Use of a mirna inhibitor for the treatment of osteogenesis imperfecta

Abstract

As epigenetic regulators of gene expression, circulating microRNAs (miRNAs) have been described in several bone diseases as potential prognostic markers. The aim of the inventors was to identify circulating miRNAs potentially associated with the severity of Osteogenesis Imperfecta (OI), in 3 steps. They have screened by RNA sequencing for the microRNAs (miRNAs) that were differentially expressed in sera of a small group of OI patients versus controls and then conducted a validation phase by RT-qPCR analysis of sera of a larger patient population. In the first phase of miROI, the inventors found 79 miRNAs that were significantly differentially expressed. They therefore selected 19 of them as the most relevant. In the second phase, the inventors were able to validate the significant overexpression of 8 miRNAs in the larger OI group (miR-106b-3p, miR-191-5p, miR-363-3p, miR-451a, miR-93-3p, miR-93-5p, let-7g-5p, miR-15b-5p). Finally, the inventors looked for a relationship between the level of variation of the validated miRNAs and the clinical characteristics of OI. The inventors found a significant difference in the expression of two microRNAs in those patients with Dentinogenesis Imperfecta. After reviewing the literature, the inventors found 6 of the 8 miRNAs already known to have a direct action on bone homeostasis. Furthermore, the use of a miRNA-gene interaction prediction model revealed a 100% probability of interaction between 2 of the 8 confirmed miRNAs and COL1A1 and / or COL1A2 (miR93 and miR-106b). This is the first study to establish the miRNA signature in OI, showing a significant modification of miRNAs expression potentially involved in the regulation of genes involved in the physiopathology of OI.

Description

[0001] USE OF A MIRNA INHIBITOR FOR THE TREATMENT OF OSTEOGENESIS IMPERFECTA

[0002] FIELD OF THE INVENTION:

[0003] The present invention is in the field of medicine, in particular bone diseases.

[0004] BACKGROUND OF THE INVENTION:

[0005] Osteogenesis Imperfecta (01) is a heterogeneous group of rare hereditary connective tissue diseases that cause bone matrix damage leading to fragility and deformity(1,2). The prevalence of the disease is estimated to be 1 in 10,000. It is the most common hereditary connective tissue disorder(3,4). In about 85% of affected patients, OI is due to one or more pathogenic variants in one of the two genes encoding the al and a2 chains of type I procollagen, COL1A1 and COL1A2, respectively. Their mode of inheritance is autosomal dominant. This results in either the decrease in type I collagen synthesis or the structure deterioration, leading to a quantitative or qualitative defects in type I collagen. It seems that quantitative damage is associated with the least severe OI, whereas qualitative damage is preferentially associated with the most debilitating forms of OI. The position of the mutation in the nucleotide chain is also an important factor, with less severe damage when the mutations are located at the N-terminal side and more often lethal damage for those located at the C-terminal(2). Finally, there are certain crucial regions, the ligand-binding regions (MLBRs), for the functional use of collagen in the matrixf5 7). Over the last 15 years at least 20 novel variant genes responsible for 15% of the remaining cases of OI have been discovered, affecting bone mineralization, post-translational modifications of type I collagen, collagen processing and cross-linking, and osteoblast differentiation and function. These discoveries have led to the identification of different modes of transmission for these forms of OI, mainly autosomal recessive or more rarely X-linked(2,8’9). Despite the progress made to identify the different types of mutations involved in the disease, the relationship between the types of variants and the severity of the clinical condition remains uncertain. There is a lack of correlation between genetics and the variability of extra-osseous manifestations of OI that impact the severity and the prognosis, such as deafness, cardiovascular disease, hyperlaxity, scoliosis, Dentinogenesis Imperfecta, ophthalmologic impairments(10). Gene expression is also strongly modulated by epigenetic regulations, leading to characteristic gene expression profiles linked to clinical outcomes. Changes in the expression of microRNAs (miRNAs), that are endogenous regulators of transcription, may explain at least partly phenotypic variability(11). MiRNAs are short (18-25 nucleotides), non-coding, single-stranded RNAs and key epigenetic regulators of many physiological and pathophysiological processes by regulating gene expression(11). It is estimated that more than 60% of human protein-coding genes have a binding affinity for miRNAs, that is generally conserved in most mammalian species(12). In bone, miRNAs have been shown to play an essential role in the regulation of osteoblastogenesis, osteoclastogenesis, mesenchymal stem cell differentiation and more generally osteogenesis and bone homeostasis(13, 14). Studying the regulation of miRNA expression and their activity in disease opens the way towards potential therapies by their specific targeting at tissues sites using synthetic small RNAs that mimic or antagonize endogenous miRNAs and restore or inhibit their functions, respectively(15,16). Abnormal miRNA level and activity have been consistently reported in bone marrow and matrix, mesenchymal stem cells, osteoblasts, osteoclasts and in blood-release of several bone-related diseases such as osteoporosis, ectopic calcification, fibrous dysplasia of bone and bone metastasisN 7 2I\ For example, miR-100 is up-regulated in bone tissue and osteoporotic osteoblasts and osteoclasts in osteoporosis(22). Such associations of the miRNA levels with the bone-related gene expression and the clinical presentation of 01 would help to decipher the pathophysiological process of the disease. $

[0006] SUMMARY OF THE INVENTION:

[0007] The present invention is defined by the claims. In particular, the present invention relates to the use of a miRNA inhibitor for the treatment of Osteogenesis Imperfecta wherein the miRNA inhibitor selected from the group consisting of miR-93 inhibitors, miR-106b inhibitors, miR- 25 inhibitors and miR-182 inhibitors.

[0008] DETAILED DESCRIPTION OF THE INVENTION:

[0009] As epigenetic regulators of gene expression, circulating microRNAs (miRNAs) have been described in several bone diseases as potential prognostic markers. The aim of the inventors was to identify circulating miRNAs potentially associated with the severity of Osteogenesis Imperfecta (OI), in 3 steps. They have screened by RNA sequencing for the microRNAs (miRNAs) that were differentially expressed in sera of a small group of OI patients versus controls and then conducted a validation phase by RT-qPCR analysis of sera of a larger patient population. In the first phase of miROI, the inventors found 79 miRNAs that were significantly differentially expressed. They therefore selected 19 of them as the most relevant. In the second phase, the inventors were able to validate the significant overexpression of 8 miRNAs in the larger 01 group (miR-106b-3p, miR-191-5p, miR-363-3p, miR-451a, miR-93-3p, miR-93-5p, let-7g-5p, miR-15b-5p). Finally, the inventors looked for a relationship between the level of variation of the validated miRNAs and the clinical characteristics of 01. The inventors found a significant difference in the expression of two microRNAs in those patients with Dentinogenesis Imperfecta. After reviewing the literature, the inventors found 6 of the 8 miRNAs already known to have a direct action on bone homeostasis. Furthermore, the use of a miRNA-gene interaction prediction model revealed a 100% probability of interaction between 2 of the 8 confirmed miRNAs and COL1A1 and / or COL1A2 (miR93 and miR-106b). This is the first study to establish the miRNA signature in OI, showing a significant modification of miRNAs expression potentially involved in the regulation of genes involved in the physiopathology of OI.

[0010] The present invention relates to a method of treating Osteogenesis Imperfecta (OI) in a patient in need thereof comprising administering to the patient a therapeutically effective amount of at least one miRNA inhibitor selected from the group consisting of miR-93 inhibitors, miR-106b inhibitors, miR-25 inhibitors and miR-182 inhibitors.

[0011] As used herein, the term “Osteogenesis Imperfecta” or “OI” has its general meaning in the art and refers to is a heterogeneous group of rare hereditary connective tissue diseases that cause bone matrix damage leading to fragility and deformity1>2. In approximately 90% of cases, OI is caused by monoallelic variants in the COL1A1 and COL1A2 genes (17q21.33 and 7q21.3) encoding the alphal and alpha2 chains of type 1 collagen. These variants can cause types I-IV of OI. In Type V, the variant is in the promoter region of the IFITM5 gene (1 Ip 15.5). Over 15 causal genes have been identified and some geno-phenotypes are emerging: in children with BMP1 variants, high bone mass can be observed. Children with homozygous WNT1 variants have ptosis and neurodevelopmental delay; and craniosynostosis defects are associated with P4HB or SEC24D variants. Age at diagnosis depends on the severity of the disease. Five clinically distinct types of osteogenesis imperfecta (OI) have been identified. The most clinically relevant characteristic of all types of OI is bone fragility, which manifests as multiple spontaneous fractures. Type I is mild and nondeforming with normal height or short stature, blue sclera, and no dentinogenesis imperfecta (DI). Patients with type II present multiple rib and long bone fractures at birth, marked deformities, broad long bones, low density on skull X- rays, and dark sclera. These patients die at birth, or shortly after. Type III is severe and the main signs include severe short stature, a triangular face, severe scoliosis, grayish sclera, and DI. Type IV and V are moderate or severe forms. Patients with type IV have moderate short stature, variable severity of scoliosis, grayish or white sclera, and some have DI. Type V is characterized by mild to moderate short stature, metaphyseal dysplasia at birth, dislocation of the radial head, mineralized interosseous membranes of the forearm and lower leg, hyperplastic callus (particularly when growth is more rapid e.g. during infancy or puberty), white sclera, and no DI. They have variable severity of scoliosis. Diagnosis is based on skeletal and extra-skeletal clinical findings. Radiological studies reveal osteoporosis and the presence of Wormian bones. Bone densitometry confirms the low bone mass.

[0012] As used herein, the term "treatment" or "treat" refer to both prophylactic or preventive treatment as well as curative or disease modifying treatment, including treatment of patient at risk of contracting the disease or suspected to have contracted the disease as well as patients who are ill or have been diagnosed as suffering from a disease or medical condition, and includes suppression of clinical relapse. The treatment may be administered to a patient having a medical disorder or who ultimately may acquire the disorder, in order to prevent, cure, delay the onset of, reduce the severity of, or ameliorate one or more symptoms of a disorder or recurring disorder, or in order to prolong the survival of a patient beyond that expected in the absence of such treatment. By "therapeutic regimen" is meant the pattern of treatment of an illness, e.g., the pattern of dosing used during therapy. A therapeutic regimen may include an induction regimen and a maintenance regimen. The phrase "induction regimen" or "induction period" refers to a therapeutic regimen (or the portion of a therapeutic regimen) that is used for the initial treatment of a disease. The general goal of an induction regimen is to provide a high level of drug to a patient during the initial period of a treatment regimen. An induction regimen may employ (in part or in whole) a "loading regimen", which may include administering a greater dose of the drug than a physician would employ during a maintenance regimen, administering a drug more frequently than a physician would administer the drug during a maintenance regimen, or both. The phrase "maintenance regimen" or "maintenance period" refers to a therapeutic regimen (or the portion of a therapeutic regimen) that is used for the maintenance of a patient during treatment of an illness, e.g., to keep the patient in remission for long periods of time (months or years). A maintenance regimen may employ continuous therapy (e.g., administering a drug at regular intervals, e.g., weekly, monthly, yearly, etc.) or intermittent therapy (e.g., interrupted treatment, intermittent treatment, treatment at relapse, or treatment upon achievement of a particular predetermined criteria [e.g., disease manifestation, etc.]). As used herein, the term “microRNA” or “miRNA” refers to an RNA molecule that is approximately 21-23 nucleotides (nt) in length. miRNAs can range between 18-26 nucleotides in length. Typically, miRNAs are single-stranded. However, in some embodiments, miRNAs may be at least partially double-stranded. In some embodiments, miRNAs may comprise an RNA duplex (referred to herein as a “duplex region”) and may optionally further comprises one or two single-stranded overhangs. In some embodiments, the miRNA comprises a duplex region ranging from 15 to 29 by in length and optionally further comprising one or two singlestranded overhangs. A miRNA may be formed from two RNA molecules that hybridize together or may alternatively be generated from a single RNA molecule that includes a self-hybridizing portion. In general, free 5 ’ends of miRNA molecules have phosphate groups, and free 3’ ends have hydroxyl groups. The duplex portion of a miRNA usually, but does not necessarily, comprise one or more bulges consisting of one or more unpaired nucleotides. One strand of a miRNA includes a portion that hybridizes with a target RNA. In some embodiments, one strand of the miRNA is not precisely complementary with a region of the target RNA, meaning that the miRNA hybridizes to the target RNA with one or more mismatches. In some embodiments, one strand of the miRNA is precisely complementary with a region of the target RNA, meaning that the miRNA hybridizes to the target RNA with no mismatches. Typically, miRNAs are thought to mediate inhibition of gene expression by inhibiting translation of target transcripts. However, in some embodiments, miRNAs may mediate inhibition of gene expression by causing degradation of target transcripts.

[0013] As used herein, the term “miR-106b” has its general meaning in the art and refers to the miRNA available from the data base http: / / mirbase.org under the miRBase accession number MI0000734 (hsa-mir-106b). The term encompasses the mature sequences hsa-miR-106b-5p (MIMAT0000680, SEQ ID NO: 1) and hsa-miR-106b-3p (MIMAT0004672, SEQ ID N0:2).

[0014] SEQ ID NO : 1 >hsa-miR- 106b-5p MIMAT0000680 UAAAGUGCUGACAGUGCAGAU

[0015] SEQ ID NO : 2 >hsa-miR- 106b-3p MIMAT0004672 CCGCACUGUGGGUACUUGCUGC

[0016] As used herein, the term “miR-93” has its general meaning in the art and refers to the miRNA available from the data base http: / / mirbase.org under the miRBase accession number MI0000095 (hsa-mir-93). The term encompasses the mature sequences hsa-miR-93-5p (MIMAT0000093, SEQ ID NO:3) and hsa-miR-93-3p (MIMAT0004509, SEQ ID NO:4).

