Universal method for preparing circular RNA and use of circular RNA

Abstract

Provided are a universal method for preparing a circular RNA and a use of the circular RNA. Specifically, optimized ribozyme recognition sites are determined on the basis of a specific local secondary structure, and correspondingly, ribozyme sequences are designed, so that circular RNA precursor molecules are constructed. Also provided are a method for preparing the circular RNA on the basis of the precursor molecules and the use of the circular RNA prepared. The circular RNA has high circularization efficiency, no sequences other than a target circular RNA sequence are introduced into a circularization product, the circularization efficiency is not affected by different sequences of the circular RNA, and the method is the universal method for preparing the circular RNA. The circular RNA prepared by the method can be used in various biomedicine fields such as diagnosis, prevention, and treatment of human or animal diseases.

Description

A universal method for preparing circular RNA and its use Technical Field

[0001] The present invention relates to the fields of molecular biology and genetic engineering, and in particular to a universal method for preparing circular RNA and its application. Background Art

[0002] Circular RNA (circular RNA, also known as an circRNA) is a type of molecule that is covalently linked end-to-end and lacks 5' and 3' ends. Due to its unique circular structure, circular RNA molecules are resistant to degradation by RNases and exhibit greater stability in vivo and in vitro than linear RNA molecules. Furthermore, recent studies have demonstrated that synthetic circular mRNA can efficiently express proteins in mammals. These remarkable properties hold great promise for the application of circular RNA in fields such as biomedicine and engineering.

[0003] Research has shown that circular RNA molecules have a variety of functions and potential uses, such as serving as functional non-coding RNAs, circular mRNAs that serve as mRNA translation templates for intracellular protein translation (such as vaccines and therapeutic proteins), circular aptamers for diagnosis, treatment, and imaging, circular guide RNAs (circ-gRNAs) for DNA and RNA editing, circular RNAs that recruit ADAR editing systems, and circular RNAs for in vivo and in vitro cell therapies (such as CAR-T, CAR-NK, CAR-M cell therapy, and stem cell therapy). Circular RNA has a wide range of potential applications in fields such as biomedicine and engineering.

[0004] The preparation of circular RNA is fundamental to expanding its potential applications in various fields. The circularization method for preparing circular RNA needs to take into account the following pressing concerns: First, the circularization efficiency must be as high as possible. Second, the circularization process must ensure sequence accuracy. It is necessary to avoid introducing additional sequences during the circularization preparation process as much as possible to ensure that the sequence of the RNA molecule remains unchanged after circularization, thereby avoiding potential risks caused by sequence changes. Finally, the circularization platform must be versatile to prepare a variety of circular RNAs for various applications.

[0005] Currently, the most commonly used strategy for preparing circular RNAs is the permuted intron-exon (PIE) ribozyme autocatalytic strategy, also known as the PIE strategy. The PIE strategy offers significant advantages in the circularization of long RNA chains, which is crucial for the biomedical applications of circular RNAs. The PIE method features a simple reaction system, and its circularization efficiency primarily depends on the efficient design of the self-splicing ribozyme circular RNA precursor molecule.

[0006] Methods for preparing short-chain RNA circularization usually include chemical ligation, enzyme-catalyzed ligation and other methods. Compared with PIE, the cyclization reaction systems of these methods are more complicated. For example, additional catalytic enzymes or splint sequences need to be introduced. In addition, the sequence of the cyclized product may change, and it is easy to form intermolecular polymerization connections. The currently known PIE strategy can avoid the above-mentioned defects, but it is rarely used to prepare short-chain circular RNA. The main reasons include: the need to introduce an additional cyclization auxiliary sequence, or the need to rely on the degree of sequence matching to screen suitable splicing sites, or the need to rely on the matching of larger splicing site structural modules to screen suitable splicing sites. Therefore, it is difficult for the existing PIE method to achieve the design of a better self-splicing ribozyme circular RNA precursor molecule on a short-chain RNA sequence.

[0007] In summary, the currently known PIE method still has the defect that it cannot universally circularize various types of RNA sequences and RNA sequences of various total lengths.

[0008] Therefore, there is an urgent need in this field to develop a universal circularization method with high circularization efficiency, accurate sequence and the ability to circularize various types of RNA, so as to promote and expand the application of circular RNA in fields such as biomedicine and engineering.

[0009] Summary of the Invention

[0010] The purpose of the present invention is to provide a universal cyclization method with high cyclization efficiency and the ability to cyclize various types of RNA.

[0011] In a first aspect of the present invention, a polynucleotide for preparing circular RNA is provided, comprising, from the 5' end to the 3' end, an operably linked module Z1, a module to be circularized L, and a module Z2, wherein the polynucleotide is a linear structure;

[0012] The modules Z1 and Z2 are reconstructed into a ribozyme with self-splicing function, and self-splicing (cutting and connecting) is performed under appropriate conditions, so that the module L to be circularized forms a circular RNA, wherein the splicing site is located in the distal loop region in the stem-loop structure formed by the module L to be circularized after the circular RNA is formed.

[0013] In another preferred embodiment, the suitable conditions refer to conditions suitable for self-splicing.

[0014] In another preferred embodiment, the module Z1 and the module Z2 are reconstructed into a ribozyme with self-splicing function under appropriate conditions (or annealing conditions).

[0015] In another preferred embodiment, the stem-loop structure is a single stem-loop structure or a poly stem-loop structure.

[0016] In another preferred embodiment, the stem-loop structure is a single stem-loop structure.

[0017] In another preferred embodiment, the single stem-loop structure comprises a stem region (also called an "arm region") and a terminal loop region located at the distal end of the stem region.

[0018] In another preferred embodiment, in the single stem-loop structure, the stem region may or may not have one or more internal loop regions.

[0019] In another preferred embodiment, in the single stem-loop structure, the stem region may or may not have one or more bulge regions.

[0020] In another preferred embodiment, the stem-loop structure is a poly stem-loop structure.

[0021] In another preferred embodiment, the poly stem-loop structure has 2-5, preferably 2-4, more preferably 3-4 terminal loop regions.

[0022] In another preferred embodiment, the poly stem-loop structure has a stem region (also called an "arm region") and a terminal loop region located at the distal end of the stem region.

[0023] In another preferred embodiment, in the multi-stem-loop structure, the number of stem regions and terminal loop regions is the same or substantially the same.

[0024] In another preferred embodiment, in the multi-stem-loop structure, each of the stem regions independently has or does not have one or more internal loop regions.

[0025] In another preferred embodiment, in the multi-stem-loop structure, each of the stem regions independently has or does not have one or more bulge regions.

[0026] In another preferred embodiment, the splicing site is a splicing site for circularization.

[0027] In another preferred embodiment, the terminal loop region comprises 2-15 nucleotides, preferably 2-10, more preferably 3-8 nucleotides.

[0028] In another preferred embodiment, the length Y of the stem region is not less than 2 nt, preferably 4≤Y≤100 nt, and more preferably 10≤Y≤100 nt.

[0029] In another preferred embodiment, the module Z1 and / or module Z2 are directly connected to the splicing site.

[0030] In another preferred embodiment, the module Z1 contains the 3' end segment h1 of the ribozyme, and the module Z2 contains the 5' end segment h2 of the ribozyme; or the module Z1 contains the 5' end segment h2 of the ribozyme, and the module Z2 contains the 3' end segment h1 of the ribozyme.

[0031] In another preferred embodiment, the module L to be cyclized is a linear counterpart corresponding to the target sequence.

[0032] In another preferred embodiment, the target sequence is a circularized circular RNA.

[0033] In another preferred embodiment, the polynucleotide comprises RNA, DNA, or RNA / DNA hybrid form.

[0034] In another preferred embodiment, the polynucleotide is RNA.

[0035] In another preferred embodiment, the polynucleotide is single-stranded.

[0036] In another preferred embodiment, the polynucleotide is L-RNA composed of L-ribonucleotides.

[0037] In another preferred embodiment, the polynucleotide has a structure as shown in Formula I: Z1-L-Z2 (Formula I)

[0038] Z1 contains the 3′-terminal section h1 of the ribozyme;

[0039] L is the linear counterpart of the target sequence;

[0040] Z2 contains the 5' end section h2 of the ribozyme.

[0041] In another preferred embodiment, the Z1 further comprises a 3' end segment h1 of the ribozyme and a random sequence r1, and the Z2 further comprises a 5' end segment h2 of the ribozyme and a random sequence r2. The structural formula of the polynucleotide is as shown in Formula II: r1-h1-L-h2-r2 (Formula II)

[0042] Where r1 and r2 are reverse complementary sequences.

[0043] In another preferred embodiment, the number of reverse complementary base pairs is ≥4, preferably ≥5.

[0044] In another preferred embodiment, the number of reverse complementary base pairs is ≤100 nt, preferably ≤50 nt, and more preferably ≤30 nt.

[0045] In another preferred embodiment, r1 and r2 are completely complementary or substantially complementary (eg, homology ≥ 80%, preferably ≥ 90% or ≥ 95%, or 100%).

[0046] In another preferred embodiment, the 3' end of the module L comprises a ribozyme recognition site i, and the ribozyme recognition site i is the first n nucleotides of the 3' end of the module L, where n≥1, preferably 1≤n≤7;

[0047] The 5' end of L comprises a ribozyme recognition site ii, and the ribozyme recognition site ii is the first m nucleotides of the 5' end of L, where m≥1, preferably 1≤m≤7.

[0048] In another preferred embodiment, the polynucleotide can undergo a self-catalytic splicing reaction to generate a circular RNA molecule.

[0049] In another preferred embodiment, the ribozyme is an autocatalytic splicing ribozyme, and the ribozyme can recognize a specific site in module L.

[0050] In another preferred embodiment, the ribozyme can recognize a specific secondary structure in L (ie, a specific splicing site and the secondary structure to be spliced ​​formed by its surrounding sequences).

[0051] In another preferred embodiment, the ribozyme is a group I intron (or type I intron).

[0052] In another preferred embodiment, the ribozyme is selected from the following group: Anabaena pre-tRNA-Leu gene intron, T4 phage Td gene intron, Tetrahymena intron, etc.

[0053] In another preferred embodiment, the ribozyme is an intron of the pre-tRNA-Leu gene of Anabaena.

[0054] In another preferred embodiment, the ribozyme is an intron of the Td gene of T4 bacteriophage.

[0055] In another preferred embodiment, the ribozyme is a Tetrahymena intron.

[0056] In another preferred embodiment, the ribozyme is a ribozyme in which the key region is mutated. In another preferred embodiment, the ribozyme is a ribozyme in which the internal guide sequence (IGS) is mutated.

[0057] In another preferred embodiment, the ribozyme is a ribozyme modified from the IGS intron of the pre-tRNA-Leu gene of Anabaena.

[0058] In another preferred example, the ribozyme is modified to mutate the IGS of the intron of the Anabaena pre-tRNA-Leu gene, so that the mutated IGS can form n base complementary pairing with the ribozyme recognition site on the target sequence, n≥1, preferably, 1≤n≤7.

[0059] In another preferred embodiment, the ribozyme is a modified ribozyme formed by partially or completely mutating the 10th to 16th positions of the 5' end of the intron of the Anabaena pre-tRNA-Leu gene. Among them, the mutation rule is: the base at the 10th position of the 5' end of the intron mutates to the complementary base of the 2nd base at the 3' end of the cyclized sequence, the base at the 11th position mutates to the complementary base of the 3rd base at the 3' end of the cyclized sequence, the base at the 12th position mutates to the complementary base of the 4th base at the 3' end of the cyclized sequence, the base at the 13th position mutates to the complementary base of the 5th base at the 3' end of the cyclized sequence, the base at the 14th position mutates to the complementary base of the 6th base at the 3' end of the cyclized sequence, the base at the 15th position mutates to the complementary base of the 7th base at the 3' end of the cyclized sequence, and the base at the 16th position mutates to the complementary base of the 8th base at the 3' end of the cyclized sequence.

[0060] In another preferred embodiment, the ribozyme modification is to mutate the 10th and 11th positions of the 5' end of the intron of the Anabaena pre-tRNA-Leu gene.

[0061] In another preferred embodiment, the ribozyme modification is to mutate the 10th, 11th and 12th positions of the 5' end of the intron of the Anabaena pre-tRNA-Leu gene.

[0062] In another preferred embodiment, the ribozyme modification is to mutate the 10th, 11th, 12th and 13th positions of the 5' end of the intron of the Anabaena pre-tRNA-Leu gene.

[0063] In another preferred embodiment, the ribozyme modification is to mutate the 10th, 11th, 12th, 13th and 14th positions of the 5' end of the intron of the Anabaena pre-tRNA-Leu gene.

[0064] In another preferred embodiment, the module L includes:

[0065] (L1) segment i of the noncoding region;

[0066] (L2) mRNA coding region; and

[0067] (L3) segment ii of the noncoding region;

[0068] Among them, L1 and L3 are formed by cutting a non-coding region at a specific site.

[0069] In another preferred embodiment, the module L includes:

[0070] (L1a) fragment i of a single stem-loop structural element;

[0071] (L2a) a sequence other than the single stem-loop structure; and

[0072] (L3a) fragment ii of a single stem-loop structural element;

[0073] Among them, L1a and L3a are formed by a single stem-loop structural element cut at a specific site.

[0074] In another preferred embodiment, the module L is mRNA. In another preferred embodiment, the single stem-loop structure is located in the coding region or non-coding region of the mRNA.

[0075] In another preferred embodiment, the single stem-loop structure is located in the non-coding region of the mRNA.

[0076] In another preferred embodiment, the single stem-loop structure is located in the translation initiation element of the mRNA.

[0077] In another preferred embodiment, the translation initiation elements include but are not limited to: internal ribosome entry sites (IRES), Kozak sequences, methylation modification sites, cap-independent translation enhancers (CITE), 5' untranslated region (5'-UTR), 3' untranslated region (3'-UTR), and other elements that can regulate mRNA translation activity.

[0078] In another preferred embodiment, the translation initiation element is IRES.

[0079] In another preferred embodiment, the single stem-loop structure is located in the regulatory element of the mRNA.

[0080] In another preferred embodiment, the mRNA regulatory element is an element that can regulate the behavior of circular mRNA molecules in cells, and the mRNA regulatory element includes but is not limited to: an aptamer sequence element for binding to an aptamer substrate, a binding element for binding to microRNA (microRNA or miRNA), and an element for interacting with other RNA molecules to change the secondary structure or spatial conformation of the circular mRNA.

[0081] In another preferred embodiment, the mRNA coding sequence contained in the L2 module is used to encode a target protein.

[0082] In another preferred embodiment, the mRNA coding sequence contained in the L2 module is used to encode n (n≥2) target proteins.

[0083] In another preferred embodiment, the n target proteins are the same protein or different proteins.

[0084] In another preferred embodiment, a spacer sequence is inserted between the mRNA coding sequences of the n target proteins, wherein the product encoded by the spacer sequence can be degraded under specific conditions, thereby separating the multiple proteins.

[0085] In another preferred embodiment, the spacer sequence is an RNA sequence encoding a 2A peptide.

[0086] In another preferred embodiment, the single stem-loop structure is an SL structure (Stem Loop structure).

[0087] In another preferred embodiment, the non-coding region or the coding region can form a SL structure.

[0088] In another preferred embodiment, the multi-stem-loop structure is a TLSL structure (TLS-like structure).

[0089] In another preferred embodiment, the non-coding region or the coding region can form a specific secondary structure.

[0090] In another preferred embodiment, the secondary structure comprises a TLSL structure (TLS-like structure) module.

[0091] In another preferred embodiment, the module L is determined by the following method:

[0092] (1) The 5' and 3' ends of the linear target sequence to be circularized are directly connected to form a target circular sequence.

[0093] (2) Determine the splicing site (SS) based on the local secondary structure of the target sequence. The polynucleotide sequences on both sides of the splicing site are ribozyme recognition sites.

[0094] (3) Cutting the target circular sequence at the selected splicing site SS to form the module L.

[0095] In another preferred embodiment, the splicing site is located in the SL structure.

[0096] In another preferred embodiment, the SL is composed of an arm connection and a distal loop.

[0097] In another preferred embodiment, the arm may include a bulge and / or an internal loop.

[0098] In another preferred embodiment, the splicing site is located on the distal loop of the SL structure.

[0099] In another preferred embodiment, the splice site is located between the nucleotide U (or T) and the adjacent nucleotide on the distal loop, and the nucleotide U (or T) is located at the 3' end of the module L formed after cleavage at the splice site.

[0100] In another preferred embodiment, for the terminal loop region in the stem-loop structure, the size of the terminal loop is ≥4 nt, preferably 4-25 nt, more preferably 4-20 nt, and most preferably 5-15 nt.

[0101] In another preferred embodiment, the splicing site is located in the SL structure of the translation initiation element.

[0102] In another preferred embodiment, the translation initiation element is a cap-independent translation initiation element.

[0103] In another preferred embodiment, the translation initiation element is an internal ribosome entry site (IRES).

[0104] In another preferred embodiment, the splicing site is located in the SL structure of the mRNA coding region.

[0105] In another preferred embodiment, the splicing site is located in the SL structure of the 5'-UTR region of the mRNA.

[0106] In another preferred embodiment, the splicing site is located in the SL structure of the mRNA 3'-UTR region.

[0107] In another preferred embodiment, the coding region encodes a protein product (polypeptide, protein or fragment thereof) or a non-protein product (such as miRNA precursor, ncRNA, etc.).

[0108] In another preferred embodiment, the module L is non-coding RNA (ncRNA).

[0109] In another preferred embodiment, the splicing site is located in the SL structure of non-coding RNA (ncRNA).

[0110] In another preferred embodiment, the splicing site is located in the TLSL structure.

[0111] In another preferred embodiment, the TLSL is composed of a multi-arm junction and multiple distal loops, wherein one arm of the multi-arm junction is the terminal arm, the terminal arm is not connected to the distal loop, and the remaining arms are each closedly connected to a distal loop, forming a multi-distal loop continuous structure with exposed 5' and 3' ends only on the distal arm.

[0112] In another preferred embodiment, the arms of the multi-arm connection may include a bulge and an internal loop, and the connection of the multi-arm connection may include a multiloop.

[0113] In another preferred embodiment, the TLSL structure is a TLSL structure containing 2-5 distal loops.

[0114] In another preferred embodiment, the splicing site is located on any distal loop of the TLSL structure.

[0115] In another preferred embodiment, the splice site is located between the nucleotide U (or T) and the adjacent nucleotide on any distal loop of the TLSL structure, and the nucleotide U (or T) is located at the 3' end of the module L formed after cleavage at the splice site.

[0116] In another preferred embodiment, the size of the distal loop is ≥4 nt.

