Gene editing TGM1 mutations for treating autosomal recessive congenital ichthyosis (ARCI)

Abstract

The invention relates to an oligonucleotide, comprising a sequence that targets a c.877-2 A>G mutation of the transglutaminase-1 (TGM1) gene. In embodiments, the oligonucleotide hybridizes to a target region of the TGM1 gene comprising the c.877-2 A>G mutation (mutation site), and the oligonucleotide is 10 to 35 nucleotides in length. The invention further relates to a gene editing system targeting a c.877-2 A>G mutation of the TGM1 gene, comprising said oligonucleotide, and a base editor, prime editor or RNA-guided endonuclease. In further aspects, the invention relates to a pharmaceutical composition, preferably for use in the treatment of a condition associated with a c.877-2 A>G mutation of the TGM1 gene, comprising said oligonucleotide or said gene editing system with a pharmaceutically acceptable carrier. The invention further relates to an in vitro method for modifying a c.877-2 A>G mutation of the TGM1 gene.

Description

[0001] GENE EDITING TGM1 MUTATIONS FOR TREATING AUTOSOMAL RECESSIVE CONGENITAL ICHTHYOSIS (ARCI) DESCRIPTION The invention is in the field of biochemistry and medicine, in particular the field of gene editing, oligonucleotides and their use in the treatment of medical conditions. The invention relates to an oligonucleotide, comprising a sequence that targets a c.877-2 A>G mutation of the transglutaminase-1 (TGM1) gene. In embodiments, the oligonucleotide hybridizes to a target region of the TGM1 gene comprising the c.877-2 A>G mutation (mutation site), and the oligonucleotide is 10 to 35 nucleotides in length. The invention further relates to a gene editing system targeting a c.877-2 A>G mutation of the TGM1 gene, comprising said oligonucleotide, and a base editor, prime editor or RNA-guided endonuclease. In further aspects, the invention relates to a pharmaceutical composition, preferably for use in the treatment of a condition associated with a c.877-2 A>G mutation of the TGM1 gene, comprising said oligonucleotide or said gene editing system with a pharmaceutically acceptable carrier. The invention further relates to an in vitro method for modifying a c.877-2 A>G mutation of the TGM1 gene, comprising administering said oligonucleotide or said gene editing system to a cell in which the TGM1 c.877-2 A>G mutation is to be modified. BACKGROUND OF THE INVENTION The human skin is a vast organ with many important functions. It is a sensory organ that reduces transepidermal water loss, acts as part of the immune system, and controls the harmful effects of environmental influences, xenobiotics, and pathogens (Maraduca et al., 2020; Kabashima et al., 2019). The skin consists of three main layers: epidermis, dermis, and hypodermis. The inner layer of the hypodermis is primarily composed of subcutaneous adipose tissue, while the dermis, the middle layer, consists of connective tissue comprised of collagen and elastin fibres. Embedded in this extracellular tissue are fibroblasts, hair follicles, sebaceous and sweat glands, as well as blood and lymph vessels, immune cells, receptors, and neurons (Kabashima et al., 2019). The barrier function of the skin is provided primarily by the outermost layer, the epidermis, which in itself consists of four layers. The epidermis mainly contains keratinocytes, which originate from skin stem cells in the stratum basale, the lowest of the outermost skin layers, and continuously differentiate throughout the layers. Terminally differentiated keratinocytes are called corneocytes and form the stratum corneum, which is the outermost layer of the epidermis. This layer is composed of 10 to 20 layers of flattened, denucleated cells that are embedded in a hydrophobic intercellular lipid matrix (Matsui et al., 2015). Corneocytes are cross-linked by corneodesmosomes and enclosed in the cornified envelope, an insoluble protein shell that replaces the cell membrane. The formation of the cornified envelope relies on transglutaminase enzymes, which catalyse the crosslinking of proteins. Corneocytes are regularly shedded in a process called desquamation, so that the stratum corneum renews every two to four weeks. The stratum corneum is a highly specialized layer that performs the main barrier function of the skin. It thereby reduces water loss and provides physical resistance against mechanical impact and pathogens (Candi et al., 2005). Skin diseases significantly impact physical and psychological well-being causing a significant economic burden worldwide (Finlay et al., 2009). This applies to very common diseases like atopic dermatitis and psoriasis, but also to genodermatoses. The latter is a diverse group of rare, often severe skin diseases that result from single mutations in ≥500 genes and have a dramatic impact on patient quality of life and life expectancy in certain cases (Pope et al., 2020; Oji et al., 2012, Ul Ain et al., 2020). In diseased skin, the protective barrier provided by the epidermis is often reduced. Skin diseases are relatively common, and are often treated purely symptomatically due to a lack of curative treatment methods. A group of heterogeneous skin diseases characterized by keratinization disorder and resulting in dry, thickened, and scaly skin are called ichthyosis (Ain et al., 2020). They are classified into congenital and vulgar forms, by their appearance, and by the mode of inheritance (Oji et al., 2010). A damaged skin barrier leads to water loss and dehydration due to lipid layer impairment and increased susceptibility to infection due to permeability of the skin for microorganisms and pathogens (Chukpanova et al., 2022). Autosomal recessive