[0017] SEQ ID NO : 3 >hsa-miR- 93-5p MIMAT0000093

[0018] CAAAGUGCUGUUCGUGCAGGUAG

[0019] SEQ ID NO : 4 >hsa-miR- 93-3p MIMAT0004509 ACUGCUGAGCUAGCACUUCCCG

[0020] As used herein, the term “miR-25” has its general meaning in the art and refers to the miRNA available from the data base http: / / mirbase.org under the miRBase accession number MI0000082 (hsa-mir-25). The term encompasses the mature sequences hsa-miR-25-5p (MIMAT0004498, SEQ ID N0:5) and hsa-miR-25-3p (MIMAT0000081, SEQ ID N0:6).

[0021] SEQ ID NO : 5 >hsa-miR-25-5p MIMAT0004498

[0022] AGGCGGAGACUUGGGCAAUUG

[0023] SEQ ID NO : 6 >hsa-miR-25-3p MIMAT0000081 CAUUGCACUUGUCUCGGUCUGA

[0024] As used herein, the term “miR-182” has its general meaning in the art and refers to the miRNA available from the data base http: / / mirbase.org under the miRBase accession number MI0000272 (hsa-mir-182). The term encompasses the mature sequences hsa-miR-182-5p (MIMAT0000259, SEQ ID N0:7) and hsa-miR-182-3p (MIMAT0000260, SEQ ID N0:8).

[0025] SEQ ID NO : 7 >hsa-miR- 182-5p MIMAT0000259

[0026] UUUGGCAAUGGUAGAACUCACACU

[0027] SEQ ID NO : 8 >hsa-miR- 182-3p MIMAT0000260 UGGUUCUAGACUUGCCAACUA

[0028] As used herein, the term “miRNA inhibitor” refers to any compound that blocks miRNA expression, processing and / or function. The miRNA inhibitor of the present invention is a compound that inhibits or reduces the activity of miR-106b, miR-93, miR-25, or miR-182. However, decreasing and / or reducing the activity of miR-106b, miR-93, miR-25, or miR-182 can also be obtained by inhibiting miR-106b, miR-93, miR-25, or miR-182 expression. The term “inhibiting miR-106b, miR-93, miR-25, or miR-182 expression” means that the production of miR-106b, miR-93, miR-25, or miR-182 in target cells after treatment is less than the amount produced prior to treatment or neutralize the activity of existent amount. One skilled in the art can readily determine whether miR-106b, miR-93, miR-25, or miR-182 expression has been inhibited in the target cells, using for example the techniques for determining miRNA transcript level.

[0029] In some embodiments, the miRNA inhibitor of the present invention is a compound such as nucleic acid that hybridizes with miR-106b, miR-93, miR-25, or miR-182 or having sequence complementarity to that of miR-106b, miR-93, miR-25, or miR-182. In some embodiments, miRNA inhibitor of the present invention is a compound such as nucleic acid having at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98 99 or 100% sequence complementarity to that of miR-106b, miR-93, miR-25, or miR-182.

[0030] Suitable miRNA inhibitors include double-stranded RNA (such as short- or small-interfering RNA or "siRNA"), antagomirs, antisense nucleic acids, and enzymatic RNA molecules such as ribozymes. Each of these compounds can be targeted to a given miRNA and destroy or induce the destruction of the target miRNA. For example, expression of a given miRNA can be inhibited by inducing RNA interference of the miRNA with an isolated double-stranded RNA ("dsRNA") molecule which has at least 90%, for example 90%; 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%, sequence homology with at least a portion of the miRNA.

[0031] In some embodiments, the dsRNA molecule is a "short or small interfering RNA" or "siRNA". siRNA useful in the present methods comprise short double-stranded RNA from about 17 nucleotides to about 29 nucleotides in length, preferably from about 19 to about 25 nucleotides in length. The siRNA comprise a sense RNA strand and a complementary antisense RNA strand annealed together by standard Watson-Crick base-pairing interactions (hereinafter "base-paired"). The sense strand comprises a nucleic acid sequence which is substantially identical to a nucleic acid sequence contained within the target miRNA. As used herein, a nucleic acid sequence in a siRNA which is "substantially identical" to a target sequence contained within the target mRNA is a nucleic acid sequence that is identical to the target sequence, or that differs from the target sequence by one or two nucleotides. The sense and antisense strands of the siRNA can comprise two complementary, single-stranded RNA molecules, or can comprise a single molecule in which two complementary portions are basepaired and are covalently linked by a single-stranded "hairpin" area. The siRNA can also be altered RNA that differs from naturally-occurring RNA by the addition, deletion, substitution and / or alteration of one or more nucleotides. Such alterations can include addition of non- nucleotide material, such as to the end(s) of the siRNA or to one or more internal nucleotides of the siRNA, or modifications that make the siRNA resistant to nuclease digestion, or the substitution of one or more nucleotides in the siRNA with deoxyribonucleotides. One or both strands of the siRNA can also comprise a 3 overhang. As used herein, a "3' overhang" refers to at least one unpaired nucleotide extending from the 3 '-end of a duplexed RNA strand. Thus, in some embodiments, the siRNA comprises at least one 3' overhang of 1 to about 6 nucleotides (which includes ribonucleotides or deoxyribonucleotides) in length, preferably from 1 to about 5 nucleotides in length, more preferably from 1 to about 4 nucleotides in length, and particularly preferably from about 2 to about 4 nucleotides in length. In some embodiments, the 3' overhang is present on both strands of the siRNA, and is 2 nucleotides in length. For example, each strand of the siRNA can comprise 3' overhangs of dithymidylic acid ("TT") or diuridylic acid ("uu"). The siRNA can be produced chemically or biologically, or can be expressed from a recombinant plasmid or viral vector, as described above. Exemplary methods for producing and testing dsRNA or siRNA molecules are described in U.S. published patent application 2002 / 0173478 to Gewirtz and in U.S. published patent application 2004 / 0018176 to Reich et al., the entire disclosures of which are herein incorporated by reference.

[0032] Expression of a given miRNA can also be inhibited by an antisense nucleic acid. As used herein, an "antisense nucleic acid" refers to a nucleic acid molecule that binds to target RNA by means of RNA-RNA or RNA-DNA or RNA-peptide nucleic acid interactions, which alters the activity of the target RNA. Antisense nucleic acids suitable for use in the present methods are singlestranded nucleic acids (e.g., RNA, DNA, RNA-DNA chimeras, PNA) that generally comprise a nucleic acid sequence complementary to a contiguous nucleic acid sequence in a miRNA. Preferably, the antisense nucleic acid comprises a nucleic acid sequence that is 50-100% complementary, more preferably 75-100% complementary, and most preferably 95-100% complementary to a contiguous nucleic acid sequence in a miRNA. Without wishing to be bound by any theory, it is believed that the antisense nucleic acids activate RNase H or some other cellular nuclease that digests the miRNA / anti sense nucleic acid duplex.

[0033] Antisense nucleic acids can also contain modifications of the nucleic acid backbone or of the sugar and base moieties (or their equivalent) to enhance target specificity, nuclease resistance, delivery or other properties related to efficacy of the molecule. Such modifications include cholesterol moieties, duplex intercalators such as acridine or the inclusion of one or more nuclease-resistant groups. Antisense nucleic acids can be produced chemically or biologically, or can be expressed from a recombinant plasmid or viral vector, as described below. Exemplary methods for producing and testing are within the skill in the art; see, e.g., Stein and Cheng (1993), Science 261 : 1004 and U.S. Pat. No. 5,849,902 to Woolf et al., the entire disclosures of which are herein incorporated by reference.

[0034] In some embodiments, the miRNA inhibitor is an antagomir. As used herein, the term “antagomir” refers to a chemically engineered small RNA that is used to silence miR-106b, miR-93, miR-25, or miR-182. The antagomir is complementary to the specific miRNA target with either mis-pairing or some sort of base modification. Antagomirs may also include some sort of modification to make them more resistant to degradation. In some embodiments the antagomir is a chemically engineered cholesterol- conjugated single-stranded RNA analogue. Inhibition of miR-106b, miR-93, miR-25, or miR-182 can also be achieved with antisense 2'- O-methyl (2'-0-Me) oligoribonucleotides, 2'-O-methoxyethyl (2'-0-M0E), phosphorothioates, locked nucleic acid (LNA), morpholino oligomers or by use of lentivirally or adenovirally expressed antagomirs (Stenvang and Kauppinen (2008), Expert Opin. Biol. Ther. 8(1): 59-81). Furthermore, MOE (2'-O-methoxy ethyl phosphorothioate) or LNA (locked nucleic acid (LNA) phosphorothioate chemistry)-modification of single-stranded RNA analogous can be used to inhibit miRNA activity.

[0035] Expression of a given miRNA can also be inhibited by an enzymatic nucleic acid. As used herein, an "enzymatic nucleic acid" refers to a nucleic acid comprising a substrate binding region that has complementarity to a contiguous nucleic acid sequence of a miRNA, and which is able to specifically cleave the miRNA. Preferably, the enzymatic nucleic acid substrate binding region is 50-100% complementary, more preferably 75-100% complementary, and most preferably 95-100% complementary to a contiguous nucleic acid sequence in a miRNA. The enzymatic nucleic acids can also comprise modifications at the base, sugar, and / or phosphate groups. An exemplary enzymatic nucleic acid for use in the present methods is a ribozyme. The enzymatic nucleic acids can be produced chemically or biologically, or can be expressed from a recombinant plasmid or viral vector, as described below. Exemplary methods for producing and testing dsRNA or siRNA molecules are described in Werner and Uhlenbeck (1995), Nucl. Acids Res. 23:2092-96; Hammann et al. (1999), Antisense and Nucleic Acid Drug Dev. 9:25-31; and U.S. Pat. No. 4,987,071 to Cech et al, the entire disclosures of which are herein incorporated by reference. The miRNA inhibitor of the present invention can be obtained using a number of standard techniques. For example, the miRNA inhibitor of the present invention can be chemically synthesized or recombinantly produced using methods known in the art. Typically, miRNA inhibitor of the present invention are chemically synthesized using appropriately protected ribonucleoside phosphoramidites and a conventional DNA / RNA synthesizer. Commercial suppliers of synthetic RNA molecules or synthesis reagents include, e.g., Proligo (Hamburg, Germany), Dharmacon Research (Lafayette, Colo., USA), Pierce Chemical (part of Perbio Science, Rockford, 111., USA), Glen Research (Sterling, Va., USA), ChemGenes (Ashland, Mass., USA) and Cruachem (Glasgow, UK).

[0036] In some embodiments, a synthetic miRNA inhibitor of the present invention contains one or more design elements. These design elements include, but are not limited to: (i) a replacement group for the phosphate or hydroxyl of the nucleotide at the 5' terminus of the complementary region; (ii) one or more sugar modifications. In some embodiments, a synthetic miRNA inhibitor of the present invention has a nucleotide at its 5' end of the complementary region in which the phosphate and / or hydroxyl group has been replaced with another chemical group (referred to as the “replacement design”). In some cases, the phosphate group is replaced, while in others, the hydroxyl group has been replaced. In some embodiments, the replacement group is biotin, an amine group, a lower alkylamine group, an acetyl group, 2'0-Me (2'oxygen- methyl), DMTO (4,4'-dimethoxytrityl with oxygen), fluorescein, a thiol, or acridine, though other replacement groups are well known to those of skill in the art and can be used as well. In some embodiments, the sugar modification is a 2'0-Me modification. In some embodiments, there is one or more sugar modifications in the first or last 2 to 4 residues of the complementary region or the first or last 4 to 6 residues of the complementary region.

[0037] In some embodiments, the miRNA inhibitor of the present invention is resistant to degradation by nucleases. One skilled in the art can readily synthesize nucleic acids which are nuclease resistant, for example by incorporating one or more ribonucleotides that are modified at the 2'- position into the miRNAs. Suitable 2'-modified ribonucleotides include those modified at the 2'-position with fluoro, amino, alkyl, alkoxy, and O-allyl.

[0038] Alternatively, the miRNA inhibitor of the present invention can be expressed from recombinant linear or circular DNA plasmids using any suitable promoter. Suitable promoters for expressing RNA from a plasmid include, e.g., the U6 promoter sequence, or the cytomegalovirus promoters. Selection of other suitable promoters is within the skill in the art. The recombinant plasmids of the present invention can also comprise inducible or regulatable promoters for expression of the miRNA inhibitor of the present invention in target cells.

[0039] The miRNA inhibitor of the present invention that is expressed from recombinant plasmids can be isolated from cultured cell expression systems by standard techniques. The miRNA inhibitor of the present invention which is expressed from recombinant plasmids can also be delivered to, and expressed directly in, target cells. The use of recombinant plasmids to deliver the miRNA inhibitor of the present invention to target cells is discussed in more detail below.

[0040] The miRNA inhibitor of the present invention can be expressed from a separate recombinant plasmid, or can be expressed from a unique recombinant plasmid. Preferably, the miRNA inhibitor of the present invention is expressed as the nucleic acid precursor molecules from a single plasmid, and the precursor molecules are processed into the functional miRNA inhibitor by a suitable processing system, including processing systems extant within target cells. Other suitable processing systems include, e.g., the in vitro Drosophila cell lysate system as described in U.S. published application 2002 / 0086356 to Tuschl et al. and the E. coli RNAse III system described in U.S. published patent application 2004 / 0014113 to Yang et al., the entire disclosures of which are herein incorporated by reference.