[0117] In another preferred embodiment, the splice site is located in the TLSL structure of the translation initiation element.

[0118] In another preferred embodiment, the translation initiation element is a cap-independent translation initiation element.

[0119] In another preferred embodiment, the translation initiation element is an internal ribosome entry site (IRES).

[0120] In another preferred embodiment, the splicing site is located in the TLSL structure of the mRNA coding region.

[0121] In another preferred embodiment, the splicing site is located in the TLSL structure of the 5'-UTR region of the mRNA.

[0122] In another preferred embodiment, the splicing site is located in the TLSL structure of the mRNA 3'-UTR region.

[0123] In another preferred embodiment, the splicing site is located in the TLSL structure of non-coding RNA (ncRNA).

[0124] In another preferred embodiment, the method for determining the splice site is as follows:

[0125] ① Obtain the secondary structure of the target circular RNA;

[0126] ② Determine the SL structure or TLSL structure based on the secondary structure information;

[0127] ③ Select the splice site SS on the SL structure or TLSL structure;

[0128] The SL structure or TLSL structure has ribozyme recognition activity.

[0129] In another preferred embodiment, the method for obtaining the secondary structure of the target circular RNA includes prediction using a computer algorithm and determination through experiments.

[0130] In another preferred embodiment, the computer algorithm prediction method includes RNAfold, Linearfold, etc.

[0131] In the second aspect of the present invention, a vector is provided, comprising the polynucleotide according to the first aspect of the present invention.

[0132] In another preferred embodiment, the vector contains a nucleic acid sequence (such as a DNA sequence) for producing the polynucleotide as described in the first aspect of the present invention.

[0133] In another preferred embodiment, the vector is a plasmid.

[0134] In another preferred embodiment, the vector is a virus-like particle.

[0135] In another preferred embodiment, the vector is a non-virus-like particle.

[0136] In another preferred embodiment, the vector is a viral vector.

[0137] In another preferred embodiment, the vector is a non-viral vector.

[0138] In a third aspect of the present invention, a method for preparing circular RNA is provided, comprising the steps of:

[0139] (1) determining the splice site based on the local secondary structure of the target sequence, and obtaining the module L in the polynucleotide according to the first aspect of the present invention, i.e., the linear counterpart of the target sequence;

[0140] (2) ligating the 3' end section of the ribozyme, the linear counterpart of the target sequence, and the 5' end section of the ribozyme by an appropriate method to obtain a circular RNA precursor molecule;

[0141] (3) The circular RNA precursor molecule obtained in step (2) undergoes self-splicing reaction under appropriate conditions to produce the target circular RNA.

[0142] In another preferred embodiment, the reaction condition is that the reaction system contains GTP and magnesium ions.

[0143] In another preferred embodiment, the reaction system contains 0.01 mM-10 mM GTP.

[0144] In another preferred embodiment, the reaction system contains 1 mM-100 mM magnesium ions.

[0145] In another preferred embodiment, the pH value of the reaction system is 5-8.

[0146] In another preferred embodiment, the temperature of the reaction system is 25-65°C.

[0147] In another preferred embodiment, the reaction is carried out in vitro for 5 min to 60 min.

[0148] In another preferred embodiment, the reaction conditions are 2±1 mM GTP and a buffer containing magnesium ions (such as 50 mM TrisHCl, 10 mM MgCl2, 1 mM DTT, pH 7.5) at 55±3°C for 15±5 minutes.

[0149] In a fourth aspect of the present invention, a circular RNA is provided, which is formed by self-splicing of the polynucleotide described in the first aspect of the present invention.

[0150] In another preferred embodiment, the circular RNA is prepared using the method described in the third aspect of the present invention.

[0151] In another preferred embodiment, the circular RNA is selected from the following group: circular guide RNA, circular RNA molecular sponge, circular interfering RNA, circular RNA aptamer, circular RNA probe, circular RNA molecular sensor, circular RNA molecular diagnosis, functional non-coding circular RNA, or a combination thereof.

[0152] In another preferred embodiment, the polynucleotide for preparing circular RNA or the circular RNA of the present invention contains one or more modified nucleotides.

[0153] In another preferred embodiment, the ways in which the nucleotides in the RNA molecule are modified include but are not limited to: N6-methyladenosine (m6A), pseudouridine (ψ), N1-methylpseudouridine (m1ψ) and 5-methoxyuridine (5moU).

[0154] In another preferred embodiment, the nucleotides in the RNA molecule are modified in a manner selected from one or more of N6-methyladenosine (m6A), pseudouridine (ψ), N1-methylpseudouridine (m1ψ) and 5-methoxyuridine (5moU).

[0155] In another preferred embodiment, the circular RNA molecule can express a polypeptide or protein in a cell.

[0156] In another preferred embodiment, the cell is in vivo.

[0157] In another preferred embodiment, the cells are mammalian cells.

[0158] In another preferred embodiment, the mammalian cells are derived from humans.

[0159] In another preferred embodiment, the production of the polypeptide or protein is tissue-specific.

[0160] In another preferred embodiment, the tissue-specific localization is in a tissue selected from the group consisting of muscle, heart, spleen, liver, kidney, brain, lung, skin, pancreas, blood and lymph node.

[0161] In another preferred embodiment, the cells are in vitro.

[0162] In another preferred embodiment, the polypeptide or protein is a therapeutic polypeptide or protein. In another preferred embodiment, the polypeptide or protein is a disease-preventive polypeptide or protein.

[0163] In the fifth aspect of the present invention, an engineered host cell is provided, which contains the circular RNA described in the fourth aspect of the present invention, or contains the vector described in the second aspect of the present invention, or has integrated into its genome a coding sequence for producing the polynucleotide described in the first aspect of the present invention.

[0164] In the sixth aspect of the present invention, a pharmaceutical composition is provided, which contains (a) the polynucleotide for preparing circular RNA according to the first aspect of the present invention, the circular RNA according to the fourth aspect of the present invention, or a combination thereof; and (b) a pharmaceutically acceptable carrier thereof.

[0165] In another preferred embodiment, the pharmaceutical composition includes a vaccine composition.

[0166] In another preferred embodiment, the pharmaceutical composition further contains other additional drugs.

[0167] In another preferred embodiment, the other drugs include but are not limited to one or more selected from the following groups: additional circular RNA, mRNA vaccines, mRNA drugs, vaccine adjuvants, siRNA, small molecule drugs, polypeptide drugs, protein drugs, antibody drugs, cell therapy drugs, gene editing drugs, gene therapy drugs, and microbial therapy.

[0168] In another preferred embodiment, the pharmaceutical composition contains: lipid nanoparticles, liposomes, exosomes, cationic liposomes, targeted lipid nanoparticles, micelles, polymer materials, nano-drug delivery systems, mesoporous materials, adeno-associated viruses, Sendai viruses, protamine carrier systems, and living cell carriers.

[0169] In another preferred embodiment, the pharmaceutically acceptable carrier is a modified lipid nanoparticle.

[0170] In another preferred embodiment, the modified lipid nanoparticles have a targeted delivery function.

[0171] In another preferred embodiment, the pharmaceutical composition is a liquid preparation, a solid preparation, or a gel preparation.

[0172] In another preferred embodiment, the pharmaceutical composition is administered by a method selected from the group consisting of gene gun injection, intravenous injection, intratumoral injection, intramuscular injection, myelin sheath injection, intradermal injection, subcutaneous injection, intranodular injection, nasal inhalation, mucosal infiltration, and microneedle.

[0173] In a seventh aspect of the present invention, a method for producing a polypeptide or protein in a cell is provided, the method comprising: contacting the cell with: (i) the circular RNA according to the fourth aspect of the present invention, (ii) the vector according to the second aspect of the present invention, under conditions where the polypeptide or protein encoding nucleic acid sequence of the circular RNA is translated and the polypeptide or protein is produced in the cell;

[0174] Alternatively, the method comprises: culturing the engineered host cell according to the fifth aspect of the present invention under conditions suitable for expression, thereby producing the polypeptide or protein.

[0175] In another preferred embodiment, the cell is in vivo.

[0176] In another preferred embodiment, the cells are mammalian cells.

[0177] In another preferred embodiment, the mammalian cells are derived from humans.

[0178] In another preferred embodiment, the production of the polypeptide or protein is tissue-specific.

[0179] In another preferred embodiment, the tissue-specific localization is in a tissue selected from the group consisting of muscle, heart, spleen, liver, kidney, brain, lung, skin, pancreas, blood and lymph node.

[0180] In another preferred embodiment, the cells are in vitro.

[0181] In another preferred embodiment, the polypeptide or protein is a therapeutic polypeptide or protein.

[0182] In another preferred embodiment, the polypeptide or protein is a disease-preventive polypeptide or protein.

[0183] In the eighth aspect of the present invention, provided is the use of the circular RNA as described in the fourth aspect of the present invention, or the vector as described in the second aspect of the present invention, or the engineered host cell as described in the fifth aspect of the present invention, or the pharmaceutical composition as described in the sixth aspect of the present invention, or the method for producing a polypeptide or protein in a cell as described in the seventh aspect of the present invention, for preparing a pharmaceutical composition or a cosmetic composition.

[0184] In another preferred embodiment, the pharmaceutical composition is used for a purpose selected from the group consisting of anti-aging, medical cosmetology, health care, and prevention, diagnosis, and treatment of human or animal diseases.

[0185] In another preferred embodiment, the circular RNA is a circular mRNA, and the circular mRNA encodes various types of proteins, including but not limited to functional proteins, preventive vaccines, therapeutic vaccines, monoclonal antibodies, bispecific antibodies, multispecific antibodies, intracellular antibodies, chimeric antigens, fusion proteins, and cytokines.

[0186] In another preferred embodiment, the circular mRNA is used to prepare mRNA cell therapy drugs in vitro, and the mRNA cell therapy drugs include but are not limited to: chimeric antigen receptor T cell immunotherapy (CAR-T), chimeric antigen receptor NK cell immunotherapy (CAR-NK), tumor infiltrating lymphocyte therapy (TIL), chimeric antigen receptor macrophage immunotherapy (CAR-M), induced pluripotent stem cell therapy (iPS), embryonic stem cell therapy (ESC), adult stem cell therapy (ASC), mesenchymal stem cell therapy (MSC), and hematopoietic stem cell therapy (HSC).

[0187] In another preferred embodiment, the circular mRNA is used to generate mRNA cell therapy drugs in vivo, wherein the circular mRNA is transported to specific cell types in the body through appropriate delivery vectors, and expresses proteins required for cell therapy in the cells, thereby converting the cell types into cell drugs with therapeutic functions, and the cell drugs include but are not limited to chimeric antigen receptor T cell immunotherapy (CAR-T), chimeric antigen receptor NK cell immunotherapy (CAR-NK), tumor infiltrating lymphocyte therapy (TIL), chimeric antigen receptor macrophage immunotherapy (CAR-M), induced pluripotent stem cell therapy (iPS), embryonic stem cell therapy (ESC), adult stem cell therapy (ASC), mesenchymal stem cell therapy (MSC), and hematopoietic stem cell therapy (HSC).

[0188] It should be understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features described in detail below (such as in the embodiments) can be combined with each other to form new or preferred technical solutions. Due to space limitations, they will not be listed here one by one. BRIEF DESCRIPTION OF THE DRAWINGS

[0189] Figure 1 shows the design principles of a classic PIE circularization construct.

[0190] Figure 2 shows the brief design principle of Hi-scarless-PIE.

[0191] Figure 3 shows the basic secondary structural elements that make up the TLS-like structure (TLSL).

[0192] Figure 4 shows a schematic diagram of the secondary structure of a typical TLS-like structure (TLSL).

[0193] Figure 5 shows the process and results of identifying TLSL structural elements, modifying the Ana-PIE intron ribozyme, and forming the "ribozyme-TLSL structural module" to form the Hi-Scarless-PIE circular RNA construct. Figure 5A shows the TLSL structural elements, with arrows indicating the locations of splice sites; Figure 5B shows the capillary electrophoresis detection results of the self-splicing reaction of the native Ana-PIE intron and the modified Ana-PIE intron.

[0194] Figure 6 shows the effect of different self-splicing ribozyme recognition sites on circularization efficiency. Figure 6A shows the location of the first splice site; Figure 6B shows the location of the second splice site; and Figure 6C shows the capillary electrophoresis detection results.

[0195] Figure 7 shows the identification of the product of the present invention as the target circular RNA molecule. Figure 7A shows the agarose gel electrophoresis analysis of the product; Figure 7B shows the agarose gel electrophoresis analysis of the product after RNase H treatment; Figure 7C shows the sequencing results of the splice site.

[0196] Figure 8 shows the effects of different ribozyme mutations on the circularization efficiency of Hi-Scarless-PIE. Figure 8A shows the secondary structure of a native Anabaena intron, along with the default nucleotide numbering and the regions of the ribozyme modification. Figure 8B shows agarose gel electrophoresis analysis of circular RNA synthesized by the various modified ribozymes.

[0197] FIG9 shows the experimental results of construct design based on the PV3 IRES-derived TLSL structure and validation of the circularization results.

[0198] FIG10 shows the experimental results of construct design based on TLSL structures derived from HRV-B3 IRES and EV-B107 IRES and verification of circularization results.

[0199] FIG11 shows the experimental results of construct design based on the SimianV4 IRES-derived TLSL structure and validation of the circularization results.

[0200] FIG12 shows the experimental results of construct design based on the BEV1 IRES-derived TLSL structure and validation of the circularization results.

[0201] Figure 13 shows the cyclization results of different "ribozyme-TLSL cyclization modules." Figure 13A shows the detection profile of capillary electrophoresis; Figure 13B shows the peak profile of the crude RNA product.

[0202] Figure 14 shows the cyclization effect of EMCV after the insertion of TLSL. Figure 14A shows the secondary structures of TLSL, EMCV IRES, and EMCV + TLSL; Figure 14B shows the agarose gel electrophoresis results of the products; Figure 14C shows the protein expression results.

[0203] Figure 15 shows the cyclization effect of CrPV after TLSL insertion. Figure 15A shows the secondary structures of TLSL, CrPV IRES, and CrPV+TLSL; Figure 15B shows the agarose gel electrophoresis results of the products; Figure 15C shows the protein expression results.

[0204] Figure 16 shows the results of an analysis of the distribution of TLSL structural elements in various RNA molecules. Figure 16A shows a typical trefoil TLSL structural element; Figure 16B shows the universal Hi-scarless-PIE cyclization platform; Figures 16C-G show some representative trefoil TLSL structural elements from IRES, human 5'-UTR, human 3'-UTR, human CDS, and non-coding RNA sequence sets, respectively.

[0205] Figure 17 shows the expression of immunogenic cytokines induced by circ-GLuc-mRNA prepared using the classic PIE and Hi-Scarless-PIE methods in A549 cells.

[0206] FIG18 shows the detection results of protein expression levels of circular GLuc mRNA with different IRES sequences in HEK-293T and A549 cells.

[0207] FIG19 shows the protein expression of cyclic hEPO and cyclic EGFP mRNA produced using the Hi-Scarless-PIE method.

[0208] FIG20 shows the temporal trends of protein expression levels in HEK-293T and A549 cells using traditional capped and tailed linear mRNA, the classic PIE system, and the Hi-Scarless-PIE system of the present disclosure.

[0209] FIG21 shows the preparation and characterization of circular FLuc-mRNA prepared using the classical PIE method and the Hi-Scarless-PIE method for LNP lipid nanoparticle encapsulation.

[0210] FIG22 shows the protein expression in mice of cyclic FLuc-mRNA-LNP lipid nanoparticles prepared using the classical PIE method and the Hi-Scarless-PIE method, respectively.

[0211] FIG23 shows a brief design principle of the Uni-cRNA of the present invention.

[0212] Figure 24 shows a schematic diagram of splice site selection within the IRES region during Uni-cRNA construct design. In Figure 24B, the blue portion represents the terminal loop, the green portion represents the complementary base pairing within the stem region, the yellow portion represents the convex or internal loop within the stem region, and the arrow indicates the splice site.

[0213] Figure 25 shows that the splice sites selected during the Uni-cRNA construct design process are located on the terminal loop of the CDS region. The arrows point to the splice sites.

[0214] Figure 26 shows the splice sites selected after sequence optimization of the CDS region. The arrows point to the splice sites.

[0215] Figure 27 shows the splice sites selected on the inner loop of the IRES region during the Uni-cRNA construct design process. The arrows point to the splice sites.

[0216] FIG28 shows the results of capillary electrophoresis detection of the circularization efficiency of circular RNA prepared by Uni-cRNA.

[0217] FIG29 shows the identification of circular RNA products produced by Uni-cRNA.

[0218] FIG30 shows the detection results of proteins expressed by circular mRNA prepared by Uni-cRNA.

[0219] Figure 31 shows the distribution of single stem-loop structures in the "ribozyme-SL cyclization module" in various RNA sequences. DETAILED DESCRIPTION

[0220] After extensive and in-depth research, through a large number of screenings, the inventors have developed the cyclization technology based on the secondary structure of circular RNA for the first time, including the precursor polynucleotides for building circular RNA, and provide the method for preparing circular RNA based on the precursor polynucleotides and the purposes of the circular RNA prepared thereof. Specifically, the inventors determine the optimized ribozyme recognition site based on specific local secondary structure (i.e., stem-loop structure), and combine wild-type or improved RNA ribozymes, thereby constructing the circular RNA precursor polynucleotides of module Z1, module L to be cyclized, and module Z2 comprising operability connection. The circular RNA precursor polynucleotides of the present invention, under annealing conditions, the module Z1 and module Z2 are reconstructed into the ribozyme with self-splicing function, thereby the module L to be cyclized is spliced ​​(cut and connected), and the module L to be cyclized is formed into circular RNA. The inventors unexpectedly found that the cyclization technology based on single stem-loop structure and multi-stem-loop structure of the present invention has excellent cyclization efficiency, and cyclization efficiency is not affected by the different sequences of cyclized RNA, and is a general method for cyclizing RNA. Furthermore, the circular RNA product of the present invention does not require any additional sequences to be introduced, which is a true scarless circularization without the introduction of additional nucleotides. The present invention was completed on this basis.

