Cytochrome p450 enzyme, nucleic acid molecule, and glycyrrhetinic acid derivative and use thereof

Abstract

Provided are a cytochrome P450 enzyme, a nucleic acid molecule, and a glycyrrhetinic acid derivative and a use thereof. By means of an in-vitro catalytic conversion system constructed by CYP161H12, selective C-H bond activation is achieved at a B ring and / or a D ring of a glycyrrhetinic acid skeleton molecule. C-H bond hydroxylation reaction achieved using the enzyme-catalysis technology has excellent site- and stereoselectivity, involves mild reaction conditions, is environmentally friendly, and conforms to the principle of green chemistry. An enzyme in-vitro catalytic conversion system constructed can generate a clean product profile, and facilitate the separation and purification of a product. A novel glycyrrhetinic acid derivative synthesized retains hydroxyl groups on the B ring and the D ring, which has important significance in expanding the chemical space of a glycyrrhetinic acid derivative and deeply exploring a structure-activity relationship of the glycyrrhetinic acid derivative in pharmacological research.

Description

Cytochrome P450 enzyme, nucleic acid molecule, glycyrrhetinic acid derivative and application thereof Technical Field

[0001] The present invention belongs to the technical field of genetic engineering pharmaceuticals, and specifically relates to a cytochrome P450 enzyme, a nucleic acid molecule, a glycyrrhetinic acid derivative and applications thereof, and particularly relates to applications thereof in the preparation of novel glycyrrhetinic acid derivatives. Background Art

[0002] Glycyrrhetinic acid is a common oleanane-type pentacyclic triterpenoid natural product. Currently, a series of glycyrrhetinic acid derivatives obtained by structural modification of the glycyrrhetinic acid nucleus have shown a wide range of pharmacological activities in anti-inflammatory, anti-tumor, antiviral, and neuroprotective aspects. Traditional organic synthesis methods mainly include two types: derivatization based on the hydroxyl group of the A ring, the conjugated enone of the C ring, and the C30 carboxyl group of the E ring on the glycyrrhetinic acid skeleton; or activation of the nearby CH bond and derivatization based on the directing group strategy to improve its pharmacological activity. However, since the B and D rings of glycyrrhetinic acid are mostly sp 3 Due to the hybrid inert CH bond and the lack of directing groups, selective CH activation of the B / D ring of glycyrrhetinic acid cannot be achieved through organic synthesis methods.

[0003] Cytochrome P450 enzymes (CYP450s) are a class of metalloenzymes with a ferrous porphyrin as the catalytic center. They catalyze the monooxygenation of substrates using molecular oxygen as the oxidant. The microenvironment formed by the interaction between the different amino acid residues in the enzyme's active pocket and the substrate confers unique regio- and stereoselectivity on CYP450s. For structurally complex natural products containing multiple inert C-H bonds with similar chemical environments, such as glycyrrhetinic acid, CYP450s are ideal catalysts for selective C-H bond activation and hydroxylation.

[0004] Usually, CYP450s need reducing proteins to assist electron transfer and sufficient NADPH supply to undergo monooxygenation reaction. Among them, the naturally fused P450RHF has an efficient electron transport chain, and its fused reducing protein P450RHFRed has high compatibility with many CYP450s. The artificial fusion enzyme CYP450-RHFRed has high catalytic efficiency and is easy to express and use. Opt13 is a phosphite dehydrogenase that can convert NADP to phosphite in a mild water system using Na2HPO3. + It is efficiently converted into the expensive NADPH cofactor and recycled, and is widely used in the catalytic transformations of CYP450s.

[0005] Currently, reported enzymatic methods for the selective C-H hydroxylation of glycyrrhetinic acid primarily utilize whole-cell conversion, utilizing enzymes native to microorganisms such as Bacillus megaterium. This approach often results in a complex product background, making isolation and purification difficult. Although in vitro enzymatic methods offer a clean product spectrum, facilitating large-scale application, the identification and cloning of bacterial CYP450 genes for the selective C-H hydroxylation of glycyrrhetinic acid have yet to be reported.

[0006] Summary of the Invention

[0007] Purpose of the invention: The technical problem to be solved by the present invention is to provide a new cytochrome P450 enzyme or a catalytically active fragment thereof that can catalyze the selective CH bond hydroxylation of glycyrrhetinic acid.

[0008] The technical problem that the present invention also aims to solve is to provide a nucleic acid molecule encoding the protein, as well as an expression cassette, a recombinant vector, a recombinant strain or a cell.

[0009] The technical problem that the present invention also aims to solve is to provide an enzyme-catalyzed conversion system with CYP161H12 as a key catalytic enzyme, and to use the system for the in vitro bioconversion of different glycyrrhetinic acid derivatives.

[0010] The technical problem that the present invention also aims to solve is to provide the application of the cytochrome P450 enzyme or its catalytically active fragment, the nucleic acid molecule, the expression cassette, the recombinant vector, the recombinant strain or cell, the recombinant vector, the recombinant strain, and the enzyme-catalyzed conversion system in the preparation of glycyrrhetinic acid derivatives.

[0011] The technical problem that the present invention also aims to solve is to provide a series of new glycyrrhetinic acid derivatives.

[0012] The technical problem that the present invention also aims to solve is to provide a method for preparing glycyrrhetinic acid derivatives by combining organic synthesis and enzyme catalysis.

[0013] The final technical problem to be solved by the present invention is to provide the use of glycyrrhetinic acid derivatives in the preparation of anti-inflammatory, anti-tumor, antiviral or neuroprotective drugs.

[0014] Technical solution: To solve the above technical problems, the present invention provides a cytochrome P450 enzyme or a catalytically active fragment thereof, comprising:

[0015] (a) the amino acid sequence of which is shown in SEQ ID NO: 2; or

[0016] (b) The amino acid sequence in (a) is substituted and / or deleted and / or one or more amino acids are added and has cytochrome P450 enzyme activity.

[0017] The present invention also includes a nucleic acid molecule encoding the cytochrome P450 enzyme or a catalytically active fragment thereof.

[0018] The nucleic acid molecule comprises:

[0019] (a) The cytochrome P450 enzyme or catalytically active fragment thereof encoded by the enzyme maintains at least 70% sequence identity with SEQ ID NO: 2.

[0020] (b) The nucleotide sequence is shown in SEQ ID NO: 1.

[0021] The cytochrome oxidase gene of the present invention belongs to the CYP161H subfamily and is named CYP161H12 according to the international nomenclature of CYP450. The amino acid sequence (404aa) of the protein encoded by CYP161H12 is shown in the sequence listing as SEQ ID NO: 1, and its nucleotide sequence (1212bp) is shown in the sequence listing as SEQ ID NO. 2.

[0022] The CYP161H1 protein sequence was obtained from the NCBI database. CYP161H12 is derived from the actinomycete Amycolatopsis pretoriensis, with the amino acid sequence Uniprot number A0A1H5RFX8. Codon preference was optimized based on the protein sequence; the optimized sequence is shown in SEQ ID NO. 2. The enzyme gene was then directly synthesized by Anhui General Biotechnology Co., Ltd. into the pET28a-RHFRed vector, with restriction enzyme cleavage sites NdeI and BamHI, creating the pET28a-CYP161H12-RHFRed recombinant plasmid.

[0023] The present invention also includes an expression cassette, a recombinant vector, a recombinant strain or a cell, which contains the nucleic acid molecule.

[0024] The present invention also includes a recombinant vector, which is obtained by introducing the nucleic acid molecule into an expression vector. Preferably, the expression vector includes a pET28a-RHFRed plasmid.

[0025] The present invention also includes a recombinant strain, which is obtained by introducing the recombinant vector into Escherichia coli. Preferably, the Escherichia coli includes Escherichia coli BL21.

[0026] The present invention also includes an enzyme-catalyzed conversion system, which includes a cell lysate 1 of the recombinant strain. Preferably, the cell-free catalytic system also includes a cell lysate 2 of a recombinant strain expressing phosphite dehydrogenase; preferably, the volume ratio of the cell lysate 1 to the cell lysate 2 is 2:1.

[0027] The present invention also includes the use of the cytochrome P450 enzyme or its catalytically active fragment, the nucleic acid molecule, the expression cassette, the recombinant vector, the recombinant strain or cell, the recombinant vector, the recombinant strain, and the enzyme-catalyzed conversion system in the preparation of glycyrrhetinic acid derivatives.

[0028] The present invention also includes a glycyrrhetinic acid derivative, the structural formula of which is shown below:

[0029] in,

[0030] R1 is a functional group on the A ring of glycyrrhetinic acid or a derivative structure based on the modification of the A ring, wherein the functional groups on the A ring include a hydroxyl group at C3, an acetyl group at C3, a propionyl group at C3, a butyryl group at C3, and a keto carbonyl group at C3; the derivative structure based on the modification of the A ring includes an α, β-unsaturated ketone of a C3-oxo-C1-ene, an A ring expanded to form a seven-membered lactone ring, and an isoxazole heterocycle fused at C2 and C3, and R2 includes H, methyl or hexenyl.

