequence having 100% sequence identity to a nucleotide sequence selected from SEQ ID NOs: 1-7, 37-54, and 62-68. In an embodiment, the recombinant polypeptide comprises a secretion signal encoded by a nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 1. In an embodiment, the recombinant polypeptide comprises a secretion signal encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 1 . In an embodiment, the recombinant polypeptide comprises a secretion signal encoded by a nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 2. In an embodiment, the recombinant polypeptide comprises a secretion signal encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 2. In an embodiment, the recombinant polypeptide comprises a secretion signal encoded by a nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 3. In an embodiment, the recombinant polypeptide comprises a secretion signal encoded by the nucleotide sequence having 100%sequence identity to SEQ ID NO: 3. In an embodiment, the recombinant polypeptide comprises a secretion signal encoded by a nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 4. In an embodiment, the recombinant polypeptide comprises a secretion signal encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 4. In an embodiment, the recombinant polypeptide comprises a secretion signal encoded by a nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 5. In an embodiment, the recombinant polypeptide comprises a secretion signal encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 5. In an embodiment, the recombinant polypeptide comprises a secretion signal encoded by a nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 6. In an embodiment, the recombinant polypeptide comprises a secretion signal encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 6. In an embodiment, the recombinant polypeptide comprises a secretion signal encoded by a nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 7. In an embodiment, the recombinant polypeptide comprises a secretion signal encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 7.

[0054] In an embodiment, the recombinant polypeptide comprises a secretion signal having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to a sequence selected from SEQ ID NOs: 8-14, 19-36, 55-61 , and 86-102. In an embodiment, the recombinant polypeptide comprises a secretion signal having 100% sequence identity to a sequence selected from SEQ ID NOs: 8-14, 19-36, 55-61 , and 86-102. In an embodiment, the recombinant polypeptide comprises a secretion signal having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 8. In an embodiment, the recombinant polypeptide comprises a secretion signal having 100% sequence identity to SEQ ID NO: 8. In an embodiment, the recombinant polypeptide comprises a secretion signal having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 9. In an embodiment, the recombinant polypeptide comprises a secretion signal having 100% sequence identity to SEQ ID NO: 9. In an embodiment, the recombinant polypeptide comprises a secretion signal having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 10. In an embodiment, the recombinant polypeptide comprises a secretion signal having 100% sequence identity to SEQ ID NO: 10. In an embodiment, the recombinant polypeptide comprises a secretion signal having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 11. In an embodiment, the recombinant polypeptide comprises a secretion signal having 100% sequence identity to SEQ ID NO: 11. Inan embodiment, the recombinant polypeptide comprises a secretion signal having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 12. In an embodiment, the recombinant polypeptide comprises a secretion signal having 100% sequence identity to SEQ ID NO: 12. In an embodiment, the recombinant polypeptide comprises a secretion signal having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 13. In an embodiment, the recombinant polypeptide comprises a secretion signal having 100% sequence identity to SEQ ID NO: 13. In an embodiment, the recombinant polypeptide comprises a secretion signal having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 14. In an embodiment, the recombinant polypeptide comprises a secretion signal having 100% sequence identity to SEQ ID NO: 14.

[0055] In an embodiment, the recombinant polypeptide is a food protein. In one embodiment, the recombinant polypeptide is brazzein. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 15 or 16, and the secretion signal encoded by a nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to a nucleotide sequence selected from SEQ ID NOs: 1-7, 37-54, and 62-68. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 15, and the secretion signal encoded by a nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to a nucleotide sequence selected from SEQ ID NOs: 1-7, 37-54, and 62-68. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 15, and the secretion signal encoded by the nucleotide sequence having 100% sequence identity to a nucleotide sequence selected from SEQ ID NOs: 1-7, 37-54, and 62-68. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 15, and the secretion signal encoded by a nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 1. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 15, and the secretion signal encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 1. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 15, and the secretion signal encoded by a nucleotide sequence having at least 75%, 80%,85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 2. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 15, and the secretion signal encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 2. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 15, and the secretion signal encoded by a nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 3. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 15, and the secretion signal encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 3. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 15, and the secretion signal encoded by a nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 4. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 15, and the secretion signal encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 4. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 15, and the secretion signal encoded by a nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 5. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 15, and the secretion signal encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 5. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 15, and the secretion signal encoded by a nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 6. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 15, and the secretion signal encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 6. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 15, and the secretion signal encoded by a nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 7. In an embodiment, therecombinant polypeptide comprises brazzein encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 15, and the secretion signal encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 7. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 15, and the secretion signal encoded by a nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 37. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 15, and the secretion signal encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 37. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 15, and the secretion signal encoded by a nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 38. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 15, and the secretion signal encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 38. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 15, and the secretion signal encoded by a nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 39. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 15, and the secretion signal encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 39. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 15, and the secretion signal encoded by a nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 40. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 15, and the secretion signal encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 40. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 15, and the secretion signal encoded by a nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 41. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having 100% sequence identity to SEQID NO: 15, and the secretion signal encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 41. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 15, and the secretion signal encoded by a nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 42. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 15, and the secretion signal encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 42. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 15, and the secretion signal encoded by a nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 43. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 15, and the secretion signal encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 43. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 15, and the secretion signal encoded by a nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 44. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 15, and the secretion signal encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 44. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 15, and the secretion signal encoded by a nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 45. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 15, and the secretion signal encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 45. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 15, and the secretion signal encoded by a nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 46. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 15, and the secretion signal encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 46. In anembodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 15, and the secretion signal encoded by a nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 47. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 15, and the secretion signal encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 47. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 15, and the secretion signal encoded by a nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 48. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 15, and the secretion signal encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 48. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 15, and the secretion signal encoded by a nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 49. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 15, and the secretion signal encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 49. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 15, and the secretion signal encoded by a nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 50. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 15, and the secretion signal encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 50. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 15, and the secretion signal encoded by a nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 51. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 15, and the secretion signal encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 51. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having at least 75%, 80%,85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 15, and the secretion signal encoded by a nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 52. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 15, and the secretion signal encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 52. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 15, and the secretion signal encoded by a nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 53. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 15, and the secretion signal encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 53. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 15, and the secretion signal encoded by a nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 54. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 15, and the secretion signal encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 54. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 15, and the secretion signal encoded by a nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 62. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 15, and the secretion signal encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 62. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 15, and the secretion signal encoded by a nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 63. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 15, and the secretion signal encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 63. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 15, and the secretionsignal encoded by a nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 64. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 15, and the secretion signal encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 64. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 15, and the secretion signal encoded by a nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 65. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 15, and the secretion signal encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 65. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 15, and the secretion signal encoded by a nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 66. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 15, and the secretion signal encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 66. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 15, and the secretion signal encoded by a nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 67. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 15, and the secretion signal encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 67. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 15, and the secretion signal encoded by a nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 68. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 15, and the secretion signal encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 68.

[0056] In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 16, and the secretion signal encoded by anucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to a nucleotide sequence selected from SEQ ID NOs: 1-7, 37-54, and 62-68. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 16, and the secretion signal encoded by the nucleotide sequence having 100% sequence identity to a nucleotide sequence selected from SEQ ID NOs: 1-7, 37-54, and 62-68. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 16, and the secretion signal encoded by a nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 1. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 16, and the secretion signal encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 1. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 16, and the secretion signal encoded by a nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 2. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 16, and the secretion signal encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 2. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 16, and the secretion signal encoded by a nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 3. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 16, and the secretion signal encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 3. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 16, and the secretion signal encoded by a nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 4. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 16, and the secretion signal encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 4. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 16, and the secretion signal encoded by a nucleotidesequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 5. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 16, and the secretion signal encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 5. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 16, and the secretion signal encoded by a nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 6. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 16, and the secretion signal encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 6. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 16, and the secretion signal encoded by a nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 7. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 16, and the secretion signal encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 7. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 16, and the secretion signal encoded by a nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 37. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 16, and the secretion signal encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 37. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 16, and the secretion signal encoded by a nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 38. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 16, and the secretion signal encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 38. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 16, and the secretion signal encoded by a nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ IDNO: 39. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 16, and the secretion signal encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 39. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 16, and the secretion signal encoded by a nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 40. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 16, and the secretion signal encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 40. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 16, and the secretion signal encoded by a nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 41. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 16, and the secretion signal encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 41. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 16, and the secretion signal encoded by a nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 42. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 16, and the secretion signal encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 42. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 16, and the secretion signal encoded by a nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 43. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 16, and the secretion signal encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 43. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 16, and the secretion signal encoded by a nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 44. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having 100%sequence identity to SEQ ID NO: 16, and the secretion signal encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 44. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 16, and the secretion signal encoded by a nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 45. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 16, and the secretion signal encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 45. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 16, and the secretion signal encoded by a nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 46. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 16, and the secretion signal encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 46. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 16, and the secretion signal encoded by a nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 47. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 16, and the secretion signal encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 47. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 16, and the secretion signal encoded by a nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 48. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 16, and the secretion signal encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 48. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 16, and the secretion signal encoded by a nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 49. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 16, and the secretion signal encoded by the nucleotide sequence having 100% sequenceidentity to SEQ ID NO: 49. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 16, and the secretion signal encoded by a nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 50. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 16, and the secretion signal encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 50. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 16, and the secretion signal encoded by a nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 51. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 16, and the secretion signal encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 51. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 16, and the secretion signal encoded by a nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 52. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 16, and the secretion signal encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 52. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 16, and the secretion signal encoded by a nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 53. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 16, and the secretion signal encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 53. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 16, and the secretion signal encoded by a nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 54. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 16, and the secretion signal encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 54. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotidesequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 16, and the secretion signal encoded by a nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 62. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 16, and the secretion signal encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 62. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 16, and the secretion signal encoded by a nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 63. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 16, and the secretion signal encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 63. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 16, and the secretion signal encoded by a nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 64. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 16, and the secretion signal encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 64. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 16, and the secretion signal encoded by a nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 65. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 16, and the secretion signal encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 65. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 16, and the secretion signal encoded by a nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 66. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 16, and the secretion signal encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 66. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ IDNO: 16, and the secretion signal encoded by a nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 67. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 16, and the secretion signal encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 67. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 16, and the secretion signal encoded by a nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 68. In an embodiment, the recombinant polypeptide comprises brazzein encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 16, and the secretion signal encoded by the nucleotide sequence having 100% sequence identity to SEQ ID NO: 68.