congenital ichthyosis (ARCI), one example for genodermatoses (Sugiura et al., 2015; Pigg et al., 2016), is an umbrella term for a subset of severe and rare forms of ichthyosis that significantly impact the physical and psychological well-being of affected patients. It includes a spectrum of disease presentations from lamellar ichthyosis (LI, OMIM 242300) and congenital ichthyosiform erythroderma (CIE, OMIM 242100) to harlequin ichthyosis (HI, OMIM 242500) (Oji et al., 2010), the latter being the most severe with a mortality rate of more than 50% in newborns (Cottle et al., 2015). The prevalence of ARCI in western Europe is estimated to be 7 per million people ( / M) (Dreyfus et al., 2014), while in Norway it affects up to 11 / M due to a founder effect (Pigg et al., 1998). While the severity may vary considerably, the symptoms are especially significant in neonates who suffer from higher mortality rates as a result of dehydration and / or infection, particularly in harlequin ichthyosis (Oji et al., 2010; Vahlquist et al., 2008; Fleckman et al., 2013). Other prominent examples of severe, monogenic skin diseases are epidermolysis bullosa and the Netherton syndrome, both highly stigmatizing diseases associated with increased mortality in some cases. Currently, there are no targeted treatment options for those genodermatoses and a cure does not exist (Ul Ain et al., 2020). ARCI is caused by a monogenic mutation in one out of a range of genes. So far twelve genes have been identified that, if affected, cause ARCI. These still do not account for 15% of documented cases, which are caused by mutations in genes outside of that range (Pigg et al., 2016). One of the genes most often affected is TGM1 (NM_000359.3). It encodes the transglutaminase-1 enzyme (TGase-1), which is part of the protein crosslinking mechanism in the cornified envelope (Candi et al., 2005; Herman et al., 2009).32% to 68% of ARCI cases are linked to mutations in TGM1, and even higher percentages in cases of LI (Chulpanova et al., 2022; Pigg et al., 2016). The splice site point mutation c.877-2A>G was found in a third of all TGM1 mutation alleles (Herman et al., 2009) and leads to a premature stop codon (Shevchenko et al., 2000). Dang et al (“Correction of the pathogenic mutation in TGM1 gene by adenine base editing in mutant embryos” Molecular Therapy, vol.30, no.1, 2022, 175-183) discloses the base editing of the c.607C>T mutation in the TGM1 gene using cytosine base editors for the treatment of LI. Freedman et al (“Preclinical Evaluation of a Modified Herpes Simplex Virus Type 1 Vector Encoding Human TGM1 for the Treatment of Autosomal Recessive Congenital Ichthyosis” Journal of Investigative Dermatology, vol.141, no.4, 2021, 874-882) discloses the treatment of ARCI using a gene therapy vector encoding full-length human TGM1 in a mouse model. Despite these proposed treatments, current treatment options for ARCI typically aim to improve quality of life without addressing the underlying cause. These treatments have no long-term effect (Chulpanova et al., 2022) and might have to be applied multiple times a day, as in moisturizers, or have many adverse effects, especially in long-term use (Vahlquist et al., 2008). It was previously shown that topical treatment with functional TGase-1 protein is in theory possible (Plank et al., 2019). However, as with current therapies, the effect would be impermanent, and applications would have to be carried out frequently. WO 2016 / 011080 teaches various sgRNAs for screening genetic elements that modulate a phenotype. The sequences disclosed therein may bear similarity to the oligonucleotides of the present invention, although the Cas9 employed in WO 2016 / 011080 is used in screening genetic elements and not for gene editing, and thus this application bears little relevance to the therapeutic approach of the present invention. Although some treatments aiming to improve life quality, no disease modifying treatments or means effectively addressing the underlying cause of diseases associated with a c.877-2 A>G mutation of the TGM1 gene have been developed. Thus, in view of the severity and substantially reduced life quality of patients suffering from such diseases, the provision of effective means for treatment of these diseases is urgently needed. SUMMARY OF THE INVENTION In light of the prior art, the technical problem underlying the present invention is to provide improved or alternative means for treating medical conditions associated with a c.877-2 A>G mutation of the TGM1 gene. Another problem underlying the present invention was the provision of gene editing strategies for modifying a c.877-2 A>G mutation of the TGM1 gene. In particular one problem underlying the present invention was the provision of a disease modifying and / or curative treatment of medical conditions associated with a c.877-2 A>G mutation of the TGM1 gene. These problems are solved by the features of the independent claims. Preferred embodiments of the present invention are provided by the dependent claims. In one aspect the present invention relates to an oligonucleotide, comprising a sequence that targets a c.877-2 A>G mutation of the transglutaminase-1 (TGM1) gene, wherein a. the oligonucleotide hybridizes to a target region of the TGM1 gene according to SEQ ID No.13, said target region comprising the c.877-2 A>G mutation (mutation site), and b. the oligonucleotide is 10 to 35 nucleotides in length. The oligonucleotides of the present invention are surprisingly effective and specific in targeting a region of the TGM1 gene comprising the c.877-2 A>G mutation, in particular to the region of the TGM1 gene according to SEQ ID No.13. The