[0031] Wherein, the glycyrrhetinic acid derivative has the following structural formula:

[0032] The present invention also includes a method for preparing glycyrrhetinic acid derivatives by combining organic synthesis and enzyme catalysis, comprising the following steps:

[0033] 1) Construction of a recombinant expression vector: introducing the nucleic acid or gene into an expression vector to obtain a recombinant expression vector;

[0034] 2) Obtaining and fermenting a recombinant strain: introducing a recombinant expression vector into a host bacterium to obtain a recombinant bacterium, fermenting and inducing expression of the obtained recombinant bacterium, and ultrasonically disrupting the obtained recombinant bacterium to obtain a cell lysate 1; preferably, the process further includes fermenting and inducing expression of a recombinant strain expressing phosphite dehydrogenase, and ultrasonically disrupting the obtained recombinant bacterium to obtain a cell lysate 2;

[0035] 3) Catalyzing the substrate to prepare a glycyrrhetinic acid derivative: reacting cell lysate 1 with a substrate to obtain a glycyrrhetinic acid derivative; preferably, adding cell lysate 2 to react; preferably, the substrate includes glycyrrhetinic acid, 3-hydroxyglycyrrhetinic acid, 3-acetylglycyrrhetinic acid, 3-propionylglycyrrhetinic acid, 3-butyrylglycyrrhetinic acid, 3-oxoglycyrrhetinic acid, 3-oxo-1-eneglycyrrhetinic acid, and a glycyrrhetinic acid derivative in which ring A is a seven-membered lactone ring.

[0036] Preferably, the recombinant expression vector in step 1) includes pET28a-CYP161H12-RHFRed;

[0037] Preferably, the fermentation step in step 2) comprises: inoculating the recombinant Escherichia coli containing pET28a-CYP161H12-RHFRed into LB medium and culturing at 37°C to obtain a seed solution, adding a trace amount of metal salt solution and the above seed solution to the TB medium, culturing at 37°C to the logarithmic growth phase, then adding IPTG and 5-ALA to induce the bacteria to express the CYP161H12-RHFRed fusion protein, induced culture at 18°C ​​for 20 hours, and centrifuging to collect the bacteria for in vitro catalytic reaction;

[0038] Preferably, the formula of the trace metal salt solution is: 50mM FeCl3, 20mM CaCl2, 10mM MnSO4, 10mM ZnSO4, 2mM CoSO4, 2mM CuCl2, 2mM NiCl2, 2mM Na2MoO4, 2mM H3BO3; preferably, the trace metal salt solution is added to the TB culture medium at a ratio of 0.1% v / v;

[0039] Preferably, the concentration of IPTG in the TB culture medium is 0.1 mM, and the concentration of 5-ALA in the TB culture medium is 0.5 mM.

[0040] The present invention also includes a method for constructing a multi-enzyme catalytic conversion system with CYP161H12 as a key catalyst and further preparing a glycyrrhetinic acid derivative, which specifically includes the following steps:

[0041] (1) Heterologous expression of CYP161H12-RHFRed in Escherichia coli: Recombinant Escherichia coli containing pET28a-CYP161H12-RHFRed was inoculated into LB medium and cultured at 37°C to obtain a seed solution. A trace amount of metal salt solution and the above seed solution were added to TB medium. First, cultured at 37°C until the logarithmic phase of growth, and then isopropyl-β-D-thiogalactopyranoside (IPTG) and 5-aminolevulinic acid hydrochloride (5-ALA) were added to induce the bacteria to express the CYP161H12-RHFRed fusion protein. The induction culture was carried out at 18°C ​​for 20 hours. The bacteria were collected by centrifugation and used for in vitro catalytic reaction. The specific implementation method is shown in Example 1.

[0042] (2) Heterologous expression of opt13 in Escherichia coli: Utilizing seamless cloning technology to connect opt13 with the vector pETDuet, the recombinant plasmid pETDue-opt13 was obtained and then transformed into Escherichia coli BL21. The recombinant E. coli was inoculated into LB liquid medium and cultured at 37°C to obtain a seed solution, which was then added to TB medium. First, the cells were cultured at 37°C until the logarithmic phase of growth, and then isopropyl-β-D-thiogalactopyranoside (IPTG) was added to induce the cells to express opt13. The cells were then cultured at 18°C ​​for 20 hours. The cells were collected by centrifugation and used for in vitro catalytic reactions. The specific implementation method is shown in Example 2.

[0043] (3) In vitro catalytic conversion reaction: The fermentation cells obtained in the above steps (1) and (2) were resuspended in kpi buffer and then ultrasonically disrupted to obtain cell lysates of CYP161H12-RhfRed and opt13, respectively. The two were combined in a volume ratio of 2:1 to obtain a three-component in vitro catalytic system including cytochrome oxidase CYP161H12, reduced protein RHFRed and phosphite dehydrogenase opt13 for efficient NADPH supply. Substrate, Na2HPO3·5H2O and NADP were added to the three-component catalytic system. + After reacting at 23°C for 20 hours, the reaction product was extracted and concentrated to separate the oxidation product of the hydroxylation of the inert CH bond on the B / D ring.

[0044] The composition of the KPI buffer solution in step (3) above is 10.27 g K2HPO4·3H2O and 0.68 g KH2PO4 dissolved in 1 L of distilled water to obtain a phosphate buffer solution with a pH of 7 and a concentration of 0.1 M.

[0045] The concentration of the KPI buffer described in step (3) above is preferably 0.1 M, and the pH value is preferably 7.0.

[0046] The novel glycyrrhetinic acid derivatives of the present invention can first be synthesized by organic chemical synthesis to obtain a glycyrrhetinic acid ring A derivative, which is then catalyzed by CYP161H12 to obtain a glycyrrhetinic acid derivative in which the A ring is derivatized and the B ring and / or D ring undergo C-H bond hydroxylation, as shown in Reaction Scheme 1.

[0047] Reaction Scheme 1:

[0048] In reaction route 1, the derivatives obtained after modification of the glycyrrhetinic acid A ring have different catalytic oxidation efficiencies with CYP161H12. Some derivatives can only obtain hydroxylation products at the C7β position, such as Examples 8 and 9; some derivatives can further obtain dihydroxy products that undergo oxidation cascades at C7β and C15α, such as Examples 7, 10, 11, 12, and 13.

[0049] The novel glycyrrhetinic acid derivatives of the present invention can also first be hydroxylated by CYP161H12 at C7β of the B ring and / or C15α of the D ring of glycyrrhetinic acid, and then esterified at the C30 position of the glycyrrhetinic acid skeleton by organic chemical synthesis to obtain a product in which the C30 position carboxyl group is esterified and the B ring and / or the D ring undergo C-H bond hydroxylation, as shown in Reaction Scheme 2.

[0050] Reaction Scheme 2:

[0051] In reaction scheme 2, CYP161H12 can undergo an oxidative cascade reaction on C7β and C15α of glycyrrhetinic acid to generate two hydroxylated products, and the esterification reaction of the carboxyl group can be easily prepared without affecting the existing hydroxyl groups.

[0052] The present invention also includes the use of the glycyrrhetinic acid derivatives in the preparation of anti-inflammatory, anti-tumor, antiviral or neuroprotective drugs.

[0053] Beneficial effects: Compared with the prior art, the present invention has the following advantages:

[0054] ① The present invention provides a novel cytochrome oxidase CYP161H12 and its encoding gene. By utilizing CYP161H12 to construct an in vitro catalytic conversion system, highly selective C-H bond activation of the B and / or D rings of the glycyrrhetinic acid backbone molecule is achieved. ② Compared with traditional organic synthesis, the C-H bond hydroxylation achieved by the present invention using enzyme-catalyzed technology offers significant advantages. This technology not only exhibits excellent site and stereoselectivity, but also exhibits mild reaction conditions, is environmentally friendly, and adheres to the principles of green chemistry. ③ Compared with whole-cell microbial transformation, the in vitro enzymatic catalytic conversion system constructed in the present invention produces a clean product spectrum, facilitating product separation and purification. ④ Hydroxyl groups, as common molecular handles, can be easily modified to introduce other functional groups. The novel glycyrrhetinic acid derivatives synthesized in the present invention retain the hydroxyl groups on the B and D rings. This is of great significance for expanding the biochemical space of glycyrrhetinic acid derivatives and for further exploring their structure-activity relationships in pharmacological research. BRIEF DESCRIPTION OF THE DRAWINGS

[0055] Figure 1 Schematic diagram of the in vitro catalytic conversion system of glycyrrhetinic acid using CYP161H12 as the key catalyst;

[0056] Figure 2 H NMR spectrum of compound 2b ( 1 H NMR spectrum);

[0057] Figure 3 C NMR spectrum of compound 2b ( 13 C NMR spectrum);

[0058] Figure 4 H NMR spectrum of compound 3a ( 1 H NMR spectrum);