[0057] In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 17, 18, 105, or 106, and a secretion signal comprises M R X3 S X5 X6 X7 X8 X9 T L L A X13 S A L A (SEQ ID NO: 85), where X3 is Y or F, X5 is T, S, or L, X6 is L, I, V, or A, X7 is V, F, L, A, or G, X8, is S, T, or V, X9, is A, D, or E, and X15 is S or A. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of 100% sequence identity to SEQ ID NO: 17, 18, 105, or 106, and a secretion signal comprises M R X3 S X5 X6 X7 X8 X9 T L L A X13 S A L A (SEQ ID NO: 85), where X3 is Y or F, X5 is T, S, V or L, X6 is L, I, V, or A, X7 is V, F, L, A, or G, X8, is S, T, or V, X9, is A, D, or E, and X15 is S or A. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 17 and a secretion signal comprises M R X3 S X5 X6 X7 X8 X9 T L L A X13 S A L A (SEQ ID NO: 85), where X3 is Y or F, X5 is T, S, V or L, X6 is L, I, V, or A, X7 is V, F, L, A, or G, X8, is S, T, or V, X9, is A, D, or E, and X15 is S or A. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of 100% sequence identity to SEQ ID NO: 17 and a secretion signal comprises M R X3 S X5 X6 X7 X8 X9 T L L A X13 S A L A (SEQ ID NO: 85), where X3 is Y or F, X5 is T, S, V or L, X6 is L, I, V, or A, X7 is V, F, L, A, or G, X8, is S, T, or V, X9, is A, D, or E, and X15 is S or A. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 18 and a secretion signal comprises M R X3 S X5 X6 X7 X8 X9 T L L A X13 S A L A (SEQ ID NO: 85), where X3 is Y or F, X5 is T, S, V or L, X6 is L, I, V, or A, X7 is V, F, L, A, or G, X8, is S, T, or V, X9, is A, D, or E, and X15 is S or A. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of 100% sequenceidentity to SEQ ID NO: 18 and a secretion signal comprises M R X3 S X5 X6 X7 X8 X9 T L L A X13 S A L A (SEQ ID NO: 85), where X3 is Y or F, X5 is T, S, V or L, X6 is L, I, V, or A, X7 is V, F, L, A, or G, X8, is S, T, or V, X9, is A, D, or E, and X15 is S or A. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 105, and a secretion signal comprises M R X3 S X5 X6 X7 X8 X9 T L L A X13 S A L A (SEQ ID NO: 85), where X3 is Y or F, X5 is T, S, V or L, X6 is L, I, V, or A, X7 is V, F, L, A, or G, X8, isS, T, or , X9, is A, D, or E, and X15 is S or A. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of 100% sequence identity to SEQ ID NO: 105 and a secretion signal comprises M R X3 S X5 X6 X7 X8 X9 T L L A X13 S A L A (SEQ ID NO: 85), where X3 is Y or F, X5 is T, S, V or L, X6 is L, I, V, or A, X7 is V, F, L, A, or G, X8, is S,T, or V, X9, is A, D, or E, and X15 is S or A. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 106 and a secretion signal comprises M R X3 S X5 X6 X7 X8 X9 T L L A X13 S A L A (SEQ ID NO: 85), where X3 is Y or F, X5 is T, S, V or L, X6 is L, I, V, or A, X7 is V, F, L, A, or G, X8, is S, T, or V, X9, is A, D, or E, and X15 is S or A. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of 100% sequence identity to SEQ ID NO: 106 and a secretion signal comprises M R X3 S X5 X6 X7 X8 X9 T L L A X13 S A L A (SEQ ID NO: 85), where X3 is Y or F, X5 is T, S, V or L, X6 is L, I, V, or A, X7 is V, F, L, A, or G, X8, is S, T, or V, X9, is A, D, or E, and X15 is S or A. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 17, 18, 105, or 106, and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to an amino acid sequence selected from SEQ ID NOs: 8-14, 19-36, 55-61 , and 86-102. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 17, 18, 105, or 106, and a secretion signal having the amino acid sequence of 100% sequence identity to an amino acid sequence selected from SEQ ID NOs: 8-14, 19-36, 55-61 , and 86-102. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 17 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 8. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 17 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 8. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 17 and asecretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 9. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 17 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 9. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 17 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 10. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 17 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 10. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 17 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 11. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 17 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 11 . In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 17 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 12. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 17 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 12. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 17 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 13. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 17 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 13. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 17 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 14. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 17 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ IDNO: 14. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 17 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 19. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 17 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 19. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 17 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 20. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 17 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 20. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 17 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 21. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 17 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 21. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 17 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 22. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 17 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 22. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 17 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 23. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 17 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 23. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 17 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 24. In anembodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 17 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 24. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 17 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 25. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 17 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 25. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 17 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 26. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 17 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 26. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 17 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 27. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 17 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 27. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 17 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 28. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 17 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 28. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 17 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 29. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 17 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 29. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%,96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 17 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 30. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 17 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 30. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 17 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 31. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 17 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 31. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 17 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 32. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 17 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 32. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 17 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 33. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 17 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 33. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 17 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 34. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 17 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 34. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 17 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 35. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 17 and a secretion signalhaving the amino acid sequence of 100% sequence identity to SEQ ID NO: 35. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 17 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 36. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 17 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 36. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 17 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 55. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 17 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 55. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 17 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 56. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 17 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 56. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 17 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 57. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 17 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 57. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 17 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 58. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 17 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 58. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 17 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%,94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 59. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 17 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 59. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 17 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 60. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 17 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 60. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 17 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 61. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 17 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 61 . In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 17 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 86. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 17 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 86. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 17 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 87. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 17 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 87. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 17 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 88. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 17 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 88. In an embodiment, the recombinant polypeptide comprises brazzein having an aminoacid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 17 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 89. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 17 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 89. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 17 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 90. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 17 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 90. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 17 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 91. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 17 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 91. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 17 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 92. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 17 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 92. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 17 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 93. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 17 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 93. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 17 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 94. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequenceof 100% sequence identity to SEQ ID NO: 17 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 94. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 17 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 95. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 17 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 95. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 17 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 96. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 17 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 96. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 17 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 97. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 17 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 97. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 17 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 98. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 17 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 98. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 17 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 99. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 17 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 99. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 17 and a secretion signal having theamino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 100. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 17 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 100. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 17 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 101. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 17 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 101. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 17 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 102. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 17 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 102.