[0221] RNA cyclization strategy of the present invention

[0222] RNA circularization can be achieved by utilizing the self-splicing properties of Group I intron ribozymes or Group II intron ribozymes. In bacteria and non-metazoan eukaryotes, certain introns located in rRNA, tRNA, and mRNA have autocatalytic activity, which can cut out the intron in the "5'-exon-intron ribozyme-exon-3'" arrangement through back-splicing, and at the same time, the two exons are directly connected (Past, present, and future of circRNAs. Patop IL, Wüst S, Kadener S. EMBO J. 2019 Aug 15; 38(16): e100836.). Based on the above principle, the permuted intron exon (PIE) system was proposed as early as 1992. The PIE system divides the intron ribozyme into two fragments, the 5' end and the 3' end, and then places the 3' end intron fragment upstream of the exon 5' and the 5' end intron fragment downstream of the exon 3', forming a "5'-intron ribozyme 3' fragment-exon-intron ribozyme 5' fragment-3'" arrangement (Group I permuted intron-exon (PIE) sequences self-splice to produce circular exons. M Puttaraju, MD Been. Nucleic Acids Res. 1992 Oct 25; 20(20): 5357-64.). At this time, the two reverse splicing sites of the ribozyme are located at the two ends of the exon (3'SS and 5'SS), so the self-catalyzed reverse splicing reaction will produce a circularized exon. When the sequence between the two splice sites is replaced with the target gene, circularization of the target gene can be achieved. The design principle of the classic PIE circularization construct is shown in Figure 1.

[0223] In the present invention, an improved high-efficiency and high-precision PIE cyclization system (High-efficient and Scarless PIE, hereinafter referred to as Hi-scarless-PIE) based on a multi-stem-loop secondary structure is provided. Based on the secondary structural characteristics of the target sequence, a suitable splicing site is selected, and the I group intron ribozyme is correspondingly transformed to construct a circular RNA precursor molecule. The molecule performs autocatalytic splicing under suitable conditions, and the circular RNA formed does not contain any sequence other than the target sequence (for example, exon sequence or spacer sequence from ribozyme), ensuring that the sequence remains unchanged during the RNA cyclization process. Experiments have shown that the efficiency of the system cyclization RNA is high, and the cyclization effect is not affected by the target sequence and can be used for the cyclization of any RNA. Figure 2 shows the brief design principle of Hi-scarless-PIE.

[0224] In the present invention, a universal, high-efficiency, high-fidelity RNA circularization platform (Universal & High-efficient & High-fidelity RNA Circularization Platform, i.e. Uni-cRNA) is also provided. Uni-cRNA is based on the single stem-loop secondary structure characteristics of the target sequence, selects a suitable splicing site, and I group intron ribozymes are correspondingly transformed to construct a circular RNA precursor molecule, which carries out autocatalytic splicing under suitable conditions. The circular RNA formed does not contain any sequence other than the target sequence (for example, exon sequence or spacer sequence from ribozyme), ensuring high sequence fidelity (i.e., the sequence of the circular RNA product is completely consistent with the target sequence) during RNA circularization. Experiments have demonstrated from multiple angles that this system can prepare target circular RNA, and circularization efficiency is high, and circularization efficiency is not affected by the target sequence, and any RNA can be circularized. Fig. 2 shows the brief design principle of Uni-cRNA.

[0225] Circular RNA precursor molecules of the present invention

[0226] Based on the above-mentioned Hi-scarless-PIE or Uni-cRNA strategy, the circular RNA precursor molecule of the present invention is designed, which comprises a module Z1, a module L, and a module Z2 that are operably connected from the 5' end to the 3' end, as shown in Formula I: Z1-L-Z2 (Formula I)

[0227] Z1 contains the 3′-terminal section h1 of the ribozyme;

[0228] L is the linear counterpart of the target sequence;

[0229] Z2 contains the 5' end section h2 of the ribozyme.

[0230] The circular RNA precursor molecule can undergo an autocatalytic splicing reaction to generate the circular RNA molecule of the present invention.

[0231] In some embodiments, the Z1 further comprises a 3' end segment h1 of a ribozyme and a random sequence r1, and the Z2 further comprises a 5' end segment h2 of a ribozyme and a random sequence r2. The structural formula of the polynucleotide is as shown in Formula II: r1-h1-L-h2-r2 (Formula II)

[0232] Where r1 and r2 are reverse complementary sequences.

[0233] In the present invention, the module L is determined by the following method:

[0234] (1) First, the 5' and 3' ends of the linear target sequence to be circularized are directly connected to form the target circular RNA sequence.

[0235] (2) Secondly, determine the splicing site (SS) of the target circular sequence. The splicing site is located on the terminal loop of the SL structural element or the TLSL structural element. The polynucleotide sequences on both sides of the splicing site are ribozyme recognition sites.

[0236] (3) The target circular sequence is cut at the selected splicing site SS to form module L.

[0237] TLSL structural elements

[0238] In the Hi-scarless-PIE circularization strategy of the present invention, the splice site is located at the TLSL structural element of the target sequence.

[0239] The TLSL structure of the present invention is shown in Figures 3 and 4 and consists of a multi-arm junction connected to multiple distal loops. One arm of the multi-arm junction is the distal arm, which is not connected to the distal loop. The remaining arms are each closed to a distal loop, forming a continuous multi-distal loop structure with exposed 5' and 3' ends only on the distal arms. The arms of the multi-arm junction may include a bulge and an internal loop, and the junction of the multi-arm junction may include multiple loops.

[0240] In one embodiment, the TLSL structure is a TLSL structure containing 2-5 end rings.

[0241] In one embodiment, the splice site is located at any one of the terminal loops of the TLSL structure.

[0242] In one embodiment, the size of the terminal loop is ≥ 4 nt.

[0243] In some embodiments, the TLSL structural module is located at the translation initiation element site, and TLSL may be naturally present at the translation initiation element site or artificially inserted into the translation initiation element site. The translation initiation element is a cap-independent translation initiation element, including but not limited to: an internal ribosome entry site (IRES), a Kozak sequence, a translation initiation element containing a methylation modification site, a cap-independent translation enhancer (CITE), a 5' untranslated region (5'untranslated region, 5'-UTR), a 3' untranslated region (3'untranslated region, 3'-UTR), other elements with cap-independent translation initiation activity, and other elements with cap-independent translation initiation activity newly discovered in the future. Among them, mammalian mRNA genes containing CITE include but are not limited to: human Fibroblast growth factor 9 (FGF-9).

[0244] In some embodiments, the cap-independent translation initiation element is an internal ribosome entry site (IRES). The IRES sequence typically contains a sequence that folds into a structure similar to that of the initiator tRNA. This structural element is a typical TLSL structure that mediates ribosomal RNA binding, thereby enhancing the initiation of protein translation. A large number of IRES sequences have a conserved TLSL structural module that can be recognized by the ribozymes of the present invention.

[0245] In some embodiments, the IRES sequence is a non-natural sequence. In some embodiments, the IRES sequence is an IRES sequence artificially inserted with a TLSL module.

[0246] SL structural elements

[0247] In the Uni-cRNA circularization strategy of the present invention, the splice site is located at the SL structural element of the target sequence.

[0248] As used herein, the terms "SL structure," "Stem loop structure," and "single stem loop structure" are used interchangeably to refer to a single stem loop secondary structure contained in a target circular RNA molecule. The SL structure consists of a stem region (also called an "arm") connected to a distal loop. The stem region may include a bulge and / or an internal loop.

[0249] In some embodiments, the size of the terminal loop is ≥4 nt, preferably 4-25 nt, more preferably 4-20 nt, and most preferably 5-15 nt.

[0250] In some embodiments, for an SL structure, the stem region is composed of two nucleotide segments that are completely complementary or partially complementary, the distal end of each nucleotide segment is connected to the terminal loop, and the proximal end of each nucleotide segment is respectively connected to the main body of the polynucleotide for preparing circular RNA of the present invention (i.e., the remaining part after removing the SL structure from the target circular RNA). When the lengths of the two nucleotide segments are Y1 and Y2 respectively, the length Y of the stem region = (Y1 + Y2) / 2. Generally, the length Y is not particularly limited. Typically, Y is 4-100nt, more preferably, 6-80nt, and most preferably, 6-40nt. Generally, when the two nucleotide segments are completely complementary, Y can be shorter, such as 3-10nt; when the two nucleotide segments are not completely complementary, Y can be longer, such as 4-20nt or 20-60nt.

[0251] In some embodiments, the number of complementary base pairs in the stem region is P, which is generally ≥3, preferably P is 5-100, and more preferably, 10-100.

[0252] In some embodiments, the ratio of the number of complementary base pairs (P) to the stem region length (Y) (ie, P / Y) is 40% to 100%, preferably 50% to 100%, and more preferably 60% to 95%.

[0253] A schematic SL structure is shown in FIG3B , in which the lengths of the two nucleotide segments in its stem region, Y1 and Y2, are 23 and 23, respectively. The stem region length Y = (23 + 23) / 2 = 23, the number of complementary base pairs, P = 13, and the P / Y ratio is 57%.

[0254] In some embodiments, in an SL structure of the present invention, the number of the convex rings and / or inner rings is 0-4, preferably 0-3, and more preferably 0-2.

[0255] The SL structural element of the present invention is widely present in various types of RNA molecules. The stem-loop structure is present in almost all naturally occurring RNA molecules and is one of the most fundamental elements in the formation of complex RNA secondary structures and further development of three-dimensional conformations. The present invention creatively designs a self-splicing ribozyme system capable of efficiently splicing RNA sequences with stem-loop secondary structural features.

[0256] In the present invention, splice sites are selected on the SL structural element based on the secondary structure of the target loop sequence.

[0257] In some embodiments, the splice site is located on the terminal loop of the SL structure.

[0258] In some embodiments, the splice site is located between the nucleotide U (or T) and the adjacent nucleotide on the terminal loop, and the nucleotide U (or T) is located at the 3' end of the linear RNA sequence formed after cleavage at the splice site.

[0259] In some embodiments, the target circular RNA molecule is a target circular mRNA molecule, and the SL structure is located in the coding region or non-coding region of the target circular mRNA molecule.

[0260] In some embodiments, the SL structure is located at the translation initiation element site of the target circular mRNA molecule. The SL structure may be naturally present at the translation initiation element site or artificially inserted into the translation initiation element site. The translation initiation element is a cap-independent translation initiation element, including but not limited to: an internal ribosome entry site (IRES), a Kozak sequence, a translation initiation element containing a methylation modification site, a cap-independent translation enhancer (CITE), a 5' untranslated region (5'-UTR), a 3' untranslated region (3'-UTR), other elements with cap-independent translation initiation activity, and other elements with cap-independent translation initiation activity newly discovered in the future. Among them, mammalian mRNA genes containing CITE include but are not limited to: human Fibroblast growth factor 9 (FGF-9).

[0261] In some embodiments, the translation initiation element is an internal ribosome entry site (IRES). IRES is a highly structured region with abundant secondary structures formed inside. Almost any IRES contains an SL structure that can be recognized by the ribozyme of the present invention.

[0262] In some embodiments, the IRES sequences of the present invention include, but are not limited to, IRES sequences derived from the following species or genes: coxsackievirus, echovirus, poliovirus, rhinovirus, human rhinovirus, cricket paralysis virus, bovine enterovirus, enterovirus, human poliovirus, encephalomyocarditis virus, hepatitis C virus, hepatitis A virus, simian virus, aphid lethal paralysis virus, reticuloendotheliosis virus, murine encephalomyelitis virus, human paravirus, bovine viral diarrhea virus, foot-and-mouth disease virus, Kashmir honey bee virus, acute paralysis virus, graminoid aphid virus, Taura syndrome virus, GB virus type C, bovine crest virus, Kubu virus, picornavirus, and swine vesicular disease virus. Aptamers for human FGF2, human SFTPA1, human AML1 / RUNX1, human AQP4, human AT1R, human BAG-1, human BCL2, human BiP, human c-IAP1, human c-myc, human eIF4G, human LEF1, human n-myc, human p27kip1, human PDGF2 / c-sis, human p53, human Pim-1, human UNR, human VEGF-A, human XIAP, human c-src, human FGF-1, Drosophila antennapedia, mouse NDST4L, mouse HIF1α, mouse Gtx, mouse Rbm3, mouse UtrA, canine Scamper, Drosophila reaper, Drosophila Ubx, Drosophila hairless, Saccharomyces cerevisiae TFIID, Saccharomyces cerevisiae YAP1, or eIF4G.

[0263] In some embodiments, the IRES sequence is a non-natural sequence.

[0264] In some embodiments, the IRES sequence is an artificially synthesized IRES sequence containing an SL structure.

[0265] In some embodiments, the SL structure is located in the coding region of the target circular mRNA sequence.

[0266] In some embodiments, the SL structure is located in the 5'-UTR region of the target circular mRNA sequence.

[0267] In some embodiments, the SL structure is located in the 3'-UTR region of the target circular mRNA sequence.

[0268] In some embodiments, the target circular RNA sequence is a non-coding RNA (ncRNA).

[0269] In some embodiments, the target circular RNA sequence is an RNA aptamer, a riboswitch, a toehold switch, a gene editing or RNA editing guide-RNA, snRNA, snoRNA, siRNA, miRNA, piRNA, lncRNA, tRNA, or rRNA.

[0270] Ribozymes of the present invention

[0271] As used herein, the term "ribozyme" refers to RNA with catalytic activity. The ribozyme in the present invention is a ribozyme capable of autocatalytic splicing. The chemical nature of the cyclization of the self-splicing ribozyme is through the breakage and recombination of the chemical bond between the ribozyme splicing active region and the splicing site, and the activity of the ribozyme and the kinetic process of chemical bond breakage and recombination depend on the relative spatial position of the functional modules involved in the reaction (Joining the two domains of a group I ribozyme to form the catalytic core. Tanner MA, Cech TR. Science. 1997 Feb 7; 275(5301): 847-9.). The ribozyme design of the present invention is based on group I introns.

[0272] A large number of natural group I introns have been discovered. Although different group I introns have great differences at the sequence level, all group I introns contain the same core secondary structure skeleton. This conserved secondary structure skeleton constitutes the autocatalytic splicing ribozyme (Crystal structure of a group I intron splicing intermediate. Adams PL, Stahley MR, Gill ML, et al. RNA. 2004 Dec; 10(12): 1867-87.). The self-splicing activity of group I intron ribozymes depends on their conserved secondary structure. Therefore, all ribozyme systems with self-splicing function derived from group I introns rely on the same self-splicing reaction mechanism (Joining the two domains of a group I ribozyme to form the catalytic core. Tanner MA, Cech TR. Science. 1997 Feb 7; 275(5301): 847-9. Crystal structure of a self-splicing group I intron with both exons. Peter L Adams, Mary R Stahley, Anne B Kosek, et al. Nature. 2004 Jul 1; 430(6995): 45-50.).

[0273] Specifically, the main mechanism of the self-splicing reaction of group I introns is as follows: the intron located between the upstream exon Exon1 and the downstream exon Exon2 can be autocatalytically spliced ​​to cut out the intron fragment and connect Exon1 and Exon2. The splicing reaction mechanism of group I introns mainly includes a two-step esterification reaction. A sequence at the 3' end of Exon1 forms a complementary base pair with a sequence at the 5' end of the intron. This pairing is called helix P1. Within helix P1, the sequence on the ribozyme P1 is called the internal guide sequence (IGS). The formation of a GU mismatch between the IGS and the first nucleotide of Exon1 is crucial for the first step of the esterification reaction. The ribozyme relies on this GU mismatch to accurately recognize the splicing site (5'splicing site, 5'SS) of the upstream Exon. In the first esterification reaction, the 3'-OH group of free guanosine or guanylate attacks the 5'SS, separating the exon and intron at the 5'SS. This exposes the free 3'-OH group of the exon 5'SS for the second esterification reaction. In the second step, the free 3'-OH group of the 5'SS acts as a nucleophile to attack the phosphodiester bond at the 3'splicing site (3'SS) of Exon2, cleaving the intron from Exon2. A new phosphodiester bond forms between the 3' end of Exon1 and the 5' end of Exon2, connecting Exon1 and Exon2. Accurate recognition of the 5'SS requires the formation of the helix P1 between the intron and the exon. Unlike the 5'SS, the formation of a complementary pair between the intron and Exon2 is not essential for accurate recognition of the 3'SS. Therefore, the design of the ribozyme in this invention primarily focuses on modifying the P1 of group I introns. On the exon, the sequence that forms a complementary pair with ribozyme P1 at the 5'SS end (i.e., helix P1) is also called the ribozyme recognition site. The ribozyme recognition site includes the first nucleotide at the 5' end of the exon to the last complementary pairing nucleotide on helix P1. In different group I introns, the length of the ribozyme recognition site required to cause a high-efficiency autocatalytic splicing reaction varies.

[0274] In some embodiments, the ribozyme of the present invention is a ribozyme obtained by mutation modification of key regions based on natural ribozymes.

[0275] In some embodiments, the IGS in a natural ribozyme is mutated to form an engineered ribozyme.

[0276] In certain embodiments, the IGS in the natural ribozyme is mutated so that the IGS after the mutation can form multiple base complementary pairings with the ribozyme recognition site. In the described embodiment, the present invention has found for the first time that when IGS forms a 2-7nt complementary pairing with the ribozyme recognition site in the Anabaena intron (i.e., the length of the ribozyme recognition site is within the range of 2-7nt), the autocatalytic splicing reaction can be achieved efficiently. However, when the length of the ribozyme recognition site is 8nt, the cyclization efficiency significantly reduces, which may be related to the structure of the P2 module being affected so that the ribozyme activity is affected.

[0277] In some embodiments, the ribozyme of the present invention is a modified ribozyme formed by partially or completely mutating the 10th to 16th positions of the 5' end of the Anabaena pre-tRNA-Leu gene intron (abbreviated as Ana-PIE). Among them, the mutation rule is: the base at position 10 at the 5' end of the PIE intron mutates to the complementary base of the base at position 2 at the 3' end of the cyclized sequence, the base at position 11 mutates to the complementary base of the base at position 3 at the 3' end of the cyclized sequence, the base at position 12 mutates to the complementary base of the base at position 4 at the 3' end of the cyclized sequence, the base at position 13 mutates to the complementary base of the base at position 5 at the 3' end of the cyclized sequence, the base at position 14 mutates to the complementary base of the base at position 6 at the 3' end of the cyclized sequence, the base at position 15 mutates to the complementary base of the base at position 7 at the 3' end of the cyclized sequence, and the base at position 16 mutates to the complementary base of the base at position 8 at the 3' end of the cyclized sequence.

[0278] In some embodiments, positions 10 and 11 of the 5' end of the Anabaena-derived intron Ana-PIE are mutated.

[0279] In some embodiments, positions 10, 11, and 12 of the 5' end of the Anabaena-derived intron Ana-PIE are mutated.

[0280] In some embodiments, positions 10, 11, 12, and 13 of the 5' end of the Anabaena-derived intron Ana-PIE are mutated.

[0281] In some embodiments, positions 10, 11, 12, 13, and 14 of the 5' end of the Anabaena-derived intron Ana-PIE are mutated.