[0059] Figure 5 C NMR spectrum of compound 3a ( 13 C NMR spectrum);

[0060] Figure 6 H NMR spectrum of compound 4a ( 1 H NMR spectrum);

[0061] Figure 7 C NMR spectrum of compound 4a ( 13 C NMR spectrum);

[0062] Figure 8 H NMR spectrum of compound 5b ( 1 H NMR spectrum);

[0063] Figure 9 C NMR spectrum of compound 5b ( 13 C NMR spectrum);

[0064] Figure 10 H NMR spectrum of compound 6a ( 1 H NMR spectrum);

[0065] Figure 11 C NMR spectrum of compound 6a ( 13 C NMR spectrum);

[0066] Figure 12 H NMR spectrum of compound 6b ( 1 H NMR spectrum);

[0067] Figure 13 C NMR spectrum of compound 6b ( 13 C NMR spectrum);

[0068] Figure 14 H NMR spectrum of compound 7a ( 1 H NMR spectrum);

[0069] Figure 15 C NMR spectrum of compound 7a ( 13 C NMR spectrum);

[0070] Figure 16 H NMR spectrum of compound 7b ( 1 H NMR spectrum);

[0071] Figure 17 C NMR spectrum of compound 7b ( 13 C NMR spectrum);

[0072] Figure 18 H NMR spectrum of compound 8a ( 1 H NMR spectrum);

[0073] Figure 19 C NMR spectrum of compound 8a ( 13 C NMR spectrum);

[0074] Figure 20 H NMR spectrum of compound 8b ( 1 H NMR spectrum);

[0075] Figure 21 C NMR spectrum of compound 8b ( 13 C NMR spectrum);

[0076] Figure 22 H NMR spectrum of compound 9a ( 1 H NMR spectrum);

[0077] Figure 23 C NMR spectrum of compound 9a ( 13 C NMR spectrum);

[0078] Figure 24 H NMR spectrum of compound 9b ( 1 H NMR);

[0079] Figure 25 C NMR spectrum of compound 9b ( 13 C NMR spectrum);

[0080] Figure 26 H NMR spectrum of compound 10a ( 1 H NMR spectrum);

[0081] Figure 27 C NMR spectrum of compound 10a ( 13 C NMR spectrum);

[0082] Figure 28 H NMR spectrum of compound 10b ( 1 H NMR spectrum);

[0083] Figure 29: C NMR spectrum of compound 10b ( 13 C NMR spectrum). DETAILED DESCRIPTION

[0084] The embodiments of the present invention will be described in detail below with reference to the examples, but it will be understood by those skilled in the art that the following examples are merely illustrative of the present invention and should not be construed as limiting the scope of the invention. Where specific conditions are not specified in the examples, the methods were performed according to conventional conditions or the conditions recommended by the manufacturer. Where the manufacturers of the reagents or instruments are not specified, they are all conventional products that can be obtained commercially.

[0085] Example 1 Heterologous Expression and Fermentation of CYP161H12-RHFRed in Escherichia coli

[0086] 1. Obtain the pET28a-CYP161H12-RHFRed recombinant expression vector

[0087] CYP161H12 is derived from the actinomycete Amycolatopsis pretoriensis, with an amino acid sequence Uniprot number of A0A1H5RFX8. CYP161H12 was optimized for the codon preference of Escherichia coli to yield the sequence shown in SEQ ID NO: 2. Using the pET28a-RHFRed plasmid as an expression vector, CYP161H12, whose nucleotide sequence is shown in SEQ ID NO: 2, was inserted into the pET28a-RHFRed plasmid containing restriction endonuclease cleavage sites NdeI and BamHI, respectively. The recombinant vector pET28a-CYP161H12-RHFRed was synthesized directly by Anhui General Biotechnology Co., Ltd.

[0088] The synthesis process of pET28a-RHFRed is as follows: RHFRed, based on the amino acid sequence reported in a 2020 publication, was inserted into pET28a containing restriction endonuclease cut sites of BamHI and XhoI. This vector, synthesized by Anhui General Biotechnology Co., Ltd., was obtained. The amino acid sequence of RHFRed is SEQ NO: 3, and the gene sequence is SEQ NO: 4.

[0089] 2. Heterologous expression and fermentation of pET28a-CYP161H12-RHFRed

[0090] pET28a-CYP161H12-RHFRed was transformed into Escherichia coli BL21. A single heterologously expressed BL21 clone was inoculated into 5 mL of LB medium and cultured at 37°C, 220 rpm, for 10 h. This served as the seed solution. The seed solution was added to sterile TB medium at a 0.3% inoculum, along with 50 μg / mL kanamycin and 1 mL / L trace metal salt solution (50 mM FeCl₃, 20 mM CaCl₂, 10 mM MnSO₄, 10 mM ZnSO₄, 2 mM CoSO₄, 2 mM CuCl₂, 2 mM NiCl₂, 2 mM Na₂MoO₄, and 2 mM H₃BO₃). The culture was continued at 37°C, 220 rpm, until the OD value reached 0.8. After cooling in an ice-water bath for 20 minutes, 0.1 mM isopropyl-β-D-thiogalactopyranoside (IPTG) and 0.5 mM 5-aminolevulinic acid hydrochloride (5-ALA) were added to induce expression of the CYP161H12-RHFRed fusion protein in the culture. The culture was incubated at 18°C ​​and 200 rpm for 20 hours. The CYP161H12-RHFRed protein-expressing cells were harvested by centrifugation at 3750 rpm for 5 minutes and used in the in vitro catalytic reaction.

[0091] Example 2 Expression and fermentation of phosphite dehydrogenase opt13 in Escherichia coli

[0092] 1. Construction of pRSFDuet-opt13 recombinant expression vector

[0093] The pETDuet plasmid (purchased from Anhui General Biotechnology Co., Ltd.) was used as a vector. The opt13 gene (the amino acid and gene sequences of the opt13 gene are shown in SEQ NOs 5 and 6, synthesized by Anhui General Biotechnology Co., Ltd.) was inserted into the vector at the restriction endonuclease sites PstI and HindIII. The primers were forward: TCGAGCTCGGCGCGCCTGCAGCTGCCGAAACTCGTTATAACTCAC; reverse: GCATTATGCGGCCGCAAGCTTTTATCAGTCTGCGGCAGGATTG. The linearized vector and the gene cloned by PCR were mixed at a 1:2 ratio, ligated together with the homologous recombinase, and transformed into Escherichia coli DH5α for expression. A single clone was cultured in LB solid medium, the plasmid was extracted, and sequencing was performed to confirm the correct construction of the pETDuet-opt13 recombinant expression vector.

[0094] 2. Heterologous expression and fermentation of pRSFDuet-opt13

[0095] The pETDuet-opt13 recombinant expression vector was transformed into Escherichia coli BL21, and the heterologously expressed BL21 monoclonal clone was inoculated into 5 mL of LB medium and cultured at 37°C and 220 rpm for 10 hours. This was the seed solution. The seed solution was added to the sterilized TB medium at a 0.3% inoculum volume, and 100 μg / mL of ampicillin was added thereto. The culture was cultured at 37°C and 220 rpm until the OD value was 0.8. After cooling in an ice water bath for 20 minutes, 0.1 mM isopropyl-β-D-thiogalactopyranoside (IPTG) was added thereto to induce the bacteria to express protein opt13. The culture was induced at 18°C ​​and 200 rpm for 20 hours. The opt13 protein-expressing bacteria were collected by centrifugation at 3750 rpm for 5 minutes for in vitro catalytic reaction.

[0096] Example 3 Construction of CYP161H12 cell-free catalytic system

[0097] The CYP161H12-RHFRed cells collected in Example 1 and the opt13 cells collected in Example 2 were resuspended in 0.1 M, pH 7.0 kpi buffer to an OD600 of 30 and then ultrasonically disrupted to obtain cell lysates of CYP161H12-RHFRed and opt13, respectively. The two were mixed at a volume ratio of CYP161H12-RHFRed:opt13 = 2:1 to form a cell-free catalytic system, wherein CYP161H12-RHFRed was the reaction catalyst.

[0098] Example 4 Preliminary Screening and Evaluation of the Catalytic Ability of CYP161H12 on Different Substrates

[0099] 3.33 mL of the CYP161H12-RHFRed cell lysate of Example 3 and 1.67 mL of the opt13 cell lysate were mixed and added to a glass tube, and substrates (glycyrrhetinic acid, 3-hydroxyglycyrrhetinic acid, 3-acetylglycyrrhetinic acid, 3-propionylglycyrrhetinic acid, 3-butyrylglycyrrhetinic acid, 3-oxoglycyrrhetinic acid, 3-oxo-1-eneglycyrrhetinic acid, and glycyrrhetinic acid derivatives with a seven-membered lactone ring in ring A) (2 mM, 1.0 equiv.) and NADP were added thereto. + (0.5 equiv.) and Na₂HPO₃·5H₂O (50 equiv.). After reacting at 23°C and 220 rpm for 20 h, the mixture was extracted with 1 mL of ethyl acetate and centrifuged at 10,000 rpm for 3 min. The supernatant was removed to remove the organic solvent, and the remaining sample was dissolved in methanol and analyzed by liquid chromatography. The concentration of CYP161H12-RHFRed protein in this reaction was 3.68 × 10 -3 mM, the amount of catalyst used is 0.18 mol%.