[0058] In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 18 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 8. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 18 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 8. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 18 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 9. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 18 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 9. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 18 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 10. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequenceof 100% sequence identity to SEQ ID NO: 18 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 10. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 18 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 11 . In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 18 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 11. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 18 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 12. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 18 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 12. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 18 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 13. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 18 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 13. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 18 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 14. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 18 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 14. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 18 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 19. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 18 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 19. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 18 and a secretion signal having theamino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 20. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 18 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 20. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 18 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 21. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 18 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 21 . In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 18 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 22. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 18 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 22. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 18 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 23. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 18 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 23. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 18 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 24. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 18 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 24. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 18 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 25. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 18 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 25. In an embodiment,the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 18 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 26. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 18 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 26. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 18 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 27. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 18 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 27. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 18 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 28. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 18 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 28. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 18 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 29. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 18 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 29. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 18 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 30. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 18 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 30. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 18 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 31. In an embodiment, therecombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 18 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 31. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 18 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 32. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 18 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 32. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 18 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 33. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 18 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 33. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 18 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 34. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 18 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 34. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 18 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 35. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 18 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 35. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 18 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 36. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 18 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 36. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%sequence identity to SEQ ID NO: 18 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 55. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 18 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 55. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 18 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 56. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 18 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 56. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 18 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 57. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 18 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 57. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 18 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 58. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 18 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 58. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 18 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 59. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 18 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 59. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 18 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 60. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 18 and a secretion signal having the amino acidsequence of 100% sequence identity to SEQ ID NO: 60. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 18 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 61. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 18 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 61. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 18 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 86. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 18 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 86. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 18 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 87. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 18 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 87. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 18 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 88. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 18 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 88. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 18 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 89. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 18 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 89. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 18 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%,or 99% sequence identity to SEQ ID NO: 90. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 18 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 90. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 18 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 91. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 18 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 91. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 18 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 92. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 18 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 92. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 18 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 93. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 18 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 93. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 18 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 94. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 18 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 94. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 18 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 95. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 18 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 95. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%,85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 18 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 96. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 18 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 96. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 18 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 97. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 18 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 97. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 18 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 98. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 18 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 98. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 18 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 99. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 18 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 99. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 18 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 100. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 18 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 100. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 18 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 101. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100%sequence identity to SEQ ID NO: 18 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 101. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 18 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 102. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 18 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 102.

[0059] In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 105 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 8. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 105 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 8. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 105 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 9. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 105 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 9. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 105 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 10. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 105 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 10. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 105 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 11 . In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 105 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 11. In an embodiment, the recombinant polypeptide comprisesbrazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 105 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 12. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 105 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 12. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 105 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 13. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 105 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 13. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 105 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 14. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 105 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 14. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 105 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 19. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 105 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 19. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 105 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 20. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 105 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 20. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 105 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 21. In an embodiment, the recombinant polypeptide comprises brazzein havingthe amino acid sequence of 100% sequence identity to SEQ ID NO: 105 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 21 . In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 105 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 22. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 105 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 22. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 105 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 23. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 105 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 23. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 105 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 24. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 105 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 24. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 105 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 25. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 105 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 25. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 105 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 26. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 105 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 26. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 105 and asecretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 27. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 105 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 27. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 105 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 28. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 105 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 28. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 105 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 29. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 105 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 29. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 105 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 30. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 105 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 30. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 105 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 31. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 105 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 31. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 105 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 32. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 105 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQID NO: 32. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 105 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 33. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 105 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 33. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 105 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 34. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 105 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 34. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 105 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 35. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 105 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 35. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 105 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 36. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 105 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 36. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 105 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 55. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 105 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 55. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 105 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 56. In anembodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 105 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 56. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 105 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 57. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 105 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 57. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 105 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 58. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 105 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 58. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 105 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 59. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 105 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 59. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 105 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 60. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 105 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 60. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 105 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 61. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 105 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 61. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%,96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 105 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 86. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 105 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 86. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 105 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 87. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 105 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 87. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 105 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 88. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 105 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 88. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 105 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 89. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 105 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 89. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 105 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 90. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 105 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 90. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 105 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 91. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 105 and a secretion signalhaving the amino acid sequence of 100% sequence identity to SEQ ID NO: 91. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 105 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 92. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 105 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 92. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 105 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 93. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 105 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 93. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 105 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 94. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 105 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 94. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 105 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 95. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 105 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 95. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 105 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 96. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 105 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 96. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 105 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%,94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 97. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 105 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 97. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 105 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 98. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 105 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 98. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 105 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 99. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 105 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 99. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 105 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 100. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 105 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 100. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 105 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 101. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 105 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 101. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 105 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 102. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 105 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 102.

[0060] In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 106 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 8. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 106 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 8. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 106 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 9. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 106 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 9. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 106 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 10. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 106 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 10. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 106 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 11 . In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 106 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 11. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 106 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 12. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 106 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 12. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 106 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identityto SEQ ID NO: 13. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 106 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 13. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 106 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 14. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 106 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 14. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 106 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 19. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 106 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 19. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 106 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 20. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 106 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 20. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 106 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 21. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 106 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 21 . In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 106 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 22. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 106 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 22. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%,92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 106 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 23. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 106 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 23. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 106 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 24. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 106 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 24. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 106 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 25. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 106 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 25. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 106 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 26. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 106 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 26. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 106 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 27. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 106 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 27. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 106 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 28. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO:106 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 28. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 106 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 29. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 106 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 29. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 106 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 30. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 106 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 30. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 106 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 31. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 106 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 31. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 106 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 32. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 106 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 32. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 106 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 33. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 106 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 33. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 106 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91 %,92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 34. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 106 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 34. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 106 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 35. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 106 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 35. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 106 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 36. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 106 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 36. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 106 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 55. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 106 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 55. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 106 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 56. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 106 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 56. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 106 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 57. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 106 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 57. In an embodiment, the recombinant polypeptide comprisesbrazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 106 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 58. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 106 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 58. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 106 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 59. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 106 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 59. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 106 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 60. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 106 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 60. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 106 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 61. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 106 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 61. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 106 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 86. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 106 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 86. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 106 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 87. In an embodiment, the recombinant polypeptide comprises brazzein havingthe amino acid sequence of 100% sequence identity to SEQ ID NO: 106 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 87. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 106 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 88. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 106 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 88. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 106 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 89. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 106 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 89. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 106 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 90. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 106 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 90. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 106 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 91. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 106 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 91. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 106 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 92. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 106 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 92. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 106 and asecretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 93. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 106 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 93. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 106 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 94. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 106 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 94. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 106 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 95. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 106 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 95. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 106 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 96. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 106 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 96. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 106 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 97. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 106 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 97. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 106 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 98. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 106 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQID NO: 98. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 106 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 99. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 106 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 99. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 106 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 100. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 106 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 100. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 106 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 101. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 106 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 101. In an embodiment, the recombinant polypeptide comprises brazzein having an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 106 and a secretion signal having the amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 102. In an embodiment, the recombinant polypeptide comprises brazzein having the amino acid sequence of 100% sequence identity to SEQ ID NO: 106 and a secretion signal having the amino acid sequence of 100% sequence identity to SEQ ID NO: 102.

[0061] In an aspect of the present disclosure, a yeast strain is genetically engineered to secrete a recombinant protein using the secretion signal described herein. For example, the yeast strain is genetically engineered to express recombinant nucleic acid to produce brazzein. The yeast cell is first made "competent" through, for example, chemical means to condition them for genetic engineering. Exogenous recombinant nucleic acid that encodes, for example, brazzein, are transformed into the yeast cell. The recombinant DNA encodes the recombinant protein that enhance the production of brazzein. Accordingly, also provided is a recombinant host cell for producing a recombinant polypeptide described herein. In an embodiment, the host cell is a mammalian, fungi, yeast, or bacterial cell. In an embodiment, the host cell is a yeast cell. In afurther embodiment the yeast is selected from the species Saccharomyces, Pichia, Kluyveromyces and Hansenula. In one embodiment, the yeast is Kluyveromyces lactis. In one embodiment, the yeast is Kluyveromyces marxianus.

[0062] Also provided is a use the food protein described herein as an emulsifier, colorant, flavoring, mouthfeel improvement agent, texture improvement agent, sugar replacement, binding agent, or any combination thereof. In an embodiment, the food protein promotes the mixing of two or more immiscible substances. In an embodiment, the food protein enhances the stability and / or consistency of the mixed two or more immiscible substances. In an embodiment, the food protein modifies or enhances the color of a food product. In an embodiment, the food protein imparts, enhances, or modifies the flavor profile of a food product. In an embodiment, the food protein improves the overall taste experience for consumers. In an embodiment, the food protein modifies the tactile sensation experienced by the consumer. In an embodiment, the food protein binds to components in a food product. In an embodiment, the food protein provides structural stability to a food product. In an embodiment, the food protein provides structural integrity to a food product. In an embodiment, the food proteins provides firmness, creaminess, or crunchiness to a food product. In an embodiment, the food protein is or comprises a substitute for sugar. In an embodiment, the food protein provides sweetness to a food product. In an embodiment, the food protein reduces caloric content and / or glycemic impact of a food product as compared to sugar. In an embodiment, the brazzein is for emulating sensory experience of sugar. In an embodiment, the food protein is or comprises the recombinant brazzein described herein. In an embodiment, the brazzein is for use as a food additive. In an embodiment, the brazzein is for use as an ingredient in a food or beverage product. In an embodiment, the brazzein is for use in a pharmaceutical or a nutraceutical product. In an embodiment, the brazzein is for use with a vitamin. In an embodiment, the brazzein is for use as a natural supplement. In an embodiment, the brazzein is for use as a functional food ingredient. The brazzein described herein can be a component of a food product. In some embodiment, the food product is selected from the group consisting of a baked goods product, a beverage product, a candy or confectionery, a dairy product, a dietary supplement, an edible gel composition, a frozen dessert, a functional food, a health supplement, a nutraceutical, a packaged snack, a processed meat product, a seasoning or condiment, a soup or broth, and a tabletop flavoring. In some embodiments, the beverage product is selected from the group consisting of a carbonated beverage, coffee, an energy drink, a flavored water, a fountain beverage, a fruit juice, a fruit juice flavored drink, a frozen and ready- to-drink beverage, a frozen beverage, a functional beverage, a health-focused beverage, a herbal infusion, a liquid concentrate, a milk-based beverage, a non-alcoholic beer, a nutritional drink, a powdered soft drink, a ready-to-drink beverage, a soft drink, a sports drink, and tea. In some embodiments, the food protein is or comprises a component of a dental hygienic product. In some embodiments, the brazzein is a component of a dental hygienic product. In some embodiments,the food protein is or comprises a component of a pharmaceutical. In some embodiments, the brazzein is a component of a pharmaceutical.