[0282] Circular RNA of the present invention

[0283] As used herein, the terms "circular RNA," "circular RNA," "circular RNA," and "circRNA" are used interchangeably to refer to a class of molecules that are covalently linked end to end and lack 5' and 3' ends. Due to their unique "circular" structure, circular RNA molecules are resistant to degradation by RNases and exhibit greater stability in vivo and in vitro than linear RNA molecules.

[0284] The circular RNA of the present invention is formed by the circular RNA precursor of the present invention through a self-splicing reaction. In some embodiments, the circular RNA is a circular mRNA, which can express proteins in mammals with high efficiency.

[0285] In some embodiments, the circular RNA is a circular non-coding RNA (ncRNA).

[0286] The circular RNA of the present invention is prepared by the following method:

[0287] (1) The circular RNA precursor molecule of the present invention can be obtained by chemical synthesis or transcription from a vector.

[0288] In some embodiments, the circular RNA precursor molecules of the present invention are directly obtained by chemical synthesis.

[0289] In some embodiments, the circular RNA precursor molecule of the present invention is transcribed from a vector. The steps are:

[0290] ① constructing a plasmid vector containing the circular RNA precursor molecule sequence;

[0291] ② Use a plasmid vector to transcribe and produce circular RNA precursor molecules.

[0292] (2) Exposing the circular RNA precursor molecule obtained in step (1) to certain reaction conditions to cause a self-splicing reaction to obtain the target circular RNA.

[0293] In some embodiments, the reaction conditions are that the reaction system contains GTP and magnesium ions.

[0294] In some embodiments, the reaction conditions are as follows: the reaction system contains 0.01 mM-10 mM GTP, 1 mM-100 mM magnesium ions, the pH value of the reaction system is between 5-8, the temperature at which the cyclization reaction occurs is between 25-65°C, and the cyclization reaction takes place in vitro for about 5 min-60 min.

[0295] In some embodiments, the reaction conditions are 2±1 mM GTP and a magnesium ion-containing buffer (50 mM TrisHCl, 10 mM MgCl2, 1 mM DTT, pH 7.5) at 55±3°C for 15±5 minutes.

[0296] The main advantages of the present invention include:

[0297] (1) The cyclization platform has excellent versatility. The cyclization effect is not affected by different target sequences, and high-efficiency cyclization with high sequence fidelity can be achieved for diverse RNA sequences. The cyclization module at the core of the circular RNA construct of the present invention is a single stem-loop structure or a multi-stem-loop structure (commonly referred to as a stem-loop structure). The stem-loop structure of the present invention can be widely present in any type of RNA molecule (including various types of long-chain and short-chain RNA molecules), especially the single stem-loop structure is more widely distributed, which makes the Uni-cRNA cyclization platform of the present invention have strong versatility.

[0298] (2) The cyclization reaction does not introduce any additional sequences. In the final circular RNA product, the sequence of the linear RNA to be cyclized is exactly the same as the sequence of the generated circular RNA. In biomedical applications, ensuring that the sequence of the RNA molecule remains unchanged after cyclization can avoid potential risks caused by sequence changes.

[0299] (3) High cyclization efficiency. The cyclization efficiency of the single stem-loop Uni-cRNA of the present invention can be as high as about 80% or higher, while the cyclization efficiency of the multi-stem-loop Hi-scarless-PIE of the present invention is about 90-95% or higher. Both stem-loop structures have unexpectedly high cyclization efficiencies, which facilitate downstream processes after cyclization and have excellent practicality.

[0300] (4) The prepared circular mRNA has prolonged stability, a long half-life in vivo, and significantly increased protein expression efficiency. Circular RNA molecules persist in the body longer and translate proteins longer, thus exhibiting better druggability than linear mRNA, laying the foundation for the preparation of circular RNA products for medical use.

[0301] (5) The circular RNA molecules prepared by the present invention have lower immunogenicity. Since they do not carry additional sequences, the circular RNA of the present invention has high purity, which is beneficial to reducing its immunogenicity.

[0302] The present invention will be further described below in conjunction with specific examples. It should be understood that these examples are intended to illustrate the present invention only and are not intended to limit the scope of the present invention. The experimental methods in the following examples, for which specific conditions are not specified, are generally performed under conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the conditions recommended by the manufacturer. Unless otherwise stated, percentages and parts are by weight.

[0303] Example 1. Design and verification of Hi-Scarless-PIE circular RNA constructs

[0304] This example involves the process and method of determining the TLSL cyclization element, modifying the Ana-PIE intron ribozyme, forming a "ribozyme-TLSL cyclization module", and further forming a Hi-Scarless-PIE circular RNA construct, and experimentally verifying the effectiveness of the construct in synthesizing circular RNA.

[0305] The design principle of the Hi-Scarless-PIE circular RNA construct of the present invention is shown in FIG2 .

[0306] The TLSL cyclization element consists of the ribozyme recognition site and the secondary structure surrounding it.

[0307] First, the TLSL cyclization module was obtained by the following steps: in CVB3 IRES (SEQ ID NO: 1), the nucleotide sequence of the TLSL cyclization element located at positions 1 to 94 of CVB3 IRES was determined based on the secondary structure and named TLSL-CVB3-IRES (SEQ ID NO: 2), and its secondary structure is shown in Figure 5A.

[0308] Next, a splice site was selected: the splice site is located between U 22 and C 23 in the TLSL-CVB3-IRES sequence, on the first stem-loop loop near the 5' end of the TLSL-CVB3-IRES secondary structure. The arrow in Figure 5A shows the location of the splice site.

[0309] In this example, the target circular RNA sequence (SEQ ID NO: 4) is composed of CVB3-IRES (SEQ ID NO: 1) and the mRNA coding region of Gaussia Luciferase (GLuc) (SEQ ID NO: 3). Based on the selected splice site, the Seq 4 sequence is separated from the splice site to form the linear counterpart of the target circular RNA sequence (SEQ ID NO: 5).

[0310] Design of a GLuc circular RNA precursor molecule based on the modified Ana-PIE ribozyme: The 3' end section of the Ana-PIE ribozyme (SEQ ID NO: 6), the linear counterpart of the target circular RNA sequence (SEQ ID NO: 5), and the 5' end section of the modified Ana-PIE ribozyme (SEQ ID NO: 7) were connected to each other to form a GLuc circular RNA precursor molecule based on the modified Ana-PIE ribozyme, named circ-CVB3-IRES-GLuc-precursor-1 (SEQ ID NO: 8).

[0311] Design of a GLuc circular RNA precursor molecule based on the unmodified Ana-PIE ribozyme: The 3' end fragment of the Ana-PIE ribozyme (SEQ ID NO: 6), the linear counterpart of the target circular RNA sequence (SEQ ID NO: 5), and the 5' end fragment of the Ana-PIE ribozyme (SEQ ID NO: 9) were connected to each other to form a GLuc circular RNA precursor molecule based on the unmodified Ana-PIE ribozyme, named circ-CVB3-IRES-GLuc-precursor-2 (SEQ ID NO: 10).

[0312] Synthesis of the circular RNA precursor molecules and constructs designed above: First, the DNA sequences corresponding to SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 6, and SEQ ID NO: 9 were synthesized (Beijing Qingke Biotechnology Co., Ltd.). These DNA sequences were cloned into the linear plasmid vector pUC57 containing a T7 promoter generated by PCR (GenBuilder Plus Cloning Kit, L00744, GenScript Biotechnology Co., Ltd.) by molecular cloning to obtain the corresponding construct (i.e., a construct formed using the natural Ana-PIE intron). The following plasmid was obtained: pUC57-CVB3-GLuc-1. On the basis of this construct, the sequence of the Ana-PIE ribozyme 5' end section (SEQ ID NO: 9) was modified, wherein the A at position 10 of the 5' end of SEQ ID NO: 9 was mutated to T, and the G at position 11 was mutated to C, forming the modified Ana-PIE ribozyme intron construct pUC57-CVB3-GLuc-2.

[0313] Preparation of linear plasmid template: Transform the plasmid into Top10 competent cells, plate, and the next day, select clones and expand them in LB medium containing Amp resistance (37°C / 200rpm / overnight). Then perform plasmid extraction (endotoxin-free plasmid mini-extraction kit, DP118, Tiangen Biochemical Technology (Beijing) Co., Ltd.). Then, use EcoRI (1040, Takara) single enzyme digestion method to prepare linearized plasmid template (37°C, 1 hour). The enzyme digestion products were recovered using a PCR & DNA Cleanup Kit (T1030, New England Biolabs), their concentrations were determined using a Nano-Drop (Thermo) and identified using 1.5% agarose gel electrophoresis. The purified linear plasmid was used as a template for in vitro transcription.

[0314] Preparation of circRNA precursors by in vitro transcription: The linearized plasmid DNA template was transcribed in vitro (37°C, 2 hours) using T7 High Yield RNA Synthesis Kit (E2040S, New England Biolabs) to synthesize the cicrRNA precursor. After in vitro transcription, the linear DNA template was digested with DNaseI (M0303S, New England Biolabs) (37°C, 15 min). Column purification was performed using RNA Cleanup Kit (T2050, New England Biolabs).

[0315] circRNA synthesis: The circular RNA precursor molecule was added to a buffer containing GTP (final concentration of 2 mM) (50 mM Tris-HCl, 10 mM MgCl2, 1 mM DTT, pH 7.5), and the above solution was heated at 55 ° C for 15 min, and then column purification was performed ( RNA Cleanup Kit, T2050, New England Biolabs).

[0316] Identification of circular RNA using capillary electrophoresis: Circularized RNA precursors and crude circularized RNA were concentrated using a Nano-Drop (Thermo Fisher Scientific) assay. The product was then processed using the QIAxcel RNA High Sensitivity Cartridge Kit (929112) according to the manufacturer's instructions. Detection and analysis were performed using the QIAxcel Connect capillary electrophoresis instrument according to the manufacturer's instructions. A high-sensitivity RNA marker (QIAxcel RNA High-Sensitivity Marker Set, 929112, QIAGEN) was used to identify distinct RNA bands.

[0317] Research results: Figure 5A shows the local secondary structure of the ribozyme recognition site. Figure 5B shows the self-splicing reaction of the natural Ana-PIE intron and the modified Ana-PIE intron. As shown in Figure 5B, there is no obvious difference in the bands between capillary lanes 1 and 2, and lane 2 does not produce obvious bands at the position of the circular RNA, indicating that the natural Ana-PIE intron (Natural PIE) cannot effectively undergo self-splicing circularization reaction. On the contrary, compared with lanes 3 and 4, most of the bands in lane 4 are located at the position of the circular RNA, with only a small amount of linear RNA bands, and there are obvious bands of intron fragments, which indicates that the modified Ana-PIE intron group (Modified PIE) undergoes a highly efficient self-splicing circularization reaction.

[0318] Example 2. Effect of the selection of splicing sites of self-splicing ribozymes on circularization efficiency

[0319] This example tests the effects of different ribozyme splicing sites on cyclization efficiency.

[0320] To verify the effect of splicing sites at different positions on the cyclization efficiency, in addition to the splicing site determined in Example 1 (located between the 22nd U and 23rd C of the TLSL-CVB3-IRES sequence, located on the end loop of the first stem loop close to the 5' end in the TLSL-CVB3-IRES secondary structure, as shown by the arrow in Figure 5A), this example selected two other splicing sites on TLSL-CVB3-IRES for experimental verification.

[0321] Among them, the first splice site is selected on the stem (the specific location is shown by the arrow in Figure 6A). Correspondingly, the 10th and 11th positions at the 5' end of the Ana-PIE ribozyme are mutated accordingly, and the sequence of the final circular RNA precursor molecule is sequence 11 (SEQ ID NO: 11). The second splice site is selected on the smaller end loop (the end loop contains 3 nucleotides). The specific location of the splice site is shown by the arrow in Figure 6B. Correspondingly, the 10th and 11th positions at the 5' end of the Ana-PIE ribozyme are mutated accordingly, and the final circular RNA precursor molecule is sequence 12 (SEQ ID NO: 12).

[0322] Experimental result is as shown in Figure 6 C, and swimming lanes 0, 1, and 2 are respectively the products of RNA molecule marker, the linear precursor molecule of circular RNA, and the linear precursor molecule of circular RNA after cyclization reaction. The position of the circular RNA of the band of capillary swimming lane 2 has a band, but the brightness is weak, and the band at the linear RNA position is obvious, proving that only a small amount of circular RNA molecules are formed. Similarly, in Figure 6 D, only a small amount of bands at the position of circular RNA are observed in swimming lane 2, indicating that the cyclization efficiency of the splicing site is also lower. These results illustrate together that when the splicing site of the self-splicing ribozyme is on the stem of the TLSL cyclization element or on the end loop but the selected end loop is smaller, cyclization can be achieved, but the cyclization efficiency is significantly reduced. Therefore, the ribozyme splicing site on the TLSL cyclization element is preferably located on the end loop of the stem loop, and the size of the end loop should be greater than or equal to 4.

[0323] Example 3. The Hi-Scarless-PIE cyclization system can produce sequence-accurate circular RNA molecules

[0324] In this embodiment, a variety of methods are used to identify whether the product of the present invention is the target circular RNA molecule, including:

[0325] Method 1. Identification by RNaseR. RNaseR is a 3'-5' exonuclease that cleaves and degrades RNA from the 3'-5' direction. It can degrade linear RNA molecules, but cannot degrade circular RNAs without 3' and 5' ends.

[0326] The specific steps are as follows: the purified circular RNA or linear circRNA precursor was heated at 65°C for 3 minutes and then immediately placed on ice for 2 minutes. The linear RNA was then digested with RNaseR (E049, Applied Biological Materials) (37°C, 30 minutes). The RNA digested with RNase R was purified by column purification using RNA Cleanup Kit (T2050, New England Biolabs), and then analyzed by agarose gel electrophoresis using 1.5% agarose gel.

[0327] The results are shown in Figure 7A. Lanes 1 and 3 represent the linear circRNA precursor (precursor-mRNA, SEQ ID NO: 8) that has not undergone cyclization, lanes 2 and 4 represent the cyclized product, and lanes 3 and 4 represent the results after RNaseR treatment. As shown in Figure 7A, the main band in lane 2 after cyclization is located below the band in lane 1, and a distinct band appears at the bottom, suggesting that the cyclization reaction produces a circular mRNA molecule with a reduced molecular weight and a very small intron fragment. The RNaseR-treated group showed that no band appeared in lane 3, and the main band in lane 4 was not affected by RNaseR, thus inferring that this band is a band of circular RNA.

[0328] Method 2: Identification by adding Poly(A) fragments. Linear mRNA molecules can be enriched with hundreds of adenosine nucleotides (i.e., Poly(A) fragments), increasing their molecular weight. However, circular RNAs are closed end to end and lack 3' ends, so they cannot be tailed. Therefore, agarose gel electrophoresis can be used to determine the size change of RNA before and after tailing to confirm whether it is a circular RNA.

[0329] The specific steps are as follows: the purified circular RNA or linear circRNA precursor was tailed using Escherichia coli Poly(A) polymerase (M0276, New England Biolabs) (37°C, 30 min). Column purification was performed using RNA Cleanup Kit (T2050, New England Biolabs).

[0330] The results are shown in Figure 7A. The linear pre-mRNA and the product of the linear pre-mRNA cyclization reaction followed by the addition of Poly(A) were loaded into lanes 5 and 6, respectively. Compared to lane 1, the band in lane 5 shifted upward after the Poly(A) assay for the linear pre-mRNA, indicating an increase in molecular weight and successful Poly(A) addition. Compared to lane 4, the band in lane 6, presumed to be a circular RNA, remained in the same position and size as the circular RNA band in lane 4 after the Poly(A) assay, indicating that Poly(A) was not added.

[0331] Method 3: Identification using RNase H. RNase H is an endoribonuclease that specifically hydrolyzes RNA within DNA-RNA hybrids. Due to the structural differences between linear and circular RNAs, when the same probe binds to both linear and circular RNAs, the linear RNA is cleaved into two bands, while the circular RNA is simply cleaved into a single linear band.

[0332] The specific steps are as follows: a 10-fold molar excess of DNA probe was added to the circular RNA obtained by RNase R treatment, followed by heating at 65°C for 5 minutes and annealing at room temperature. Subsequently, the RNA was digested with RNase H (M0279, New England Biolabs) at 37°C for 20 minutes, and the digested RNA was column purified. The DNA probe sequence is shown in SEQ ID NO: 13.

[0333] As shown in Figure 7B , after RNase H treatment, linear pre-mRNA formed two bands, while circular mRNA molecules formed one band.

[0334] Method 4. Verify the accuracy of the ribozyme recognition site sequence by RT-PCR and Sanger sequencing. The aforementioned methods (1), (2), and (3) can confirm that a circular RNA molecule is formed after the cyclization reaction, but the accuracy of the ribozyme recognition site sequence needs to be verified. Therefore, this example also uses sequencing at the splice site to confirm that the cyclization reaction occurs at the expected location and forms the target circular RNA molecule.

[0335] The specific steps are as follows: Circular RNA generated by RNase R treatment is synthesized into first-strand cDNA using a random primer using the RevertAid First Strand cDNA Synthesis Kit (K1622, Thermo Fisher Scientific). Two forward and reverse PCR primers are then designed upstream and downstream of the splice junction, respectively. Using the cDNA as a template, PCR is performed to obtain amplified fragments, which are then verified by sequencing. Circular mRNA molecules will be detected near the splice site, along with the expected RNA sequence spanning the splice site. Primer sequences are shown in SEQ ID NO:14 and SEQ ID NO:15.

[0336] The results, shown in Figure 7C, confirm that the sequences flanking the splice site are consistent with the designed circular RNA sequence, demonstrating that the circular RNA head and tail have been connected. A circular mRNA molecule with the correct sequence was successfully obtained.

[0337] In summary, this embodiment verifies that the target circular RNA molecule is successfully synthesized in an in vitro cyclization reaction system by four complementary methods.

[0338] Example 4. Effects of different ribozyme mutations on the cyclization efficiency of Hi-Scarless-PIE

[0339] In this example, the effects of different ribozyme modification conditions on the cyclization efficiency of Hi-Scarless-PIE were determined by performing corresponding mutations at positions 10-19 of the 5' end of an intron derived from Anabaena. FIG8A shows the secondary structure of a natural Anabaena intron and the default numbering of nucleotides (the left figure of FIG8A is cited from the literature Distinct sites of phosphorothioate substitution interfere with folding and splicing of the Anabaena group I intron. Lupták A, Doudna JA. Nucleic Acids Res. 2004 Apr 23; 32(7): 2272-80. doi: 10.1093 / nar / gkh548.). An enlarged view of the positions of helix P1 and P2 in the left figure is shown in the right figure of FIG8A , wherein the nucleotides within the dotted box are the regions where the natural ribozyme was mutated in this embodiment. The nucleotide numbering of the intron herein all uses the labeling method shown in FIG8A .