[0100] Example 5 Large-scale preparation of enzyme-catalyzed oxidation products

[0101] In Example 4, substrates that produced oxidation products were initially screened and amplified. Following the method of Example 3, CYP161H12-RHFRed was fermented in 2 L of TB culture medium, and opt13 was fermented in 1 L of TB culture medium. These were mixed to create a cell-free catalytic system for large-scale production. 1 equiv of substrate, 50 equiv of Na2HPO3·5H2O, and 0.5 equiv of NADP, pre-dissolved in DMSO, were added to the cell-free catalytic system. + After reacting at 23°C and 220 rpm for 20 hours, the reaction product was extracted three times with ethyl acetate, concentrated, and separated and purified to obtain the oxidation product. Specific catalytic experiments are shown in the following examples.

[0102] The TB medium formula is as follows: 2.2 g of KH2PO4 and 12.3 g of K2HPO4·3H2O are dissolved in 0.05 L of distilled water and sterilized by autoclaving at 121°C for 20 minutes as a phosphorus source. 11.8 g of tryptone and 23.6 g of yeast extract are dissolved in 4 mL of glycerol in 0.95 L of distilled water, sterilized by autoclaving at 121°C for 20 minutes, and then cooled to 60°C. 0.05 L of a sterilized phosphorus source is added to obtain 1 L of TB medium.

[0103] Example 6 Preparation of glycyrrhetinic acid oxidation products by in vitro enzymatic conversion

[0104] Following the method of Example 4, the yield of substrate 1 catalyzed by CYP161H12 was determined to be as high as 100%. The hydroxylation product 1a:1b ratio was 39:61. Following the method of Example 5, 1a and 1b were prepared using 1 g of glycyrrhetinic acid. The structural data obtained by mass spectrometry, H NMR, and C NMR were consistent with previously reported data.

[0105] Compound 1a: 1 H NMR (400 MHz, DMSO-d6) δ H 5.43(1H,s,H-12),3.87(1H,dd,J=10.7,4.7Hz,H-3),3.01(1H,dd,J=4.5,11.4 Hz,H-7),2.26(1H,s,H-9),1.39,1.10,1.02,1.00,0.91,0.76,0.68(s,3H×7); 13 C NMR (100 MHz, DMSO-d6) δ C 199.1,178.2,170.2,127.9,77.0,71.2,61.8,51.3,50.4,49.2,44.8,43.6,41.3,38.9,37.9,37.1,3 6.7,32.0,30.8,30.0,28.9,28.8,28.6,28.3,27.5,26.6,23.6,16.5,16.4,12.7; HRESIMS(m / z)[M+H] + calculated C 30 H 47 O5487.3423, found 487.3438.

[0106] Compound 1b: 1 H NMR (300 MHz, Pyridine-d5) δ H 6.18(1H,s,H-12),4.68(1H,m,H-15),4.51(1H,m,H-7),3.51(1H,m,H-3),1.74,1.46,1.42,1.35,1.28,1.09,0.89(s,3H×7); 13 C NMR (75 MHz, Pyridine-d5) δ C198.8,179.0,170.2,129.1,77.5,71.4,66.4,62.4,51.9,51.7,50.3,49.7,43.9,41.3,39.4,39.4,3 7.9,37.7,35.9,32.2,31.3,29.2,28.6,28.5,28.0,27.8,18.7,16.5,16.4,13.2; HRESIMS(m / z)[M+H] + calculated C 30 H 47 O6 503.3373, found 503.3408.

[0107] Example 7 Synthesis of 2a and 2b by Enzymatic Combination with Organic Catalysis

[0108] Step A: Synthesis of substrate 2

[0109] 0.5 g (1 equiv.) of glycyrrhetinic acid was dissolved in 10 mL of acetic anhydride and heated under reflux at 130°C for 1 h. 5 mL of acetic acid was then added. After cooling, the reaction was quenched by adding ice water. The mixture was filtered and the filter cake dried to obtain 0.45 g of substrate 2 (white solid, 82% yield). The structure of the product, as determined by mass spectrometry, H NMR, and C NMR, was consistent with previously reported data.

[0110] 1 H NMR (400 MHz, CDCl3): δ H 5.74(1H,s,H-12),4.53(1H,dd,J=4.8,11.6Hz,H-3),2.39(1H,s,H-9),2. 08(3H,s,CH3C=O),1.38,1.25,1.18,1.15,0.90,0.90,0.86(3H,s,CH3×7); 13 C NMR (101 MHz, CDCl3): δ C 200.4,181.8,171.1,169.6,128.4,80.6,61.7,55.0,48.3,45.5,43.8,43.2,40.8,38.8,38.1,37.7,36.9,3 2.7,31.9,30.9,28.6,28.5,28.1,26.5,26.4,23.6,23.4,21.4,18.7,17.4,16.7,16.4; HRESIMS(m / z)[M+H] + calculated C 32 H 49O5513.3580,found 513.3584.

[0111] Step B: Enzymatic synthesis of 2a and 2b

[0112] Following the method of Example 4, the yield of substrate 2 catalyzed by CYP161H12 was determined to be 92%. The hydroxylation product 2a:2b ratio was 91:9. Following the method of Example 5, 0.2 g of substrate 2 was used to prepare 2a and 2b. Compound 2a was characterized by mass spectrometry, H NMR, and C NMR, and the structural data obtained were consistent with previously reported data. Compound 2b is reported for the first time in this invention.

[0113] Compound 2a: 1 H NMR (400 MHz, CDCl3): δ H 5.78(1H,s,H-12),4.52(1H,dd,J=4.9,11.4Hz,H-3),4.10(1H,dd,J=4.9,10.8Hz,H-7),2.3 4(1H,s,H-9),2.07(3H,s,CH3C=O),1.46,1.25,1.18,1.16,0.91,0.89,0.86(3H,s,CH3×7); 13 C NMR (101 MHz, CDCl3): δ C 199.3,181.7,171.1,169.3,128.6,80.3,72.4,61.9,51.7,50.5,48.8,44.5,43.9,41.0,38.4,37.8,37.6,3 7.0,31.8,30.9,30.1,28.7,28.5,28.5,28.0,26.6,23.7,23.5,21.3,16.7,16.1,12.3; HRESIMS(m / z)[M+H] + calculated C 32 H 49 O6 529.3529, found 529.3533. Compound 2b: 1 H NMR (400 MHz, Pyridine-d5): δ H 6.13(1H,s,H-12),4.76(1H,dd,J=5.2,10.9Hz,H-3),4.66(1H,m,H-15),4.44(1H,m,H-7),2. 55(1H,s,H-9),2.04(3H,s,CH3C=O),1.73,1.41,1.34,1.33,0.93,0.93,0.88(3H,s,CH3×7);13 C NMR (101 MHz, Pyridine-d5) δ C 198.5,179.1,170.3,170.3,129.0,80.1,71.1,66.4,62.1,51.7,51.6,50.3,49.7,43.8,41.3,38.6,37.9,3 7.8,37.4,35.9,32.2,31.3,29.1,28.5,27.9,27.3,23.8,20.9,18.7,16.8,16.2,13.2; HRESIMS(m / z)[M+H] + calculated C 32 H 49 O7 545.3478, found 545.3478. Example 8 Synthesis of 3a by Enzymatic Combination with Organic Catalysis

[0114] Step A: Synthesis of substrate 3

[0115] 0.5 g (1 equiv.) of glycyrrhetinic acid was dissolved in 15 mL of anhydrous pyridine, to which were added (1.2 equiv.) of propionic anhydride and (0.2 equiv.) of DMAP. The reaction mixture was heated under reflux at 100°C for 3 h. After cooling, ice water was added to quench the reaction, and the filter cake was filtered and dried to yield 0.56 g of substrate 3 (white solid, 99% yield). The structure of the product, as determined by mass spectrometry, H NMR, and C NMR, was consistent with previously reported data.

[0116] 1 H NMR (300MHz, CDCl3): δ H 5.73(1H,s,H-12),4.54(1H,dd,J=5.0,11.4Hz,H-3),1.39,1.24,1.18,1.14,0.89,0.88,0.84(3H,s,CH3×7); 13 C NMR (75MHz,CDCl3):δ C 200.4,181.7,174.4,169.6,128.4,80.3,61.7,55.0,48.2,45.5,43.8,43.2,40.9,38.7,38.1,37.7,36.9,32. 7,31.9,31.0,28.5,28.5,28.1,28.1,26.5,26.4,23.6,23.4,18.7,17.4,16.7,16.4,9.4; HRESIMS(m / z)[M+H] + calculated C 33 H51 O5527.3736,found527.3710.