c.877-2 A>G mutation of the TGM1 gene is associated with autosomal, recessive, congenital ichthyosis (ARCI), a diverse group of severe diseases of the skin for which no curative treatment is available to date. According to the knowledge of the inventors no oligonucleotides targeting the specific region of the TGM1 gene comprising the c.877-2 A>G mutation have been described to date. The oligonucleotides described herein thus advantageously provide novel means for the treatment of medical conditions associated with a c.877-2 A>G mutation of the TGM1 gene including ARCI. The oligonucleotides efficiently and specifically bind to the target region and thereby direct various gene editing tools including RNA guided endonucleases, base editors and prime editors to their site of action resulting in specific editing of the c.877-2 A>G mutation of the TGM1 gene without substantial bystander editing or off target effects. In contrast to common treatments of ARCI, to date solely directed to symptomatic treatment, the oligonucleotides of the present invention thus allow a disease modifying and curative treatment of ARCI by directly addressing the c.877-2 A>G mutation of the TGM1 gene as underlying cause. Low levels of bystander editing, and off target effects, are noteworthy advantages of the present invention. As shown in the examples below, the gene editing approach of the present invention enables clinically relevant editing rates in human skin tissue via LNP mediated gene delivery. The examples disclosed herein were assessed for off-target effects and, surprisingly and beneficially, no guide RNA-dependent off-target effects were detectable. The means disclosed herein thus enable improvements over alternative approaches to gene editing, in which bystander editing and off target effects are evident. The prior art disclosure of Dang et al, differs significantly from the approach of the present invention. The approach described herein employs preferably CBEs to correct the mutation (c.877-2A>G) in the TGM1 gene of patient-derived keratinocytes, Dang et al. used CBEs to induce the mutation (c.607C>T) in the TGM1 gene of HEK cells so that they could later correct it using ABEs. Dang tested several base editors, including BEmax-AID, BEmax-A3A-Y130F, AncBE4max, and AncBEmax-NG, combined with different sgRNAs to generate a mutant cell line using HEK cells. BEmax-AID achieved editing at the target site but unfortunately produced bystander edits in other C bases. For example, in Dang, BEmax-A3A-Y130F had approximately 55% on-target editing efficiency while causing 10-25% bystander editing. AncBE4max achieved 45-65% editing efficiency at the target site and 27-36% at non-target sites. A major difference between the present invention and the approach of Dang is that Dang observed significant off-target and by-stander editing. To avoid bystander editing, the present invention may employ, in embodiments, preferably base editors, including BE4max, BE4max-NG, and A3G-BE5.14, or eTD editors, preferably the selected eTD base editors disclosed herein. For example, eTd-CBE is a TadA-derived CBE with a shorter editing window (positions 5-6) compared to BE4max (positions 4-8), resulting in less bystander editing. For example, using eTD or other editors disclosed herein and optimizing the sgRNA sequence to those disclosed herein, the present invention achieved successful reduction and in some cases elimination of bystander editing, which plagued approaches of the prior art. This is critical in the present invention, as the bystander is directly adjacent to the target mutation. Since the target mutation is a splice-site mutation, by-stander editing would prevent functional repair of the mutation. The present invention thus achieves functional gene repair without unwanted bystander editing, representing a beneficial and surprising advantage over approaches of the prior art. The present disclosure presents preferred and beneficial base editors and sgRNA sequences, with which the present therapeutic gene editing approach can be achieved with no, or only negligible levels of, off-target and by-stander editing. The editors and sequences disclosed herein may be employed or adjusted as may be necessary to achieve or improve the effects shown. For example, eTD has been shown in Chen et al (Re-engineering the adenine deaminase TadA- 8e for efficient and specific CRISPR-based cytosine base editing. Nature Biotechnology, 2023. 41(5): p.663-672) to have a narrowed editing window (thereby reducing bystander editing) potentially due to the elimination of the protein linker tethering the deaminase to the Cas9 enzyme. Previously it has been reported that shortening, adding rigidity or even eliminating the linker in other base editing architectures has achieved a narrow editing window (as shown in Tan, J., et al., Engineering of high-precision base editors for site-specific single nucleotide replacement. Nature Communications, 2019.10(1): p.439 ). Additionally, CBE6 has been shown to have improved product purity (further reducing undesirable substitutions at the target nucleotide) and improved on-target editing efficiency (Zhang, E., et al., Phage-assisted evolution of highly active cytosine base editors with enhanced selectivity and minimal sequence context preference. Nature Communications, 2024.15(1): p.1697). Based on these teaching, combinations of eTD, CBE6 and modifications to the linker may be incorporated into the approach disclosed herein to produce a highly efficient base editor with a narrowed editing window. These base editors (eTD and CBE6) have been demonstrated to efficiently target clinically relevant mutations for other genetic diseases, indicating