[0340] The modified ribozymes used in Examples 1, 2, and 3 above only mutated positions 10 and 11 at the 5' end of the Anabaena-derived intron. In this example, corresponding mutations were made at positions 10-14, 10-17, and 10-19 at the 5' end of the Anabaena-derived intron in the circ-CVB3-Gluc-precurser-2 sequence (SEQ ID NO: 10), resulting in the following circular RNA precursor sequences: SEQ ID NO: 16, SEQ ID NO: 17, and SEQ ID NO: 18. The reaction was then carried out according to the method for synthesizing circular RNA described in Example 1, and the reaction was analyzed by agarose gel electrophoresis on a 1.5% agarose gel.

[0341] Results: As shown in Figure 8B, lanes 1, 3, and 5 represent circular RNA precursor molecules formed after mutations were made at positions 10-14, 10-17, and 10-19 of the 5' end of the Anabaena intron, respectively. Lanes 2, 4, and 6 represent the cyclized products of the precursor molecules after mutations were made at positions 10-14, 10-17, and 10-19 of the 5' end of the Anabaena intron, respectively. As shown in Figure 8B, after cyclization, only the main band in lane 2 remained below the band in lane 1, with a distinct band appearing at the position of the intron fragment at the bottom of the lane. There was no significant shift in band position between lanes 4 and 3, or between lanes 6 and 5. This demonstrates that mutations at positions 10-14 of the 5' end of the Anabaena intron can form circular RNA molecules within the circular RNA precursor. Mutating positions 10-17 and 10-19 at the 5' end of the intron may affect certain core modules of the ribozyme, thereby affecting the catalytic activity of the ribozyme and preventing the formation of circularized RNA. Therefore, it can be determined that preferably, in the present invention, mutation modification of some or all of the nucleotides in the region between positions 10-16 at the 5' end of the intron derived from Anabaena so that this region forms a partial or complete complementary pairing with the target gene will ensure that the self-splicing circularization efficiency of the modified ribozyme is at a high level.

[0342] Example 5. Study on the universality of the Hi-Scarless-PIE cyclization system between different "ribozyme-TLSL cyclization modules"

[0343] The aforementioned Examples 1, 2, and 3 all use the nucleotide sequence from positions 1 to 94 of CVB3 IRES as the TLSL cyclization element (TLSL-CVB3-IRES, SEQ ID NO: 2). In order to verify that the "ribozyme-TLSL cyclization module" of this patent is a universal method based on the local secondary structure of the ribozyme recognition site, this example selects multiple TLSL structural elements different from TLSL-CVB3-IRES to verify whether the "ribozyme-TLSL cyclization module" constituted by it can also achieve efficient Scarless circular RNA preparation.

[0344] The TLSL structural elements used in this embodiment include: SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, and SEQ ID NO: 23. The nucleotide sequences of these five TLSLs are different, but all conform to the description of the TLSL structural features in this patent. Among them:

[0345] SEQ ID NO: 19 is derived from HRV-B3 IRES (SEQ ID NO: 24),

[0346] SEQ ID NO: 20 is derived from EV-B107IRES (SEQ ID NO: 25),

[0347] SEQ ID NO: 21 is derived from PV3 IRES (SEQ ID NO: 26),

[0348] SEQ ID NO: 22 is derived from SimianV4 IRES (SEQ ID NO: 27),

[0349] SEQ ID NO: 23 is derived from BEV1 IRES (SEQ ID NO: 28).

[0350] For each TLSL structural element, corresponding mutations were made to positions 10 and 11 at the 5' end of the Ana-PIE ribozyme. This example used the same method as described in Example 1 to construct the precursor molecule of the cyclic IRES-GLuc as shown below:

[0351] circ-HRV-B3-IRES-GLuc-precursor (SEQ ID NO: 29),

[0352] circ-EV-B107-IRES-GLuc-precursor (SEQ ID NO:30),

[0353] circ-PV3-IRES-GLuc-precursor (SEQ ID NO:31),

[0354] circ-SimianV4-IRES-GLuc-precursor (SEQ ID NO:32),

[0355] circ-BEV1-IRES-GLuc-precursor (SEQ ID NO:33).

[0356] Then, the circular RNA molecular identification method described in Example 3 was used to verify the effectiveness of its circular RNA preparation.

[0357] Research Results:

[0358] First, Figure 9 shows the experimental results of construct design based on the PV3 IRES-derived TLSL structure and validation of the circularization results. Figure 9A shows the PV3 IRES-derived TLSL structure and the selected splice sites (indicated by arrows). The validation results are shown in Figure 9B. Lanes 1 and 3 represent the linear circRNA precursor (precursor-mRNA) before circularization, lanes 2 and 4 represent the circularized product, and lanes 3 and 4 represent the results after RNaseR treatment. As shown in Figure 9B, the main band in lane 2 after circularization is located below the band in lane 1, with a distinct band appearing at the bottom, suggesting that the circularization reaction produces circular mRNA molecules with reduced molecular weight and very small intronic fragments. The RNaseR-treated group shows no band in lane 3, while the band for the circular RNA in lane 4 remains unaffected by RNaseR. Lane 5 represents the linear mRNA precursor after RNase H treatment, and lane 6 represents the circular mRNA after RNase H treatment. After RNase H treatment, the linear pre-mRNA formed two bands, while the circular mRNA molecule formed a single band. The sequencing results in Figure 9C confirmed that the sequences flanking the splice site were consistent with the designed circular RNA sequence, demonstrating that the circular RNA had been joined head-to-tail. The circular mRNA was successfully obtained.

[0359] Similarly, Figures 10, 11, and 12 respectively show the situations of searching for TLSL structures and selecting splicing sites in different IRESs. Among them, Figure 10 shows the experimental results of the construct design of the TLSL structure based on HRV-B3 IRES and EV-B107IRES and the verification of the cyclization results, Figure 11 shows the experimental results of the construct design of the TLSL structure based on SimianV4IRES and the verification of the cyclization results, and Figure 12 shows the experimental results of the construct design of the TLSL structure based on BEV1 IRES and the verification of the cyclization results. The presentation of the results is similar to that of Figure 9. The results of Figures 10, 11, and 12 all show that the present invention can successfully and efficiently synthesize circular RNA molecules for different TLSLs, proving that the Hi-Scarless-PIE system of the present invention is universal.

[0360] Example 6. Practical verification of the Hi-Scarless-PIE cyclization system between different "ribozyme-TLSL cyclization modules"

[0361] In order to further verify whether the Hi-Scarless-PIE cyclization system has the stability of the cyclization efficiency between different "ribozyme-TLSL cyclization modules", this example quantitatively analyzed the changes in the cyclization efficiency of different "ribozyme-TLSL cyclization modules" by capillary electrophoresis.

[0362] Specific implementation method: After the concentration of circularized RNA precursor and circularized RNA crude product was determined by Nano-Drop, they were treated with QIAxcel RNA High Sensitivity Cartridge Kit (929112, QIAGEN) according to the instructions, and then detected and analyzed using QIAxcel Connect capillary electrophoresis instrument (QIAGEN) according to the operating instructions.

[0363] The nucleotide sequences involved in this embodiment are as follows: SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32 and SEQ ID NO:33.

[0364] Implementation effect: Figure 13A shows the detection spectrum of capillary electrophoresis. Among them, the 2nd, 4th, 6th, 8th, and 10th lanes are the circular RNA precursor molecules of SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, and SEQ ID NO:33, and the 3rd, 5th, 7th, 9th, and 11th lanes are the products after the cyclization reaction of these circular RNA precursor molecules. According to experience, the molecular weight of the circular RNA after ring formation is smaller than that of its linear precursor molecule, and the corresponding band position shifts downward. In addition, the cyclized product contains intron peaks and intron dimer peaks, and may contain cyclized RNA dimer peaks. Figure 13B shows the peak diagram of the RNA crude product after the cyclization reaction of the circular RNA precursor (SEQ ID NO:30). In conjunction with Figures 13A and 13B , the molecular weight of the circular RNA precursor (SEQ ID NO: 30) decreases after circularization, and the corresponding band position shifts downward (from 1648 nt to 1330 nt). There are also a 177 nt intron peak, a 336 nt intron duplex peak, and a 2676 nt circularized RNA duplex peak. (Due to the inherent characteristics of the capillary electrophoresis system, the molecular weights indicated by the system may differ slightly from the actual molecular weights of the bands.) Compared to lanes 2, 4, 6, 8, and 10, the bands in lanes 3, 5, 7, 9, and 11 are mostly located at the circular RNA site, with only a small amount of linear RNA bands located at the linear RNA site. Circularization efficiency was calculated using the QIAxcel Connect capillary electrophoresis instrument's built-in software (QIAxcel ScreenGel 2.0). Circularization efficiency = 100% * circularization / (linear + circularization). The results showed that the cyclization efficiencies of SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, and SEQ ID NO:33 all reached over 90%, namely 95.45%, 91.58%, 93.90%, 90.03%, and 92.14%, respectively. These results collectively demonstrate that the Hi-Scarless-PIE system disclosed in the present invention can efficiently cyclize different target sequences (cyclization efficiencies exceeding 90%).

[0365] Example 7. Modular design of Hi-Scarless-PIE circular RNA constructs using pre-defined TLSL circularization elements

[0366] Considering that not all RNA molecules contain TLSL structural elements, this embodiment verifies whether the verified TLSL cyclization element can be inserted into the target RNA molecule when there is no TLSL structural element, so that the target RNA molecule can be efficiently cyclized using the Hi-Scarless-PIE system. This embodiment uses mRNA as a case for verification. It is reported that the TLSL structural element can play a role in recruiting ribosomes in IRES to promote protein translation (Structural basis for cloverleaf RNA-initiated viral genome replication. Keerthi Gottipati, Sean C McNeme, Jerricho Tipo, et al. Nucleic Acids Res. 2023 Sep 8; 51 (16): 8850-8863.). Therefore, this example inserts a TLSL cyclization element into IRES to verify, on the one hand, whether Hi-Scarless-PIE can be used for high-efficiency cyclization after inserting the TLSL cyclization element, and on the other hand, whether the protein translation level of circular mRNA can be enhanced after inserting the TLSL structural element into IRES.

[0367] Experimental methods:

[0368] In this example, the TLSL structural element (TLSL-CVB3-IRES: SEQ ID NO: 2) was inserted into the 5' end of the EMCV IRES (SEQ ID NO: 34) and the CrPV IRES (SEQ ID NO: 35), respectively, to form new sequences containing the TLSL structural element, designated as EMCV+TLSL (SEQ ID NO: 36) and CrPV+TLSL (SEQ ID NO: 37), respectively. Subsequently, the target circular RNA sequence (SEQ ID NO: 38) was formed from the EMCV+TLSL (SEQ ID NO: 36) and the Gaussia Luciferase (GLuc) mRNA coding region (SEQ ID NO: 3), and the target circular RNA sequence (SEQ ID NO: 39) was formed from the CrPV+TLSL (SEQ ID NO: 37) and the Gaussia Luciferase (GLuc) mRNA coding region (SEQ ID NO: 3). The 3' end fragment of the Ana-PIE ribozyme (SEQ ID NO: 6), the linear counterparts of the target circular RNA sequence (SEQ ID NO: 38 and SEQ ID NO: 39), and the 5' end fragment of the modified Ana-PIE ribozyme (SEQ ID NO: 7) were linked together to form the corresponding constructs: circ-EMCV+TLSL-IRES-GLuc-precursor (SEQ ID NO: 40) and circ-CrPV+TLSL-IRES-GLuc-precursor (SEQ ID NO. 41). Circular RNA precursor molecules were then synthesized and circular RNAs were prepared in vitro according to the method described in Example 1. Agarose gel electrophoresis analysis was then performed on a 1.5% agarose gel. At the same time, circular RNA prepared by the classical PIE system (i.e., circular RNA molecules without the TLSL cyclization element inserted) was used as a control (classical PIE-EMCV-IRES-GLuc-precursor: SEQ ID NO: 42 and classical PIE-CrPV-IRES-GLuc-precursor: SEQ ID NO: 43).

[0369] Cell culture: HEK-293T cells were cultured in a 37°C, 5% CO2 incubator (Thermo Fisher Scientific). HEK-293T cells were maintained in high-glucose DMEM (L110KJ, Shanghai Yuanpei Biotechnology Co., Ltd.) supplemented with 10% fetal bovine serum (SH30396.03, Hyclone) and 1% double-stranded antibody (S110JV, Shanghai Yuanpei Biotechnology Co., Ltd.). Cells were subcultured every 2-3 days.

[0370] Cell transfection: Before transfection, HEK-293T cells were seeded at 20,000 cells / well in a 96-well plate. Then, 50-100 ng (equimolar amount of each RNA) of the circular mRNA molecules prepared according to the method of Example 1 were transferred into HEK-293T cells using Lipofectamine 3000 transfection reagent (L3000001, Thermo Fisher Scientific) according to the manufacturer's instructions.

[0371] Protein expression analysis: 24 hours after transfection, 10 μl of culture supernatant was collected and luciferase activity was measured using the Pierce Gaussia Luciferase Glow Assay Kit (Thermo Fisher Scientific). Luciferase activity was measured using a SpectraMax i3 microplate reader (Molecular Devices).

[0372] Experimental results:

[0373] Figure 14A shows the secondary structures of TLSL, EMCV IRES and EMCV+TLSL, and Figure 15A shows the secondary structures of TLSL, CrPV IRES and CrPV+TLSL. It can be seen from the secondary structure that the sequence after the insertion of TLSL forms a TLSL structural element at the expected position, and the structural element has no effect on other secondary structure regions on the IRES. The electrophoresis detection results are shown in the agarose gel results of Figures 14B and 15B. Lane 1 is a linear circRNA precursor (precursor-mRNA) that has not undergone a cyclization reaction, and lane 2 is the product after cyclization. After the cyclization treatment, the main band position of lane 2 is significantly shifted downward, and a clear band appears at the bottom, which suggests that the cyclization reaction produces a circular mRNA molecule with a reduced molecular weight and an intron fragment with a very small molecular weight. This shows that after inserting the TLSL cyclization element, Hi-Scarless-PIE can be used for efficient cyclization. As shown in the protein expression results of Figures 14C and 15C, the circular RNA molecules synthesized using the Hi-Scarless-PIE cyclization method of the present invention and inserted with the preset TLSL cyclization element expressed luciferase activity values ​​that were significantly higher than those of the circular RNA molecules not inserted with the TLSL cyclization element (synthesized using the classic PIE method).

[0374] According to the research results of this embodiment, it can be reasonably inferred that this patent can perform modular "ribozyme-TLSL cyclization element" design on any IRES (natural or modified, such as inserting a preset TLSL structural element to modify the natural IRES), thereby achieving high-efficiency circular mRNA preparation. At the same time, the protein translation level of IRES is significantly improved after the insertion of the TLSL cyclization element. These results show that the modular design concept of the "ribozyme-TLSL cyclization element" of this patent can achieve the "killing two birds with one stone" effect of high-efficiency circularization preparation and improving protein translation level in the preparation application of circular mRNA.

[0375] Example 8. TLSL structural elements are abundant in natural and non-natural RNA molecules

[0376] This example comprehensively analyzes the distribution of TLSL structural elements in various RNA molecules. In this example, only the classic clover-shaped TLSL structure is used as a typical case for analysis.

[0377] Implementation method:

[0378] Search for TLSL elements in RNA secondary structure. First, the RNAfold algorithm is used to predict the secondary structure of the RNA sequence, and the prediction results are presented using dot-bracket notation. RNAfold predicts the corresponding secondary structure for each RNA sequence. Then, the TLSL search program built in this article is used to search the secondary structure file for each RNA sequence to see if it contains a TLSL structure. The matching principle of the TLSL search follows the clover TLSL structural characteristics. In this embodiment, in addition to the basic features meeting the structural description of the classic clover TLSL, the total length of TLSL is limited to no more than 200nt.

[0379] Distribution analysis of TLSL structural elements in various major RNA sequences. IRES, 5'-UTR, 3'-UTR, mRNA coding regions, non-coding RNA, and non-natural RNA sequences are RNA types closely related to this patent. Therefore, for each of these RNA molecules, we first searched and downloaded representative sequences from public databases. Then, we performed secondary structure prediction and TLSL element searches on the sequences. Finally, we used a bar chart to display the occurrence ratio of TLSL elements in various RNA sequences. The data collection and preprocessing process is as follows:

[0380] The IRES sequence is derived from the IRESbase database (IRESbase: A Comprehensive Database of Experimentally Validated Internal Ribosome Entry Sites. Zhao J, Li Y, Wang C, et al. Genomics Proteomics Bioinformatics. 2020Apr;18(2):129-139.), which contains a total of 1,328 IRES sequences. IRES sequences are derived from humans, viruses, and other eukaryotic organisms. The dataset also contains a portion of artificially designed IRES sequences with a length of 174 nt, which is named "IRES-IRESbase". Whether the IRES sequences from the IRESbase database can efficiently initiate protein translation in mRNA has not been experimentally verified for consistency. Therefore, this experiment further collected a set of IRES sequences that have been verified by consistency experiments from the literature. Specifically, 51 experimentally verified IRES sequences that can efficiently initiate mRNA translation were extracted from an experimental paper published in the journal Nature Biotechnology in 2023 (Engineering circular RNA for enhanced protein production. Chen R, Wang SK, Belk JA, et al. Nat Biotechnol. 2023Feb; 41(2): 262-272.). The data set of these 51 sequences was named "IRES-high activity".

[0381] 5'-UTR and 3'-UTR sequences were obtained from the UTRdb database (UTRdb 2.0: a comprehensive, expert curated catalog of untranslated regions of eukaryotic mRNAs. Lo Giudice C, Zambelli F, Chiara M, et al. Nucleic Acids Res. 2023 Jan 6;51(D1):D337-D344). The UTRdb database currently contains over 12.9 million 5'-UTR sequences and over 13.19 million 3'-UTR sequences from 673 species. To save computational time, this study used human UTR sequences as a representative case for TLSL analysis. UTRdb contains a total of 93,457 5'-UTR sequences and 87,932 3'-UTR sequences. Inclusion criteria for analysis were: 1) sequence length greater than 150 nt; 2) only the longest sequence from the same gene was retained. Finally, a total of 12,661 5'-UTR sequences and 18,414 3'-UTR sequences were included in this analysis.