[0041] Selection of plasmids suitable for expressing the miRNA inhibitor of the present invention, methods for inserting nucleic acid sequences into the plasmid to express the gene products, and methods of delivering the recombinant plasmid to the cells of interest are within the skill in the art. See, for example, Zeng et al. (2002), Molecular Cell 9: 1327-1333; Tuschl (2002), Nat. Biotechnol, 20:446-448; Brummelkamp et al. (2002), Science 296:550-553; Miyagishi et al. (2002), Nat. Biotechnol. 20:497-500; Paddison et al. (2002), Genes Dev. 16:948-958; Lee et al. (2002), Nat. Biotechnol. 20:500-505; and Paul et al. (2002), Nat. Biotechnol. 20:505-508, the entire disclosures of which are herein incorporated by reference.

[0042] In some embodiments, a plasmid expressing the miRNA inhibitor of the present invention comprises a sequence encoding a miRNA inhibitor precursor under the control of the CMV intermediate early promoter. As used herein, "under the control" of a promoter means that the nucleic acid sequences are located 3' of the promoter, so that the promoter can initiate transcription of the miRNA inhibitor coding sequences. The miRNA inhibitor of the present invention can also be expressed from recombinant viral vectors. It is contemplated that the miRNA inhibitor of the present invention can be expressed from separate recombinant viral vectors, or from a unique viral vector. The miRNA inhibitor expressed from the recombinant viral vectors either can be isolated from cultured cell expression systems by standard techniques or can be expressed directly in target cells. The use of recombinant viral vectors to deliver the miRNA inhibitor to target cells is discussed in more detail below. The recombinant viral vectors of the present invention comprise sequences encoding the miR-106b, miR-93, miR-25, or miR-182 inhibitor compound of the present invention and any suitable promoter for expressing the miRNA inhibitor sequences. Suitable promoters include, for example, the U6 or HI RNA pol III promoter sequences, or the cytomegalovirus promoters. Selection of other suitable promoters is within the skill in the art. The recombinant viral vectors of the present invention can also comprise inducible or regulatable promoters for expression of the miRNA inhibitor in target cells. Any viral vector capable of accepting the coding sequences for The miRNA inhibitor of the present invention can be used; for example, vectors derived from adenovirus (AV); adenoassociated virus (t); retroviruses (e.g., lentiviruses (LV), Rhabdoviruses, murine leukemia virus); herpes virus, and the like. The tropism of the viral vectors can be modified by pseudotyping the vectors with envelope proteins or other surface antigens from other viruses, or by substituting different viral capsid proteins, as appropriate. For example, lentiviral vectors of the present invention can be pseudotyped with surface proteins from vesicular stomatitis virus (VSV), rabies, Ebola, Mokola, and the like. AAV vectors of the present invention can be made to target different cells by engineering the vectors to express different capsid protein serotypes. For example, an AAV vector expressing a serotype 2 capsid on a serotype 2 genome is called AAV 2 / 2. This serotype 2 capsid gene in the AAV 2 / 2 vector can be replaced by a serotype 5 capsid gene to produce an AAV 2 / 5 vector. Techniques for constructing AAV vectors which express different capsid protein serotypes are within the skill in the art; see, e.g., Rabinowitz J. E. et al. (2002), J Virol 76:791801, the entire disclosure of which is herein incorporated by reference.

[0043] The miRNA inhibitor can be administered to a patient by any means suitable for delivering these compounds to target cells. For example, the miRNA inhibitor can be administered by methods suitable to transfect cells of the patient with these compounds, or with nucleic acids comprising sequences encoding these compounds. Preferably, the cells are transfected with a plasmid or viral vector comprising sequences encoding at least one miRNA inhibitor. The miRNA inhibitor can be administered to a patient by any suitable enteral or parenteral administration route. Suitable enteral administration routes for the present methods include, e.g., oral, rectal, or intranasal delivery. Suitable parenteral administration routes include, e.g., intravascular administration (e.g., intravenous bolus injection, intravenous infusion, intraarterial bolus injection, intra-arterial infusion and catheter instillation into the vasculature); peri- and intra-tissue injection (e.g., intra-retinal injection, or subretinal injection); subcutaneous injection or deposition, including subcutaneous infusion (such as by osmotic pumps); direct application to the tissue of interest, for example by a catheter or other placement device (e.g., an implant comprising a porous, non-porous, or gelatinous material); and inhalation. Preferred administration routes are injection, infusion and direct injection into the tumor tissue.

[0044] In the present methods, a miRNA inhibitor can be administered to the patient either as naked RNA, in combination with a delivery reagent, or as a nucleic acid (e.g., a recombinant plasmid or viral vector) comprising sequences that express the miRNA inhibitor. Suitable delivery reagents include, e.g, the Minis Transit TKO lipophilic reagent; lipofectin; lipofectamine; cellfectin; polycations (e.g., polyethylenimine which become a nanoparticle (less than 50 nm) when mixed with glucose solution; or e.g, polylysine), and liposomes. In some embodiments, liposomes are used to deliver a miRNA inhibitor (or nucleic acids comprising sequences encoding them) to a patient. Liposomes can also increase the blood half-life of the gene products or nucleic acids. Liposomes suitable for use in the invention can be formed from standard vesicle-forming lipids, which generally include neutral or negatively charged phospholipids and a sterol, such as cholesterol. The selection of lipids is generally guided by consideration of factors such as the desired liposome size and half-life of the liposomes in the blood stream. A variety of methods are known for preparing liposomes, for example, as described in Szoka et al. (1980), Ann. Rev. Biophys. Bioeng. 9:467; and U.S. Pat. Nos. 4,235,871, 4,501,728, 4,837,028, and 5,019,369, the entire disclosures of which are herein incorporated by reference. The liposomes for use in the present methods can comprise a ligand molecule that targets the liposome to target cells. Ligands which bind to receptors prevalent in target cells, such as monoclonal antibodies that bind to cancer cell antigens, are preferred. The liposomes for use in the present methods can also be modified so as to avoid clearance by the mononuclear macrophage system ("MMS") and reticuloendothelial system ("RES"). Such modified liposomes have opsonization-inhibition moieties on the surface or incorporated into the liposome structure. In particular, a liposome of the present invention can comprise both opsonization-inhibition moieties and a ligand. Opsonization-inhibiting moieties for use in preparing the liposomes of the present invention are typically large hydrophilic polymers that are bound to the liposome membrane. As used herein, an opsonization inhibiting moiety is "bound" to a liposome membrane when it is chemically or physically attached to the membrane, e.g., by the intercalation of a lipid-soluble anchor into the membrane itself, or by binding directly to active groups of membrane lipids. These opsonization-inhibiting hydrophilic polymers form a protective surface layer that significantly decreases the uptake of the liposomes by the MMS and RES; e.g., as described in U.S. Pat. No. 4,920,016, the entire disclosure of which is herein incorporated by reference. Opsonization inhibiting moieties suitable for modifying liposomes are preferably water-soluble polymers with a number-average molecular weight from about 500 to about 40,000 daltons, and more preferably from about 2,000 to about 20,000 daltons. Such polymers include polyethylene glycol (PEG) or polypropylene glycol (PPG) derivatives; e.g., methoxy PEG or PPG, and PEG or PPG stearate; synthetic polymers such as polyacrylamide or poly N-vinyl pyrrolidone; linear, branched, or dendrimeric polyamidoamines; polyacrylic acids; polyalcohols, e.g., polyvinylalcohol and polyxylitol to which carboxylic or amino groups are chemically linked, as well as gangliosides, such as ganglioside GM1. Copolymers of PEG, methoxy PEG, or methoxy PPG, or derivatives thereof, are also suitable. In addition, the opsonization inhibiting polymer can be a block copolymer of PEG and either a polyamino acid, polysaccharide, polyamidoamine, polyethyleneamine, or polynucleotide. The opsonization inhibiting polymers can also be natural polysaccharides containing amino acids or carboxylic acids, e.g., galacturonic acid, glucuronic acid, mannuronic acid, hyaluronic acid, pectic acid, neuraminic acid, alginic acid, carrageenan; animated polysaccharides or oligosaccharides (linear or branched); or carboxylated polysaccharides or oligosaccharides, e.g., reacted with derivatives of carbonic acids with resultant linking of carboxylic groups. Preferably, the opsonization-inhibiting moiety is a PEG, PPG, or derivatives thereof. Liposomes modified with PEG or PEG-derivatives are sometimes called "PEGylated liposomes". The opsonization inhibiting moiety can be bound to the liposome membrane by any one of numerous well-known techniques. For example, an N-hydroxysuccinimide ester of PEG can be bound to a phosphatidyl-ethanolamine lipid-soluble anchor, and then bound to a membrane. Similarly, a dextran polymer can be derivatized with a stearylamine lipid-soluble anchor via reductive animation using Na (CN)BH3 and a solvent mixture, such as tetrahydrofuran and water in a 30: 12 ratio at 60° C. Liposomes modified with opsonizationinhibition moieties remain in the circulation much longer than unmodified liposomes. For this reason, such liposomes are sometimes called "stealth" liposomes. Stealth liposomes are known to accumulate in tissues fed by porous or "leaky" microvasculature. Thus, tissue characterized by such microvasculature defects will efficiently accumulate these liposomes; see Gabizon, et al. (1988), Proc. Natl. Acad. Sci., USA, 18:6949-53. In addition, the reduced uptake by the RES lowers the toxicity of stealth liposomes by preventing significant accumulation of the liposomes in the liver and spleen. Thus, liposomes that are modified with opsonization-inhibition moieties are particularly suited to deliver the miRNA inhibitors (or nucleic acids comprising sequences encoding them) to target cells.

[0045] One skilled in the art can readily determine a therapeutically effective amount of the miRNA inhibitor to be administered to a given patient, by taking into account factors such as the size and weight of the patient; the extent of disease penetration; the age, health and sex of the patient; the route of administration; and whether the administration is regional or systemic. An effective amount of said compound can be based on the approximate or estimated body weight of a patient to be treated. Preferably, such effective amounts are administered parenterally or enterally, as described herein. For example, an effective amount of the compound administered to a patient can range from about 5-10000 micrograms / kg of body weight and is preferably between about 5-3000 micrograms / kg of body weight, and is preferably between about 700- 1000 micrograms / kg of body weight, and is more preferably greater than about 1000 micrograms / kg of body weight. One skilled in the art can also readily determine an appropriate dosage regimen for the administration of the compound to a given patient. For example, the compound can be administered to the patient once (e.g., as a single injection or deposition).

[0046] In some embodiments, the miRNA inhibitor of the present invention is administered to the patient in combination with one or more bisphosphonate(s). As used herein, the term “bisphosphonate” means compounds characterised by two C — PO3 2- bonds. If the two bonds are located on the same carbon atom, the compounds are called geminal bisphosphonates. It should be noted that the term “bisphosphonate” as used herein are meant to also encompass diphosphonates, biphosphonic acids, and diphosphonic acids, as well as salts and derivatives of these materials.

[0047] In some embodiments, the miRNA inhibitor of the present invention is administered to the patient in combination with one or more sclerostin inhibitor(s). As used herein, the term “sclerostin” has its general meaning in the art and refers to a protein that in humans is encoded by the SOST gene (Balemans, Wendy, et al. "Increased bone density in sclerosteosis is due to the deficiency of a novel secreted protein (SOST)." Human molecular genetics 10.5 (2001): 537-544). Sclerostin is a secreted glycoprotein with a C-terminal cysteine knot-like (CTCK) domain and sequence similarity to the DAN (differential screening-selected gene aberrative in neuroblastoma) family of bone morphogenetic protein (BMP) antagonists. As used herein, the term "sclerostin inhibitor" means any molecule that inhibits the biological activity of sclerostin on bone, as measured by changes to bone mineralization, bone density, bone height, effect on osteoblasts and / or osteoclasts, markers of bone formation, markers of bone resorption, markers of osteoblast activity, and / or markers of osteoclast activity. Such inhibitors may act by binding to sclerostin or its receptor or binding partner. Inhibitors in this category include "sclerostin binding agents," such as, e.g., antibodies or peptide-based molecules. "Sclerostin inhibitors" also refers to small organic chemical compounds, optionally of less than about 1000 Daltons in molecular weight that bind sclerostin and inhibit its activity. Inhibitors may alternatively act by inhibiting expression of sclerostin. Inhibitors in this category include polynucleotides or oligonucleotides that bind to sclerostin DNA or mRNA and inhibit sclerostin expression, including, but not limited to, an antisense oligonucleotide, inhibitory RNA, DNA enzyme (deoxyribozyme), ribozyme, an aptamer or pharmaceutically acceptable salts thereof that inhibit the expression of sclerostin. Examples of sclerostin inhibitors include romosozumab, blosozumab, and setrusumab.

[0048] In some embodiments, the miRNA inhibitor of the present invention is administered to the patient in combination with one or more TGF-beta inhibitor(s). As used herein, the term "TGF- beta" has its general meaning in the art and refers to one or more members of the transforming growth factor-beta family of proteins, e.g., TGF-beta 1 , TGF- beta 2, and TGF- beta 3. As used herein, the term "TGF-beta inhibitor" refers to an agent having the ability to directly or indirectly inhibit a biological function of TGF-beta. Thus, TGF-beta inhibitors include, but are not limited to, inhibitors (e.g., blocking (neutralizing) antibodies) specific for TGF-beta, soluble TGF-beta receptors (which would competitively inhibit TGF-beta), membrane-bound TGF- beta receptors, protease inhibitors that inactivate a protease responsible for activating a precursor TGF-beta into mature TGF-beta, inhibitors (e.g., antibodies or small molecules) specific to TGF-beta receptors (Types I, II or III) that prevent TGF-beta binding to the receptor, siRNA or antisense RNA that block expression of TGF-beta or combinations of the foregoing. In some embodiments, the TGF-beta inhibitor is fresolimumab.