the intention of these technologies for clinical applications, and in principle their suitability in the present invention. Another difference to the prior art Dang et al is their focus on germline gene therapy, where they injected ABE mRNA and sgRNA into human mutant embryos created by microinjecting patient sperm carrying the c.607C>T mutation into oocytes. In contrast, the present invention comprises preferably a topically applicable gene-editing-based therapy for in situ correction of the disease- causing mutation c.877-2A>G, preferably using lipid nanoparticles (LNP) to facilitate gene delivery into the viable epidermis of the skin. In one embodiment, the target region of the TGM1 gene according to SEQ ID No.13 and / or the complementary strand of the target region of the TGM1 gene according to SEQ ID No.12 comprises a protospacer adjacent motif (PAM) or a sequence complementary to the PAM. In one embodiment, the oligonucleotide hybridizes to a sequence within the target region of the TGM1 gene according to SEQ ID No.13 adjacent to the PAM or adjacent to a sequence complementary to the PAM. In one embodiment, the oligonucleotide hybridizes to a region of the TGM1 gene according to SEQ ID No.13 downstream of the PAM or the sequence complementary to the PAM. In one embodiment, the PAM or the sequence complementary to the PAM is at least 2 nucleotides in length. In one embodiment the PAM or the sequence complementary to the PAM is 2, 3, 4, 5, or 6 nucleotides in length. In one embodiment, the PAM is selected from NG, NGG, NGAN, NGAG, NNNRRT, NGNG, NGN, NAN, NRRH, NRCH. In one embodiment, the distance between the mutation site and the PAM or sequence complementary to the PAM is 3 to 19 oligonucleotides. In one embodiment, the distance between the mutation site and the PAM or sequence complementary to the PAM is 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 or 19 nucleotides. In one embodiment the oligonucleotide is 10, 11, 12, 13, 14, 15, 16,17, 18, 19, 20, 21, 22, 23, 24,25, 26, 27, 28, 29, 30, 31, 32, 33, 34 or 35 nucleotides in length. In one embodiment, the oligonucleotide has a nucleic acid sequence according to the formula (X)n- GGA –(X)m (5’ to 3’) wherein a. m and n are, independently of each other, 0 to 20, preferably 0 to 18, more preferably 0 to 17, and b. X is, independently of each other, any nucleotide(s). In one embodiment, the oligonucleotide has a nucleic acid sequence according to the formula (X)n- CGGAAGGAGGGAT –(X)m (5’ to 3’) wherein a. m and n are, independently of each other, 0 to 15, preferably 0 to 10, more preferably 0 to 7, and b. X is, independently of each other, any nucleotide(s). In one embodiment, the oligonucleotide has a nucleic acid sequence according to the formula (X)n- CCGGAAGGAGGGATG-(X)m(5’ to 3’) wherein a. m and n are, independently of each other, 0 to 10, preferably 0 to 7, more preferably 0 to 5, and b. X is, independently of each other, any nucleotide(s). In one embodiment, the oligonucleotide has a nucleic acid sequence according to the formula (X)n- ACCGGAAGGAGGGATGG-(X)m(5’ to 3’) wherein a. m and n are, independently of each other, 0 to 7, preferably 0 to 5, more preferably 0 to 3, and b. X is, independently of each other, any nucleotide(s). In one embodiment, the oligonucleotide has a nucleic acid sequence according to the formula (X)n- AACCGGAAGGAGGGATGG-(X)m(5’ to 3’) wherein a. m and n are, independently of each other, 0 to 5, preferably 0 to 3, more preferably 0 to 2, and b. X is, independently of each other, any nucleotide(s). In one embodiment, n is 0, 1, 2, 3, 4, 5, 6, 7, 8, 910, 11, 12, 13, 14, or 15 nucleotides in length. In one embodiment, m is 0, 1, 2, 3, 4, 5, 6, 7, 8, 910, 11, 12, 13, 14, or 15 nucleotides in length. In one embodiment, the oligonucleotide has a sequence according to any one of SEQ ID No.1 to 10, or a sequence with an at least 80%, preferably 90%, sequence identity thereto. In one embodiment, the oligonucleotide has a sequence according to any one of SEQ ID No.1 to 8, or a sequence with an at least 80%, preferably 90%, sequence identity thereto. In one embodiment, the oligonucleotide has a sequence according to any one of SEQ ID No.2 to 7, or a sequence with an at least 80%, preferably 90%, sequence identity thereto. In one embodiment, the oligonucleotide has a sequence according to any one of SEQ ID No.3 to 6, or a sequence with an at least 80%, preferably 90%, sequence identity thereto. In one embodiment, the oligonucleotide has a sequence according to any one of SEQ ID No.4 to 6, or a sequence with an at least 80%, preferably 90%, sequence identity thereto. In one embodiment, the oligonucleotide has a sequence according to any one of SEQ ID No.9 to 10, or a sequence with an at least 80%, preferably 90%, sequence identity thereto. In one embodiment, the oligonucleotide is an RNA oligonucleotide. In one embodiment the oligonucleotide is a single stranded RNA (ssRNA). In one embodiment the oligonucleotide is a guide RNA (sgRNA). In preferred embodiments, the oligonucleotide is a guide RNA (sgRNA), and comprises or consists of a sequence according to SEQ ID NO 5 (AAACCGGAAGGAGGGATGGA), also known as p5, or SEQ ID NO 6 (CAAACCGGAAGGAGGGATGG), also known as p6. In embodiments, these sgRNAs are preferred and, without prejudice, enable improved base editing efficiencies compared to other sgRNA disclosed herein. In embodiments, p5 or p6 sgRNA sequences are therefore the guides intended for combination with base editors showing reduced bystander editing. Other sgRNA sequences listed (including P4 for example) also achieve low off-target effects and bystander editing, and may be used with base editors, for example those with