[0382] Human mRNA coding region sequences are derived from the Consensus Coding Sequence (CCDS) database (Consensus coding sequence (CCDS) database: a standardized set of human and mouse protein-coding regions supported by expert curation. Pujar S, O'Leary NA, Farrell CM, et al. Nucleic Acids Res. 2018 Jan 4; 46 (D1): D221-D228.). Specifically, a file containing CDS nucleotide sequences (file name "CCDS_nucleotide.current.fna.gz") was downloaded from the official website of the CCDS database. This version of the CCDS database contains a total of 35,624 human CDS sequences, all of which were included in the analysis.

[0383] The non-coding RNA (ncRNA) dataset is derived from the RNAChallenge benchmark dataset, a benchmark used to evaluate the performance of ncRNA classification tools. It contains 11,040 ncRNA sequences from multiple species (A large-scale benchmark study of tools for the classification of protein-coding and non-coding RNAs. Dalwinder Singh and Joy Roy. Nucleic Acids Research, gkac1092, 2022). The dataset can be downloaded from https: / / github.com / cbl-nabi / RNAChallenge. All 11,040 ncRNA sequences were included in this analysis.

[0384] Research Results:

[0385] The results are shown in the table below and Figure 16A. In the "IRES-IRESbase" sequence set, 194 Clover TLSL structural elements were matched across 188 IRES sequences, accounting for 14.16% of all IRES sequences analyzed. In the "IRES-High Activity" sequence set, 46 Clover TLSL structural elements were matched across 37 IRES sequences, accounting for 72.55% of all high-activity IRES sequences analyzed. In the human 5'-UTR sequence set, 2442 Clover TLSL structural elements were matched across 2327 5'-UTR sequences, accounting for 18.38% of all 5'-UTR sequences analyzed. In the human 3'-UTR sequence set, 9766 Clover TLSL structural elements were matched across 6508 3'-UTR sequences, accounting for 35.34% of all 3'-UTR sequences analyzed. In the human CDS sequence set, 28,526 Cloverleaf TLSL structural elements were matched in 17,896 CDS sequences, accounting for 50.24% of all CDS sequences analyzed. In the ncRNA sequence set, 14,104 Cloverleaf TLSL structural elements were matched in 6,706 ncRNA sequences, accounting for 60.74% of all ncRNA sequences analyzed.

[0386] In summary, using typical clover TLSL structural features for matching, 14.16%, 72.55%, 18.38%, 35.34%, 50.24%, and 60.74% of the sequences analyzed in this example, respectively, contained typical clover TLSL structural elements (Figure 16A). Figures 16C-G show some representative clover TLSL structural elements from IRES, human 5'-UTR, human 3'-UTR, human CDS, and non-coding RNA sequence sets. Among them, the first line of the annotation content next to the TLSL structure in Figure 16C is the ID number of the IRES from which the TLSL is derived, where the ID number uses the number of the IRESbase database, and the three numbers in the second line of the annotation content are the start point, end point, and length of the TLSL in the original IRES. Among them, the annotation content next to the TLSL structure in Figure 16D is the name of the gene from which the TLSL is derived. Among them, the annotation content next to the TLSL structure in Figure 16E is the name of the gene from which the TLSL is derived. Among them, the first line of the annotation content next to the TLSL structure in Figure 16F is the ID number of the CDS sequence from which the TLSL is derived, wherein the ID number uses the number of the CCDS database, and the three numbers in the second line of the annotation content are respectively the starting point, the ending point and the length of the TLSL in the original CDS sequence. Among them, the first line of the annotation content next to the TLSL structure in Figure 16G is the ID number of the ncRNA sequence from which the TLSL is derived, wherein the ID number uses the sequence ID number of the RNAChallenge data set, and the three numbers in the second line of the annotation content are respectively the starting point, the ending point and the length of the TLSL in the original ncRNA sequence.

[0387] In summary, this example demonstrates that TLSL structural elements are widely present in RNA molecules such as IRES, UTR, CDS and ncRNA, which provides flexibility and broad space for the design of the "ribozyme-TLSL cyclization module" in the Hi-Scarless-PIE cyclization strategy of the present invention. The cyclization platform of this patent has good versatility. In theory, combined with Examples 5 and 6, it can be reasonably inferred that the method of this patent can be used to prepare any of the above-mentioned RNA sequences containing TLSL structural elements by high-efficiency cyclization; at the same time, combined with Example 7, it can be reasonably inferred that using natural IRES or IRES modified by the modification method proposed in this patent as a translation initiation sequence, the method of this patent can be used to prepare any mRNA by high-efficiency cyclization.

[0388] Example 9. Circular RNA prepared by Hi-Scarless-PIE cyclization system has low immunogenicity

[0389] This example tested the expression of immune-related factors induced by the Anabaena PIE system and circular mRNA prepared by Hi-Scarless-PIE in the present disclosure in A549 cells.

[0390] The specific steps are as follows:

[0391] HPLC purification: The circularized RNA product after RNase R treatment was heated at 65°C for 5 minutes and then placed on ice for 2 minutes. HPLC purification conditions: Silica-based aqueous gel column (Dikma Protein SEC-1000 300x8.0mm, 5μm, 99305, Dima Technology), flow rate: 0.5ml / min, nuclease-free buffer: 10mM Tris, 1mM EDTA, pH=6, HPLC instrument model: Shimadzu LC-20AD XR high-performance liquid chromatograph, RNA signal was detected using a UV detector at 260nm, and RNA was collected. The collected RNA was then column-purified.

[0392] Cell culture: A549 cells (Cell Bank, Chinese Academy of Sciences) were cultured at 37°C in a 5% CO2 incubator (Thermo Fisher Scientific). A549 cells were cultured in RPMI-1640 medium (L210KJ, Shanghai Yuanpei Biotechnology Co., Ltd.) supplemented with 10% fetal bovine serum (SH30396.03, Hyclone) and 1% double-antibody (S110JV, Shanghai Yuanpei Biotechnology Co., Ltd.). Cells were subcultured every 2-3 days.

[0393] Immunogenicity assay: A549 cells were seeded at 100,000 cells / well in a 12-well plate. After reaching 70-90% confluency, 1000 ng / well RNaseR-treated circular RNA or further HPLC-purified circular RNA and 3p-hpRNA (tlrl-hprna, InvivoGen) were transferred into the 12-well plate using Lipofectamine 3000 transfection reagent (L3000001, Thermo Fisher Scientific) according to the instructions. After 16 hours of transfection, the cells were lysed using Trizol and RNA was extracted. The first strand of cDNA was then synthesized using the RevertAid First Strand cDNA Synthesis Kit (K1622, Thermo Fisher Scientific). The expression of four immune response proteins, CCL5, IL6, INF-1B, and RIG-1, was then detected by fluorescent quantitative PCR.

[0394] The sequences used for quantitative PCR are as follows:

[0395] GAPDH-F:GTCTCCTCTGACTTCAACAGCG(SEQ ID NO:44)

[0396] GAPDH-R:ACCACCCTGTTGCTGTAGCCAA(SEQ ID NO:45)

[0397] IL6-F:AGACAGCCACTCACCTCTTCAG(SEQ ID NO:46)

[0398] IL6-R:TTCTGCCAGTGCCTCTTTGCTG (SEQ ID NO:47)

[0399] RIG-1-F:CACCTCAGTTGCTGATGAAGGC(SEQ ID NO:48)

[0400] RIG-1-R:GTCAGAAGGAAGCACTTGCTACC(SEQ ID NO:49)

[0401] CCL5-F:CCTGCTGCTTTGCCTACATTGC (SEQ ID NO:50)

[0402] CCL5-R:ACACACTTGGCGGTTCTTTCGG(SEQ ID NO:51)

[0403] IFNB1-F:CTTGGATTCCTACAAAGAAGCAGC(SEQ ID NO:52)

[0404] IFNB1-R:TCCCTCTTTCTGGAACTGCTGCA(SEQ ID NO:53)

[0405] Research Results:

[0406] Figure 17 shows the expression of immunogenic cytokines induced by circ-GLuc-mRNA prepared using the classic PIE and Hi-Scarless-PIE methods in A549 cells. Among them, the circular RNA precursor molecule (SEQ ID NO: 54) prepared using the classic PIE method was used as a control for immunogenicity comparison, and the circular RNA precursor molecule prepared using the Hi-Scarless-PIE method used the aforementioned SEQ ID NO: 8. 3p-hpRNA is a triphosphate hairpin RNA, which is a characteristic structure recognized by RIG-I and is an effective and specific agonist of RIG-I. In this experiment, 3p-hpRNA was used as a positive control that showed high immunogenicity in A549. Among the experimental groups, the PIE unpurified group consisted of samples synthesized using the classic PIE cyclization product without HPLC purification, the PIE purified group consisted of samples synthesized using the classic PIE cyclization product after HPLC purification, the Ym-11 unpurified group consisted of samples synthesized using the Hi-Scarless-PIE cyclization product without HPLC purification, and the Ym-11 purified group consisted of samples synthesized using the Hi-Scarless-PIE cyclization product after HPLC purification. The experiment compared the immunogenicity of circular RNA synthesized using the classic PIE method and the Hi-Scarless PIE method. The immunogenicity of circular RNA synthesized using HPLC and without HPLC purification was also compared.

[0407] The results are shown in Figure 17. Compared to the positive control, circ-GLuc-mRNA prepared by the classic PIE and Hi-Scarless-PIE methods, regardless of whether or not it was purified by HPLC, showed lower expression levels of the four cytokines. Compared to the group without HPLC purification, the samples purified by HPLC showed lower expression of IL6, INF-B1, and RIG-1. This trend was consistent in samples prepared by classic PIE and Hi-Scarless-PIE. At the same time, this experiment also observed that the samples prepared by classic PIE did not show a decrease in CCL5 expression levels after purification, while the samples prepared by Hi-Scarless-PIE showed a significant decrease in CCL5 expression levels after purification. Among the sample groups purified by HPLC, the samples prepared by Hi-Scarless-PIE showed lower expression of CCL5, IL6, and INF-B1 than the classic PIE method.

[0408] Based on the results of this experiment, the circular RNA prepared by the Hi-Scarless-PIE method showed immunogenicity comparable to or lower than that of classic PIE in cells.

[0409] Example 10. Circular mRNAs containing different IRES sequences prepared by the Hi-Scarless-PIE cyclization system can all express proteins in vitro

[0410] In this example, the protein expression levels of circular GLuc mRNAs with different IRES sequences prepared by Hi-Scarless-PIE in the present disclosure were detected in HEK-293T and A549 cells.

[0411] The nucleotide sequences involved in this embodiment are as follows: SEQ ID NO:8, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:55 and SEQ ID NO:56.

[0412] Implementation method:

[0413] Cell transfection: Before transfection, HEK-293T or A549 cells were seeded at 20,000 cells / well in 96-well plates. 50-100 ng (equimolar amount of each RNA) of the circular mRNA molecules prepared according to the method of Example 1 were then transfected into HEK-293T and A549 cells, respectively, using Lipofectamine 3000 transfection reagent (L3000001, Thermo Fisher Scientific) according to the manufacturer's instructions.

[0414] Protein expression analysis: 24 hours after transfection, 10 μl of culture supernatant was collected and luciferase activity was measured using the Pierce Gaussia Luciferase Glow Assay Kit (Thermo Fisher Scientific). Luciferase activity was measured using a SpectraMax i3 microplate reader (Molecular Devices).

[0415] Experimental results:

[0416] Figures 18A and 18B show the protein expression levels of circular GLuc mRNA with different IRES sequences in HEK-293T and A549 cells. Using the CVB3 IRES as a reference, significant differences in protein expression levels were observed for the same IRES in different cells. For example, GLuc translation levels for PV3 and CVA20 IRES were very low in A549 cells, but significantly increased in HEK-293T cells, reaching approximately half the level of CVB3 IRES. In A549 cells, CVB3 IRES and EV-B107 IRES expressed essentially the same protein, but in HEK-293T cells, EV-B107 IRES protein translation levels were reduced to approximately 15% of CVB3 IRES protein translation. These results suggest that IRES protein translation levels are cell-type selective and that different IRESs exhibit distinct cell-selective tendencies. This study demonstrates that circular mRNA molecules with different IRES sequences, generated using the Hi-Scarless-PIE system disclosed herein, can express proteins at the cellular level. The same IRES can express different levels of protein in different cells, and different IRESs can also express different levels of protein in the same cell. These results suggest that the protein translation initiation activity of different IRESs is cell-type selective.

[0417] Consistent with our findings, other research groups have also reported that IRES protein translation levels are cell- and tissue-selective. For example, at the 25th Annual Meeting of the American Society of Gene and Cell Therapy (ASGCT) in 2022, Alexander Wesselhoef reported a high-throughput screening study (Discovery of Translation Initiation Elements Enabled by a Parallel Arrayed Screen of Full-length Viral UTRs in Synthetic Circular RNA, May 16, 2022), which found that IRES activity is cell-type dependent, with different levels of protein translation in different cell types.

[0418] Based on this study and the reported cell and tissue selectivity of IRES activity, combined with the platform advantages of the versatility and practicality of the Hi-Scarless-PIE cyclization system demonstrated in Examples 5, 6, 7, and 8, this patent can be used to design circular mRNA products for the preparation of a wide range of medical uses based on the Hi-Scarless-PIE platform. The basic principle is shown in Figure 18C: The cap-independent translation initiation element (such as IRES) serves as a non-coding region. This patent can design a "ribozyme-TLSL cyclization module" in this region to achieve high-efficiency and high-fidelity circular mRNA preparation. Based on the diverse tissue-selective protein translation initiation activity of the IRES library and the flexible and variable protein encoding capacity of the mRNA coding region, the design of diseased tissue-specific circular IRES-mRNA drugs is achieved for the corresponding diseased tissues of a variety of diseases, thereby being used for the treatment of a wide range of diseases. Under this design concept, the IRES region simultaneously assumes the functions of high-efficiency circularization preparation and tissue-specific selection of protein expression, while the sequence of the mRNA coding region will not affect the efficiency of circularization preparation. Therefore, this design concept can be used for any mRNA sequence to achieve high-efficiency and high-fidelity circularization preparation and tissue-selective expression of mRNA therapy.

[0419] In summary, the Hi-Scarless-PIE invented in this patent is a universal circular mRNA preparation platform that can be used for a wide range of biomedical applications.

[0420] Example 11. Detection of protein expression levels of cyclic hEPO and EGFP

[0421] In this example, the protein expression of cyclic hEPO and cyclic EGFP mRNA prepared using the Hi-Scarless-PIE method was detected.

[0422] The nucleotide sequences involved in this embodiment are as follows:

[0423] EGFP-precursor: SEQ ID NO: 57

[0424] hEPO-precursor: SEQ ID NO: 58

[0425] Implementation Method: Before transfection, HEK-293T cells were seeded at 20,000 cells / well in a 96-well plate. Then, 100 ng of circ-EGFP, hEPO, and GLuc mRNA molecules from the Hi-Scarless-PIE system of the present invention, prepared according to the method of Example 1, were transfected into the HEK-293T cells using Lipofectamine 3000 transfection reagent (L3000001, Thermo Fisher Scientific) according to the manufacturer's instructions. Green fluorescence expression was observed 24 hours later using an inverted fluorescence microscope (OLYMPUS inverted CKX53 microscope). For HEK-293T cells transfected with circ-hEPO mRNA, 10 μL of culture supernatant was collected 24 hours later and the hEPO protein concentration in the supernatant was measured using the Human Erythropoietin ELISA Kit (hEPO) (ab274397, Abcam) according to the manufacturer's instructions. ELISA assays were performed using a SpectraMax i3 microplate reader (Molecular Devices).

[0426] Experimental results: Figure 19 shows the protein expression of cyclic hEPO and cyclic EGFP mRNA prepared using the Hi-Scarless-PIE method. Figure 19A is the fluorescence detection result of the circ-EGFP protein expression level. The circ-hEPO here has no fluorescence and is used as a negative control for EGFP fluorescence detection. The results show that circ-hEPO has no specific green fluorescence, while circ-EGFP shows obvious specific green fluorescence. Figure 19B is the protein expression detection result of circ-hEPO. Gluc here is used as a negative control. The results show that there is no hEPO detection signal in the Gluc group, while the hEPO protein concentration detected in the hEPO group reaches about 2000mIU / ml. This example demonstrates that the circular RNA prepared using the Hi-Scarless-PIE method can effectively express EGFP and hEPO genes.

[0427] Example 12. Dynamic Trends in In Vitro Protein Expression Levels of Circular mRNA Prepared by the Hi-Scarless-PIE Circularization System

[0428] This example compares the protein expression trends of capped and tailed linear RNA, circular RNA prepared using the classic PIE system, and circular mRNA prepared using the Hi-Scarless-PIE system in HEK-293T and A549 cells over time. The sequences involved are as follows:

[0429] Capped and tailed linear mRNA (SEQ ID NO: 59)

[0430] PIE Circular (SEQ ID NO: 54) is a circular mRNA precursor molecule produced by the classic PIE system.

[0431] Circular mRNA precursor molecule SEQ-01Circular (SEQ ID NO: 8) prepared by Hi-Scarless-PIE

[0432] Implementation method:

[0433] Linear mRNA synthesis and purification: The linear mRNA used the 5'-UTR region sequence (SEQ ID NO: 60) and 3'-UTR region sequence (SEQ ID NO: 61) from the human beta-globin (HBB) gene. The linear mRNA obtained by the in vitro transcription method in Example 1 was heated at 65°C for 5 minutes and then immediately placed in an ice bath for 5 minutes. The cap structure was then added to the transcript using vaccinia virus capping enzyme (M2080, New England Biolabs) and mRNA cap-2'-O-methyltransferase (M0366, New England Biolabs) according to the operating instructions of New England Biolabs. Then, the poly (A) tail was added to the capped transcript using Escherichia coli Poly (A) polymerase (M0276, New England Biolabs). The fully processed product was then purified by RNA was purified using RNA Cleanup Kit (T2050, New England Biolabs).

[0434] Cell transfection: Before transfection, HEK-293T or A549 cells were seeded at 20,000 cells / well in a 96-well plate. Then, 50-100 ng (equimolar amount of each RNA) of the circular mRNA or capped and tailed linear mRNA molecules of the Anabaena PIE system and the Hi-Scarless-PIE system of the present disclosure prepared according to the method of Example 1 were transfected into HEK-293T and A549 cells respectively using Lipofectamine 3000 transfection reagent (L3000001, Thermo Fisher Scientific) according to the manufacturer's instructions.