[0049] The miRNA inhibitors of the present invention are preferably formulated as pharmaceutical compositions, prior to administering to a patient, according to techniques known in the art. Pharmaceutical compositions of the present invention are characterized as being at least sterile and pyrogen-free. As used herein, "pharmaceutical formulations" include formulations for human and veterinary use. Methods for preparing pharmaceutical compositions of the present invention are within the skill in the art, for example as described in Remington's Pharmaceutical Science, 17th ed., Mack Publishing Company, Easton, Pa. (1985), the entire disclosure of which is herein incorporated by reference. The present pharmaceutical formulations comprise miRNA inhibitor (e.g., 0.1 to 90% by weight), or a physiologically acceptable salt thereof, mixed with a pharmaceutically-acceptable carrier. The pharmaceutical formulations of the present invention can also comprise miRNA inhibitor which are encapsulated by liposomes and a pharmaceutically-acceptable carrier. Preferred pharmaceutically-acceptable carriers are water, buffered water, normal saline, 0.4% saline, 0.3% glycine, hyaluronic acid and the like. Pharmaceutical compositions of the present invention can also comprise conventional pharmaceutical excipients and / or additives. Suitable pharmaceutical excipients include stabilizers, antioxidants, osmolality adjusting agents, buffers, and pH adjusting agents. Suitable additives include, e.g., physiologically biocompatible buffers (e.g., tromethamine hydrochloride), additions of chelants (such as, for example, DTPA or DTPA-bisamide) or calcium chelate complexes (such as, for example, calcium DTPA, CaNaDTPA-bisamide), or, optionally, additions of calcium or sodium salts (for example, calcium chloride, calcium ascorbate, calcium gluconate or calcium lactate). Pharmaceutical compositions of the present invention can be packaged for use in liquid form or can be lyophilized.

[0050] The invention will be further illustrated by the following figures and examples. However, these examples and figures should not be interpreted in any way as limiting the scope of the present invention.

[0051] FIGURES:

[0052] Figure 1: Flow chart of the miROI study. The initial screening phase identified potential miRNAs that were quantified in larger groups of subjects in the validation phase to investigate the potential associations of circulating miRNAs with the disease phenotype in the clinical phase

[0053] Figure 2: Volcano plot showing the significant variations in miRNA expression between the control and OI groups. The expression level of miRNAs was compared between groups by the ratio of tag per million and transformed into relative data by calculating the log2 fold change. The -loglO change in FDR-corrected p values were plotted against the log2 fold change. The continuous line is the FDR-corrected p-value threshold equal to 0.05 and the discontinuous line to 0.0005. The miRNAs with p<0.0005 have been captioned.

[0054] Figure 3: The relative level of the eight miRNAs that were significantly differentially expressed between OI patients (n=48) and matched control subjects (n=48). Data are presented as mean of log2 Fold Change in OI and control groups and 95% confidence interval. The relative level was measured by RT-qPCR on pre-spotted Taqman Low-density Array cards. Figure 4A: Expression level of COL1A1 by qPCR in MC3T3E1 osteoblasts after 5 days of treatment with Mimic-CTRL, Mimic miR-93-3p, Mimic miR-106b-3p, Antago-CTRL, Antago miR-93-3p, Antago-miR-106b-3p, respectively. Expression level is presented as a ratio of 2A- delta Ct relative to their respective controls. Results are shown as mean+ / -SEM (n=5). * P < 0.05 vs. the control group.

[0055] Figure 4B: Expression level of COL1A2 by qPCR in MC3T3E1 osteoblasts after 5 days of treatment with Mimic-CTRL, Mimic miR-93-3p, Mimic miR-106b-3p, Antago-CTRL, Antago miR-93-3p, Antago-miR-106b-3p, respectively. Expression level is presented as a ratio of 2A- delta Ct relative to their respective controls. Results are shown as mean+ / -SEM (n=5). * P < 0.05 vs. the control group.

[0056] Figure 5A: Expression level of COL1A1 by qPCR in osteoblasts derived from 12-week-old adult C57BL / 6 mouse long bones after 5 days of treatment with Mimic-CTRL, Mimic miR-93- 3p, Mimic miR-106b-3p, Antago-CTRL, Antago miR-93-3p, Antago-miR-106b-3p, respectively. Expression level is presented as a ratio of 2A-delta Ct relative to their respective controls. Results are shown as mean+ / -SEM (n=3). * P < 0.05 vs. the control group.

[0057] Figure 5B: Expression level of COL1A2 by qPCR in osteoblasts derived from 12-week-old adult C57BL / 6 mouse long bones after 5 days of treatment with Mimic-CTRL, Mimic miR-93- 3p, Mimic miR-106b-3p, Antago-CTRL, Antago miR-93-3p, Antago-miR-106b-3p, respectively. Expression level is presented as a ratio of 2A-delta Ct relative to their respective controls. Results are shown as mean+ / -SEM (n=3). * P < 0.05 vs. the control group.

[0058] Figure 6: Modulation of miR-93-3p Affects Type I Collagen Expression in MC3T3 and Primary Osteoblasts: Western Blot Analysis and Quantification. Representative Western blot images showing Type I collagen and beta-actin expression in osteoblasts treated with Antago-CTRL and Antago-miR-93-3p (A) or treated with Mimic-CTRL and Mimic-miR-93- 3p (B) on MC3T3E1 lineage after 5 days. Relative quantification of Type I collagen normalized to beta-actin in MC3T3E1 cells (C) or primary osteoblasts (E) treated with Antago-miR-93-3p, compared to Antago-CTRL after 5 days. Relative quantification of Type I collagen normalized to beta-actin in MC3T3E1 cells (D) or primary osteoblasts (F) treated with Mimic-miR-93-3p, compared to Mimic-CTRL after 5 days. P-value T-test <0,05 = *

[0059] Figure 7: Immunofluorescence analysis of type I collagen expression in MC3T3E1 cells treated with Antago-CTRL and Antago miR-93-3p. (A) Confocal microscopy (Zeiss 880, x20) of MC3T3E1 cells stained for type I collagen following treatment with Antago-CTRL. (B) Confocal microscopy of MC3T3E1 cells treated with Antago miR-93-3p. The same parameters were applied (A-B). (C) Automated quantification of type I collagen expression normalized to cell number across the entire slide (n=3). P-value T-test <0,05 : *

[0060] Figure 8: Immunofluorescence analysis of type I collagen expression in MC3T3E1 cells treated with Antago-CTRL and Antago miR-93-3p. (A) Confocal microscopy (Zeiss 880, x40) of MC3T3E1 cells stained for type I collagen following treatment with Mimic-CTRL. (B) Confocal microscopy of MC3T3E1 cells treated with Mimic miR-93-3p. The same parameters were applied (A-B). (C) Automated quantification of type I collagen expression normalized to cell number across the entire slide (n=3). P-value T-test <0,05 : *

[0061] EXAMPLE 1:

[0062] Material and Methods:

[0063] The study has been conducted in three steps. We have first carried out a screening phase by Next Generation Sequencing (NGS) to determine the differential expression of all miRNAs in the serum of ten OI patients and ten controls subjects. We have then performed a validation phase by RT-qPCR analysis of the miRNAs selected from the screening phase in a larger collection of sera. Finally, we have investigated the potential association of the miRNA differential expression and clinicopathological characteristics in our group of OI patients.

[0064] Recruitment

[0065] OI patients were recruited for the mirOI study from October 2019 until October 2021. The recruitment was performed either during hospitalization or during consultation in the reference centre for bone diseases at the Edouard Herriot University Hospital in Lyon, France (OSCAR network). Patients had to meet the following inclusion criteria: men and women over 18 years- old, carrying a COL1A1 or COL1A2 mutation, with a diagnosis of OI type I or type III according to the Sillence classification previously established by a rheumatologist expert in bone diseases(23). Non-inclusion criteria included long-term glucocorticoid treatment (>3 months), ongoing anti-osteoporotic treatment, the presence of inflammatory disease, uncontrolled hypo / hyperthyroidism or hypo / hyperparathyroidism, active cancer in the last 2 years, malabsorption, the presence of benign bone tumours and other bone diseases, pregnancy or breastfeeding, shortcomings in understanding French language that could prevent informed consent, judicial protection measure. Written informed consent was obtained from each participant. For the screening phase we recruited ten 01 patients and forty-eight patients were included in the validation phase. Controls were healthy individuals matched for age (by 5-years age group), sex and Body Mass Index (BMI, by 2 kg / m2group), recruited from the OFELY, MODAM and STRAMBO population cohorts at INSERM UMR 1033 (Lyon, France)f24 27). OFELY (Os des Femmes de Lyon) is a prospective cohort of 1089 healthy women aged 31 to 89 years, recruited in 1992 and 1993 to study the determinants of bone fragility. MODAM (Mother Daughter Microarchitecture) is a case-control from May 2010 until February 2012. STRAMBO (the bone structure of ageing men) is a cohort of 1169 healthy men between 20 and 85 years old, recruited between 2006 and 2016, in Lyon. The participant distribution and the study design are displayed in Figure 1. The study was approved by a French ethics committee (CPP Ile-de-France VI, registration N°2019-A00521-56), and conducted in accordance with the French national ethical directives and with the ethical standards of the revised Helsinki Declaration. It was registered on ClinicalTrials.gov (NCT T04009733).

[0066] Blood Sample Collection

[0067] Blood samples were preferentially collected in the morning after an overnight fast, centrifuged at 2000g, at 4°C, within one hour of collection for serum preparation, aliquoted and stored at - 80°C until analysis. Macroscopic visual analysis of the blood samples was performed to assess the quality of the serum, including the presence of haemolysis and fibrin clotting.

[0068] Collection of Clinical and Biological Data

[0069] Clinical information was collected both by a clinical questionnaire filled in by the physician with the patient, and by a SF-36 quality-of-life questionnaire completed by the patient herself / himself(28). Patients ’clinical data was obtained from their standardized electronic medical records (from 2009 to today, DPI Easily®). The Sillence Classification and the assessment of the disease severity were made by a rheumatologist of the reference centre for rare bone diseases.

[0070] The Analysis of OI MiRNome by Next Generation Sequencing

[0071] The screening phase was performed to compare the serum miRNA profile (miRNome) between OI patients and control subjects. For this purpose, we carried out the miRNome analysis in serum of 10 01 patients versus 10 matched controls by NGS after total RNA extraction, library preparation, and quantification, followed by the miRNA sequencing (Illumina platform; QIAGEN Genomic Services, Germantown, MD, USA). Total RNA (5pL) extracted from serum by the miRNeasy serum / plasma kit (Qiagen®) was used for the preparation of miRNA-NGS libraries, by the QIAseq miRNA library kit (Qiagen®). First, a ligation was performed on the mature miRNA in order to add an adaptor poly A sequence to the 3 '-OH end followed by ligation of an adaptor sequence to 5'-PO4 end by an ATP ligase. Mature single-stranded miRNAs containing a specific nucleotide sequence, the Unique Molecular Index (UMI), were obtained. A reverse transcription (RT) reaction generated the cDNA containing the UMI, which allowed the library identification after sequencing. After amplification by a 22 cycle PCR, the cDNA was incubated with QMN beads (QIAseq miRNA NGS beads), washed and eluted from the beads by RNase / DNase free water. Each library was then amplified using the Qiaseq miRNA index kit. Prior to this, a fraction enriched in miRNAs was isolated by agarose gel electrophoresis and subjected to quality control on the Bioanalyzer 2100 (Agilent®, Santa Clara, CA, USA). After a final quantification by PCR, the libraries obtained from the different samples were pooled at equimolar concentration to generate the clusters on the flow cell surface before sequencing on a NextSeq500 sequencer (Illumina). The data collected in the form of "reads" were subjected to read quality control and corrected for library amplification bias prior to alignment with the mature miRNA sequences referenced in miRBase-20 and with the GRCh38 human genome(29 32). After demultiplexing the raw reads, the data were expressed as count. The data were normalised by dividing the count of a specific miRNA by the total count number in a sample and multiplied by 106and then by the Trimmed Mean of M-values (TMM) methods. The expression level of the miRNAs was expressed in TPMs (Tags per Million Reads) and then compared by the ratio of TPMs between the groups. This ratio was then transformed into relative data by calculating the Log2(Fold change) (LogFC).