[0063] The brazzein can readily be modified into other valuable compounds other than brazzein, which can be used in applications such as food dyes or medicinal supplements. In an embodiment, the brazzein is modified. In an embodiment, the modified brazzein is for use as a food dye. In an embodiment, the brazzein is for use as a medicinal supplement. Also provided is a composition comprising the brazzein and at least one additive selected from the group consisting of an alcohol, an amino acid or salt thereof, an astringent compound, a bitter compound, a carbohydrate, a fatty acid, a flavonoids, a flavorant, a flavoring ingredient, a glycoside, an inorganic acid, an inorganic salt, an organic acid, an organic acid salt, an organic base salt, an organic salt, a peptide, a polyamino acid or salt thereof, a polyol, a polymer, a protein, a protein hydrolysate, a sugar acid or salt thereof, a surfactant, a terpenoid, an emulsifier, a nucleotide, a vitamin, and a combination thereof.

[0064] The secretion signal described herein can be useful for secreting a recombinant polypeptide comprising a dairy protein such as bovine lactoferrin (UniProt database entry P24627; also known as lactotransferrin), bovine beta lactoglobulin (UniProt database entry P02754), bovine alpha-lactalbumin (UniProt database entry P00711), human alpha lactalbumin (UniProt database entry P00709), or human lactoferrin (UniProt database entry Q19KS2). In an embodiment, the recombinant polypeptide comprises a dairy protein. In an embodiment, the dairy protein comprises bovine lactoferrin, bovine beta lactoglobulin, bovine alpha-lactalbumin, human alpha lactalbumin, or human lactoferrin. In an embodiment, the dairy protein is or comprises bovine lactoferrin. In an embodiment, the dairy protein comprises bovine beta lactoglobulin. In an embodiment, the dairy protein comprises bovine alpha-lactalbumin. In an embodiment, the dairy protein comprises human alpha lactalbumin. In an embodiment, the dairy protein comprises human lactoferrin.

[0065] The secretion signal described herein can be useful for secreting a recombinant polypeptide comprising a meat-like protein such as bovine myoglobin (UniProt database entry P02192), soy leghemoglobin 3 (UniProt database entry P02238), or bovine collagen alpha-1 (I) chain (UniProt database entry P02453).

[0066] In an embodiment, the recombinant polypeptide comprises a meat-like dairy protein. In an embodiment, the meat-like protein comprises bovine myoglobin, soy leghemoglobin 3, or bovine collagen alpha-1 (I) chain. In an embodiment, the meat-like protein comprises bovine myoglobin. In an embodiment, the meat-like protein comprises soy leghemoglobin 3. In an embodiment, the meat-like protein comprises bovine collagen alpha-1 (I) chain.

[0067] In an embodiment, the recombinant polypeptide is or comprises a therapeutic protein. In an embodiment, the therapeutic protein is or comprises an antibody. In anembodiment, the antibody is a monoclonal, chimeric, humanized, or an antigen binding fragment thereof.In an embodiment, the antigen binding fragment is a Fv, scFv, Fab, Fab', F(ab')2, dsFv, ds-scFv, sdAB, dimer, minibody, diabody, nanobody, or multimer antigen binding fragment. In an embodiment, the antibody is a nanobody.

[0068] Also provided is a method for producing a recombinant protein. In an embodiment, the recombinant protein is or comprises a recombinant food protein. In an embodiment, the recombinant food protein is or comprises a recombinant sweet protein. In an embodiment, the method comprises culturing a recombinant host cell in a culture medium provided herein under conditions suitable for obtaining the fermentation comprising the recombinant sweet protein provided herein. Suitable culture media for use are known to the person skilled in the art, as are suitable culture conditions. In an embodiment, the method further comprises constructing recombinant vectors and / or polynucleotide encoding the recombinant protein operably linked to the secretion peptide described herein. Methods for constructing vectors and polynucleotides are known to the person skilled in the art. In an embodiment, the recombinant vectors and / or nucleic acid are synthetically generated, isolated, and / or PCR amplified by standard procedures from organisms, cells, tissues, or plasmid constructs. In an embodiment, the nucleic acid encoding the recombinant protein is or comprises codon optimized for expression in a particular host cell. The skilled person can readily determine suitable nucleotide sequences for expressing a particular amino acid sequence.

[0069] Introduction of vector or nucleic acid into a host cell can be carried out by techniques known by the skilled person in the art. The process of introducing vector or nucleic acid into a host cell such as a yeast cell is known as transformation, which could involve lithium, electroporation, biolistic and glass bead methods, using a circularized or linearized vector. The skilled person in the art is able to select one or more suitable methods for transforming cells with expression constructs or vectors described herein based on the knowledge in the art that certain techniques for introducing vectors work better for certain types of cells. In addition, the identification of recombinant host cells can be done by expressing drug resistance or auxotrophic markers encoded by the recombinant vectors that permit selection for or against growth of cells. The selected recombinant host cells can be grown in an appropriate liquid medium containing specific nutrients for cell growth. The cell suspension is then incubated within specific environmental conditions conducive for fermentation, such that the recombinant host cell's production of recombinant protein, for example, a food protein such as brazzein. During fermentation, the engineered host cell produces, for example, brazzein which can either remain inside the cell or secreted out into the medium. The recombinant host cell is fermented up to a certain density and time point to maximize recombinant protein production. In some embodiment, the method further comprises introducing the vector and / or polynucleotide into a host cell. In anembodiment, the method further comprises transforming a host cell with the vector and / or nucleic acid to obtain the recombinant host cell described herein. In an embodiment, the method further comprises increasing or reducing the number of nucleic acids and / or the strength of the promoter that are operably linked to the nucleic acid, thereby balances expression of the recombinant protein. In some embodiments, the promoter is selected from GAL1 , LAC4, NC-1 , TDH3, TEF3, BGL2, and SPL1755. In some embodiments, the promoter comprises a nucleotide sequence selected from SEQ ID NOs: 69-75. In an embodiment, the vector comprises a CYC1 terminator. In an embodiment, the vector comprises a terminator having a nucleic acid sequence of SEQ ID NO: 76. In an embodiment, the method further comprises selecting a secretion peptide or a combination of secretion peptides for efficient secretion. In an embodiment, the promotersecretion signal-food protein-terminator comprises a nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to nucleotide sequence of SEQ ID NO: 84. In an embodiment, the promoter-secretion signal-food protein-terminator comprises a nucleotide sequence having 100% sequence identity to nucleotide sequence of SEQ ID NO: 84. In an embodiment, the polynucleotide described herein is provided in a vector. In an embodiment, the vector is a plasmid. In an embodiment, the method further comprises isolating the food protein.

[0070] At the end of fermentation, both the cells and the medium are subjected to downstream processing (DSP) which can involve several processes to extract and purify the recombinant protein such as brazzein from the cellular milieu. Upon purification, the recombinant protein can further be processed specific to its intended application (e.g. spray drying). A variety of methods known in the art are suitable for extracting and subsequently purifying the secreted recombinant protein. Common steps in such methods include centrifugation at the speeds that cause the pelleting of cells and removal of cell pellets comprising the recombinant host cells and cell debris, followed by precipitation of the recombinant proteins using precipitants, or affinity separation, or ultrafiltration with molecular cutoff membranes. The suspended recombinant proteins can be dialyzed to remove the dissolved salts. Additionally, the dialyzed recombinant proteins can be lyophilized using freeze drying or spray drying techniques. In an embodiment, the method further comprises extracting the secreted recombinant protein from the fermentation broth.