[0117] Step B: Enzymatic synthesis of 3a

[0118] Following the method of Example 4, the yield of substrate 3 catalyzed by CYP161H12 was determined to be 61%. The hydroxylation product was 3a. Following the method of Example 5, 0.1 g of substrate 3 was used to prepare 3a. Compound 3a is reported for the first time in this invention.

[0119] Compound 3a: 1 H NMR (300 MHz, MeOD): δ H 5.65(1H,s,H-12),4.53(1H,dd,J=4.7,11.6Hz,H-3),4.07(1H,dd,J=5.0,10.8Hz ,H-7),2.47(1H,s,H-9),1.19,1.19,1.15,1.15,0.94,0.94,0.86(3H,s,CH3×7); 13 C NMR (75 MHz, MeOD) δ C 200.3,179.5,174.6,171.5,127.6,80.3,71.5,61.7,51.4,50.4,49.2,44.6,43.5,41.3,38.0,37.6,37.5,36. 8,31.5,30.7,29.7,27.9,27.8,27.5,27.4,27.1,26.3,23.1,22.6,15.8,15.3,11.6,8.3; HRESIMS(m / z)[M+H] + calculated C 33 H 51 O6 543.3686, found 543.3724.

[0120] Example 9 Synthesis of 4a by Enzymatic Combination with Organic Catalysis

[0121] Step A: Synthesis of substrate 4

[0122] 0.5 g (1 equiv.) of glycyrrhetinic acid was dissolved in 15 mL of anhydrous pyridine, to which were added (1.2 equiv.) of n-butyric anhydride and (0.2 equiv.) of DMAP. The mixture was heated under reflux at 100°C for 3 h. After cooling, the reaction mixture was quenched with ice water, filtered, and the filter cake dried to afford 0.33 g of substrate 4 (white solid, 78% yield). The structure of the product, as determined by mass spectrometry, H NMR, and C NMR, was consistent with previously reported data.

[0123] 1 H NMR (400 MHz, CDCl3): δ H 5.73(1H,s,H-12),4.55(1H,dd,J=4.8,11.6Hz,H-3),2.39(1H,s,H-9),1.39,1.24 ,1.18,1.14,0.89,0.89,0.85(3H,s,CH3×7),0.97(3H,t,J=7.4Hz,CH3CH2CH2C=O); 13 C NMR (101 MHz, CDCl3): δ C 200.5,182.1,173.6,169.6,128.4,80.3,61.7,55.0,48.2,45.5,43.8,43.2,40.8,38.8,38.1,37.7,36.9,36.8,3 2.7,31.9,30.9,28.6,28.5,28.1,26.5,26.4,23.6,23.4,18.7,18.7,17.4,16.8,16.4,13.8; HRESIMS(m / z)[M+H] + calculated C 34 H 53 O5:541.3893,found:541.3894.

[0124] Step B: Enzymatic synthesis of 4a

[0125] Following the method of Example 4, the yield of substrate 4 catalyzed by CYP161H12 was determined to be 23%. The hydroxylation product was 4a. Following the method of Example 5, 0.1 g of substrate 4 was used to prepare 4a. Compound 4a is reported for the first time in this invention.

[0126] Compound 4a: 1 H NMR (400 MHz, DMSO-d6): δ H 5.44(1H,s,H-12),4.45(1H,dd,J=4.4,11.8Hz,H-3),3.90(1H,dd,J=4.8,10.7Hz,H-7),1. 40,1.06,1.00,0.96,0.83,0.82,0.73(3H,s,CH3×7),0.89(3H,t,J=7.3Hz,CH3CH2CH2C=O); 13 C NMR (101 MHz, DMSO-d6): δ C199.0,179.9,172.9,170.4,127.8,79.8,70.8,61.5,50.8,50.4,49.3,44.8,43.6,41.2,38.02,37.9,37.8,37.0, 36.3,32.0,30.8,30.0,28.8,28.6,28.3,28.1,26.6,23.8,23.5,18.6,17.1,16.4,13.9,12.7; HRESIMS(m / z)[M+H] + calculated C 34 H 53 O6:557.3842,found:557.3872.

[0127] Example 10 Synthesis of 5a and 5b by Enzymatic Combination with Organic Catalysis

[0128] Step A: Synthesis of substrate 5

[0129] 0.5 g (1 mmol, 1 equiv.) of 1 was dissolved in 5 mL of THF and placed in an ice bath. 1.5 mL of Jones reagent was added dropwise. After stirring for 1.5 h, the reaction solution turned from reddish-brown to clear, revealing dark green solid masses. The reaction was quenched with ice water, filtered, and dried to yield 0.45 g of substrate 5 (white solid, 90% yield). The structure determined by mass spectrometry, H NMR, and C NMR spectroscopy was consistent with previously reported structures.

[0130] 1 H NMR (400 MHz, CDCl3): δ H 5.77(1H,s,H-12),2.47(1H,s,H-9),1.40,1.30,1.25,1.19,1.13,1.09,0.88(s,CH3×7); 13 C NMR (101 MHz, CDCl3): δ C 217.3,199.7,181.8,169.9,128.4,61.1,55.4,48.3,47.8,45.3,43.8,43.3,40.9,39.7,37.7,36 .7,34.3,32.1,31.9,30.9,28.6,28.5,26.5,26.4,26.4,23.4,21.5,18.8,18.5,15.7; LC-MS:[MH] - :467.4.

[0131] Step B: Enzymatic synthesis of 5a and 5b

[0132] Following the method of Example 4, the yield of substrate 5 catalyzed by CYP161H12 was determined to be 87%. The ratio of hydroxylated products 5a:5b was 76:24. Following the method of Example 5, 0.5 g of substrate 5 was used to prepare 5a and 5b. The structural data obtained for compound 5a were consistent with previously reported data by mass spectrometry, H NMR, and C NMR. Compound 5b is reported for the first time in this invention.

[0133] Compound 5a: 1 H NMR (400 MHz, CDCl3): δ H 5.80(1H,s,H-12),4.13(1H,t,J=7.9Hz,H-7),2.42(1H,s,H-9),1.46,1.29,1.24,1.20,1.12,1.07,0.87(s,CH3×7); 13 C NMR (101 MHz, CDCl3): δ C 216.8,198.8,182.0,170.0,128.5,72.0,61.1,52.2,50.3,48.9,47.4,44.7,43.9,41.0,39.3,37.6,36 .7,34.2,31.8,30.9,30.1,29.9,28.6,28.5,26.6,26.3,23.59,21.45,15.4,12.2; HRESIMS(m / z)[M+H] + calculated C 30 H 45 O5485.3267, found 485.3224.

[0134] Compound 5b: 1 H NMR (400 MHz, Pyridine-d5): δ H 6.14(1H,s,H-12),4.64(1H,dd,J=5.0,11.4Hz,H-15),4.44(1H,dd,J=5.6,9.8 Hz,H-7),2.64(1H,s,H-9),1.69,1.41,1.41,1.34,1.18,1.07,0.88(s,CH3×7); 13 CNMR (101MHz, Pyridine-d5)δ C215.3,198.1,178.9,170.6,128.9,70.6,66.5,61.4,51.8,51.5,50.3,49.7,47.3,43.8,41.3,39. 4,37.9,37.0,35.9,34.3,32.2,31.3,29.1,28.5,26.2,21.4,18.7,15.5,13.1; HRESIMS(m / z)[MH] - calculated C 30 H 43 O6 499.3060, found 499.3060.

[0135] Example 11 Synthesis of 6a and 6b by Enzymatic Combination with Organic Catalysis

[0136] Step A: Synthesis of substrate 6

[0137] 2 g (4.2 mmol, 1 equiv.) of compound 1 was dissolved in 60 mL of DMSO, and 4 equiv. of 2-iodoacylbenzoic acid was added. The reaction was refluxed at 80°C for 4 h, then cooled to room temperature and quenched with 5% NaHCO₃. The resulting mixture was extracted three times with ether. The combined organic layers were washed with water and saturated sodium chloride solution, dried over anhydrous sodium sulfate, and the organic solvent removed. The product was eluted with 200-300 mesh silica gel column chromatography (CH₂Cl₂:MeOH = 20:1) to afford 1.77 g of substrate 6 (white solid, 89% yield). The structure of the product, confirmed by mass spectrometry, H NMR, and C NMR, was consistent with previously reported data.

[0138] 1 H NMR (400 MHz, CDCl3): δ H 7.76(1H,d,J=10.2Hz,H-1),5.84(1H,d,J=10.2Hz,H-2),5.83(s,1H,H-12),1.44,1.42,1.26,1.21,1.18,1.13,0.89(CH3×7). 13 C NMR (101 MHz, CDCl3): δ C 204.7,199.2,182.2,170.8,161.7,128.2,124.6,55.6,52.8,48.4,45.6,44.8,43.9,43.5,40.9,38 .8,37.7,32.1,31.9,30.9,28.6,28.5,27.6,26.5,26.3,23.4,21.6,20.1,19.0,18.2.LC-MS:[M+H] +:465.2.