[0072] The Analysis of MiRNAs by RT-qPCR

[0073] Total RNA was extracted from 200 pL of serum with the Nucleospin miRNA plasma kit (Macherey-Nagel, Duren, Germany) according to the manufacturer's recommendations. Samples were thawed on ice and centrifuged at 3000g for 5 min. Lysis buffer containing 1 pL of glycogen as RNA carrier and a synthetic spike-in control RNA (cel-miR-39-3p) as exogenous control were added to the serum (4pL of 0. Inmol / L dilution). After cell lysis, protein precipitation and washes, RNA was eluted from a silica microcolumn with 40 pL of water without RNAse / DNAse and stored at -80°C. The miRNAs were quantified using the TaqMan Advanced miRNA technology (Applied Biosystems, Thermo-Fisher Scientific, Waltham, MA, USA). Quantification of miRNAs expressed at low copy number was improved by 14 cycles of cDNA amplification in a 2X TaqMan PreAmp master mix containing Megaplex PreAmp primers. The miRNAs were subjected to RT to prepare cDNA from 2 pL of total RNA using a TaqMan Advanced miRNA synthesis kit. The qPCR amplification was performed on 1 :20 dilution of cDNA obtained by miRNA- Amplification reaction on 5 pl of the RT samples, using the 2X Fast Advanced Master Mix and the 20X TaqMan Advanced miRNA Assays. The miRNAs were then amplified for quantification using TaqMan Low Density MicroRNA Arrays (TLDA) cards and TaqMan Fast Advanced Mastermix (Applied Biosystems, ThermoFisher Scientific). The TLDAs were designed for real-time PCR quantification of 23 miRNAs (19 candidate miRNAs, three endogenous controls (let-7a-5p, miR-222-3p and miR-361-5p) and the exogenous control cel-miR-39-3p) on a QuantStudio® 7 flex (Applied Biosystems). The threshold cycle (CT) value was recorded as the cycle number at which the fluorescence generated within a reaction crosses the fluorescence threshold, a fluorescent signal significantly greater than the ROX™ fluorescence background recorded in each sample. We used Expression Suite software (Applied Biosystems) to express the miRNA level as relative quantification (RQ). The CT values of each miRNA were normalised by the average of the expression level of the three endogenous miRNAs (let7a-5p, miR-222-3p and miR-361-5p) that are ubiquitously expressed and are not related to bone and joint tissue metabolism. RQ was calculated as 2- AACT, with ACT = (CT of miRNA - average CT of the three endogenous controls) and AACT = (ACT of miRNA - average ACT of miRNA over all samples) and converted to fold change (FC) = Iog2(2-AAACT). The exogenous spike-in cel-miR-39-3p was used as quality control for qPCR(33). In addition, we used 96-well plates with primers specific to the miRNAs tested (Taqman® advanced miRNA assay) after each extraction, RT and pre-amplification, in order to control the quality of these steps and guarantee the quality of the analysis. For this purpose, before each TLDA analysis, we performed a 96 well plate analysis with 7 miRNAs, including 2 endogenous control miRNAs, the exogenous control and 4 target miRNAs with different expression levels.

[0074] Statistical Analysis

[0075] Controls were matched to patients for age, sex, and BMI. The NGS step and differential expression analysis of circulating miRNAs were performed by Qiagen using the EdgeR software package. Differential expression was assessed for each gene using an exact test analogous to Fisher’s exact test but adapted for overdispersed data(34). Relative quantification for RT-qPCR was calculated with Expression-Suite Software. The characteristics of patients and controls were expressed as mean ±SD for the continuous variables and number (%) for the qualitative variables. The search for a significant difference in characteristics between the two groups was done by Wilcoxon-Mann-Whitney test. P-Values were corrected for the false discovery rate (FDR) by the Benjamini -Hochberg method. In the second phase, N>30, Anderson-Darling and Shapiro tests and compatible distribution curves indicated that the approximation to the normal distribution was correct. Therefore, Student's t-test was used to analyse the significance of the difference in serum miRNA levels between patients and controls. P-Values were corrected for the false discovery rate (FDR) by the Benjamini -Hochberg method and were considered significant for values <0.05. Subgroup analyses according to molecular type, resulting in smaller numbers, were conducted with a non-parametric Mann-Whitney test. Association of the miRNA levels with the severity of the disease was evaluated with a Mann- Whitney rank sum test for qualitative data. We tested for a correlation between miRNA expression levels and clinical characteristics using Pearson's r for continuous data and Spearman's r for ordinal data. All the analyses, graphics and figures were performed using GraphPad Prism version 8.0.0 for Windows, GraphPad Software, San Diego, California USA, http: / / www.graphpad.com.

[0076] Results:

[0077] Screening Phase: Identification of Differentially Expressed Circulating miRNAs in OI by

[0078] NGS Analysis.

[0079] Characteristics

[0080] The characteristics of the 10 OI patients (5 men, 5 women) and 10 controls (5 men, 5 women) are presented in Table 1. There was no significant difference in BMI but the patients were significantly shorter and lighter than the controls.

[0081] Comparison of the Expression Levels of Circulating MiRNAs in OI Patients and Control subjects by NGS

[0082] Among a total of 1297 miRNAs quantified in 10 OI and 10 control patients, Next Generation Sequencing (NGS) identified 79 miRNAs that were significantly differentially expressed between the OI and control groups, with a Benjamini Hochberg false discovery rate (FDR) adjusted probability of less than 0.05 (Table 2). Of these miRNAs, 19 were downregulated and 60 were overexpressed in the OI group compared to the control group. Twenty-seven among these 79 miRNAs had an FDR-corrected p-value of less than 5xl0'4(Figure 2). We have selected 19 miRNAs for the validation phase by retaining the miRNAs with the highest level of statistical significance and with the highest expression level (RT-qPCR being technically less sensitive than NGS) (Table 3). The candidate miRNAs for validation are presented in Table 4.

[0083] Validation Phase: Differential Expression of Circulating: MiRNAs by RT-qPCR

[0084] Population Characteristics

[0085] For the validation phase of candidate miRNAs, 48 additional patients with 01 and 48 controls matched for age, sex and BMI were involved. Among them, 45 had Type 1 01 and 3 had Type 3 01. Mean age was 43 years old. We noted a lower weight and height for 01 patients compared to controls, which is consistent with the classical morphology of 01 patients. A median of 17 previous fractures was observed in the 01 patients, with a predominance of wrist, elbow, tibia and vertebral fractures (approximately 30% prevalence for each item) and 61% had previously received bisphosphonates. Interestingly, 55% were above secondary school level in education compared to 34% for the whole French population in 2014, according to French government figures(35). All patient characteristics are presented in Table 5. For a better understanding of the potential epigenetic regulation according to the 01 molecular subtype, we have sorted the 01 patients with molecular type I and molecular type III - IV. Patients with a suspected structural collagen deficiency caused by a mutation resulting in a premature stop codon were considered as type I 01. The patients presenting a supposed qualitative collagen defect in connection with a mutation involving an amino acid substitution were considered as 01 type III and IV (12 / 15 patients involved on substitution by a glycine) (Table 6). For mutations involving splice sites, we conducted predictions using the translation tool from http: / / www.expasy.org, as well as splice site prediction algorithms including SpliceSiteFinder, MaxEntScan, NNSPLICE, and GeneSplicer. The results were reviewed by a geneticist (CC) to determine the occurrence of a stop codon, frame shift, exon skipping, or intron translation. Based on these outcomes, splice site mutations were categorized as either quantitative or structural anomalies (Table 7)f36 40 / it has to be noted that one patient was excluded from this analysis because of the lack of mutation type in his record.

[0086] Comparison of the Expression Level of Circulating MiRNAs in the Serum of Patients and Control Subjects in the Validation Phase We compared the level of the 19 previously selected circulating miRNAs in 96 individuals (48 01 and 48 controls) by running RT-qPCR on pre-spotted TaqMan Low Density Array (TLDA) cards. Among these 19 miRNAs we found 10 miRNAs that were significantly differentially expressed between the 2 groups. After correction by the Benjamini -Hochberg method, 8 of them remained significantly different (miR-106b-3p, miR-191-5p, miR-363-3p, miR-451a, miR-93-3p, miR-93-5p, let-7g-5p, miR-15b-5p) (Figure 3). Only miR-15b-5p was underexpressed in OI group compared to healthy controls; all other miRNAs were overexpressed in OI (Table 8). Concerning the comparison of the expression level according to the molecular type of OI, among the 19 selected miRNAs, 6 of them that were previously dysregulated in the whole OI population (miR-106b-3p, miR-191-5p, miR-363-3p, miR-451a, miR-19b-3p, miR-93-5p) remained significantly increased in OI patients with quantitative defect of collagen. In the group with structural defect of collagen, 2 miRNAs remained significantly upregulated (miR-191-5p, miR-451a) with miR-93-5p and miR-93-3p showing a strong trend without reaching statistical significance (p=0.06). The expression level oflet-7g- 5p that was increased in the whole population (p<0.043) did not remained significantly different after sorting the population, neither in the quantitative group, neither in the structural group.

[0087] (Table 9)

[0088] Clinical Phase: Association Between the MiRNA Deregulation and the Phenotype and Severity of Osteogenesis Imperfecta

[0089] Some phenotypic characteristics are presented in Table 5. We looked for an association between phenotypic characteristics and the circulating level of validated miRNAs in OI patients. Specifically, we investigated whether the differential expression of miRNAs was associated with the number of prevalent severe fractures, hearing impairment, hyperlaxity, practitioner classification of OI severity, Sillence group and Dentinogenesis Imperfecta. We found that only the latter was significantly related to the circulating level of -miR-363-3p and - miR-451a (Table 10). We did not find any significant correlation between the expression level of validated miRNAs and the number of severe fractures. Adjustment for age in a multiple regression model did not alter the results for fractures or hearing impairment. Refining the molecular subgroups to search for associations between the OI phenotype and the miRNA deregulation did not show additional significant correlations. However, there is a weak correlation between the severity of scoliosis assessed by the radiographic measurement of the Cobb angle and miR-96-5p (r=-0.442, p=0.045) and miR-93-5p (r=-0.457, p=0.037). The Association Between the MiRNA Deregulation and the Pathophysiological Mechanisms of Osteogenesis Imperfecta

[0090] To address the question of biological regulations of pathogenic variants in 01, we searched for the link between the miRNA differential expression in 01 and the molecular mechanism changes in this disease. To this end, we used the miRwalk3® algorithm to predict the potential interaction between a given miRNA and a corresponding gene. It is classically described that the miRNA will then be able to destabilize the mRNA and partially inhibit the initiation of translationMl-42t Therefore, we looked for an interaction between the validated miRNAs and COL1A1 or COL1A2. Here we found an estimated 100% interaction between hsa-miR-106b- 3p and COL1 Al and COL1 A2 and between hsa-miR-93-3p and COL1 A2.

[0091] Discussion:

[0092] In our case-control study of 48 patients with OI, we have observed differential expression of 8 circulating miRNAs, compared with healthy controls. After sorting the OI population according to their collagen mutation, 2 miRNAs remained significantly up-regulated in the structural group (miR-191, miR-451a) whereas 6 miRNAs were significantly differently expressed in the quantitative group. These data suggest that the miRNA-induced modulation of biological functions differed according to OI pathological variants. Two of these miRNAs (miR-106b-3p and miR-93-3p) are potentially directly involved in the pathophysiology of the disease via their predictive interaction with COL1 Al and COL1 A2 inducing a further enhanced lower collagen expression. This regulation of collagen levels might be mediated by miR-106b-3p in OI patients who have a quantitative collagen defect, as the increase in miR-106b-3p in the structural group was not significant, while the close-to-significant increase of miR-93-3p in the structural group could potentially play the same role in structural mutation. By further examining the role of these dysregulated miRNAs in OI we observed that several of them have been consistently reported as regulators of osteogenesis-related genes, pointing out changes in pathophysiological pathways that might be induced by OI in bone cells, bone mineralization and remodelling (13,15,20,21) Therefore, we searched for associations between circulating level of significantly dysregulated miRNAs in OI patients and their phenotypic characteristics. The overexpression of miR-363-3p and miR-451a was significantly correlated to Dentinogenesis Imperfecta status although we have not been able to demonstrate further correlation between expression levels of these miRNAs and other severity criteria (i.e., number of fractures, severity in the classification). The pathophysiology of OI is currently unclear. Specifically, the phenotypic variability of OI remains elusive, especially considering the potential expression of extra- skeletal manifestations(43), suggesting the existence of other pathways to regulate the gene expression downstream of the mutation, such as miRNAs as epigenetic regulators. In our study, we further support this hypothesis by reporting their potential direct interaction with the mutated genes but also with other pathways in bone pathophysiology. Due to some imperfect complementarity and the small size of seeds, each miRNA influences the regulation of numerous mRNAs with different efficiency. Some miRNAs have several binding sites in a 3'- UTR sequence strongly downregulating the targeted gene, and each miRNA is able to interact with hundreds of different 3'-UTR regions(12). This also implies that the target sites of miRNAs are difficult to saturate, thus inducing weak to moderate downstream regulation(44). Overexpression or inhibition of these miRNAs therefore likely involves multiple unexplored or unknown pathophysiological pathways in 01, making this finding a novel approach to the disease. We conducted a literature review to search for experimentally validated interaction of the 8 miRNAs with targeted genes involved in bone homeostasis that have been previously described. We have highlighted the miR-25 / 93 / 106 cluster, located on chromosome 7q.22.1. in MCM7 intron 13. The three miRNAs were significantly up-regulated in serum of 01 patients in NGS analysis with only miR-93-5p, miR-93-3p and miR-106b-3p being significantly increased in the larger 01 population of the validation phase. MiR-93-5p also interacts with Osx and is a well-known regulator of osteoblastogenesis(45,46). As it has been largely previously reported, Osx plays an essential role in bone homeostasis by regulating osteoblastic differentiation and maturation^7 49). This interaction would induce the inhibition of Osx transcription and the increase of miR-93 in 01 patients could participate in a decrease of osteoblast maturation via a maladaptive response of the miR-93 / Osx regulatory loop. The existence of a strong regulation of Osx is consistent with literature data suggesting that a mutation of the latter is responsible for a form of 01 with a recessive inheritance(50). Moreover, both miR-93-5p and miR-106b-3p appear to inhibit Bone morphogenetic protein 2 (BMP2) expression and inhibit osteoblastogenesis through the repression of osteogenesis(51). The work of Zhang et al demonstrated in vitro the interaction between mir-93 and BMP2. Stimulation of miR-93 is responsible for a reduction in BMP -2 expression. The role of BMP-2 is essential, through its interaction with Runx-2 and Osterix, and as a member of TGF-P superfamily but is also directly involved in bone homeostasis(52). The overexpression of miR-93 in the 01 cohort could lead to a repression of BMP -2 expression and be responsible for an inhibition of osteoblastic differentiation. MiR-106b is already known to be an inhibitor of Smad5 and BMP-2 and thus inhibit osteogenic differentiation^3). Moreover the inhibition of miR-106b improves osteoblastogenesis and bone density in a mice model of cortico-induced osteoporosis(54). Our data also suggest that in the quantitative group, the CollAl / A2 downregulation was further increased as a consequence of the miR-25 / 93 / 106 cluster dysregulation with the main impact of miR-106b-3p upregulation, through the direct targeting of CollAl / 2. This molecular mechanism of Coll Al / 2 regulation would be restricted to the quantitative group since the miR- 106b-3p and miR-93-3p upregulation did not reach significance in the structural group. The increase approaching significance of miR-93-3p could nonetheless suggest that it might have a regulatory role in the structural group, but we lack the power to support it. There is no literature suggesting a regulatory mechanism for this cluster in 01, but we can assume the existence of a direct or indirect negative feedback from type 1 collagen on the expression of miR-93 and miR- 106b, which would be lifted by silencing of the affected allele, not present in the structural form. Further in vitro studies are required to investigate this point. Overall, the regulation of the miR-106 and miR-93 gene expression in miR-106b-25 cluster in OI may have impacted their expression level as -5p / -3p mature form which in turn differently target osteogenesis factors. Their release in bloodstream reflecting their alteration in tissues suggest that miR-106 and miR-93 are non-invasive biomarker of the disease. We have previously reported that miR- 25-3p might be a negative regulator of osteoblastogenesis by downregulating the expression of genes involved in osteoblast differentiation, but it could also reduce osteoclastogenesis by targeting RANKL(21). Therefore, the role of miR-25-3p in the regulation of bone cell -related genes remains to be explored and could be patient-dependent, explaining the lack of significance observed in the validation phase. The alteration of this cluster’s expression involves multiple regulatory pathways in bone and other tissues strengthening the hypothesis that these miRNAs are regulators of the disease and differ in their activity according to the group of OI patients. We also reported that miR-19b-3p was upregulated in patient with quantitative defect of collagen but not in patient with structural defect. Interestingly the expression of miR-19b-3p that belongs to the miR-17-92 cluster is modulated by PI3K / Akt / mT0R signalling pathway155’. Its upregulation promotes osteogenesis by regulating negatively the expression of gene of phosphate and tension homology (PTEN) that increases osteocalcin, osteopontin, and RunX2 and Coll Al protein levels(56-57). MiR-19b-3p is upregulated in serum from osteoporotic patients with vertebral fractures and low BMD(58-59). Recent studies have demonstrated that the inhibition of miR-19a / b in osteoporotic rats significantly enhances the effect of parathyroid hormone on osteoformation by relieving the inhibition on TG-interacting factor 1 and reducing RANKL-mediated resorption activity(60). The lack of significance in the structural mutation group suggests that this mechanism is not effective, possibly triggered solely by the quantitative decrease of COL1A1. The strong overexpression ofmiR-191-5p has been described in response to mechanical strain exerted on osteoblastic cells through the regulation of mRNA with which we again find the interaction with protein level of bone morphogenetic proteins (BMP -2 and BPM-4)(61). MiR-191 is able to decrease the migration of bone marrow mesenchymal stem cells. Under osteogenic culture conditions of these cells, inhibition of miR-191 induces bone formation and influences chondrogenesis by directly targeting CCAAT enhancer binding protein(62). Furthermore, miR-191 was strongly over-expressed in patients with the structural mutations while we did not find such an over expression of the previous cluster excepted for miR-93-5p, suggesting an alternative inhibition of osteogenesis in these patients. In the whole population of 01, the overexpression of miR-451a and miR-363-3p was associated to Dentinogenesis Imperfecta. This suggests that among the patients of the quantitative group, miR-363-3p and miR-451a overexpression may regulate signalling pathways for the one suffering of Dentinogenesis Imperfecta and that only miR-451a may have a function in the Dentinogenesis Imperfecta of structural group. The miR- 363-3p promotes activation of the PTEN / PI3K / AKT pathway, thereby enhancing osteoclastogenesis and inhibiting osteoblatogenesis(63). The miR-451 inhibits BMP-6 and thereby inhibits osteoblastogenesis(64). Its inhibition in a mouse model of osteoporosis induced by ovariectomy allows an improvement in the qualitative and quantitative bone parameters. There is no literature reporting a link between these two miRNAs and dentinogenesis per se, but we can assume that their respective impact on the PTEN and BMP6 pathways may be responsible for dysregulation of dentinogenesisf65 67< The miRNAs let-7g-5p and miR-15b-5p are less known in bone. Some papers suggest that let-7g-5p may participate in osteoblastic differentiation, but the mechanisms are not yet well understood, with a more oncogenic role in extraosseous bonef68 7I ). MiR-15b-5p that was overexpressed in sera of 01 patients in miRNome analysis, was weakly but significantly downregulated in 01 patients in the validation phase (p<0.042) and did not differ in quantitative and structural groups. MiR-15b-5p is known for its dual role in oncogenesis as an oncogene or a tumour suppressor, depending on its dysregulation in various tissue and of its numerous gene targets(72). It has not been robustly reported as a key regulator in bone homeostasis despite few papers suggesting a role in promoting or inhibiting osteoblastogenesis (72>73) Whereas miR-15b promotes the differentiation of mesenchymal stem cells and osteoprogenitors into osteoblasts by indirect targeting of RUNX2(73), it inhibits osteoblast differentiation and autophagy to aggravate osteoporosis in mice by indirect USP1 targeting(74). We report an inconsistent response of miR-15b-5p expression in 01 sera that may result of differences in mutational status. Another interesting feature highlighted in this study is the overexpression of miR-191-5p, which has often been reported as an endogenous control and used for data normalisation(75,76). However, in the miROI study, the NGS screening phase has shown that miR-191-5p was significantly overexpressed in 01 serum. As NGS is the only technique that allows the detection of all the miRNAs including previously non-identified miRNAs, the level of each miRNA is expressed comparatively to the global amount of miRNAs in the sample as the normalization procedure. This warranted us for reassessment of miR-191-5p stability at least in OI. In the validation phase miR-191-5p was found significantly overexpressed in serum of OI when raw data were normalised by three other endogenous controls. This was confirmed when miR-191-5p raw data (CT) where normalised with the exogenous spike-in cel-miR-39-3p (data not shown). The NGS in the discovery phase 1 showed the overexpression of the three members of the miR- 182 / 96 / 183 cluster located in the human chromosome 7q32.2 suggesting their common regulation in the disease. A polycistronic cluster comprises two or more miRNAs transcribed from adjacent loci. Fifty percent of mammalian miRNAs have their loci clustered near other miRNA loci(12). They are classically regulated in a synchronous manner. After RT-qPCR analysis, only the miR-182-5p was strongly increased, but without reaching statistical significance. This -miR-182 / 96 / 183 cluster is involved in the regulation of bone homeostasis and bone-related disease(21)by stimulating osteoclastogenesis and inhibiting osteoblastogenesis through the interaction with several targets, notably FoxOl, Heme Oxygenase- 1 or Osterix (Osx)f77 8I / However, this miRNA cluster was not differentially expressed in the validation phase analysis. The mirOI study is the first to examine the link between miRNAs and the severity of Osteogenesis Imperfecta with a sizeable number of patients for this rare bone disease. Recruitment was carried out in a bone disease reference centre with strict inclusion criteria guaranteeing the quality of the data. In addition, the study was built with a serious methodology with analytical screening phase and validation phase including two different methods of analysis of circulating miRNA levels. This is the first study reporting a miRNA signature associated with pathophysiological mechanisms in OI with a molecular and a clinical approach. It allows for new ways to explore the physiopathology but also the therapy of the disease. The management of Osteogenesis Imperfecta is currently based on surgical management of fractures and deformities, but we lack effective medications. Bisphosphonates remain the primary drug therapy in children(82>83). More than 50% of our patients had already received bisphosphonates. However, despite a well-demonstrated action on bone mineral density and relief of vertebral compression in growing children, it is difficult to demonstrate a real benefit in the management of osteogenesis imperfecta in adults (84"87)_ The development of other approaches, such as an anti-sclerostin treatment currently evaluated in phase III and another one targeting TGF-beta, has triggered new hope for treatment(88), but there has not been approved treatment to date. MiRNAs seem to be an interesting avenue that is increasingly being explored in different areas of research for targeted treatment. This is particularly true in oncology where miRNAs are emerging as tumour suppressors with several promising trials underway(89’90). It is therefore relevant to consider this approach in bone diseases so our results could form the basis for in vitro and in vivo investigations in this direction especially since some animal model studies in osteoporosis seem to be promising (miR-106b, miR-19a / b)(54’60).

[0093] In conclusion, our study profiled the circulating miRNAs in 01 patients and identified eight dysregulated disease-associated miRNAs that could be used as potential biomarkers of the disease. These miRNAs appear to be involved in pathophysiological mechanisms that directly affect the C0L1A1 and C0L1A2 mutated genes or other pathways involved in bone homeostasis, especially regulating osteoblastogenesis. This observation is reinforced by our studies performed on cells showing that the expression of C0LA1 A and C0L1 A2 is decreased in presence of miR93 or miR-106b inhibitors (Figures 4A, 4B and 5A, 5B). The identified miRNAs thus represent a promising therapeutic target.

[0094] EXAMPLE 2:

[0095] Material and Methods:

[0096] For Western Blot analysis, osteoblasts were treated with either Antago-CTRL, Antago-miR- 93-3p, Mimic-CTRL, or Mimic-miR-93-3p for 5 days. Proteins were extracted and separated by SDS-PAGE, followed by transfer to a PVDF membrane (Bio-Rad). The primary antibody used was rabbit polyclonal anti-type I collagen (Proteintech). Beta-actin was used as a loading control. Membranes were incubated with HRP-conjugated goat anti-rabbit secondary antibodies, followed by detection using ECL substrate. Quantifications were normalized to beta-actin using Imaged (FIJI). For immunofluorescence (IF), MC3T3E1 cells were treated under the same conditions. Cells were fixed and stained with the anti-collagen type I rabbit polyclonal antibody (Proteintech) and visualized using CoraLite® Plus 488-Goat anti-Rabbit secondary antibody. Confocal microscopy (Zeiss 880) was used to capture images. Quantification of collagen type 1 staining was automated on a whole slide and normalized to cell number using ImageJ.

[0097] Results :

[0098] Western blot results demonstrated that treatment with Antago-miR-93-3p significantly increased type I collagen expression compared to Antago-CTRL in both MC3T3 and primary osteoblasts (p=0.040, n=3)(Figures 6A, 6B, 6C, 6D, 6E, 6F). Conversely, treatment with Mimic-miR-93-3p reduced collagen levels compared to Mimic-CTRL, confirming miR-93-3p's role in collagen regulation without reaching significance (p=0.055, n=3). Immunofluorescence images supported these findings, with increased collagen staining in cells treated with Antago- miR-93-3p and decreased staining following Mimic-miR-93-3p treatment. Quantification of fluorescence intensity further corroborated the Western blot data, with significant differences in collagen expression with antago-93-3p versus antago-CTRL and with mimic-93-3p and mimic-CTRL (Figures 7 A, 7B, 7C and 8A, 8B, 8C).

[0099] TABLES: Table 1: Baseline characteristics of patients and controls for the screening phase. BMI =Body

[0100] Mass Index, *Significant difference for p value < 0.05 calculated with Mann-Whitney test.

[0101] Table 2: The comparison of the serum miRNA profiling in patients with controls by Next- Generation-Sequencing identifies 79 miRNAs that were significantly higher in patients, with the Benjamini -Hochberg false discovery rate (FDR) corrected p-values (FDR p-value) <0.05.

[0102] Table 3: Identification of the 19 miRNAs selected by the screening phase for RT-qPCR analysis Table 4: The differential expression of the 19 miRNAs selected after the miRNome NGS analysis. The group mean difference is expressed as Tag Per Million; the Log2 fold change is the relative miRNAs level in 01 patients versus control subjects.

[0103]

[0104] Table 6: List of exon mutations in 01 patients of validation phase with nucleotide modification, protein consequence, and structural or quantitative consequence on type 1 collagen. Table 7: Prediction of the effect of splice site mutations in COL1A1 and categorization into quantitative or qualitative groups based on expasy.org, SpliceSiteFinder, MaxEntScan, NNSPLICE, and GeneSplicer

[0105] Table 8: Comparison of the miRNAs levels (Means) in serum of 01 patients and controls. The circulating level of 19 selected miRNAs was analysed by RT-qPCR in 48 sera of 01 patients and 48 sera of controls. Results are Log2Fold Change of miRNAs expression level in 01 sera versus controls sera, after normalization and relative level expression, p-value is corrected by False Discovery Rate according Benjamini- Hochberg method (q-value). *Values of p or FDR p <0.05. Table 9: Comparison of the miRNAs levels (Median) in serum of 01 patients and controls. The circulating level of 19 selected miRNAs was analysed by RT-qPCR in 47 sera of 01 patients and 47 sera of controls. Results are median difference of Log2Fold Change between controls and 01 patients after normalization and relative level expression. Median of the difference in relative levels = Median (01) - Median (Control).

[0106] Table 10: Association of 01 phenotypic parameters and circulating miRNA levels. The circulating miRNAs level is expressed as Log2FoldChange. The significance of expression level differences was estimated by Mann-Whitney test. All types of hearing loss (loss of at least

[0107] 20 dB on standard audiometry) were counted whether transmissive, sensorineural or mixed. Only fractures of femur, pelvis, proximal tibia, humerus and spine fractures were considered and included in the severe fracture status. REFERENCES:

[0108] Throughout this application, various references describe the state of the art to which this invention pertains. The disclosures of these references are hereby incorporated by reference into the present disclosure.