[0071] The secretion signals and nucleic acid described herein when introduced into a recombinant cell can achieve high yield production of recombinant proteins. In an embodiment, the secretion signal comprises at least two secretion signals described herein. In an embodiment, the secretion signal comprises at least two amino acid sequences selected from SEQ ID NOs: 8- 14, 19-36, 55-61 , and 86-102. In an embodiment, the recombinant host cell produces a secreted yield of a recombinant protein of at least about 1%, at least about 5%, at least about 10%, at least about 20% or at least about 30%; from about 1% to about 100%, to about 90%, to about 80%, toabout 70%, to about 60%, to about 50%, to about 40%, to about 30%, or to about 20%; from about 20% to about 100%, to about 90%, to about 80%, to about 70%, to about 60%, to about 50%, to about 40%, to about 30%; from about 30%, to about 100%, to about 90%, to about 80%, to about 70%, to about 60%, to about 50%, or to about 40%; from about 40% to about 100%, to about 90%, to about 80%, to about 70%, to about 60%, orto about 50%, from about 50% to about 100%, to about 90%, to about 80%, to about 70%, or to about 60%; from about 60% to about 100%, to about 90%, to about 80%, or to about 70%; from about 70% to about 100%, to about 90%, orto about 80%; from about 80% to about 100%, orto about 90%; from about 90% to about 100% by weight oftotal yields of the recombinant protein produced by the recombinant host cells.

[0072] In a particular aspect of the present disclosure, also provided is a recombinant yeast cell for producing a recombinant brazzein. There are potential compatibility issues with genetically engineered biosynthetic pathways using any microbial strain with Generally Recognized As Safe (GRAS) designation for producing recombinant brazzein. The present inventors have identified a particular strain of yeast, namely Kluyveromyces marxianus, that is receptive of the vector and / or nucleic acid described herein, and the resulting recombinant Kluyveromyces marxianus is capable of efficiently producing recombinant brazzein.

[0073] Embodiments of the disclosure will be described in a non-limiting manner by reference to Examples.ExamplesExample 1 - Genes of Interests Preparation and Polymerase Chain Reaction

[0074] Genes of interest were amplified from genomic DNA, plasmid DNA templates, and synthetic DNA using Platinum™ SuperFi™ II PCR Master mix (Thermo Fisher Scientific, Cat #12368010). The reaction conditions were as follows: step 1) One cycle initial denaturation at 98°C; step 2) 10 sec denaturation at 98°C; step 3) 10 sec annealing at 60°C; step 4) 30 sec per kb extension at 72°C; step 5) repeat step 2-4 for 35 cycles; step 6) 5 min final extension at 72°C; step 7) hold at 4°C.

[0075] Oligonucleotides were synthesized by ACGT Corp, Integrated DNA Technologies, or ThermoFisher Scientific. gBIock fragments were synthesized by Integrated DNA Technologies, or Twist Biosciences.

[0076] Certain exemplary polypeptide and nucleic sequences contemplated herein are shown below in Tables 1-7. DNA sequences are listed in the tables indicated. Each of the elements can be selected and promoters were selected from Table 5. Signal Secretion peptides sequences were selected from Table 1 and Table 2. Brazzein sequences were selected from Table 3. Terminator sequences were selected from Table 6. DNA sequences were codon optimized for expression in Kluyveromyces marxianus.Example 2 - Plasmid Construction

[0077] To assemble plasmid pBF-01 , Primer-1 (5’- cgattcgcacgctgcaacggcatgccgcgtgttacaaccaattaacc-3’; SEQ ID NO: 78) and Primer-2 (5’- atctgtacatgattcgtcagtgtgagccgcacggttatccacagaatc-3’; SEQ ID NO: 79) were used to amplify the kanamycin and bacterial ORI from pMTU-DO-URA-C4. Primer-3 (5’tcctgcgttatcccctgattctgtggataaccgctagcgtgcggctcacactgacgaatc-3’; SEQ ID NO: 80) and Primer- 4 (5’-gcaaaatggtcaatgttagaaagtattgactcgggtaataactgatataattaaattg-3’; SEQ ID NO: 81) were usedto amplify the URA selection cassette from pMTU-DO-URA-C4. The resulting purified PCR product was assembled using NEBuilder HiFi DNA Assembly Master Mix with pKD1 to generate pBF-01 .

[0078] Purified PCR products were assembled into plasmids using NEBuilder HiFi DNA Assembly Cloning Kit (New England BioLabs Inc, Cat #E5520). 10uL of the HiFi DNA Assembly Master Mix was used with 15-30ng of each PCR product and 30ng of linearized vector to a final volume of 20pL. The reaction was carried out at 50°C for 1 hour. 2pL of the assembled product was transformed into 10-beta Competent E. coll cells (provided in the cloning kit) by heat shock at 42°C for 30 seconds; cells were incubated at 37°C in 1 mL SOC for 1 hour with shaking at 280 rpm. 100pL of the recovery mixture was plated on LB agar plates containing ampicillin at a concentration of 100pg / mL. Plates were incubated overnight at 37°C. Colonies were screened by colony

[0079] To assemble pBF-01.1 (see FIG. 1 and FIG. 2A), pBF-01 was digested with Nhel (New England Biolabs Inc, Cat#R3131S) to generate a linear fragment. The gBLOCK containing expression cassette consisting of the Gall promoter sequence selected from Table 5, scBGL2 signal peptide selected from Table 1 , brazzein DNA sequence selected from Table 3, and a CYC1 terminator sequence selected from Table 6 was PCR amplified to contain then contained the necessary overlap sequences to facilitate proper DNA assembly using HEB HiFi DNA Assembly Cloning Kit.

[0080] To assemble pBF-01.1.1 (see FIG. 1 and FIG. 2B), pBF-01.1 was digested with Nhel to generate a linear fragment. The gBLOCK containing expression cassette consisting of the Gall promoter sequence selected from Table 5, scBGL2 signal peptide selected from Table 1 , brazzein DNA sequence selected from Table 3, and a CYC1 terminator sequence selected from Table 6 was PCR amplified to contain then contained the necessary overlap sequences to facilitate proper DNA assembly using HEB HiFi DNA Assembly Cloning Kit. This process was repeated to generate the fully assembled pBF-01 .1 .1.

[0081] To assemble pBF-02, pBF-02.1 , and pBF-02.1.1 (see FIG. 1), a similar strategy as described above was used.Example 3 - Preparation of Kluyveromyces marxianus transformation-competent cells

[0082] Solutions was prepared separately as follows: per litre of LB broth includes 10 g yeast extract, 20 g peptone, and 20 g dextrose. A single colony of Kluyveromyces marxianus was inoculated into 5 mL of YPD broth and incubated overnight at 30 degrees Celsius with shaking at 200 rpm. 250 pL of the overnight culture is added to 10 mL of fresh YPD broth per transformant and incubated for 3-4 hours at 30 degrees Celsius with shaking at 200 rpm or until GD600 reaches 0.6. Cells were collected by centrifugation at 4500g for 10 minutes. Cells were washed twice with 10 mL of sterile water, collected, and resuspended in 1 mL of sterile water. Cells were collected and resuspended in 100 pL of sterile water per transformation.Example 4 - Transformation of DNA into Kluyveromyces marxianus

[0083] 100 pL of prepared Kluyveromyces marxianus cells was centrifuged to remove the supernatant. The cell pellet was then mixed, with 240 pL 50% PEG 3350, 36 pL 1 M lithium acetate, 50 pL 2 mg / mL salmon sperm DNA, 5 pL recombinant DNA, 29 pL sterile water. Cells were heat-shocked for 40 minutes at 42 degrees Celsius. Cells were then centrifuged at maximum speed for 30 seconds and the supernatant was removed. The cell pellet was then resuspended in 1 mL of YPD broth and incubated at 30 degrees Celsius for 2.5 hours. Cells were then centrifuged at maximum speed for 30 seconds and resuspended in 400 pL YPD and spread onto selective plates. The plates were incubated at 30 degrees Celsius for 2-5 days.Example 5 - Genome integration of DNA into Kluyveromyces marxianus

[0084] The whole cassette “promoter-signal peptide-gene of interest-terminator” (for example SEQ ID NO: 84) was PCR amplified with primers containing sites for overlap using HiFi assembly to plasmids for integration into the Kluyveromyces marxianus genome.Example 6 - Shake Flask Medium

[0085] Minimal media shake flask components were prepared as follows: per litre of shake flask medium includes 6.74 g yeast nitrogen base, 2 g Yeast Synthetic Drop-out Medium Supplements without Uracil (Sigma), and 40 g lactose. The pH of the minimal media was adjusted to 6.5 with 2 M sodium hydroxide.Example 7 - Growing Cultures in Shake Flasks for Production of Brazzein

[0086] A Kluyveromyces marxianus strain from a fresh colony or frozen stock was inoculated into 5 mL YPD growth media and grown at 30° Celsius with shaking at 200 rpm for 14- 20 hours. Overnight cells were diluted to 0.2 OD600 in 1L of YPD growth media. Cells were grown at 30° Celsius with shaking at 200 rpm for 4-6 hours until 0.8 OD600 was reached. Cells were then centrifuged and the supernatant was removed. The pellet was resuspended in minimal media supplemented with 4% lactose. The cells were grown at 30° Celsius with shaking at 200 rpm for 24-72 hours.Example 8 - Fermentation Medium and Feeds

[0087] The components indicated below were dissolved and the volume adjusted with water. The components were, for example, Food Chemicals Codex (FCC) grade or equivalent. The medium was sterilized by autoclaving, by steaming in place, or with an equivalent.