[0139] Step B: Enzymatic synthesis of 6a and 6b

[0140] Following the method of Example 4, the yield of substrate 6 catalyzed by CYP161H12 was determined to be 81%. The hydroxylation product 6a:6b ratio was 76:24. Following the method of Example 5, 0.2 g of substrate 6 was used to prepare 6a and 6b. Compounds 6a and 6b are reported for the first time in this invention.

[0141] Compound 6a: 1 H NMR (400 MHz, MeOD): δ H 7.75(1H,d,J=10.2Hz,H-1),5.79(1H,d,J=10.2Hz,H-2),5.75(1H,s,H-12),4.13( 1H,m,H-7),2.83(1H,s,H-9),1.52,1.43,1.21,1.20,1.18,1.13,0.88(s,CH3×7); 13 C NMR (101 MHz, MeOD) δ C 205.3,199.0,179.1,172.5,162.3,127.4,124.0,70.9,55.7,50.5,49.4,49.0, 44.9,44.1,43.6,41.1,38.7,37.6,31.5,30.6,29.7,28.6,27.9,27.4,26.6,26.3,22.5,20.7,19.2,12.0; HRESIMS(m / z)[MH] - calculated C 30 H 41 O5481.2954,found 481.2964.

[0142] Compound 6b: 1 H NMR (400 MHz, MeOD): δ H 7.74(1H,d,J=10.3Hz,H-1),5.80(1H,d,J=10.4Hz,H-2),5.82(1H,s,H-12),4.34(1H,dd,J=5.2,11.7Hz,H- 15),4.17(1H,dd,J=5.2,9.9Hz,H-7),2.79(1H,s,H-9),1.46,1.43,1.23,1.21,1.19,1.15,0.91(s,CH3×7); 13 C NMR (75 MHz, MeOD) δ C205.2,198.4,179.0,171.9,162.2,128.0,124.0,70.3,66.3,55.6,51.2,50.0,49.6,48.8,44.1,38.7 ,37.3,34.6,31.7,30.5,30.4,29.4,28.4,27.3,26.8,26.7,20.6,19.3,17.2,12.2; HRESIMS(m / z)[MH] - calculated C 30 H 41 O6 497.2903, found 497.2924.

[0143] Example 12 Synthesis of 7a and 7b by Enzymatic Combination with Organic Catalysis

[0144] Step A: Synthesis of substrate 7

[0145] 0.5 g (1 mmol, 1 equiv.) of compound 5 was dissolved in 30 mL of anhydrous CH2Cl2. (0.175 mmol) of m-chloroperbenzoic acid and (3.5 equiv.) of lithium carbonate were added. The reaction was stirred at room temperature for 12 h, then quenched with 5% Na2SO3. The reaction was extracted three times with CH2Cl2. The combined organic layers were washed with water, saturated NaHCO3 solution, and saturated sodium chloride solution, respectively, and dried over anhydrous sodium sulfate. The organic solvent was removed, and the product was eluted with 200-300 mesh silica gel column chromatography (petroleum ether:ethyl acetate = 2:1) to afford 0.24 g of substrate 7 (white solid, 46% yield). The obtained structural data were consistent with those previously reported by mass spectrometry, H NMR, and C NMR.

[0146] 1 H NMR (400 MHz, DMSO-d6): δ H 5.46(1H,s,H-12),1.41,1.38,1.34,1.26,1.10,1.07,0.77(CH3×7). 13 CNMR (101 MHz, DMSO-d6):δ C 198.5,178.2,175.0,170.5,127.9,85.5,61.2,52.5,49.0,48.5,45.3,43.6,43.5,41.1,39.5,38 .0,32.5,32.0,31.8,31.4,30.8,28.9,28.3,26.6,26.5,26.2,23.3,22.1,18.3,18.0.LC-MS:[MH] - :483.3.

[0147] Step B: Enzymatic synthesis of 7a and 7b

[0148] Following the method of Example 4, the conversion of substrate 7 by CYP161H12 was determined to be 87%. The hydroxylation product 7a:7b ratio was 47:53. Following the method of Example 5, 0.2 g of substrate 7 was used to prepare 7a and 7b. Compounds 7a and 7b are reported for the first time in this invention.

[0149] Compound 7a: 1 H NMR (300 MHz, MeOD): δ H 5.70(1H,s,H-12),4.10(1H,dd,J=4.4,11.0Hz,H-7),5.75(1H,s,H-12),2.73(1H,s,H-9),1.53,1.53,1.46,1.39,1.19,1.18,0.87(s,CH3×7); 13 C NMR (75 MHz, MeOD) δ C 199.1,179.2,176.8,171.3,127.9,85.5,70.5,61.9,50.3,49.9,49.4,44.9,43.6,41.2,39.4,39.2, 37.5,32.5,31.7,31.6,30.6,30.2,29.7,27.8,27.4,26.3,25.5,22.1,17.1,10.8; HRESIMS(m / z)[MH] - calculated C 30 H 43 O6 499.3060, found 499.3060.

[0150] Compound 7b: 1 H NMR (300 MHz, MeOD): δ H 5.77(1H,s,H-12),4.28(1H,dd,J=4.4,11.0Hz,H-15),4.14(1H,dd,J=5.2,11.6 Hz,H-7),2.70(1H,s,H-9),1.54,1.48,1.46,1.39,1.20,1.20,0.90(s,CH3×7); 13 C NMR (101 MHz, MeOD) δ C198.40,178.9,176.8,170.8,128.5,85.4,69.4,66.2,61.7,51.2,50.1,49.5,43.5,40.8,39.5,39.3, 37.2,34.7,31.8,31.7,30.8,30.5,30.2,29.4,28.3,27.3,25.5,17.1,16.9,11.0; HRESIMS(m / z)[MH] - calculated C 30 H 43 O7 515.3009, found 515.3019.

[0151] Example 13 Synthesis of 8a and 8b by Enzymatic Combined Organic Catalysis

[0152] Step A: Synthesis of substrate 8

[0153] 0.5 g (1 mmol, 1 equiv) of compound 2 was dissolved in 8 mL of DMF, and (3 equiv) of potassium carbonate was added. After stirring at room temperature for 0.5 h, (2 equiv) of benzyl bromide was added dropwise. The mixture was refluxed at 100°C for 3 h, cooled, and quenched with water. The reaction was filtered and the filter cake dried to yield 0.53 g of a white solid, 8-S1. 8-S1 was dissolved in 8 mL of ethyl formate, and (16 equiv) of sodium hydride was added. The mixture was stirred at room temperature for 10 min, then quenched with methanol. The mixture was extracted three times with a 1:2 mixture of CH2Cl2:Et2O. The combined organic layers were washed with 5% HCl, saturated NaHCO3 solution, and saturated sodium chloride solution, respectively, dried over anhydrous sodium sulfate, and the organic solvent removed by rotary evaporation. The mixture was eluted with 200-300 mesh silica gel column chromatography (petroleum ether:ethyl acetate = 3:1) to yield 0.47 g of 8-S2 (white solid, 79% overall yield for the two-step reaction). 0.47 g (0.8 mmol, 1 equiv.) of 8-S2 was dissolved in 10 mL of THF, to which 0.09 g of 10% Pd—C was added. After stirring at room temperature under a hydrogen atmosphere for 8 h, the Pd—C was removed by filtration through celite, and the organic solvent was removed by rotary evaporation. The product was eluted with 200-300 mesh silica gel column chromatography (CH2Cl2:MeOH=30:1) to obtain 0.22 g of 8-S3 (white solid, 56% yield). 0.22 g (0.44 mmol, 1 equiv.) of 8-S3 was dissolved in 5 mL of acetic acid, to which (5 equiv.) of NH2OH·HCl and (0.5 equiv.) of anhydrous sodium acetate were added. The mixture was stirred at 60°C for 0.5 h, cooled to room temperature, and quenched with ice water to precipitate a white solid. The filter cake was dried and eluted with 200-300 mesh silica gel column chromatography (CH2Cl2:MeOH = 20:1) to afford 0.17 g of substrate 8 (white solid, 78% yield). The structural data obtained by mass spectrometry, H NMR, and C NMR were consistent with those previously reported.

[0154] 1 H NMR (300MHz, CDCl3): δ H 8.04(1H,s,-CH=N-),5.82(1H,s,H-12),2.57(s,1H,H-9),1.42,1.35,1.27,1.27,1.21,1.13,0.89(CH3×7); 13 C NMR (101 MHz, CDCl3): δ C199.7,182.2,172.3,170.2,150.4,128.5,109.1,60.1,53.3,48.2,45.3,43.9,43.4,41.0,38.4,37.7 ,36.0,34.8,31.9,31.8,30.9,28.9,28.6,28.5,26.6,26.4,23.3,21.6,18.3,18.1,15.8; LC-MS:[MH] - :492.3.