altered editing windows, to avoid bystander editing. In embodiments, when using the sgRNA p5, the preferred base editors are BE4max, BE4max- NG, YE1-BE4max, AncBE4-max, YE2-BE4max, EE-BE4max, YEE-BE4max, whereby, in embodiments, the potential PAM is NGG, NG, NGN, or NRRH. In embodiments, when using the sgRNA p6, the preferred base editors are BE4max, BE4max- NG, YE1-BE4max, AncBE4-max, Td-CBEs, YE2-BE4max, EE-BE4max, YEE-BE4max, whereby, in embodiments, the potential PAM is NGG, NG, NGNG or NGN. In embodiments, including one or more mismatches in the p5 and p6 sgRNA sequences to its target genomic sequence may be employed to further reduce bystander editing. In embodiments, the SEQ ID NO 5 or 6 may comprise 1-3, preferably 1-2, mismatches to the target sequence. When considering the positions of the one or more mismatches, a skilled person is aware of their positioning and how to introduce a mismatch to influence or not influence sgRNA properties, as may be desired. For example, mismatches at the 3‘ end of the sgRNA (in the second half of the sequence, such as in the last 5 nt of the gRNA towards the 3’ end) are typically more critical for recognition and binding by the Cas proteins. However, two or more mismatches at the 3’ end can significantly reduce the efficiency of the gRNA. In embodiments, for example, mismatches at the 5’ end from the PAM position (for example in the first half of the sequence, or preferably at positions 2-6 of the sgRNA, from the 5’ end), of up to two nucleotides, are generally well tolerated and may improve base editing efficiency. In embodiments, the gRNA sequences disclosed herein, e.g. SEQ ID NO 1-10, preferably 4, 5 and 6, more preferably SEQ ID NO 5 or 6, comprise one or more mismatches as described herein. In embodiments, the features regarding particular mismatches in particular regions of the sgRNA (e.g. those presented above) may be used in combination with the features of % identity to reference sequences, in order to define the inventive oligonucleotides. In one embodiment, the oligonucleotide is configured as a guide RNA for a base editor, prime editor and / or RNA-guided endonuclease, preferably a CRISPR / Cas protein. In one embodiment, the oligonucleotide is fused to a reverse transcriptase (RT) template sequence. In one embodiment the oligonucleotide fused to a RT template and is configured as a prime editing guide RNA (pegRNA) for a prime editor. In one embodiment the RT template has at least a 90%, preferably 95%, sequence identity to a target region of the TGM1 gene according to SEQ ID No.13, and wherein the nucleobase of the HR-template corresponding to the mutation site is A. In one embodiment the pegRNA is 120 to 230 nucleotides in length, preferably 130 to 220 nucelotides in length, more preferably 140 to 160 nucleotides in length. In one embodiment the pegRNA is 120, 125, 130, 135, 137, 140, 145, 150, 154, 155, 160, 165, 170, 175, 180, 185, 190, 195, 200, 205, 210, 215, 217, 220, 225 or 230 nucleotides in length. In one embodiment the distance between the nicking site and the mutation site is 0 to 120 nucleotides, preferably 20 to 100 nucleotides, more preferably 50 to 80 nucleotides. In one aspect the invention relates to a gene editing system targeting a c.877-2 A>G mutation of the TGM1 gene, said system comprising: a. an oligonucleotide, and b. a base editor, prime editor or RNA-guided endonuclease, preferably a CRISPR / Cas protein, or a nucleic acid molecule, preferably an mRNA, encoding the same. In one embodiment the base editor is a cytosine base editor, preferably selected from the group consisting of BE4max-NG, BE4max-NRCH, A3G-BE, A3G-BE5.14, Target-AID, Target-AIDmax, Target-AID-NG, SpCas9-TadCBEa, SpCas9-TadCBEb, SpCas9-TadCBEc, SpCas9-TadCBEd, SpCas9-TadCBEe, SpCas9-TadCBEa-V106W, SpCas9-TadCBEd-V106W, SpCas9-TadCBEd- N108Q / L145T, SpRY-Cas9 and SpCas9-TadCBEd-V106W / N108Q / L145T. In one embodiment the base editor is selected from the group consisting of AncBE4-max-NG, YE2-BE3, EE-BE3, YEE-BE3, eAID-BE4max, BE4-max, AncBE4-max, YE2-BE4-NG, EE-BE4- NG, YEE-BE4-NG, R33A+ K34A-BE4-NG, xCas9-BE, SpCas9-NRRH-BE, Td-CBEs and EQR- BE. In one embodiment the base editor is a cytosine base editor, preferably a fourth-generation cytosine base editor (BE4), selected from BE4max-NG or BE4max-NRCH. In one embodiment, the base editor is a cytosine base editor, preferably a fourth-generation (BE4) or a fifth-generation (BE5) cytosine base editor, selected from BE4max, AncBE4-max, Td- CBEs and A3G-BE5.14. In one embodiment, the mRNA encoding for the base editor, prime editor or RNA-guided endonuclease is a modified mRNA. In one embodiment, the invention relates to a gene editing system comprising: (a) an oligonucleotide according to SEQ ID No.4 and (b) a BE4max-NG or AncBE4-max- NG base editor or a nucleic acid molecule, preferably an mRNA, encoding the same, (b) an oligonucleotide according to SEQ ID No.5 and (b) a YE2-BE3, EE-B3, YEE-BE3, eAID-BE4max, BE4-max, AncBE4-max, YE2-BE4-NG, EE-BE4-NG, YEE-BE4-NG, R33A+K34A-BE4-NG, xCas9-BE or SpCas9-NRRH-BE base editor or a nucleic acid molecule, preferably an mRNA, encoding the same, or (b) an oligonucleotide according to SEQ ID No.6 and (b) a BE4-max, AncBE4-max, Td- CBEs, EQR-BE or xCas9-BE base editor or a nucleic acid molecule, preferably an mRNA, encoding the same, or In one embodiment the invention relates to a gene editing system comprising: (a) an oligonucleotide according to SEQ ID No.6 and (b) a BE4max-NG base editor or a nucleic acid molecule, preferably an mRNA, encoding the same, or (b) an oligonucleotide according to SEQ ID No.4 and (b) a BE4max-NRCH editor or a nucleic acid molecule, preferably an