[0088] Basal salts medium containing per liter: (NH4)2SO4, 5g; MgSO4*7H2O, 0.5g; KH2PO4, 3g; EDTA, 15mg, ZnSo4«7H20, 4.5mg; MnCI2«7H2O, 1 mg; CoCI2«6H20, 0.3mg; CuSO4«5H2O, 0.3mg; Na2Mo04«2H20, 0.4mg; Cacl2«2H2O, 4.5mg; FeSO4«7H2O, 3mg;H3BO3, 1 mg; KI, 0.1 mg; biotin, 0.1 mg; Ca-pantothenate, 1 mg; nicotinic acid, 1mg; antifoaming agent, 0.15 ml_. The medium was sterilized at 120°C for 20 min.

[0089] Fed-batch medium feed containing per liter: (NH4)2SO4, 10g; MgSO4*7H2O, 5g; KH2PO4, 20g; EDTA, 750mg, ZnSo4«7H20, 225mg; MnCI2«7H2O, 50mg; CoCI2«6H20, 15mg; CuSO4«5H2O, 15mg; Na2Mo04«2H20, 20mg; Cacl2«2H2O, 225mg; FeSO4«7H2O, 150mg; H3BO3, 50mg; KI, 5mg; biotin, 5mg; Ca-pantothenate, 100mg; nicotinic acid, 100mg; antifoaming agent, 0.15 mL and 500ml_ glycerol. The medium was sterilized at 120°C for 20 min.

[0090] The SG-lactose medium used in bioreactor cultivations contained 360 g / L lactose and the fed batch medium without the addition of glycerol.Example 9 - Lab-Scale FermentationSeed Shake Flask Protocol

[0091] A starter culture is prepared by inoculating a glycerol stock into 1-5 mL YPD and grown at 30°C with shaking at 200 rpm for 16-20 hours (overnight). A second seed culture was prepared by inoculating 1-5 mL ofthe overnight culture into a 50-100 mL YPD in a 500mL flask and cells incubated at 30°C with shaking at 225 rpm for 8-20 hours. Cultures were grown at 30°C with shaking (200 RPM). The culture volume was 10-20% of the nominal shake flask volume. A 2.8L nominal volume flask with 250 to 500 mL of medium was routinely used. Cultures were grown to a cell density (OD600) of 4.0-6.0.Fermentation Protocol

[0092] The fermentation was divided into three phases: P1 , a glycerol batch phase; P2, a glycerol fed-batch phase; and P3, the lactose fed-batch phase.Batch Fermentation Phase

[0093] The fermentation medium and feeds were prepared as described herein. The fed- batch culture was started as a batch culture. The initial volume should be about 50% of the maximum fermenter volume, e.g., 5 L, if the maximum working volume of the fermenter is 10-L. This is because the process will approach the maximum working volume by the end of the fermentation. The fermenter is inoculated with shake flask seed at 5-10% inoculum-fermenter ratio, e.g. if 5 L of initial media are present in the fermenter, the fermenter is inoculated with about 0.5 L of shake flask seed. The seed culture was inoculated into 2.5 L Basal Salts Medium containing glycerol in a 5L fermenter with an initial OD600 of 0.6. The culture was grown for 20-24 hours. Process controls include the following: 30°C temperature; dissolved oxygen controlled by agitationaeration cascade to maintain 0-50%; and pH controlled via addition of NH4OH was maintained, the set point will depend on the phase of the process. Antifoam 204 (Sigma Aldrich) was added at a concentration of between 0.005% and 0.01% or polypropylene glycol P2000 before heat sterilization and at certain points during the induction phase to de-foam.Glycerol Fed-Batch Fermentation Phase

[0094] Fed batch medium containing 50% glycerol (m / m) solution was added at a rate of 18ml_ / h / L. The culture was grown for 24 hours or until a biomass OD600 of 200 was achieved.Lactose Fed-batch phase

[0095] Feed was initiated when OD600 reaches 200 or after 24-48 hours. Lactose feed of 360g / L was adjusted, based on fluctuations in lactose level. pH was maintained between 5-6.5, and dissolved oxygen levels were maintained 10-50%. If oxygen concentration was too low, pure oxygen was mixed with air. Stirring was maintained between 300-800 RPM.Example 10 - Extraction of Brazzein

[0096] Following fermentation, samples were collected via centrifugation at 15000g for 20 minutes and the supernatant was collected. The supernatant was clarified through a 0.22 pm filter using bottle top vacuum clarification to obtain a crude protein extract.Example 11 - Purification of Brazzein

[0097] The crude protein extract was subject to a filtration process to remove salts and buffer ions. First, the crude protein extract was pumped through a 30 kDa or 10 kDa Vivaflow TFF Cassette (Sartorius PES membrane). The feed pressure was about 1 to 2.5 bar and the retentate pressure was about 0.1 to 1 bar. The retentate was recycled back to the crude protein extract. The filtrate was collected to yield the crude brazzein protein extract. The crude brazzein protein extract was concentrated to less than 500 mL using a 2 kDa Vivaflow TFF Cassette (Sartorius PES membrane). The feed pressure was about 1 to 2.5 bar and the retentate pressure was about 0.1 to 1 bar. The retentate was recycled back to the crude brazzein extract and the filtrate was discarded.

[0098] The sample could be further purified using fast protein liquid chromatography (FPLC) or high-performance liquid chromatography (HPLC).

[0099] The protein extract was run through a AKTA pure 25L protein purification system (AKTA) equipped with a Superdex 75 Increase 100 / 300 GL (Cytiva). A size exclusion buffer was prepared using 20mM Tris, pH 7.6 and 150 mM NaCI. The protein extract was diluted with the size exclusion buffer 1 :1. 2 mL was loaded into the AKTA using a 2mL loading loop. The column was equilibrated with size exclusion buffer at a flow rate of 0.5 mL / min for 15 minutes or roughly 2 column volumes. The sample was applied to the column by running 20 column volumes of size exclusion buffer through the loading loop at a flow rate of 1 mL / min. The separation lasted 120 minutes and the sample eluted at approximately 110 minutes. The sample was then eluted with size exclusion buffer using 1 column volume at a flow rate of 1 mL / min.

[0100] HPLC analysis was performed using a Hypersil Gold C18 column. A linear gradient increased from 10% - 50% 0.1 % TFA in water: 0.1 % TFA in acetonitrile over 10 minutes then dropped down to 10% for an additional 5 minutes at a flow rate of 0.5 mL / min. Brazzein eluted at approximately 2.5 minutes.

[0101] The fraction containing brazzein may be collected. The fraction was added to a diafiltration reservoir (Sartorius) and the sample was then subject to diafiltration to remove salts and buffers. At least 5 volumes of pure water was used as a buffer exchange. The feed pressure was about 1 to 2.5 bar and the retentate pressure was about 0.1 to 1 bar. The solution was then allowed to concentrate to less than 100 ml_. The liquid product was freeze dried to below 5% moisture.Example 12 - Quantification of BrazzeinPurified brazzein samples were analyzed through SDS-PAGE, Coomassie blue protein staining, FPLC, Western Blot, and BOA Assay.Example 13 - Transformation to introduce brazzein expression into Kluyveromyces marxianus

[0102] Expression vectors were into prepared competent Kluyveromyces marxianus cells. 200pL of the recovery mixture was plated on YPD agar plates containing G418 at a concentration of 200pg / ml_ or SC-URA plates. Plates were incubated for 2 to 4 days at 30°C. Colonies were screened by colony PCR for the presence of the insert. A successful transformant was inoculated for shake flask cultivation for analysis of recombinant protein expression and function.Example 14 -Assembling brazzein biosynthesis genes for inteqration into Kluyveromyces marxianus

[0103] The whole cassette “Integration site-promoter-signal peptide-genes of interest- terminator-integration site” was PCR amplified with primers containing overhangs to assemble gene cassettes for integration into the Kluyveromyces marxianus genome. Alternatively, the whole cassette could be assembled into a plasmid that contains integration sites using known methods. The plasmid could be digested with restriction enzymes to generate the assembled whole cassette.

[0104] To integrate into the genome, a CRISPR-Cas9 system was used to induce double strand breaks. Many methods to express the system and associated parts (gRNA) are known in the art. This could include Cas9 expression from plasmids, genome, or purified proteins. The Alt- R™ CRISPR-Cas9 System (Integrated DNA Technologies) was used to target whole cassettes for genomic integration. T ransformation of linear dsDNA for integration was performed using the method described by Rajkumar and Morrissey (2021)1, herein incorporated by reference.