[0109] 1. Forlino A, Marini JC. Osteogenesis imperfecta. The Lancet. 2016 Apr;387(10028): 1657-71.

[0110] 2. Marini JC, Forlino A, Bachinger HP, Bishop NJ, Byers PH, Paepe AD, FassierF, Fratzl- Zelman N, Kozloff KM, Krakow D, Montpetit K, Semler O. Osteogenesis imperfecta. Nature Reviews Disease Primers. 2017 Aug 18;3: 17052.

[0111] 3. Folkestad L. Mortality and morbidity in patients with osteogenesis imperfecta in Denmark. Dan Med J. 2018 Apr;65(4).

[0112] 4. Thakker RV, editor. Genetics of bone biology and skeletal disease. London ; Waltham, MA: Academic Press; 2013.

[0113] 5. Di Lullo GA, Sweeney SM, Korkko J, Ala-Kokko L, San Antonio JD. Mapping the ligand-binding sites and disease-associated mutations on the most abundant protein in the human, type I collagen. J. Biol. Chem. 2002 Feb 8;277(6):4223-31.

[0114] 6. Sweeney SM, Orgel JP, Fertala A, McAuliffe JD, Turner KR, Di Lullo GA, Chen S, Antipova O, Perumal S, Ala-Kokko L, Forlino A, Cabral WA, Barnes AM, Marini JC, San Antonio JD. Candidate cell and matrix interaction domains on the collagen fibril, the predominant protein of vertebrates. J. Biol. Chem. 2008 Jul 25;283(30):21187-97.

[0115] 7. Pace JM, Wiese M, Drenguis AS, Kuznetsova N, Leikin S, Schwarze U, Chen D, Mooney SH, Unger S, Byers PH. Defective C-propeptides of the proalpha2(I) chain of type I procollagen impede molecular assembly and result in osteogenesis imperfecta. J. Biol. Chem. 2008 Jun 6;283(23): 16061-7.

[0116] 8. Trejo P, Rauch F. Osteogenesis imperfecta in children and adolescents — new developments in diagnosis and treatment. Osteoporosis International. 2016 Dec;27(12):3427- 37.

[0117] 9. Steiner RD, Basel D. COL1 Al / 2 Osteogenesis Imperfecta. In: Adam MP, Ardinger HH, Pagon RA, Wallace SE, Bean LJ, Stephens K, Amemiya A, editors. GeneReviews® [Internet], Seattle (WA): University of Washington, Seattle; 1993 [cited 2020 May 8], Available from: http: / / www.ncbi.nlm.nih.gov / books / NBK1295 /

[0118] 10. Chougui K, Addab S, Palomo T, Morin SN, Veilleux L-N, Bernstein M, Thorstad K, Hamdy R, Tsimicalis A. Clinical manifestations of osteogenesis imperfecta in adulthood: An integrative review of quantitative studies and case reports. American Journal of Medical Genetics Part A [Internet], 2020 Jan [cited 2020 Mar 3];n / a(n / a). Available from: http : / / onlinelibrary .wiley . com / doi / ab s / 10.1002 / aj mg. a.61497

[0119] 11. Bartel DP. Metazoan Mi croRN As. Cell. 2018 Mar 22;173(l):20-51.

[0120] 12. Friedman RC, Farh KK-H, Burge CB, Bartel DP. Most mammalian mRNAs are conserved targets of microRNAs. Genome Res. 2009 Jan;19(l):92-105.

[0121] 13. Moore BT, Xiao P. MiRNAs in bone diseases. Microrna. 2013;2(l):20-31.

[0122] 14. Wu M, Chen G, Li Y-P. TGF-P and BMP signaling in osteoblast, skeletal development, and bone formation, homeostasis and disease. Bone Res. Nature Publishing Group; 2016 Apr 26;4(1):1-21.

[0123] 15. Feng Q, Zheng S, Zheng J. The emerging role of microRNAs in bone remodeling and its therapeutic implications for osteoporosis. Biosci. Rep. 2018 29;38(3).

[0124] 16. Endisha H, Rockel J, Jurisica I, Kapoor M. The complex landscape of microRNAs in articular cartilage: biology, pathology, and therapeutic targets. JCI Insight. 2018 06;3(17).

[0125] 17. Feurer E, Kan C, Croset M, Sornay -Rendu E, Chapurlat R. Lack of Association Between Select Circulating miRNAs and Bone Mass, Turnover, and Fractures: Data From the OFELY Cohort. J. Bone Miner. Res. 2019;34(6): 1074-85.

[0126] 18. Suttamanatwong S. MicroRNAs in bone development and their diagnostic and therapeutic potentials in osteoporosis. Connect Tissue Res. 2017 Jan;58(l):90-102.

[0127] 19. Croset M, Pantano F, Kan CWS, Bonnelye E, Descotes F, Alix-Panabieres C, Lecellier C-H, Bachelier R, Allioli N, Hong S-S, Bartkowiak K, Pantel K, Clezardin P. miRNA-30 Family Members Inhibit Breast Cancer Invasion, Osteomimicry, and Bone Destruction by Directly Targeting Multiple Bone Metastasis-Associated Genes. Cancer Res. American Association for Cancer Research; 2018 Sep 15;78(18):5259-73.

[0128] 20. Pickering M-E, Millet M, Rousseau J-C, Croset M, Szulc P, Borel O, Sornay Rendu E, Chapurlat R. Selected serum microRNA, abdominal aortic calcification and risk of osteoporotic fracture. PLoS One. 2019;14(5):e0216947.

[0129] 21. Legrand MA, Millet M, Merle B, Rousseau J-C, Hemmendinger A, Gineyts E, Sornay - Rendu E, Szulc P, Borel O, Croset M, Chapurlat R. A Signature of Circulating miRNAs Associated With Fibrous Dysplasia of Bone: the mirDys Study. J Bone Miner Res. 2020 Oct;35(10): 1881-92.

[0130] 22. Kelch S, Balmayor ER, Seeliger C, Vester H, Kirschke JS, van Griensven M. miRNAs in bone tissue correlate to bone mineral density and circulating miRNAs are gender independent in osteoporotic patients. Sci Rep. 2017 Nov 20;7(l): 15861. 23. Sillence DO, Senn A, Danks DM. Genetic heterogeneity in osteogenesis imperfecta. J. Med. Genet. 1979 Apr; 16(2): 101-16.

[0131] 24. Arlot ME, Sornay-Rendu E, Garnero P, Vey-Marty B, Delmas PD. Apparent pre- and postmenopausal bone loss evaluated by DXA at different skeletal sites in women: the OFELY cohort. J Bone Miner Res. 1997 Apr;12(4):683-90.

[0132] 25. Sornay-Rendu E, Boutroy S, Munoz F, Delmas PD. Alterations of cortical and trabecular architecture are associated with fractures in postmenopausal women, partially independent of decreased BMD measured by DXA: the OFELY study. J Bone Miner Res. 2007 Mar;22(3):425-33.

[0133] 26. Chaitou A, Boutroy S, Vilayphiou N, Munoz F, Delmas PD, Chapurlat R, Szulc P. Association between bone turnover rate and bone microarchitecture in men: the STRAMBO study. J Bone Miner Res. 2010 Nov;25(l l):2313-23.

[0134] 27. Nagy H, Sornay-Rendu E, Boutroy S, Vilayphiou N, Szulc P, Chapurlat R. Impaired trabecular and cortical microarchitecture in daughters of women with osteoporotic fracture: the MOD AM study. Osteoporos Int. 2013 Jun;24(6): 1881-9.

[0135] 28. Weinberger M, Samsa GP, Hanlon JT, Schmader K, Doyle ME, Cowper PA, Uttech KM, Cohen HJ, Feussner JR. An evaluation of a brief health status measure in elderly veterans. J Am Geriatr Soc. 1991 Jul;39(7):691-4.

[0136] 29. Griffiths-Jones S, Saini HK, van Dongen S, Enright AJ. miRBase: tools for microRNA genomics. Nucleic Acids Research. 2008 Jan l;36(suppl_l):D154-8.

[0137] 30. Kozomara A, Griffiths- Jones S. miRBase: annotating high confidence microRNAs using deep sequencing data. Nucleic Acids Research. 2014 Jan l;42(Dl):D68-73.

[0138] 31. Kozomara A, Birgaoanu M, Griffiths- Jones S. miRBase: from microRNA sequences to function. Nucleic Acids Research. 2019 Jan 8;47(Dl):D155-62.

[0139] 32. Schneider VA, Graves-Lindsay T, Howe K, Bouk N, Chen H-C, Kitts PA, Murphy TD, Pruitt KD, Thibaud-Nissen F, Albracht D, Fulton RS, Kremitzki M, Magrini V, Markovic C, McGrath S, Steinberg KM, Auger K, Chow W, Collins J, Harden G, Hubbard T, Pelan S, Simpson JT, Threadgold G, Torrance J, Wood JM, Clarke L, Koren S, Boitano M, Peluso P, Li H, Chin C-S, Phillippy AM, Durbin R, Wilson RK, Flicek P, Eichler EE, Church DM. Evaluation of GRCh38 and de novo haploid genome assemblies demonstrates the enduring quality of the reference assembly. Genome Res. 2017 May;27(5):849-64.

[0140] 33. Huggett JF, Foy CA, Benes V, Emslie K, Garson JA, Haynes R, Hellemans J, Kubista M, Mueller RD, Nolan T, Pfaffl MW, Shipley GL, Vandesompele J, Wittwer CT, Bustin SA. The digital MIQE guidelines: Minimum Information for Publication of Quantitative Digital PCR Experiments. Clin Chem. 2013 Jun;59(6):892-902.

[0141] 34. Robinson MD, McCarthy DJ, Smyth GK. edgeR: a Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics. 2010 Jan 1;26(1): 139-40.

[0142] 35. Poulet-Coulibando P, Testas A. le niveau d’etudes de la population et des jeunes. L’etat de 1’Enseignement superieur et de la Recherche en France n°10 - Avril 2017 [Internet], 2017 Apr 7 [cited 2021 Oct l];(10). Available from: https: / / publication.enseignementsup- recherche . gouv . fr / eesr / 10ZEESR 10_E S_20. php

[0143] 36. Gasteiger E, Gattiker A, Hoogland C, Ivanyi I, Appel RD, Bairoch A. ExPASy: The proteomics server for in-depth protein knowledge and analysis. Nucleic Acids Res. 2003 Jul 1;31(13):3784— 8.

[0144] 37. Leman R, Gaildrat P, Le Gac G, Ka C, Fichou Y, Audrezet M-P, Caux-Moncoutier V, Caputo SM, Boutry-Kryza N, Leone M, Mazoyer S, Bonnet-Dorion F, Sevenet N, Guillaud- Bataille M, Rouleau E, Bressac-de Paillerets B, Wappenschmidt B, Rossing M, Muller D, Bourdon V, Revillon F, Parsons MT, Rousselin A, Davy G, Castelain G, Castera L, Sokol owska J, Coulet F, Delnatte C, Ferec C, Spurdie AB, Martins A, Krieger S, Houdayer C. Novel diagnostic tool for prediction of variant spliceogenicity derived from a set of 395 combined in silico / in vitro studies: an international collaborative effort. Nucleic Acids Res. 2018 Sep 6;46(15):7913-23.

[0145] 38. Yeo G, Burge CB. Maximum entropy modeling of short sequence motifs with applications to RNA splicing signals. J Comput Biol. 2004; 11(2-3):377-94.

[0146] 39. Reese MG, Eeckman FH, Kulp D, Haussler D. Improved splice site detection in Genie. J Comput Biol. 1997;4(3):311-23.

[0147] 40. Pertea M, Lin X, Salzberg SL. GeneSplicer: a new computational method for splice site prediction. Nucleic Acids Res. 2001 Mar 1;29(5): 1185-90.

[0148] 41. Bartel DP. MicroRNA Target Recognition and Regulatory Functions. Cell. 2009 Jan 23;136(2):215-33.

[0149] 42. Sticht C, De La Torre C, Parveen A, Gretz N. MiRWalk: An online resource for prediction of microRNA binding sites. PLoS One. 2018 Oct 18; 13(10): ;

[0150] 43. Swinnen FK, Coucke PJ, De Paepe AM, Symoens S, Malfait F, Gentile FV, Sangiorgi L, D’Eufemia P, Celli M, Garretsen TJ, Cremers CW, Dhooge IJ, De Leenheer EM. Osteogenesis imperfecta: the audiological phenotype lacks correlation with the genotype. Orphanet J Rare Dis. 2011 Dec 29;6:88. 44. Denzler R, McGeary SE, Title AC, Agarwal V, Bartel DP, Stoffel M. Impact of MicroRNA Levels, Target-Site Complementarity, and Cooperativity on Competing Endogenous RNA-Regulated Gene Expression. Mol. Cell. 2016 03;64(3):565-79.

[0151] 45. Jing D, Hao J, Shen Y, Tang G, Li M-L, Huang S-H, Zhao Z-H. The role of microRNAs in bone remodeling. Int J Oral Sci. 2015 Sep;7(3): 131-43.

[0152] 46. Yang L, Cheng P, Chen C, He H-B, Xie G-Q, Zhou H-D, Xie H, Wu X-P, Luo X-H. miR-93 / Sp7 function loop mediates osteoblast mineralization. J Bone Miner Res. 2012 Jul;27(7): 1598-606.

[0153] 47. Eriksen EF. Cellular mechanisms of bone remodeling. Rev Endocr Metab Disord. 2010;l l(4):219-27.

[0154] 48. Hojo H, Ohba S. Sp7 Action in the Skeleton: Its Mode of Action, Functions, and Relevance to Skeletal Diseases. International Journal of Molecular Sciences. Multidisciplinary Digital Publishing Institute; 2022 Jan;23(10):5647.