mRNA, encoding the same. In one embodiment the invention relates to a gene editing system comprising: (a) an oligonucleotide according to any one of SEQ ID No.1 to 8, and (b) a base editor elected from those of table 1a or 1b, corresponding to said oligonucleotide in Table 1a or 1b, or a nucleic acid molecule, preferably an mRNA, encoding the same. Tables 1a and 1b provide i.a. exemplary sgRNA sequences (e.g., SEQ ID NO 1 to 10) and for each sgRNA, potential base editors, and potential PAM sequences. In embodiments, each of the sgRNA sequences disclosed therein may be combined with one or more of the corresponding potential base editors and / or PAM sequences, provided for each sgRNA. Table 1b provides three exemplary sgRNA sequences and for each sgRNA, potential base editors, deaminases, Cas nucleases, PAM sequences and editing windows. In embodiments, each of the sgRNA sequences disclosed therein may be combined with one or more of the corresponding potential base editors, deaminases, Cas nucleases, PAM sequences and / or editing windows, provided for each sgRNA. In one embodiment the invention relates to a gene editing system additionally comprising a homology directed repair (HDR)-Template, wherein the HDR-template has at least a 90%, preferably 95%, sequence identity to the target region of the TGM1 gene according to SEQ ID No.13, and wherein the nucleobase of the HDR-template corresponding to the mutation site is A. In one embodiment the HDR-template is a ssDNA template and 80 to 130 nucleotides in length, preferably 90 to 120, more preferably 100 to 115 nucleotides in length. In one embodiment the HDR-template is a ssDNA template and 80, 85, 90, 95, 100, 105, 110, 115, 120, 125 or 130 nucleotides in length. In one embodiment the HDR template comprises or consists of a sequence according to SEQ ID No.11. In one embodiment the invention relates to a gene editing system comprising an oligonucleotide according to SEQ ID No.9 or 10, an HDR-Template according to SEQ ID No.11 and an RNA- guided endonuclease, preferably a CRISPR / Cas protein, or a nucleic acid molecule, preferably an mRNA, encoding the same. In one aspect the invention relates to the oligonucleotide or the gene editing system for use in the treatment of a medical condition associated with a c.877-2 A>G mutation of the TGM1 gene. In one embodiment the invention relates to the oligonucleotide or the gene editing system for use in the treatment of a medical condition associated with a c.877-2 A>G mutation of the TGM1 gene. In one embodiment the medical condition is a genodermatosis associated with a c.877-2 A>G mutation of the TGM1 gene. In one embodiment the medical condition is autosomal, recessive, congenital ichthyosis (ARCI). In one aspect the invention relates to a pharmaceutical composition comprising the oligonucleotide or the gene editing system, with a pharmaceutically acceptable carrier. In one aspect the invention relates to a pharmaceutical composition, preferably for use in the treatment of a condition associated with a c.877-2 A>G mutation of the TGM1 gene, comprising the oligonucleotide or the gene editing system, with a pharmaceutically acceptable carrier. In one embodiment the oligonucleotide and / or gene editing system is encapsulated in a lipid nanoparticle (LNP). In one embodiment the oligonucleotide and / or gene editing system is encapsulated in a polymeric nanoparticle. In one embodiment the oligonucleotide and / or gene editing system is encapsulated in a peptide nanoparticle. In one embodiment the pharmaceutical composition comprises lipid nanoparticles encapsulating the oligonucleotide. In one embodiment the pharmaceutical composition comprises lipid nanoparticles encapsulating the oligonucleotide and lipid nanoparticles encapsulating an mRNA encoding for a base editor, prime editor or RNA-guided endonuclease. In one embodiment the pharmaceutical composition comprises lipid nanoparticles encapsulating the oligonucleotide and lipid nanoparticles encapsulating an mRNA encoding for a cytosine base editor. In one embodiment the pharmaceutical composition comprises lipid nanoparticles encapsulating the oligonucleotide and lipid nanoparticles encapsulating an mRNA encoding for a CRISPR / Cas protein. In one embodiment the composition is configured for topical administration. The efficient delivery of nucleic acids delivery to the skin proves to be a challenge, as the skin barrier formed by the stratum corneum is not permeable for macromolecules, even in impaired skin. Some of the common issues include the physicochemical properties of large and charged molecules or nucleic acids, off-target effects and insufficient transfection rates. A systemic approach would hardly reach the epidermis, which does not have vasculature and is closed off from the dermis with a tight junction zone. Advantageously the oligonucleotides and nucleic acids of the present invention can easily and efficiently be encapsulated into delivery systems such as lipid nanoparticles (LNPs) which are well suited for efficient topic delivery directly to the cells wherein the c.887-2 AYG mutation of the TGM1 gene need to be edited. In one aspect the invention relates to an in vitro method for modifying a c.877-2 A>G mutation of the TGM1 gene, comprising administering an oligonucleotide or a gene editing system to a cell in which the TGM1 c.877-2 A>G mutation is to be modified. All features described in the present specification may be employed to define any other embodiment or aspect of the invention, for example, features used to describe the oligonucleotide may be used to describe the gene editing system, the pharmaceutical composition or the method for modifying