[0105] If a plasmid was utilized for expression of the Cas9 and gRNA, the plasmid was recycled to allow for subsequent transformation for the next genomic integration.Example 15A - Production of Brazzein in Yeast

[0106] The recombinant yeast cell described herein is useful for the efficient production of a food protein, such as the sweet protein brazzein. Yeast strain Kluyveromyces marxianus was engineered to produce recombinant brazzein by introducing into the yeast a polynucleotide encoding a polypeptide comprising at least one secretion signal and brazzein. The polynucleotide sequence is designed to improve expression in the yeast, and specifically efficient secretion of the recombinant protein. The engineered Kluyveromyces marxianus is cultured in an appropriate growth medium under suitable conditions to stimulate growth and protein production. Periodic sampling of the culture medium is performed to monitor the secretion of the recombinant brazzein into the medium. Once a sufficient quantity of recombinant brazzein has been produced, the protein is then purified from the culture medium using a series of filtration and chromatography steps. The purified protein is then subjected to a range of quality control assays to confirm its identity, purity, and functional activity. A high yield of pure, active recombinant brazzein is produced efficiently. The method and recombinant yeast strain described herein are useful for facilitating large-scale, cost- effective production of food protein, such as a sweet protein including brazzein.

[0107] SDS-PAGE analysis of medium samples from induced Kluyveromyces marxianus culture containing various secretion signal peptides (any one of SEQ ID NO: 8-14, 19-36, and 55- 58) fused to brazzein are conducted. Quantification of brazzein expression is measured and normalized to optical density. HPLC analysis of brazzein standard and samples are also conducted. These show the production of brazzein by Kluyveromyces marxianus involving the secretion signal peptides described herein.Example 15B - Production of Brazzein using Modified Signal Peptides in Kluyveromyces MarxianusShake Flask Medium

[0108] Mineral media shake flask components were prepared as follows: per liter shake flask medium includes 10g yeast extract, 6.74g. Yeast nitrogen base (YNB), 0.5g magnesium sulfate, 3g potassium phosphate, 100mM bicarbonate buffer, pH 6, 0.1 mg biotin and 40g of lactose.Growing Cultures in Shake Flasks for Production of Brazzein

[0109] Kluyveromyces strains, each transformed with a construct encoding a recombinant brazzein tagged at the N-terminus with SP1 (SEQ ID NO: 19), SP3 (SEQ ID NO: 21), SP4 (SEQ ID NO: 22), SP5 (SEQ ID NO: 23), SP6 (SEQ ID NO: 24), SP15 (SEQ ID NO: 33), or Saccharomyces cerevisiae o-mating factor alpha secretion signal (SC AF; SEQ ID NO: 57), were obtained from a fresh colony or frozen stock was inoculated into 5 mL YPD growth media andgrown at 30° Celsius with shaking at 200 rpm for 14-20 hours. Overnight cells were diluted to 0.2 OD600 in 1L of yeast extract peptone dextrose (YPD) growth media. Cells were grown at 30°C with shaking at 200 rpm for 4-6 hours until 0.8 OD600 was reached. Cells were then centrifuged, and the supernatant was removed. The pellet was resuspended in Mineral media supplemented with 4% lactose. The cells were grown at 30°C with shaking at 200 rpm for 72 hours.Quantification of Brazzein

[0110] Brazzein from the supernatant was separated by SDS-PAGE followed by Coomassie blue protein staining, and the resulting stained gel was imaged using a BioRad GelDoc Imaging system (white tray) auto acquisition feature and quantified for relative band intensity. Brazzein secretion relating to the SP peptides was determined and fold change relative to the widely used Saccharomyces cerevisea a-mating factor secretion signal peptide. The results are summarized in FIG. 4.

[0111] These results show that the SPs described herein are useful for producing recombinant proteins, for example, sweet food protein such as brazzein.Example 16A - Use of recombinant secretion signals in other heterologous yeast strains

[0112] The expression and use of the recombinant secretion signals in other host strains could be utilized to secrete a desired protein. A plasmid suitable for the specific host organism can contain the whole gene cassette containing the promoter, signal secretion, gene of interest, and terminator sequence which are codon optimized to suit the specific organism. The introduction of these expression plasmids into the host organism is known in the art and is similar to the examples described previously. The described secretion signals described herein can be utilized in the host organism Saccharomyces cerevisiae and Pichia pastoris, where the secretion signals are heterologous to the host cell.

[0113] Selected secretion signal peptides are fused to brazzein and the recombinant brazzein is produced in Pichia pastoris and Saccharomyces cerevisiae as host strains. SDS- PAGE analysis of medium samples from induced Pichia pastoris and Saccharomyces cerevisiae culture are carried out. Quantification of brazzein expression ais measured and normalized to optical density. This shows the production of brazzein by Pichia pastoris and Saccharomyces cerevisiae involving the secretion signal peptides described herein.Example 16B - Pichia plasmid generation and electroporation transformation

[0114] pGAPZ-B is obtained from Thermofisher was linearized by PCR with forward primer (pGAPZ-B. FOR - 5’ AGGAATTCACGTGGCCCA 3’; SEQ ID NO: 107) and reverse primer (pGAPZB-SP5.REV - 5’TAACAATAGAAGAATATCTCATCGTTTCGAAATAGTTGTTCAATTGATTGAAATAGGGAC 3’; SEQ ID NO: 108). The resulting PCR product is gel purified.

[0115] Brazzein protein sequence is codon optimized for Pichia pastoris expression (GACAAGTGCAAGAAGGTCTATGAGAACTACCCTGTCTCTAAATGTCAACTTGCAAACCAGT GTAACTACGACTGCAAGTTGGACAAACACGCTAGGTCAGGCGAATGCTTCTACGATGAGA AGCGTAATTTACAATGCATTTGCGACTATTGTGAGTATTAA; SEQ ID NO: 109) and PCR amplified with forward primer (ppBR-SP5.FOR - 5’GAAACGATGAGATATTCTTCTATTGTTACTGCTACTTTGTTGGCTGCTTCTTCTGCTTTGGC TGACAAGTGCAAGAAGGTCTATGAGAAC 3’; SEQ ID NO: 110) and reverse primer (ppBR- pGAPZB-RVS 5’GGCCGGCTGGGCCACGTGAATTCCTTTAATACTCACAATAGTCGCAAATGC 3’; SEQ ID NO: 111). The resulting PCR product was gel purified.

[0116] To assemble pGAPZ-B-SP5-BZ, the aforementioned PCR products are assembled into plasmids using NEBuilder HiFi DNA Assembly Cloning Kit (New England Biolabs Inc, Cat #E5520). 10pL of the HiFi DNA Assembly Master Mix is used with 15-30ng of each PCR product to a final volume of 20pL. The reaction is carried out at 50°C for 1 hour. 2pL of the assembled product is transformed into 10-beta Competent E. coll cells (provided in the cloning kit) by heat shock at 42°C for 30 seconds; cells are incubated at 37°C in 1 ml_ SOC for 1 hour with shaking at 280 rpm. 100pL of the recovery mixture is plated on LB agar plates containing ampicillin at a concentration of 100pg / mL. Plates are incubated overnight at 37°C. Colonies are screened by colony PCR and prepared for plasmid purification.

[0117] X-33 Pichia pastoris cells are obtained from Thermofisher which are transformed using electroporation according to the manufacturer’s instructions. Briefly, the purified plasmid is digested with Avr II, gel purified, and resuspended in water. Pichia is prepared according to manufacturer’s instructions and transformed by electroporation according to the parameters for yeast as suggested by the manufacturer using the electroporation device. Selection is carried out using Zeocin™ containing YPDS plates and incubated for 2-3 days at 30°C. Colonies are screened by colony PCR and prepared for recombinant protein production.Example 17A - Use of recombinant secretion signals for the secretion of other recombinant proteins

[0118] The recombinant secretion signals can also be used to secrete any recombinant proteins. The described recombinant secretion signals can be added to the N-terminus of a desired recombinant protein and expressed in a host cell, where the secretion signals are heterologous to the host cell.

[0119] Selected secretion signal peptides are fused to thaumatin or a nanobody and the recombinant thaumatin or nanobody is produced as described herein using Kluyveromyces marxianus. The schematic map of pBF01.2 for producing thaumatin fused to a signal peptide is shown in FIG. 3. Quantification of thaumatin and nanobody expression is measured andnormalized to optical density. HPLC analysis of thaumatin standard, nanobody standard, and samples are also conducted. This shows the production of thaumatin and nanobody by Kluyveromyces marxianus involving the secretion signal peptides described herein.