[0155] Step B: Enzymatic synthesis of 8a and 8b

[0156] Following the method of Example 4, the yield of substrate 8 catalyzed by CYP161H12 was determined to be 97%. The hydroxylation product 8a:8b ratio was 19:81. Following the method of Example 5, 0.2 g of substrate 8 was used to prepare compounds 8a and 8b. Compounds 8a and 8b are reported for the first time in this invention.

[0157] Compound 8a: 1 H NMR (300MHz, CDCl3): δ H 8.03(1H,s,-CH=N-),5.85(1H,s,H-12),4.20(1H,dd,J=4.7,10.7Hz,H-7 ),2.52(1H,s,H-9),1.49,1.33,1.25,1.25,1.22,1.12,0.88(s,CH3×7); 13 C NMR (75MHz, CDCl3)δ C 198.7,182.0,171.9,170.0,150.3,128.6,109.2,71.9,60.1,50.4,50.3,48.9,44.7,43.9,41.1,38.4,37 .6,35.6,34.6,31.8,30.9,30.2,29.2,28.8,28.6,28.5,26.6,23.5,21.6,15.5,11.9; HRESIMS(m / z)[MH] - calculated C 31 H 42 NO5508.3063,found 508.3064.

[0158] Compound 8b: 1 H NMR (300 MHz, MeOD): δ H8.15(1H,s,-CH=N-),5.78(1H,s,H-12),4.32(1H,dd,J=4.2,11.7Hz,H-15),4.17(1H,dd,J =4.5,11.1Hz,H-7),2.64(1H,s,H-9),1.47,1.36,1.27,1.22,1.20,1.12,0.90(s,CH3×7); 13 C NMR (101 MHz, MeOD) δ C 198.8,178.8,172.0,171.1,150.1,128.4,109.4,70.1,66.3,59.8,51.1,50.0,49.7,49.5,43.5,40.9,38 .3,37.3,34.9,34.7,34.2,31.7,30.6,28.5,27.8,27.4,26.8,20.8,17.3,14.7,11.6; HRESIMS(m / z)[MH] - calculated C 31 H 42 NO6 524.3012, found 524.3023.

[0159] Example 14: Synthesis of 9a and 9b by Enzymatic Combined Organic Catalysis

[0160] Step A: Synthesis of 9a

[0161] Using the enzymatic product 1a from Example 6 as starting material, 0.05 g (0.1 mmol, 1 equiv.) of 1a was dissolved in 2 mL of DMF. 4 equiv. of potassium carbonate was added, and the mixture was stirred at room temperature for 30 minutes. 2 equiv. of iodomethane was then added to the reaction mixture. After stirring at room temperature for 2.5 hours, water was added to precipitate a large amount of white solid. The solid was filtered, and the filter cake was collected and dried. The filter cake was eluted with 200-300 mesh silica gel column chromatography (petroleum ether:ethyl acetate = 1:1) to afford 0.04 g of compound 9a (white powder, 78% yield).

[0162] Compound 9a: 1 H NMR (300MHz, CDCl3): δ H 5.72(1H,s,H-12),4.06(1H,dd,J=5.0,10.9Hz,H-7),3.24(1H,t,J=6.8Hz,H-3),3.7 0(3H,s,CH3),2.55(1H,s,H-9),1.45,1.16,1.15,1.15,1.03,0.82,0.82(s,CH3×7);13 C NMR (75MHz, CDCl3)δ C 199.3,177.0,169.1,128.6,78.5,72.5,61.9,51.8,51.6,50.4,49.0,44.5,44.1,41.2,38.9,38.8,37.6 ,37.1,31.8,31.1,30.1,28.9,28.5,28.4,28.1,27.3,26.6,23.7,16.0,15.6,12.2; HRESIMS(m / z)[M+H] + calculated C 31 H 49 O5501.3580,found 501.3545.

[0163] Step B: Synthesis of 9b

[0164] Using 1b in Example 6 as starting material, 9b (white powder, 49% yield) was obtained according to the esterification method in Step A of Example 14.

[0165] Compound 9b: 1 H NMR (400 MHz, pyridine-d5): δ H 6.06(1H,s,H-12),4.64(1H,dd,J=5.0,11.5Hz,H-15),4.49(1H,dd,J=4.5,10.8Hz,H-7),3.66(3H,s,OCH3 ),3.51(1H,dd,J=4.5,11.6Hz,H-3),2.48(1H,s,H-9),1.67,1.44,1.41,1.27,1.15,1.08,0.86(s,CH3×7); 13 C NMR (101 MHz, pyridine-d5) δ C 198.7,176.6,169.6,129.1,77.5,71.4,66.3,62.4,51.8,51.6,51.5,50.3,49.7,44.0,40.9,39.3,39. 3,37.6,37.6,35.8,32.1,31.0,29.1,28.5,28.0,27.9,27.8,18.6,16.5,16.4,13.2; HRESIMS(m / z)[MH] - calculated C 31 H 47 O6515.3373, found 515.3387.

[0166] Example 15 Synthesis of 10a and 10b by Enzymatic Combination with Organic Catalysis

[0167] Step A: Synthesis of 10a

[0168] Using compound 1a from Example 6 as starting material, 0.04 g (0.8 mmol, 1 equiv.) of 1a was dissolved in 2 mL of DMF. (3 equiv.) of potassium carbonate was added, and the mixture was stirred at room temperature for 30 minutes. (1.5 equiv.) of 6-bromo-1-hexene was then added to the reaction mixture. After stirring at room temperature for 2.5 hours, water was added to precipitate a large amount of white solid. The solid was filtered, and the filter cake was collected and dried. The filter cake was eluted with 200-300 mesh silica gel column chromatography (petroleum ether:ethyl acetate = 1:1) to afford 0.035 g of compound 10a (white powder, 75% yield).

[0169] Compound 10a: 1 H NMR (400 MHz, MeOD): δ H 5.04(1H,dd,J=1.7,17.1Hz,CH2=CHCH2-),4.98(1H,d,J=10.2Hz,CH2=CHCH2-),4.05(1H,dd,J=5.0,11.0Hz,H -7),3.19(1H,dd,J=4.5,11.7Hz,H-3),2.42(1H,s,H-9),1.50,1.17,1.16,1.14,1.03,0.85,0.83(s,CH3×7); 13 C NMR (101 MHz, MeOD): δ C 200.3,176.7,170.9,138.1,127.8,114.0,77.8,71.7,64.1,62.0,51.5,50.4,49.2,44.6,43.9,41.1,38.6,38.6,37.5, 36.9,33.0,31.5,30.6,29.6,28.2,27.9,27.8,27.3,27.2,26.5,26.3,25.2,22.6,15.3,15.0,11.6; HRESIMS(m / z)[M+H] + calculated C 36 H 57 O5569.4206,found 569.4190.

[0170] Step B: Synthesis of 10b

[0171] Using compound 1b in Example 6 as starting material, compound 10b (white powder, yield 43%) was obtained according to the esterification method in step A of Example 15.

[0172] Compound 10b: 1 H NMR (300MHz, CDCl3): δ H 5.04(1H,m,CH2=CHCH2-),4.97(1H,m,CH2=CHCH2-),4.31(1H,dd,J=4.2,11.8Hz,H-15),4.07(1H,dd,J=4.9,11.2 Hz,H-7),3.21(1H,dd,J=4.6,11.8Hz,H-3),2.37(1H,s,H-9),1.43,1.18,1.16,1.16,1.04,0.88,0.83(s,CH3×7); 13 C NMR (101 MHz, MeOD) δ C 199.5,176.6,170.3,138.1,128.4,114.0,77.7,71.0,66.2,64.1,61.8,51.3,51.2,49.8,49.5,43.8,40.7,38.6,38.6, 37.2,37.1,34.7,33.0,31.7,30.5,28.3,27.9,27.2,27.2,26.5,26.4,25.2,17.2,15.3,15.0,11.8; HRESIMS(m / z)[M+H] + calculated C 36 H 57 O6 585.4155, found 585.4154.

[0173] Example 16 Study on the pharmacological effects of the product of the present invention

[0174] In vitro antitumor activity screening assay

[0175] Step A: Cell culture

[0176] Human hepatoma cells HepG2 and human colon cancer cells SW480 were cultured in complete medium consisting of high-glucose DMEM medium containing 10% (v / v) heat-inactivated fetal bovine serum, 100 U / mL penicillin, and 100 U / mL streptomycin. All cells used in the experiments were cultured in a 37°C incubator with 5% CO2 saturated humidity.

[0177] Step B: Preparation of compound solutions at different concentrations

[0178] All compounds were dissolved in DMSO to prepare a final compound stock solution with a concentration of 20 mM.