a c.877-2 A>G mutation of the TGM1 gene, and vice versa. Similarly, features used to describe the methods of the invention may be used to describe the oligonucleotides, gene editing systems or compositions, and vice versa. SEQUENCES Any of the sequences provided in the table below, any combination of sequences may represent an embodiment of the invention and / or be employed in any of the aspects or embodiments of the invention described herein. Table 1a: Preferred sequences of the invention Within the table the changes in the HDR-template in comparison to the target region of the TGM1 gene according to SEQ ID No.13 are marked. SEQ ID Sequence (5‘ to 3‘) Comment No. 1 CGGAAGGAGGGATGGAGGGC sgRNA Position of C: p1 Potential PAM: NGAN (4-11), NGAG (4-11), NNNRRT (3-12), NGNG (4- 8), NGN (4-8) 2 CCGGAAGGAGGGATGGAGGG sgRNA Position of C: p2 Potential PAM: NRRH (4-8) 3 ACCGGAAGGAGGGATGGAGG sgRNA Position of C: p3 4 AACCGGAAGGAGGGATGGAG sgRNA Position of C: p4 Potential Base editor: BE4max-NG, AncBE4-max Potential PAM: NRCH (4-8), NG (4-8) 5 AAACCGGAAGGAGGGATGGA sgRNA Position of C: p5 Potential Base editor: BE4max, BE4max-NG, YE1-BE4max, AncBE4-max, YE2-BE4max, EE-BE4max, YEE-BE4max Potential PAM: NGG, NG, NGN, NRRH 6 CAAACCGGAAGGAGGGATGG sgRNA Position of C: p6 Potential Base editor: BE4max, BE4max-NG, YE1-BE4max, AncBE4-max, Td-CBEs, YE2-BE4max, EE-BE4max, YEE-BE4max Potential PAM: NGG, NG, NGNG, NGN 7 TCAAACCGGAAGGAGGGATG sgRNA Position of C: p7 Potential PAM: NAN 8 GTCAAACCGGAAGGAGGGAT sgRNA Position of C: p8 Potential PAM: NGNG, NG, NGN 9 CCCGTGGTCAAACCGGAAGG sgRNA, HDR 10 CACCCCGTGGTCAAACGGGA sgRNA, HDR 11 TGGGTGTGGGGGCTGGGGTATTGGAGCAGGGTGC ssDNA, TGGCCTAGGGTTCAGGCTGTCACCTCTGCCCTCCA HDR donor template TCCCTGCTTCCAGTTTGACCACGGGGTGCTGGATG CCTGCTT 12 AAGCAGGCATCCAGCACCCCGTGGTCAAAccggaagg TGM1 gene DNA section agggatggagggcagaggtgacagcctgaaccctaggccagcaccctgc (non-coding strand) tccaataccccagcccccacaccca 13 TGGGTGTGGGGGCTGGGGTATTGGAGCAGGGTGC TGM1 gene DNA section TGGCCTAGGGTTCAGGCTGTCACCTCTGCCCTCCA (coding strand) TCCCTCCTTCCGGTTTGACCACGGGGTGCTGGATG CCTGCTT Table 1b: Additional sgRNA and sequence information for C at p4 AACCGGAAGGAGGGATGGAG (SEQ ID NO 4) Name Deaminase Cas nuclease PAM Editing window BE4-max-NG rAPOBEC1 nCas9-NG (D10A) NG 4–8 AncBE4-max-NG rAPOBEC1 nCas9-NG (D10A) NG 4–8 for C at p5 AAACCGGAAGGAGGGATGGA (SEQ ID NO 5) Name Deaminase Cas nuclease PAM Editing window YE2-BE3 rAPOBEC1-YE2 nCas9 (H840A) NGG 5–6 EE-BE3 rAPOBEC1-EE nCas9 (H840A) NGG 5–6 YEE-BE3 rAPOBEC1-YEE nCas9 (H840A) NGG 5–6 eAID-BE4max hAID nCas9 (D10A) NGG 4–8 BE4-max rAPOBEC1 nCas9 (D10A) NGG 4–8 AncBE4-max rAPOBEC1 nCas9 (D10A) NGG 4–8 YE2-BE4-NG rAPOBEC1-YE2 nCas9-NG (D10A) NG 5–8 EE-BE4-NG rAPOBEC1-EE nCas9-NG (D10A) NG 5–8 YEE-BE4-NG rAPOBEC1-YEE nCas9-NG (D10A) NG 5–8 R33A+ K34A-BE4-NG rAPOBEC1-R33A / K34A nCas9-NG (D10A) NG 5–8 xCas9-BE SpCas9 NGN 4–8 SpCas9-NRRH-BE SpCas9 NRRH 4–8 for C at p6 CAAACCGGAAGGAGGGATGG (SEQ ID NO 6) Name Deaminase Cas nuclease PAM Editing window BE4-max rAPOBEC1 nCas9 (D10A) NGG 4–8 AncBE4-max rAPOBEC1 nCas9 (D10A) NGG 4–8 Td-CBEs eTd-CBE, eTd-CBE- nCas9 (D10A) NGG 6–7 A48M, eTd-CBE-P29A EQR-BE SpCas9 NGNG 4–8 xCas9-BE SpCas9 NGN 4–8 Table 1b: Primers and probes used in the examples below SEQ ID Sequence (5‘ to 3‘) Comment No. 14 CAGGGTCACATACACCCAGAGGAG Primer Forward, TGM1-E5 15 GAGGGAGACCCCTTCCTGAAGTATC Primer Reverse, TGM1-E5 16 AAGTGCCTTGTCTGTAGTGTC Primer forward HPRT drop-off qPCR assay 17 ATTTCATCCGTGCTGAGTGT Primer reverse HPRT drop-off qPCR assay 18 5HEX-CACCCAAGG-ZEN- Control probe AAAGACTATGAAATGGAGAGC-3IABkFQ HPRT drop-off qPCR assay 56-FAM-CC+CTT+C+C+T+AGT+AA-3IABkFQ Drop-off probe HPRT drop-off qPCR assay 19 AATTATGGGGATTACTAGGA sgRNA for HPRT drop-off qPCR assay DETAILED DESCRIPTION As described in detail herein, the invention relates to oligonucleotides and their use in the prevention and or treatment of medical conditions associated with a c.877-2 A>G mutation of the TGM1 gene. Oligonucleotides The term “oligonucleotide” refers to an oligomer or polymer of nucleic acids with its ordinary meaning in the art, including without limitation ribonucleic acid (RNA) or deoxyribonucleic acid (DNA) or any mimetic or structurally modified nucleic acid thereof, including, without limitation DNA, messenger RNA (mRNA), RNA, genomic RNA (gRNA), transfer RNA (tRNA), ribosomal RNA (rRNA), microRNA (miRNA), small interfering RNA (siRNA), single guide RNA (sgRNA), piwi-interacting RNA (piRNA), small nuclear RNA (snRNA), plus strand RNA (RNA(+)), minus strand RNA (RNA(-)), genomic DNA (gDNA), complementary DNA (cDNA), recombinant polynucleotides, branched polynucleotides, plasmids, nucleic acid probes and primers. The term includes, without limitation, single and double stranded oligonucleotides. In embodiments, an oligonucleotide is 5 to 50, preferably 10 to 40, more preferably 10 to 35 nucleotides (nt) in length. Oligonucleotides are typically short but may vary in length. The term oligonucleotide includes oligonucleotides composed of naturally-occurring nucleobases, sugars and covalent internucleoside (backbone) linkages as well as oligonucleotides having non- naturally-occurring portions which function similarly. Such modified or substituted oligonucleotides are often preferred over native forms because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for nucleic acid target and increased stability in the presence of nucleases. In embodiments, oligonucleotides may also include nucleobase (often referred to in the art simply as “base”) modifications or substitutions. As used herein, “unmodified” or “natural” nucleobases include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U). In