[0120] In addition, recombinant nanobodies that contain a HIS-tag are generated and their expression are analyzed by Western blotting. This shows the production of HIS-tag recombinant nanobodies by Kluyveromyces marxianus involving the secretion signal peptides described herein.Example 17B - Use of a recombinant secretion signal for the secretion of recombinant GFPSecretion of GFP in Kluyveromyces Marxianus

[0121] Kluyveromyces Marxianus prepared and transformed with plasmid expressing GFP tagged at the N-terminus with SP5 was cultivated generally according to Examples 5-6. In short, untransformed Kluyveromyces Marxianus cells and Kluyveromyces Marxianus cells containing pKD1-SP5-GFP were induced with lactose for 24 hours. Cells were sedimented by centrifugation and the resulting supernatant was collected and exposed under UV light. FIG. 5 shows untransformed Kluyveromyces Marxianus wild type (left tube) ands Kluyveromyces Marxianus transformed with pKD1-SP5-GFP (right tube). Phenotypic changes associated with the Kluyveromyces strain containing pKD1-SP5-GFP is clearly shown. The relative fluorescence units of GFP were measured using a microplate reader (excitation: 485 / 14nm, emission: 535 / 25nm) to determine the levels of GFP secretion, as plotted and shown in FIG. 6.

[0122] These results show that the SPs described herein can be useful for producing recombinant proteins.Example 18 - Scaled up production of brazzein in yeast

[0123] Scaled up production of brazzein comprising secretion signals by using Kluyveromyces marxianus, Pichia pastoris and Saccharomyces cerevisiae are conducted. The fermentation is carried out in a 10L reactor. Quantification of brazzein expression is measured and normalized to optical density. This shows the production of recombinant brazzein by Kluyveromyces marxianus, Pichia pastoris and Saccharomyces cerevisiae involving the secretion signal peptides described herein.

[0124] While the present disclosure has been described with reference to examples, it is to be understood that the scope of the claims should not be limited by the embodiments set forth in the examples, but should be given the broadest interpretation consistent with the description as a whole.

[0125] All publications, patents and patent applications are herein incorporated by reference in their entirety to the same extent as if each individual publication, patent or patentapplication was specifically and individually indicated to be incorporated by reference in its entirety. Where a term in the present disclosure is found to be defined differently in a document incorporated herein by reference, the definition provided herein is to serve as the definition for the term.CITATIONS FOR REFERENCES REFERRED TO IN THE SPECIFICATIONChenna et al., 2003, Nucleic Acids Res., 31 (13):3497-500Dayhoff et al. (1978), Atlas of Protein Sequence and Structure, 5(Suppl. 3):345-352Rajkumar, A.S. and Morrissey, J.P. (2022) Protocols for marker-free gene knock-out and knockdown in Kluyveromyces marxianus using CRISPR / Cas9. FEMS Yeast Res. 22, foab067

Claims

Claims1 . A method for producing a recombinant protein, the method comprising culturing a recombinant yeast cell comprising a polynucleotide encoding a polypeptide comprising at least one heterologous secretion signal selected from secretion signal of Kluyveromyces marxianus, S. cerevisiae, mutated variant thereof, and combinations thereof.

2. The method of claim 1 , wherein the at least one secretion signal comprises a secretion signal comprising M R X3 S X5 X6 X7 X8 X9 T L L A A X13 S A L A, where X3 is Y or F, X5 is T, S, V or L, X6 is L, I, V, or A, X7 is V, F, L, A, or G, X8, is S, T, or , X9, is A, D, or E, and X15 is S or A, or has at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to an amino acid sequence selected from SEQ ID NOs: 23, 8-14, 19-22, 24-36, 55-61 , and 86-102.

3. The method of claim 1 or 2, wherein the at least one secretion signal has 100% sequence identity to an amino acid sequence selected from SEQ ID NOs: 23, 8-14, 19-22, 24-36, 55-61 , and 86-102.

4. The method of any one of claims 1-3, wherein the at least one secretion signal has 100% sequence identity to an amino acid sequence selected from SEQ ID NOs: 23, 8-1419-22, 24-36, and 86-102.

5. The method of any one of claims 1-4, wherein the polynucleotide is operably linked to a promoter and / or comprises a terminator having a nucleic acid sequence of SEQ ID NO: 76.

6. The method of claim 5, wherein the promoter is selected from GAL1 p, LAC4p, NC-1 p, TDH3p, TEF3p, BGL2p, and SPL1755p.

7. The method of claim 5, wherein the promoter comprises a nucleotide sequence selected from SEQ ID NOs: 69-75.

8. The method of any one of claims 1-7, wherein the recombinant protein is or comprises a food protein or a therapeutic protein.

9. The method of claim 8, wherein the food protein is or comprises a sweet protein or the therapeutic protein is or comprises a nanobody.

10. The method of claim 9, wherein the sweet protein is or comprises brazzein, thaumatin, monellin, mabinlin, curculin, pentadin, or miraculin.

11. The method of claim 10, wherein the sweet protein is or comprises brazzein.

12. The method of claim 11 , wherein the brazzein has an amino acid sequence of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 17, 18, 105, or 106.

13. The method of claim 11 or 12, wherein the brazzein has the amino acid sequence of 100% sequence identity to SEQ ID NO: 17, 18, 105, or 106.

14. The method of claim 12, wherein the polynucleotide comprises a nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to nucleotide sequence of SEQ ID NO: 84.

15. The method of claim 14, wherein the polynucleotide comprises a nucleotide sequence having 100% sequence identity to nucleotide sequence of SEQ ID NO: 84.

16. The method of any one of claims 1-15, wherein the polynucleotide is provided on a vector.

17. The method of claim 16, wherein the vector is a plasmid.

18. The method of any one of claims 1-17, wherein the recombinant yeast cell is selected from Saccharomyces, Pichia, Kluyveromyces and Hansenula.

19. The method of any one of claims 1-18, wherein the recombinant yeast cell is selected from Saccharomyces cerevisiae, Pichia pastoris, Hansenula polymorpha, Kluyveromyces lactis, and Kluyveromyces marxianus.

20. The method of claim 19, wherein the yeast cell is Kluyveromyces marxianus.

21. The method of any one of claims 1-20, further comprising isolating the food protein.

22. The food protein produced by the method of any one of claims 1-21 , wherein the food protein is or comprises brazzein for use as a sweetener.

23. A food protein produced by the method of any one of claims 1-21 , wherein the food protein is for use as an emulsifier, colorant, flavoring, mouthfeel improvement agent, texture improvement agent, sugar replacement, binding agent, or any combination thereof.

24. A food protein produced by the method of any one of claims 1-21 , wherein the food protein is or comprises brazzein.

25. The food protein of claim 24, wherein the brazzein is for use as a food additive, for use as an ingredient in a food or beverage product, for use in a pharmaceutical or a nutraceutical product, for use with a vitamin, for use as a natural supplement, or for use as a functional food ingredient.

26. A food product comprising the food protein produced by the method of any one of claims 1-21 , wherein the food protein is or comprises brazzein.

27. The food product of claim 26, wherein the food product is selected from the group consisting of a baked goods product, a beverage product, a candy or confectionery, a dairy product, a dietary supplement, an edible gel composition, a food product, a frozen dessert, a functional food, a health supplement, a nutraceutical, a packaged snack, a processed meat product, a seasoning or condiment, a soup or broth, and a tabletop flavoring.

28. The food product of claim 27, wherein the beverage product is selected from the group consisting of a carbonated beverage, coffee, an energy drink, a flavored water, a fountain beverage, a fruit juice, a fruit juice flavored drink, a frozen and ready-to-drink beverage, a frozen beverage, a functional beverage, a health-focused beverage, a herbal infusion, a liquid concentrate, a milkbased beverage, a non-alcoholic beer, a nutritional drink, a powdered soft drink, a ready-to-drink beverage, a soft drink, a sports drink, and tea.

29. An isolated nucleic acid comprising at least one nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to at least one of SEQ ID NOs: 1-7, 37-54, 62-68, and 84.

30. The isolated nucleic acid of claim 29, comprising at least one nucleotide sequence having 100% sequence identity to at least one of SEQ ID NOs: 1-7, 37-54, 62-68, and 84.31 . A polypeptide comprising at least one amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to any one of SEQ ID NOs: 23, 8-14, 19-22, 24-36, 55-61 , and 86-102.

32. The polypeptide of claim 31 , comprising at least one amino acid sequence having 100% identity to any one of SEQ ID NOs: 23, 8-14, 19-22, 24-36, 55- 61 , and 86-102.

33. The polypeptide of claim 31 or 32, comprising an amino acid sequence that least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 17, 18. 105, or 106.

34. The polypeptide of claim 33, comprising an amino acid sequence having 100% sequence identity to SEQ ID NO: 17, 18, 105, or 106.

35. A recombinant yeast cell comprising a polynucleotide encoding the polypeptide of any one of claims 34-37.

36. The recombinant yeast cell of claim 35, comprising a polynucleotide comprising at least one nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any one of SEQ ID NOs: 1-7, 37-54, 62-68, and 84.

37. The recombinant yeast cell of claim 36, comprising a polynucleotide comprising at least one nucleotide sequence having at 100% sequence identity to at least one of SEQ ID NOs: 1-7, 37-54, 62-68, and 84.

Images