[0179] 200 μM compound solution was prepared by adding 10 μL of compound stock solution to 1 mL of complete medium;

[0180] 80 μM compound solution was prepared by adding 4 μL of compound stock solution to 1 mL of complete medium;

[0181] For a 40 μM compound solution, add 0.5 mL of an 80 μM compound solution to 0.5 mL of complete medium;

[0182] For a 20 μM compound solution, add 0.5 mL of a 40 μM compound solution to 0.5 mL of complete medium;

[0183] For a 10 μM compound solution, add 0.5 mL of a 20 μM compound solution to 0.5 mL of complete medium;

[0184] For a 5 μM compound solution, add 0.5 mL of a 10 μM compound solution to 0.5 mL of complete medium;

[0185] Step C: Preliminary screening of cell growth inhibitory activity

[0186] The inhibitory effect of the compound on tumor cells was investigated using CCK8 assay. 4 Cells were seeded in a 96-well plate (100 μL / mL). 200 μL of 0.01 M, pH 7.4 PBS buffer was added to the outermost 36 wells of the plate, and the inner 60 wells served as the drug group, blank group, and negative control group. Three parallel experiments were performed for each group.

[0187] Drug group: 100 μL of cell suspension was added to each well and incubated in an incubator for 24 h. 100 μL of 80 μM compound solution (100 μL of 200 μM compound solution for compound 1) was added and incubated for 48 h. 20 μL of CCK-8 was added to each well and incubated for another 2 h. The absorbance at 450 nm was measured using a microplate reader.

[0188] Blank group: 100 μL complete medium was added to each well and incubated in an incubator for 24 h. After adding 100 μL complete medium and incubating for 48 h, 20 μL CCK8 was added to each well and incubated for another 2 h. The absorbance at 450 nm was detected using a microplate reader.

[0189] Negative control group: 100 μL of cell suspension was added to each well and incubated in an incubator for 24 h. 100 μL of complete culture medium containing 0.4 μL of DMSO was added and incubated for 48 h. 20 μL of CCK8 was added to each well and incubated for another 2 h. The absorbance at 450 nm was detected using a microplate reader.

[0190] The cell growth inhibition rate was calculated according to the following formula:

[0191] IR:Inhibitory Ratio Cell growth inhibition rate

[0192] ODpositive: absorbance of drug group

[0193] ODblank: absorbance of blank group

[0194] ODnegetive: absorbance of negative control group

[0195] Step D: Determination of IC50 of the half-maximal growth inhibition concentration of the compound on tumor cells HepG2 and SW480

[0196] For compounds with a tumor cell inhibition rate higher than 50% at a concentration of 40 μM, the cell growth inhibition rate was tested at a concentration gradient of 80 μM, 40 μM, 20 μM, 10 μM, and 5 μM. Three parallel groups were set for each concentration. Based on the cell inhibition rate at different concentrations, the half-maximal growth inhibition concentration (IC50) was calculated using GraphPad Prism9.

[0197] Table 1 IC50 (μmol / L) of compounds against HepG2 and SW480

[0198] The in vitro anti-tumor activity screening experiments of a series of glycyrrhetinic acid derivatives containing B-ring and / or D-ring hydroxyl groups provided by the present invention showed that compound 10a had more than two times the activity against human colon cancer cells compared with the parent compound 1 glycyrrhetinic acid; compound 10b had more than two times the activity against human liver cancer cells and human colon cancer cells compared with the parent compound 1 glycyrrhetinic acid. The above results indicate that the products of selective CH bond hydroxylation at the C7β and C15α sites in the glycyrrhetinic acid structural skeleton obtained by using the cytochrome P450 enzyme - CYP161H12 provided by the present invention have potential anti-tumor activity, and it is expected that novel anti-tumor active drugs can be prepared by derivatization based on the hydroxylation sites.

Claims

1. A cytochrome P450 enzyme or a catalytically active fragment thereof, comprising: (a) the amino acid sequence of which is shown in SEQ ID NO: 2; or (b) The amino acid sequence in (a) is substituted and / or deleted and / or one or more amino acids are added and has cytochrome P450 enzyme activity.

2. A nucleic acid molecule encoding the cytochrome P450 enzyme or a catalytically active fragment thereof according to claim 1.

3. The nucleic acid molecule according to claim 2, comprising: (a) the sequence encoding the cytochrome P450 enzyme or the catalytically active fragment thereof according to claim 1 has at least 70% sequence identity with SEQ ID NO: 2; (b) Its nucleotide sequence is shown in SEQ ID NO:

1.

4. An expression cassette, a recombinant vector, a recombinant strain or a cell, comprising the nucleic acid molecule according to claim 2 or 3.

5. A recombinant vector or a recombinant strain, characterized in that: The recombinant vector is obtained by introducing the nucleic acid molecule described in claim 2 or 3 into an expression vector. Preferably, the expression vector includes a pET28a-RHFRed plasmid. The recombinant strain is obtained by introducing the recombinant vector described in claim 4 into Escherichia coli. Preferably, the Escherichia coli includes Escherichia coli BL21.

6. An enzyme-catalyzed conversion system, characterized in that: The enzyme-catalyzed conversion system comprises a cell lysate 1 of the recombinant strain according to claim 5. Preferably, the enzyme-catalyzed conversion system further comprises a cell lysate 2 of a recombinant strain expressing phosphite dehydrogenase; preferably, the volume ratio of the cell lysate 1 to the cell lysate 2 is 2:

1.

7. Use of the cytochrome P450 enzyme or catalytically active fragment thereof according to claim 1, the nucleic acid molecule according to claim 2 or 3, the expression cassette, recombinant vector, recombinant strain or cell according to claim 4, the recombinant vector, the recombinant strain according to claim 5, and the enzyme catalytic conversion system according to claim 6 in the preparation of glycyrrhetinic acid derivatives.

8. Glycyrrhetinic acid derivatives, the structural formula of which is shown below: in, R1 is a functional group on the A ring of glycyrrhetinic acid or a derivative structure based on the modification of the A ring, wherein the functional group on the A ring includes a hydroxyl group at C3, an acetyl group at C3, a propionyl group at C3, a butyryl group at C3, and a keto carbonyl group at C3; the derivative structure based on the modification of the A ring includes an α, β-unsaturated ketone of a C3-oxo-C1-ene, an A ring expanded to form a seven-membered lactone ring, and a fused isoxazole heterocycle at C2 and C3, and R2 includes H, methyl or hexenyl. Preferably, the glycyrrhetinic acid derivative has the following structural formula:

9. A method for preparing glycyrrhetinic acid derivatives by combining organic synthesis and enzyme catalysis, characterized in that: The following steps are involved: 1) Construction of a recombinant expression vector: introducing the nucleic acid or gene described in claim 2 or 3 into an expression vector to obtain a recombinant expression vector; 2) Obtaining and fermenting the recombinant strain: introducing the recombinant expression vector into the host bacteria to obtain the recombinant bacteria, fermenting and inducing the expression of the obtained recombinant bacteria and ultrasonically disrupting the obtained recombinant bacteria to obtain cell lysate 1; preferably, the process further includes fermenting and inducing the expression of the recombinant strain expressing phosphite dehydrogenase and ultrasonically disrupting the obtained recombinant bacteria to obtain cell lysate 2; 3) Catalyzing the substrate to prepare a glycyrrhetinic acid derivative: reacting the cell lysate 1 with the substrate to obtain; preferably, the process further comprises adding the cell lysate 2 to react; preferably, the substrate comprises glycyrrhetinic acid, 3-hydroxyglycyrrhetinic acid, 3-acetylglycyrrhetinic acid, 3-propionylglycyrrhetinic acid, 3-butyrylglycyrrhetinic acid, 3-oxoglycyrrhetinic acid, 3-oxo-1-eneglycyrrhetinic acid, and a glycyrrhetinic acid derivative in which the A ring is a seven-membered lactone ring; Preferably, the recombinant expression vector in step 1) includes pET28a-CYP161H12-RHFRed; Preferably, the fermentation step in step 2) comprises: inoculating the recombinant Escherichia coli containing pET28a-CYP161H12-RHFRed into LB medium and culturing at 37°C to obtain a seed solution, adding a trace amount of metal salt solution and the above seed solution to TB medium, culturing at 37°C to the logarithmic growth phase, then adding IPTG and 5-ALA to induce the bacteria to express the CYP161H12-RHFRed fusion protein, inducing the culture at 18°C ​​for 20 hours, and collecting the bacteria by centrifugation for in vitro catalytic reaction; Preferably, the formula of the trace metal salt solution is: 50mM FeCl3, 20mM CaCl2, 10mM MnSO4, 10mM ZnSO4, 2mM CoSO4, 2mM CuCl2, 2mM NiCl2, 2mM Na2MoO4, 2mM H3BO3; preferably, the trace metal salt solution is added to the TB culture medium at a ratio of 0.1% v / v; Preferably, the concentration of IPTG in the TB medium is preferably 0.1 mM, and the concentration of 5-ALA in the TB medium is preferably 0.5 mM; Preferably, in the above step (3), the ratio of adding the cell lysis solution 1 to the cell lysis solution 2 is 2:

1.

10. Use of the glycyrrhizic acid derivative according to claim 8 in the preparation of anti-inflammatory, anti-tumor, antiviral or neuroprotective drugs.

Images