[0435] Protein expression analysis: For HEK-293T cells, 10 μl of culture supernatant was collected 24 hours (Day 1), 48 hours (Day 2), 72 hours (Day 3), 96 hours (Day 4), 120 hours (Day 5), 144 hours (Day 6), and 168 hours (Day 7) after transfection, and luciferase activity in the supernatant was measured using the Pierce Gaussia Luciferase Glow Assay Kit (Thermo Fisher Scientific). For A549 cells, 10 μl of culture supernatant was collected 24 hours (Day 1), 48 hours (Day 2), and 72 hours (Day 3) after transfection, and luciferase activity in the supernatant was measured using the Pierce Gaussia Luciferase Glow Assay Kit (Thermo Fisher Scientific). Luciferase activity was measured using a SpectraMax i3 microplate reader (Molecular Devices). After each day of testing, the culture medium was completely removed and replaced with new culture medium in the culture plate.

[0436] Research Results:

[0437] Figure 20 shows the trend of protein expression levels over time in HEK-293T and A549 cells using traditional capped and tailed linear mRNA, the classic PIE system, and the circular mRNA prepared by Hi-Scarless-PIE in the present disclosure. The results are shown in Figure 20. Linear is the traditional capped and tailed linear mRNA, PIE Circular is the circular RNA prepared by the classic Anabaena PIE system, and SEQ-01Circular is the circular mRNA prepared by Hi-Scarless-PIE in the present disclosure. Figure 20 shows that in HEK-293T cells, SEQ-01Circular is the same as PIE Circular, and both can continuously and stably express Gaussia Luciferase protein at a high level, with a protein expression half-life of 4-5 days, which is significantly better than the linear mRNA group. In A549 cells, SEQ-01Circular has the same protein expression trend as PIE Circular, and both are better than linear mRNA, with a half-life of 2 days.

[0438] These results indicate that, similar to the classical PIE system, the circular mRNA prepared by Hi-Scarless-PIE in the present invention has prolonged stability, a long in vivo half-life, and significantly increased protein expression efficiency.

[0439] Example 13. Protein expression in mice using circular mRNA prepared using the Hi-Scarless-PIE cyclization system

[0440] In this example, the protein expression of circular mRNA prepared by the Anabaena PIE system and the Hi-Scarless-PIE disclosed in this disclosure in mice was tested.

[0441] Implementation Method: Circular mRNAs CVB3-FLUC (SEQ ID NO: 62) and its circRNA precursors SEQ ID NO: 63 and SEQ ID NO: 58, respectively, were prepared according to the method described in Example 1. A circRNA molecule (SEQ ID NO: 64) prepared according to the classical PIE method (its circRNA precursor SEQ ID NO: 65) was used as a control group. Furthermore, CVB3-hEPO (SEQ ID NO: 66) and its circRNA precursor (SEQ ID NO: 58) were prepared in this example, along with a circRNA precursor (SEQ ID NO: 67) used in the classical PIE preparation protocol. The prepared circular mRNAs were purified according to the method described in Example 1.

[0442] Preparation of circular mRNA-LNPs: The purified product was used to prepare circular mRNA-lipid nanoparticle complexes. The specific steps were as follows: DLin-MC3-DMA:DSPC:cholesterol:DMG-PEG2000 (Aiweituo (Shanghai) Pharmaceutical Technology Co., Ltd.) was dissolved in ethanol at a lipid molar ratio of 50:10:38.5:1.5, and the circular RNA was dissolved in 10 mM sodium citrate buffer, pH 4.5. The two phases were rapidly mixed using a microfluidic device (INano L / L+, Maianna (Shanghai) Instrument Technology Co., Ltd.) at a total flow rate of 12 ml / min, with a flow rate ratio of 3:1 between the aqueous buffer (circular RNA) and the ethanol-lipid mixture. After preparation, the ethanol was removed using ultrafiltration tubing and replaced with PBS. The particle size, polydispersity index (PDI), and zeta potential of the circular RNA-plasmid nanocomplexes were then measured by dynamic light scattering (DLS) using a laser particle size analyzer (Zetasizer Nano-ZSP, Malvern, UK), and the content of circular RNA in the complex and the encapsulation efficiency were detected using Quant-iT Ribogreen (Thermo Fisher Scientific).

[0443] In vivo administration: The prepared circ-FLuc-mRNA-LNP lipid nanoparticles were injected into the right hind leg muscle of approximately 8-week-old Balb / c mice at a dose of 3 μg per mouse. Whole-body fluorescence intensity was measured on days 1, 3, 7, 14, and 21 after injection. The prepared circ-FLuc-mRNA-LNP lipid nanoparticles were injected intravenously into approximately 8-week-old Balb / c mice at a dose of 8 μg per mouse. Whole-body fluorescence intensity was measured on days 1, 3, and 7 after injection. Prior to measurement, D-Luciferin potassium salt (ST196-25 mg, Beyotime) was injected via the tail vein at a dose of 10 μl / g body weight. Fluorescence intensity was measured using a small animal fluorescence imaging system (PerkinElmer, IVIS Spectrum) 10-20 minutes after injection, after the fluorescence signal reached a peak plateau. The prepared circ-hEPO-mRNA-LNP lipid nanoparticles were injected intravenously into 8-week-old Balb / c mice at a dose of 8 μg per mouse. Blood samples were collected 6, 12, 24, 48, 72, and 96 hours after injection, and plasma hEPO protein concentrations were measured using a Human Erythropoietin ELISA Kit (hEPO) (ab274397, Abcam).

[0444] Research Results:

[0445] Figure 21 shows the preparation and characterization of circular FLuc-mRNA prepared using the classical PIE method and the Hi-Scarless-PIE method for LNP lipid nanoparticle encapsulation. Among them, the characterization experimental results of circ-GLuc mRNA prepared using the classical PIE method (Figure 21A) and the Hi-Scarless-PIE method (Figure 21B) and LNP encapsulation are shown in the figure. The results of this experiment demonstrate that the circular RNA molecules prepared using the Hi-Scarless-PIE method have relatively consistent properties when preparing LNP encapsulation mixtures.

[0446] Figure 22 shows protein expression in mice of cyclic FLuc-mRNA-LNP lipid nanoparticles prepared using the classical PIE method and the Hi-Scarless-PIE method, respectively. Figures 22A and 22B show the expression of FLuc protein after intramuscular injection of cyclic FLuc-mRNA-LNP and the statistical results of expression levels. Compared with the control group, FLuc protein was significantly expressed after injection of cyclic FLuc-mRNA-LNP, and the high expression of FLuc protein was sustained for at least one week. Figure 22C shows the expression of FLuc protein after intravenous injection of cyclic FLuc-mRNA-LNP. Compared with the control group, significant FLuc protein expression was detected one day after intravenous injection of cyclic FLuc-mRNA-LNP.

[0447] Figure 22D shows the expression of hEPO in mouse plasma after intravenous injection of circ-hEPO-mRNA-LNP lipid nanoparticles. The concentration of hEPO was at a high level 6 hours, 12 hours, and 1 day after injection, and decreased significantly after 2 days after injection.

[0448] The results of this experiment demonstrated that, similar to circular RNA molecules prepared using classic PIE, circular RNA molecules prepared using the Hi-Scarless-PIE method can efficiently express target proteins in mice.

[0449] Example 14. Design and verification of Uni-cRNA circular RNA constructs

[0450] In this example, a single stem-loop (SL) cyclization element was identified and, based on the sequence near the splice site on the SL, the Ana-PIE intronic ribozyme was engineered accordingly. Furthermore, a process and method were developed to construct a "ribozyme-SL cyclization module" from the engineered ribozyme and the SL, ultimately forming a Uni-cRNA circular RNA construct. The effectiveness of this construct in synthesizing circular RNA was experimentally verified.

[0451] The design principle of the Uni-cRNA circular RNA construct in the present invention is shown in FIG23 .

[0452] The SL cyclization element consists of a stem-loop structure and a ribozyme recognition site located on the terminal loop.

[0453] In this example, various scenarios were explored, including searching for stem-loop structures and selecting SL structural elements in the IRES region and CDS (mRNA coding region), as well as searching for SL structural elements in native sequences and algorithm-optimized non-native sequences. This example also demonstrated two scenarios in which the splice site is located in the terminal loop and in the internal loop of the SL. Circular RNA constructs for each of these scenarios were constructed and tested for their efficiency in producing circular RNA.

[0454] Searching for the SL cyclization element in the IRES region: First, the SL cyclization element was obtained by the following steps: In CVB3IRES (SEQ ID NO.68), its secondary structure is shown in Figure 24A, and the schematic diagram of the CVB3 IRES secondary structure is cited from the literature (Nat Biotechnol. 2023; 41(2): 262-272). Based on the secondary structure of CVB3 IRES, the SL cyclization element was selected to be located at the nucleotide sequence of positions 183 to 232 of CVB3 IRES, named Stem-loop-CVB3-IRES (SEQ ID NO.69), and its secondary structure is shown in Figure 24B. Secondly, the splicing site was selected: (1) The splicing site is located between the 24th U and the 25th C of the Stem-loop-CVB3-IRES sequence. The arrow in Figure 24B shows the position of the splicing site. In this example, the target circular RNA sequence (SEQ ID NO. 71) is composed of CVB3-IRES (SEQ ID NO. 68) and the mRNA coding region of Gaussia Luciferase (GLuc) (SEQ ID NO. 70). Based on the selected splice site, the Seq 4 sequence is separated from the splice site to form the linear counterpart of the target circular RNA sequence (SEQ ID NO. 72).

[0455] Design of a GLuc circular RNA precursor molecule based on the modified Ana-PIE ribozyme: The 3' end section of the Ana-PIE ribozyme (SEQ ID NO.73), the linear counterpart of the target circular RNA sequence (SEQ ID NO.72), and the 5' end section of the modified Ana-PIE ribozyme (SEQ ID NO.74) were connected to each other to form a GLuc circular RNA precursor molecule based on the modified Ana-PIE ribozyme, named circ-CVB3-IRES-GLuc-precursor (SEQ ID NO.75).

[0456] Synthesis of the circular RNA precursor molecule and construct designed above: First, DNA sequences corresponding to SEQ ID NO. 68, SEQ ID NO. 70, SEQ ID NO. 73, and the 5' end section (SEQ ID NO. 76) of the natural Ana-PIE ribozyme were synthesized (Beijing Qingke Biotechnology Co., Ltd.). These DNA sequences were cloned into the linear plasmid vector pUC57 containing a T7 promoter generated by PCR (GenBuilder Plus Cloning Kit, L00744, GenScript Biotechnology Co., Ltd.) to obtain the corresponding construct (i.e., a construct formed using the natural Ana-PIE intron). Based on this construct, the sequence of the 5' end section (SEQ ID NO: 76) of the natural Ana-PIE ribozyme was modified, wherein the A at position 10 of the 5' end of SEQ ID NO: 76 was mutated to G, and the G at position 11 was mutated to C, forming the modified Ana-PIE ribozyme intron construct.

[0457] Prepare linear plasmid template: Transform the plasmid into Top10 competent cells, plate, and select clones the next day and expand the culture in LB medium containing Amp resistance (37°C / 200rpm / overnight). Then perform plasmid extraction (endotoxin-free plasmid mini-extraction kit, DP118, Tiangen Biochemical Technology (Beijing) Co., Ltd.). Then use EcoRI (1040, Takara) single enzyme digestion method to prepare linearized plasmid template (37°C, 1 hour). The enzyme digestion products were recovered using a PCR & DNA Cleanup Kit (T1030, New England Biolabs), their concentrations were determined using a Nano-Drop (Thermo) and identified using 1.5% agarose gel electrophoresis. The purified linear plasmid was used as a template for in vitro transcription.

[0458] Preparation of circRNA precursors by in vitro transcription: The linearized plasmid DNA template was transcribed in vitro (37°C, 2 hours) using T7 High Yield RNA Synthesis Kit (E2040S, New England Biolabs) to synthesize the cicrRNA precursor. After in vitro transcription, the linear DNA template was digested with DNaseI (M0303S, New England Biolabs) (37°C, 15 min). Column purification was performed using RNA Cleanup Kit (T2050, New England Biolabs).

[0459] circRNA synthesis: The circular RNA precursor molecule was added to a buffer containing GTP (final concentration of 2 mM) (50 mM Tris-HCl, 10 mM MgCl2, 1 mM DTT, pH 7.5), and the above solution was heated at 55 ° C for 15 min, and then column purification was performed ( RNA Cleanup Kit, T2050, New England Biolabs).

[0460] Identification of circular RNA by capillary electrophoresis: Circularized RNA precursors and crude circularized RNA were concentrated using a Nano-Drop (Thermo Fisher Scientific) assay. The product was then processed using the QIAxcel RNA High Sensitivity Cartridge Kit (929112) according to the manufacturer's instructions. Detection and analysis were performed using the QIAxcel Connect capillary electrophoresis instrument according to the manufacturer's instructions. A high-sensitivity RNA marker (QIAxcel RNA High-Sensitivity Marker Set, 929112, QIAGEN) was used to identify RNA bands of varying sizes.

[0461] Search for SL cyclization elements in the CDS region:

[0462] (1) Native sequence: In Gaussia Luciferase (SEQ ID NO. 70), the SL cyclization element located at nucleotides 384 to 420 of Gaussia Luciferase was selected based on its secondary structure and named SL-Gaussia Luciferase (SEQ ID NO. 77). Its secondary structure is shown in Figure 25. The splice site is located between U at position 18 and C at position 19 of the SL-Gaussia Luciferase sequence. The arrows in Figure 25 indicate the location of the splice site in the full-length GLuc.

[0463] (2) Non-natural sequences optimized using computer algorithms: A large number of computer algorithms can optimize the sequence of RNA, thereby improving the properties or functions of the RNA molecule itself. Among them, Linear design is a representative algorithm for optimizing the CDS region of mRNA. This algorithm makes the sequence of the CDS region of mRNA more stable by replacing synonymous codons without affecting the encoded protein product. In this embodiment, in the Gaussia Luciferase sequence optimized by Linear design (SEQ ID NO.78), based on the secondary structure, it was found that the nucleotide sequence from the 384th to the 420th position of the Gaussia Luciferase sequence optimized by Linear design is also a stem-loop (SEQ ID NO.79), and the stem-loop was selected as the SL cyclization element. The secondary structure of the sequence without Linear Design optimization is shown in Figure 26A, and the secondary structure of the sequence after Linear Design optimization is shown in Figure 26B. Figure 26C shows the specific location of the splicing site as indicated by the arrow. The splicing site is located between the 18th U and the 19th G in the SL-Gaussia Luciferase sequence. The splicing site was selected, and then the corresponding circular RNA precursor molecules (SEQ ID NO.80 and SEQ ID NO.81) were synthesized according to the above-mentioned design and synthesis method of circ-CVB3-IRES-GLuc-precursor.

[0464] The splicing site is on the internal loop: In addition to the terminal loop in the stem-loop, common loop structures in RNA also include internal loops. Therefore, this example compares the effects of the splicing site being located at the terminal loop and at the internal loop on the cyclization efficiency. The secondary structure diagram of CVB3 IRES is shown in Figure 27A, which is cited from the literature (Nat Biotechnol. 2023; 41(2): 262-272). In CVB3 IRES (SEQ ID NO. 68), the SL cyclization element was selected based on the secondary structure. The nucleotide sequence from position 183 to position 232 of CVB3 IRES was named SL-CVB3-IRES (SEQ ID NO. 69), and its secondary structure is shown in Figure 27B. Secondly, the splicing site was selected: the splicing site is located between the 16th U and the 17th A of the SL-CVB3-IRES sequence, as shown by the arrow in Figure 27B. The splicing site was selected, and then the corresponding circular RNA precursor molecule (SEQ ID NO.82) was synthesized according to the above-mentioned design and synthesis method of circ-CVB3-IRES-GLuc-precursor.

[0465] The results are shown in Figure 28. Capillary lanes 1 and 2 show a circular RNA precursor molecule with a splice site located within the internal loop and its subsequent circularization product, respectively. Compared to lanes 1 and 2, the bands in lane 2 are primarily located within the linear RNA, with only a small amount of circular bands. Circularization efficiency was calculated using the QIAxcel Connect capillary electrophoresis instrument's built-in software (QIAxcel ScreenGel 2.0). Circularization efficiency = 100% * Circularization / (Linearization + Circularization). Quantitative results showed a circularization efficiency of 6.77% for this group. Capillary lanes 5 and 6 show a circular RNA precursor molecule synthesized within the terminal loop of the stem loop of the CVB3 IRES and its subsequent circularization product, respectively. Compared to lane 5, the bands in lane 6 are primarily located within the circular RNA, and quantitative results show a circularization efficiency of 62.41%. These two experimental results demonstrate that the circularization efficiency of splice sites located within the terminal loop is significantly higher than that within the internal loop.

[0466] As shown in Figure 28, capillary lanes 3 and 4 show the circular RNA precursor molecule and the circularized product, respectively, synthesized with the splicing site at the terminal loop of the natural Gaussia Luciferase sequence. Capillary lanes 7 and 8 show the circular RNA precursor molecule and the circularized product, respectively, synthesized with the splicing site at the terminal loop of the Gaussia Luciferase sequence optimized by Linear Design. Compared with the circular RNA precursor molecule, the main band of the circularized product is located at the position of the circular RNA, and the circularization efficiency of the natural Gaussia Luciferase sequence and the Gaussia Luciferase sequence optimized by Linear Design are comparable, at 78.55% and 79.21%, respectively. These results demonstrate that the "ribozyme-SL circularization module" can achieve highly efficient circularization preparation in both natural and non-natural RNA sequences.

[0467] The capillary electrophoresis peak data and cyclization efficiency used for quantitative calculation in this experiment are shown in the following table.

[0468] Example 15. Uni-cRNA Circularization System Can Prepare Sequence-Precise Circular RNA Molecules

[0469] In this embodiment, a variety of methods are used to identify whether the product of the present invention is the target circular RNA molecule, including:

[0470] 1. Identification by RNaseR. RNaseR is a 3'-5' exonuclease that cleaves and degrades RNA from the 3'-5' direction. It can degrade linear RNA molecules, but cannot degrade circular RNA without 3' and 5' ends.

[0471] The specific steps are as follows: the purified circular RNA or linear circRNA precursor was heated at 65°C for 3 minutes and then immediately placed on ice for 2 minutes. The linear RNA was then digested with RNaseR (E049, Applied Biological Materials) (37°C, 30 minutes). The RNA digested with RNase R was purified by column purification using RNA Cleanup Kit (T2050, New England Biolabs), and then analyzed by agarose gel electrophoresis using 1.5% agarose gel.