[0155] 49. Chan WCW, Tan Z, To MKT, Chan D. Regulation and Role of Transcription Factors in Osteogenesis. Int J Mol Sci. 2021 May 21;22(11):5445.

[0156] 50. Fiscaletti M, Biggin A, Bennetts B, Wong K, Briody J, Pacey V, Birman C, Munns CF. Novel variant in Sp7 / Osx associated with recessive osteogenesis imperfecta with bone fragility and hearing impairment. Bone. 2018 May; 110:66-75.

[0157] 51. Zhang Y, Wei Q-S, Ding W-B, Zhang L-L, Wang H-C, Zhu Y-J, He W, Chai Y-N, Liu Y-W. Increased microRNA-93-5p inhibits osteogenic differentiation by targeting bone morphogenetic protein-2. PLoS ONE. 2017;12(8):e0182678.

[0158] 52. Matsubara T, Kida K, Yamaguchi A, Hata K, Ichida F, Meguro H, Aburatani H, Nishimura R, Yoneda T. BMP2 Regulates Osterix through Msx2 and Runx2 during Osteoblast Differentiation. J Biol Chem. 2008 Oct 24;283(43):29119-25.

[0159] 53. Fang T, Wu Q, Zhou L, Mu S, Fu Q. miR-106b-5p and miR-17-5p suppress osteogenic differentiation by targeting Smad5 and inhibit bone formation. Experimental Cell Research. 2016 Sep;347(l):74-82.

[0160] 54. Liu K, Jing Y, Zhang W, Fu X, Zhao H, Zhou X, Tao Y, Yang H, Zhang Y, Zen K, Zhang C, Li D, Shi Q. Silencing miR-106b accelerates osteogenesis of mesenchymal stem cells and rescues against glucocorticoid-induced osteoporosis by targeting BMP2. Bone. 2017 Apr;97: 130-8.

[0161] 55. Liu D, Wang B, Qiu M, Huang Y. MiR-19b-3p accelerates bone loss after spinal cord injury by suppressing osteogenesis via regulating PTEN / Akt / mTOR signalling. J Cell Mol Med. 2021 Jan;25(2):990-1000. 56. Zhu Y, Long H-T, Zeng L, Tang Y-F, Zhao R-B, Lin Z-Y, Zhao S-S, Cheng L. MiR- 19b-3p regulates osteogenic differentiation of PDGFRa+ muscle cells by specifically targeting PTEN. Cell Biol Int. 2019 May;43(5):565-73.

[0162] 57. Xiaoling G, Shuaibin L, Kailu L. MicroRNA-19b-3p promotes cell proliferation and osteogenic differentiation of BMSCs by interacting with IncRNA H19. BMC Med. Genet. 2020 09;21(l):l 1.

[0163] 58. Sun M, Hu L, Wang S, Huang T, Zhang M, Yang M, Zhen W, Yang D, Lu W, Guan M, Peng S. Circulating MicroRNA-19b Identified From Osteoporotic Vertebral Compression Fracture Patients Increases Bone Formation. Journal of Bone and Mineral Research. 2020;35(2):306-16.

[0164] 59. Zarecki P, Hackl M, Grillari J, Debono M, Eastell R. Serum microRNAs as novel biomarkers for osteoporotic vertebral fractures. Bone. 2020 Jan 1 ; 130: 115105.

[0165] 60. Taipaleenmaki H, Saito H, Schroder S, Maeda M, Mettler R, Ring M, Rollmann E, Gasser A, Haasper C, Gehrke T, Weiss A, Grimm SK, Hesse E. Antagonizing microRNA-19a / b augments PTH anabolic action and restores bone mass in osteoporosis in mice. EMBO Mol Med. 2022 Nov 8;14(1 l):el36I7.

[0166] 61. Guo Y, Wang Y, Liu Y, Liu Y, Zeng Q, Zhao Y, Zhang X, Zhang X. MicroRNA-218, microRNA-191*, microRNA-3070a and microRNA-33 are responsive to mechanical strain exerted on osteoblastic cells. Mol Med Rep. 2015 Aug;12(2):3033-8.

[0167] 62. Liu Y, Liu X, Ye P, Zhang X, Schilling AF, Yonezawa T, Gao G, Cui X. MicroRNA- 191 regulates differentiation and migration of mesenchymal stem cells and their paracrine effect on angiogenesis. Biotechnol Lett. 2020 Sep;42(9): 1777-88.

[0168] 63. Li M, Luo R, Yang W, Zhou Z, Li C. miR-363-3p is activated by MYB and regulates osteoporosis pathogenesis via PTEN / PI3K / AKT signaling pathway. In Vitro Cell. Dev. Biol. Anim. 2019 May;55(5):376-86.

[0169] 64. Lu X-D, Han W-X, Liu Y-X. Suppression of miR-451a accelerates osteogenic differentiation and inhibits bone loss via Bmp6 signaling during osteoporosis. Biomed. Pharmacother. 2019 Dec; 120: 109378.

[0170] 65. Heikinheimo K. Stage-specific expression of decapentaplegic-Vg-related genes 2, 4, and 6 (bone morphogenetic proteins 2, 4, and 6) during human tooth morphogenesis. J Dent Res. 1994 Mar;73(3):590-7.

[0171] 66. Wang S-K, Zhang H, Wang Y-L, Lin H-Y, Seymen F, Koruyucu M, Wright JT, Kim J- W, Simmer JP, Hu JC-C. FAM20A mutations and transcriptome analyses of dental pulp tissues of enamel renal syndrome. Int Endod J. 2023 Aug;56(8):943-54. 67. Fu J, Zhang X, Zheng H, Yang G, Chen Z, Yuan G. A WWP2-PTEN-KLF5 signaling axis regulates odontoblast differentiation and dentinogenesis in mice. J Biol Chem. 2022 Aug;298(8): 102220.

[0172] 68. Weilner S, Skalicky S, Salzer B, Keider V, Wagner M, Hildner F, Gabriel C, Dovjak P, Pietschmann P, Grillari-Voglauer R, Grillari J, Hackl M. Differentially circulating miRNAs after recent osteoporotic fractures can influence osteogenic differentiation. Bone. 2015 Oct 1;79:43-51.

[0173] 69. Chen R, Liao X, Chen F, Wang B, Huang J, Jian G, Huang Z, Yin G, Liu H, Jin D. Circulating microRNAs, miR-10b-5p, miR-328-3p, miR-100 and let-7, are associated with osteoblast differentiation in osteoporosis. Int J Clin Exp Pathol. 2018 Mar 1 ; 11 (3): 1383— 90.

[0174] 70. Chen C-C, You J-Y, Lung J, Huang C-E, Chen Y-Y, Leu Y-W, Ho H-Y, Li C-P, Lu C- H, Lee K-D, Hsu C-C, Gau J-P. Aberrant Iet7a / HMGA2 signaling activity with unique clinical phenotype in JAK2-mutated myeloproliferative neoplasms. Haematol ogica. 2017 Mar;102(3):509-18.

[0175] 71. Hua J, Liu D, Cao L, Wang D, Wu T, Lin F, Su P, Niu Y, Sun Y. Diagnostic and prognostic values of blood microRNA-Let7A for osteosarcoma. J Bone Oncol. 2018 Sep;12:65-8.

[0176] 72. Ghafouri-Fard S, Khoshbakht T, Hussen BM, Jamal HH, Taheri M, Hajiesmaeili M. A Comprehensive Review on Function of miR-15b-5p in Malignant and Non-Malignant Disorders. Front Oncol. 2022; 12:870996.

[0177] 73. Vimalraj S, Partridge NC, Selvamurugan N. A positive role of microRNA-15b on regulation of osteoblast differentiation. J Cell Physiol. 2014 Sep;229(9): 1236-44.

[0178] 74. Lu X, Zhang Y, Zheng Y, Chen B. The miRNA-15b / USP7 / KDM6B axis engages in the initiation of osteoporosis by modulating osteoblast differentiation and autophagy. J Cell Mol Med. 2021 Feb;25(4):2069-81.

[0179] 75. Coste E, Rouleux-Bonnin F. The crucial choice of reference genes: identification of miR-191-5p for normalization of miRNAs expression in bone marrow mesenchymal stromal cell and HS27a / HS5 cell lines. Sci Rep. 2020 Oct 20; 10(1): 17728.

[0180] 76. Hu Z, Dong J, Wang L-E, Ma H, Liu J, Zhao Y, Tang J, Chen X, Dai J, Wei Q, Zhang C, Shen H. Serum microRNA profiling and breast cancer risk: the use of miR-484 / 191 as endogenous controls. Carcinogenesis. 2012 Apr;33(4):828-34.

[0181] 77. Inoue K, Deng Z, Chen Y, Giannopoulou E, Xu R, Gong S, Greenblatt MB, Mangala LS, Lopez -Berestein G, Kirsch DG, Sood AK, Zhao L, Zhao B. Bone protection by inhibition of microRNA-182. Nat Commun. 2018 05;9(l):4108. 78. Kim KM, Park SJ, Jung S-H, Kim EJ, Jogeswar G, Ajita J, Rhee Y, Kim C-H, Lim S-

[0182] K. miR-182 is a negative regulator of osteoblast proliferation, differentiation, and skeletogenesis through targeting FoxOl . J Bone Miner Res. 2012 Aug;27(8): 1669-79.

[0183] 79. Pan B-L, Tong Z-W, Li S-D, Wu L, Liao J-L, Yang Y-X, Li H-H, Dai Y-J, Li J-E, Pan

[0184] L. Decreased microRNA-182-5p helps alendronate promote osteoblast proliferation and differentiation in osteoporosis via the Rapl / MAPK pathway. Biosci. Rep. 2018 21;38(6).

[0185] 80. Ke K, Sul O-J, Rajasekaran M, Choi H-S. MicroRNA-183 increases osteoclastogenesis by repressing heme oxygenase-1. Bone. 2015 Dec;81 :237-46.

[0186] 81. Liu H, Liu Q, Wu X-P, He H-B, Fu L. MiR-96 regulates bone metabolism by targeting osterix. Clin. Exp. Pharmacol. Physiol. 2018;45(6):602-13.

[0187] 82. Rauch F, Glorieux FH. Osteogenesis imperfecta. Lancet. 2004 Apr 24;363(9418): 1377— 85.

[0188] 83. Biggin A, Munns CF. Long-Term Bisphosphonate Therapy in Osteogenesis Imperfecta. Curr Osteoporos Rep. 2017 Oct;15(5):412-8.

[0189] 84. Marom R, Rabenhorst BM, Morello R. Osteogenesis imperfecta: an update on clinical features and therapies. Eur J Endocrinol. 2020 Oct;183(4):R95-106.

[0190] 85. Rossi V, Lee B, Marom R. Osteogenesis imperfecta: advancements in genetics and treatment. Curr. Opin. Pediatr. 2019 Dec;31(6):708-15.

[0191] 86. Hald JD, Evangelou E, Langdahl BL, Ralston SH. Bisphosphonates for the Prevention of Fractures in Osteogenesis Imperfecta: Meta- Analysis of Placebo-Controlled Trials. Journal of Bone and Mineral Research. 2015;30(5):929-33.

[0192] 87. Dwan K, Phillipi CA, Steiner RD, Basel D. Bisphosphonate therapy for osteogenesis imperfecta. Cochrane Database Syst Rev. 2016 Oct 19;2016(10):CD005088.

[0193] 88. Glorieux FH, Devogelaer J-P, Durigova M, Goemaere S, Hemsley S, Jakob F, Junker U, Ruckle J, Seefried L, Winkle PJ. BPS804 Anti-Sclerostin Antibody in Adults With Moderate Osteogenesis Imperfecta: Results of a Randomized Phase 2a Trial. J Bone Miner Res. 2017 Jul;32(7): 1496-504.

[0194] 89. O’Neill CP, Dwyer RM. Nanoparticle-Based Delivery of Tumor Suppressor microRNA for Cancer Therapy. Cells. 2020 Feb 24;9(2):E521.

[0195] 90. Mollaei H, Safaralizadeh R, Rostami Z. MicroRNA replacement therapy in cancer. J Cell Physiol. 2019 Aug;234(8): 12369-84.

Claims

CLAIMS:

1. A method of treating Osteogenesis Imperfecta (01) in a patient in need thereof comprising administering to the patient a therapeutically effective amount of at least one miRNA inhibitor selected from the group consisting of miR-93 inhibitors, miR- 106b inhibitors, miR-25 inhibitors and miR-182 inhibitors.

2. The method according to claim 1 wherein the miRNA inhibitor is a compound such as nucleic acid that hybridizes with miR-106b, miR-93, miR-25, or miR-182 or having sequence complementarity to that of miR-106b, miR-93, miR-25, or miR-182.

3. The method according to claim 1 or 2 wherein the miRNA inhibitor is selected from the group consisting of double-stranded RNAs (such as short- or small-interfering RNA or "siRNA"), antagomirs, antisense nucleic acids, and enzymatic RNA molecules such as ribozymes.

4. The method according to claim 1 or 2 wherein the miRNA inhibitor is an antisense oligonucleotide.

5. The method according to claim 1 or 2 wherein the miRNA inhibitor is an antagomir.

6. The method according to any one of claims 1 to 5 wherein the miRNA inhibitor is administered to the patient in combination with one or more bisphosphonate(s).

7. The method according to any one of claims 1 to 5 wherein the miRNA inhibitor is administered to the patient in combination with one or more sclerostin inhibitor(s).

8. The method according to any one of claims 1 to 5 wherein the miRNA inhibitor is administered to the patient in combination with one or more TGF-beta inhibitor(s).

Images