[0472] The results are shown in Figure 29A. Lanes 1 and 3 represent the linear circRNA precursor (precursor-mRNA, SEQ ID NO: 80) that did not undergo cyclization, lanes 2 and 4 represent the cyclized product, and lanes 3 and 4 represent the results after RNaseR treatment. As shown in the figure, after cyclization, the main band in lane 2 is located below the band in lane 1, with a distinct band appearing at the bottom, suggesting that the cyclization reaction produces a circular mRNA molecule with a reduced molecular weight and a very small intronic fragment. The RNaseR-treated group showed no band in lane 3, while the band in lane 4, presumed to be a circular RNA, remained unaffected by RNaseR. Lanes 8 and 10 represent the linear circRNA precursor (precursor-mRNA, SEQ ID NO: 81) that did not undergo cyclization, lanes 9 and 11 represent the cyclized product, and lanes 10 and 11 represent the results after RNaseR treatment. As shown in the figure, after circularization, the main band in lane 9 is located below the band in lane 8, with a distinct band appearing at the very bottom. This suggests that the circularization reaction produces circular mRNA molecules with reduced molecular weight and very small intronic fragments. In the RNaseR-treated group, no band appears in lane 10, while the band in lane 11, presumed to be a circular RNA, remains unaffected by RNaseR.

[0473] 2. Identify using RNase H. RNase H is an endoribonuclease that specifically hydrolyzes RNA within DNA-RNA hybrids. Due to the structural differences between linear and circular RNAs, when the same probe binds to both linear and circular RNAs, the linear RNA is cleaved into two bands, while the circular RNA is simply cleaved into a single linear band.

[0474] The specific steps are as follows: a 10-fold molar excess of DNA probe was added to the circular RNA obtained by RNase R treatment, followed by heating at 65°C for 5 minutes and annealing at room temperature. Subsequently, the RNA was digested with RNase H (M0279, New England Biolabs) at 37°C for 20 minutes, and the digested RNA was column-purified. The DNA probe sequences are shown in SEQ ID NO:83 and SEQ ID NO:84.

[0475] The experimental results are shown in Figure 29A. In the Seq-13 group, lane 5 is a linear RNA precursor molecule, and lane 6 is the product of the circularization reaction. After the samples in lanes 5 and 6 were treated with RNase H, lane 5 formed two bands, while lane 6 formed a single band, suggesting that lane 6 contains circular RNA. Similarly, in the Seq-14 group, lane 12 is a linear RNA precursor molecule, and lane 13 is the product of the circularization reaction. After treatment with RNase H, lane 12 formed two bands, while lane 13 formed a single band, suggesting that lane 13 contains circular RNA.

[0476] 3. Verify the accuracy of the ribozyme recognition site sequence by RT-PCR and Sanger sequencing. While methods 1 and 2 above can confirm the formation of a circular RNA molecule after the circularization reaction, the accuracy of the connection near the splice site requires further sequencing verification. Therefore, this example also utilizes sequencing at the splice site to confirm that the circularization reaction occurs at the expected location, forming the target circular RNA molecule.

[0477] The specific steps are as follows: Circular RNA obtained by RNase R treatment is synthesized into first-strand cDNA using a random primer using the RevertAid First Strand cDNA Synthesis Kit (K1622, Thermo Fisher Scientific). Two forward and reverse PCR primers are then designed upstream and downstream of the splice junction, respectively. Using the cDNA as a template, PCR is performed to obtain the amplified fragment, which is then verified by sequencing. The circular mRNA molecule will be detected near the splice site, along with an RNA sequence that spans the expected splice site. The primer sequences are shown in SEQ ID NO:85, SEQ ID NO:86, SEQ ID NO:87, and SEQ ID NO:88.

[0478] The results, shown in Figures 29B and 29C , show that the sequencing results for Seq-13 and Seq-14 confirmed that the sequences flanking the splice site were consistent with the designed circular RNA sequence, demonstrating that the circular RNA head and tail had been connected. The correct circular mRNA molecule was successfully obtained.

[0479] In summary, this embodiment verifies that the target circular RNA molecule is successfully synthesized in an in vitro cyclization reaction system by three complementary methods.

[0480] Example 16. Circular mRNAs prepared by the Uni-cRNA Circularization System can all express proteins in cells

[0481] In this example, the protein expression level of circular GLuc mRNA prepared by Uni-cRNA in the present disclosure was detected in HEK-293T and A549 cells.

[0482] The nucleotide sequences involved in this example are as follows: SEQ ID NO: 75, SEQ ID NO: 89 (this sequence is the circular RNA construct circ-CVA20-IRES-GLuc-precursor synthesized by searching for a stem-loop in CVA20IRES, determining the splicing site, and synthesizing the same according to the method described in Example 14), SEQ ID NO: 90 (this sequence is the circular RNA construct circ-CVB3-IRES-hEPO-precursor synthesized by searching for a stem-loop in hEPO CDS, determining the splicing site, and synthesizing the same according to the method described in Example 14).

[0483] Implementation method:

[0484] Cell transfection: Before transfection, HEK-293T or A549 cells were seeded at 20,000 cells / well in 96-well plates. Then, approximately 100 ng (equimolar amount of each RNA) of circular mRNA molecules prepared according to the method of Example 1 were transferred into HEK-293T and A549 cells respectively using Lipofectamine 3000 transfection reagent (L3000001, Thermo Fisher Scientific) according to the manufacturer's instructions. After RNase R purification, the circular mRNA molecules were transferred into HEK-293T and A549 cells respectively.

[0485] Protein expression analysis: 24 hours after transfection, 10 μL of culture supernatant was collected from cells transfected with circ-GLuc, and the luciferase activity in the supernatant was detected using the Pierce Gaussia Luciferase Glow Assay Kit (Thermo Fisher Scientific). Luciferase activity was detected using a SpectraMax i3 microplate reader (Molecular Devices). For HEK-293T cells transfected with circ-hEPO mRNA, 10 μL of culture supernatant was collected 24 hours later, and the concentration of hEPO protein in the supernatant was detected using the Human Erythropoietin ELISA Kit (hEPO) (ab274397, Abcam) according to the manufacturer's instructions. ELISA detection was performed using a SpectraMax i3 microplate reader (Molecular Devices).

[0486] Experimental Results: Figures 30A and 30B show the protein expression levels of circular GLuc mRNA containing different IRES sequences in HEK-293T and A549 cells, respectively. Figure 30C shows the protein expression levels of circular hEPO mRNA containing the CVB3 IRES sequence in HEK-293T cells. These results demonstrate that circular RNA prepared using the Uni-cRNA method of the present invention can effectively express GLuc and hEPO proteins.

[0487] Example 17. SL structural elements are widely present in different types of RNA molecules

[0488] In order to confirm the scope of application of the "ribozyme-SL cyclization module" approach in diverse RNA molecules, this example comprehensively analyzes the distribution of SL structural elements in various RNA molecules. Stem-loop structure is one of the most basic RNA secondary structures and is widely present in various RNA molecules. This example only uses several common RNA categories for exemplary analysis, where a representative data set is selected for analysis for each type of RNA. The present invention mainly involves two major categories of RNA molecules: 1) mRNA (mRNA molecules serve as translation templates, and translation produces corresponding protein products as effector molecules), and 2) non-mRNA (not used to encode polypeptides and proteins, but the RNA molecule itself is used as the effector molecule). Therefore, in this example, the human mRNA reference set is selected as the analysis object for mRNA, and non-mRNA selects non-coding RNA (ncRNA) as the analysis object for non-mRNA. In addition, the IRES element is the most commonly used translation initiation regulatory element in circular mRNA, so this example also analyzes the distribution of stem-loop in IRES. For each type of RNA, the sources and acquisition methods of the representative data sets selected in this example are as follows:

[0489] 5'-UTR and 3'-UTR sequences were obtained from the UTRdb database (UTRdb 2.0: a comprehensive, expert curated catalog of untranslated regions of eukaryotic mRNAs. Lo Giudice C, Zambelli F, Chiara M, et al. Nucleic Acids Res. 2023 Jan 6;51(D1):D337-D344). The UTRdb database currently contains over 12.9 million 5'-UTR sequences and over 13.19 million 3'-UTR sequences from 673 species. To save computational time, this study used human UTR sequences as a representative case for TLS analysis. UTRdb contains a total of 93,457 5'-UTR sequences and 87,932 3'-UTR sequences. Inclusion criteria for analysis were: 1) sequence length greater than 150 nt; 2) only the longest sequence from the same gene was retained. Finally, a total of 12,661 5'-UTR sequences and 18,414 3'-UTR sequences were included in this analysis.

[0490] Human mRNA coding region sequences are derived from the Consensus Coding Sequence (CCDS) database (Consensus coding sequence (CCDS) database: a standardized set of human and mouse protein-coding regions supported by expert curation. Pujar S, O'Leary NA, Farrell CM, et al. Nucleic Acids Res. 2018 Jan 4; 46 (D1): D221-D228.). Specifically, a file containing CDS nucleotide sequences (file name "CCDS_nucleotide.current.fna.gz") was downloaded from the official website of the CCDS database. This version of the CCDS database contains a total of 35,624 human CDS sequences, all of which were included in the analysis.

[0491] The IRES sequence is derived from the IRESbase database (IRESbase: A Comprehensive Database of Experimentally Validated Internal Ribosome Entry Sites. Zhao J, Li Y, Wang C, et al. Genomics Proteomics Bioinformatics. 2020 Apr; 18(2): 129-139.), which contains a total of 1,328 IRES sequences. IRES sequences come from humans, viruses, and other eukaryotic organisms. The dataset also contains some artificially designed IRES sequences with a length of 174 nt.

[0492] The non-coding RNA (ncRNA) dataset is derived from the RNAChallenge benchmark dataset, a benchmark dataset used to evaluate protein-coding and non-coding RNA classification algorithms. It contains 11,040 ncRNA sequences from multiple species (A large-scale benchmark study of tools for the classification of protein-coding and non-coding RNAs. Dalwinder Singh and Joy Roy. Nucleic Acids Research, gkac1092, 2022). The dataset can be downloaded from https: / / github.com / cbl-nabi / RNAChallenge.

[0493] Experimental methods:

[0494] Search for stem-loop structure in RNA secondary structure. First, the RNAfold algorithm is used to predict the secondary structure of the RNA sequence, and the prediction results are presented using dot-bracket notation. Then, the stem-loop search program built in this article is used to search the secondary structure file for each RNA sequence to see whether it contains a stem-loop structure and the number of different stem-loops. In this embodiment, the length of the stem-loop arm is limited to ≥2 consecutive complementary paired nucleotides, and the size of the loop is set to contain n (3≤n≤10) unpaired nucleotides.

[0495] Research Results:

[0496] The results are shown in the table below and in Figure 31A. Using stem-loop structural features for matching, the percentage of sequences containing at least one stem-loop in the human 5'-UTR, human CDS, human 3'-UTR, IRES, and non-coding RNA sequence sets analyzed in this example was 99.69%, 99.99%, 99.85%, 98.72%, and 100%, respectively (Figure 31A). Furthermore, Figures 31B-F show the percentage of sequences containing 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, and more than 10 stem-loop structures within the same sequence. The results show that sequences containing more than 10 stem-loop structures are very common in the human CDS region, human 3'-UTR, and ncRNA sequence sets, accounting for the vast majority of sequences. This provides a vast number of alternative splice sites for the design of the "ribozyme-SL structural module" of the present invention. The number of stem-loops in the IRES sequence set is mainly distributed between 1 and 5, while the number of stem-loops in the 5'-UTR sequence set is mainly distributed between 2 and 6. This may be due to the shorter average sequence lengths of IRES and 5'-UTR.

[0497] discuss

[0498] Example 5, Example 6, Example 7 and Example 8 together illustrate that, in the present invention, the Hi-Scarless-PIE cyclization system based on the modular design concept of "ribozyme-TLSL cyclization module" has good versatility and practicality. Exemplarily (as shown in Figure 16B), for the target mRNA sequence, when the sequence contains TLSL structural elements, the "ribozyme-TLSL cyclization module" can be directly designed and high-efficiency cyclization preparation can be achieved. When the target mRNA molecule does not contain TLSL structural elements, the pre-designed TLSL structural element module can be inserted in the appropriate area, thereby designing the "ribozyme-TLSL cyclization module" and achieving high-efficiency cyclization preparation. This fully illustrates that the Hi-Scarless-PIE cyclization platform proposed in the present invention is a universal circular mRNA preparation platform.

[0499] Circular RNAs are primarily used in two categories: mRNA and non-coding RNA. When using an IRES+CDS sequence combination within circular mRNA, the SL structural element is found in nearly 100% of the combined sequences, enabling the construction of a "ribozyme-SL circularization module" for highly efficient circular mRNA production. SL structural elements are present in nearly all non-coding RNAs, so the present invention enables the design of a corresponding "ribozyme-SL circularization module" to achieve highly efficient non-coding RNA circularization.

[0500] In summary, Examples 14, 15, and 17 collectively demonstrate that the Uni-cRNA cyclization platform based on the "ribozyme-SL cyclization module" proposed by the present invention can achieve highly efficient in vitro cyclization preparation of almost any RNA molecule. Example 16 demonstrates that circular mRNA prepared using Uni-cRNA can efficiently express proteins. These examples collectively demonstrate that the Uni-cRNA of the present invention is a universal, highly efficient, and high-fidelity RNA cyclization technology suitable for preparing circular mRNA and circular non-coding RNA for a wide range of applications.

[0501] All documents mentioned in this application are incorporated herein by reference, just as if each document were incorporated herein by reference individually. It should also be understood that after reading the above teachings of the present invention, those skilled in the art may make various changes or modifications to the present invention, and that such equivalents also fall within the scope of the claims appended hereto.

Claims

1. A polynucleotide for preparing circular RNA, characterized in that: From the 5' end to the 3' end, the polynucleotide comprises an operably linked module Z1, a module to be cyclized L, and a module Z2, wherein the polynucleotide is a linear structure; The modules Z1 and Z2 are reconstructed into a ribozyme with self-splicing function, and self-splicing (cutting and connecting) is performed under appropriate conditions, so that the module L to be circularized forms a circular RNA, wherein the splicing site is located in the distal loop region (distal loop region) in the stem-loop structure (stem-loop structure) formed by the module L to be circularized after the circular RNA is formed.

2. The polynucleotide according to claim 1, wherein The stem-loop structure is a single stem-loop structure or a poly stem-loop structure.

3. The polynucleotide according to claim 2, wherein The single stem-loop structure has a stem region and a terminal loop region located at the distal end of the stem region.

4. The polynucleotide according to claim 2, wherein The poly stem-loop structure has 2-5 terminal loop regions.

5. The polynucleotide according to claim 1, wherein The polynucleotide has a structure shown in Formula I: Z1-L-Z2 (Formula I) Z1 contains the 3′ end section h1 of the ribozyme; L is the linear counterpart of the target sequence; Z2 contains the 5' end section h2 of the ribozyme.

6. The polynucleotide according to claim 1, wherein The Z1 further comprises a 3' end section h1 of the ribozyme and a random sequence r1, and the Z2 further comprises a 5' end section h2 of the ribozyme and a random sequence r2. The structural formula of the polynucleotide is as shown in Formula II: r1-h1-L-h2-r2 (Formula II) Wherein r1 and r2 are reverse complementary sequences.

7. The polynucleotide according to claim 1, wherein The ribozyme is a self-catalytic splicing ribozyme, and the ribozyme can recognize a specific site in the L module.

8. The polynucleotide according to claim 1, wherein The ribozyme can recognize a specific secondary structure in L, that is, a secondary structure to be spliced ​​consisting of a specific splicing site and its surrounding sequences.

9. The polynucleotide according to claim 1, wherein The ribozyme is a modified ribozyme formed by partially or completely mutating the 10th to 16th positions of the 5' end of the pre-tRNA-Leu gene intron of Anabaena.

10. The polynucleotide according to claim 1, wherein The module L is determined by the following method: (1) directly connecting the 5' and 3' ends of the linear target sequence to be circularized to form a target circular sequence; (2) determining the splicing site (SS) based on the local secondary structure of the target sequence, wherein the polynucleotide sequences on both sides of the splicing site are ribozyme recognition sites; (3) Cutting the target circular sequence at the selected splicing site SS to form the module L.

11. The polynucleotide according to claim 10, wherein In the multi-stem-loop structure, the splice site is located in the TLSL structure, and the TLSL is composed of a multi-arm junction and a plurality of distal loops, wherein one arm of the multi-arm junction is a terminal arm, the terminal arm is not connected to the terminal loop, and the remaining arms are respectively connected to a terminal loop to form a multi-terminal loop continuous structure with exposed 5' and 3' ends only on the terminal arm; 12. The polynucleotide according to claim 10, wherein In the single stem-loop structure, the splice site is located in the SL structure, the SL is composed of an arm connection and a distal loop, the splice site is located between the nucleotide U (or T) and the adjacent nucleotide on the distal loop, and the nucleotide U (or T) is located at the 3' end of the module L formed after cutting at the splice site.

13. A carrier, characterized in that Comprising the polynucleotide as claimed in claim 1.

14. A method for preparing circular RNA, characterized in that: Includes steps: (1) determining the splicing site based on the local secondary structure of the target sequence, and obtaining the module L in the polynucleotide as claimed in claim 1, i.e., the linear counterpart of the target sequence; (2) connecting the 3' end section of the ribozyme, the linear counterpart of the target sequence and the 5' end section of the ribozyme by an appropriate method to obtain a circular RNA precursor molecule; (3) The circular RNA precursor molecule obtained in step (2) undergoes self-splicing reaction under appropriate conditions to produce the target circular RNA.

15. A circular RNA, characterized in that Formed by self-splicing of the polynucleotide according to claim 1.

16. A pharmaceutical composition, characterized in that Containing (a) the polynucleotide for preparing circular RNA according to claim 1, the circular RNA according to claim 15, or a combination thereof; and (b) a pharmaceutically acceptable carrier thereof.

17. An engineered host cell, characterized in that Contains the circular RNA of claim 15, or contains the vector of claim 13, or contains the pharmaceutical composition of claim 16, or has a coding sequence for producing the polynucleotide of claim 1 integrated into the genome.

18. A method for producing a polypeptide or protein in a cell, characterized in that: The method comprises: contacting the cell with: (i) the circular RNA of claim 15, (ii) the vector of claim 13, under conditions where the polypeptide or protein encoding nucleic acid sequence of the circular RNA is translated and the polypeptide or protein is produced in the cell; Alternatively, the method comprises: culturing the engineered host cell of claim 17 under conditions suitable for expression, thereby producing the polypeptide or protein; Alternatively, the method comprises: transfecting the circular RNA of claim 15 into the cell using lipofection, nanocarriers, polymers or electroporation, thereby producing a polypeptide or protein.

19. The use of the circular RNA according to claim 15, or the vector according to claim 13, or the pharmaceutical composition according to claim 16, or the engineered host cell according to claim 17, or the method for producing a polypeptide or protein in a cell according to claim 18, characterized in that: Used for preparing pharmaceutical compositions or cosmetic compositions.

Images