the context of the present invention, reference to oligonucleotide sequences that use (U) in the context of an RNA sequence may also relate to the DNA counterpart of the sequence, thereby encompassing the same sequence in which (T) is present in place of (U), and vice versa. Oligonucleotides of the invention include oligonucleotides or variants having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to any of the reference sequences described herein, typically where the variant maintains at least one biological activity of the reference sequence. As used herein, "sequence identity", "identity", “sequence homology” or “homology” in the context of two nucleic acid sequences makes reference to a specified percentage of residues in the two sequences that are the same when aligned for maximum correspondence over a specified comparison window, as measured by sequence comparison algorithms or by visual inspection. As used herein, "percent (%) sequence identity", “sequences with % identity”, “percent (%) sequence homology” or “sequences with % homology” to a specific “reference sequence” (e.g., to SEQ ID No 1) means the percentage of nucleotides in a certain sequence that are identical with the nucleotides of the reference sequence and is determined by comparing the two optimally aligned sequences over a comparison window wherein the portion of the polynucleotide sequences in the comparison window may include additions or deletions (i.e., gaps) as compared to the reference sequence (which does not include additions or deletions) for optimal alignment of the two or more sequences. The percentage is calculated by determining the number of positions at which the identical nucleic acid base occurs in the two or more sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison, and multiplying the result by 100 to yield the percentage of sequence identity. In embodiments, the window of comparison of two sequences comprises the entire oligonucleotide sequence of the reference sequence (the entire length of the sequence), and the number of identical nucleotides is determined between the reference sequence and other sequence of interest within the window. Included are oligonucleotides having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to any of the reference sequences described herein, typically where the oligonucleotide variant maintains at least one biological activity of the reference oligonucleotide. Any suitable methods of alignment of sequences for determination the percent sequence identity may be employed and are known to a person skilled in the art. The determination of percent identity between any two or more sequences can be accomplished using a publicly available mathematical algorithm. Computer software implementations of these mathematical algorithms include but are not limited to: ClustalW algorithm (VNTI software, InforMax Inc.), ALIGN (Version 2.0), GAP (Genetics Computer Group, software; now available via Accelrys on http: / / www.accelrys.com), BESTFIT, BLAST®, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Version 8 (available from Genetics Computer Group (GCG), Madison, Wis., USA) and Multiple sequence alignments MUSCLE (EMBL’s European Bioinformatics Institute (EMBL-EBI), Cambridgeshire, UK). Alignments using these programs can be performed using the default parameters. Software for performing BLAST® analyses is publicly available through the National Center for Biotechnology Information. A sequence database can be searched using the nucleic acid sequence of interest. Algorithms for database searching are typically based on the BLAST software (Altschul et al., 1990). In some embodiments, the percent homology or identity can be determined along the full-length of the nucleic acid. An oligonucleotide “targeted” to any given nucleic acid region (target region) such as a region of the TGM1 gene according to SEQ ID No.13 comprising thec.877-2 A>G mutation refers to an oligonucleotide capable of specifically binding to (or hybridizing) to the particular target nucleic acid sequence or a part thereof. Specific binding does not refer to absolute absence of binding to other targets. Although some cross-specificity may be found, whereby a nucleotide may bind to additional sequences than the preferred target sequence, the specific binding is considered to encompass binding events that occur more preferentially under either in vivo or in vitro conditions compared to binding to other target sequences. With respect to the preferred oligonucleotides of the invention, it is preferred to target a specific region (target region) of a gene, preferably the transglutaminase-1 (TGM1) gene. In the present invention, the target region is a region of the TGM1 gene according to SEQ ID No.13 comprising thec.877-2 A>G mutation (also termed mutation site). As used herein the term "hybridizing" (also referred to as “binding”) refers to a reaction in which one or more polynucleotides react to form a complex that is stabilized via hydrogen bonding between the bases of the nucleotide residues. The hydrogen bonding may occur by Watson Crick base pairing, Hoogstein binding, or in any other sequence specific manner between complementary nucleoside or nucleotide bases. For example, adenine and thymine are complementary nucleobases which pair through the formation of hydrogen bonds. A sequence capable of hybridizing with a given sequence may be referred to as the "complement" of the given sequence, even if sequence complementarity is only partial. Stringent conditions for hybridization refer to conditions under which a nucleic acid having complementarity to a target sequence predominantly hybridizes with the target sequence, and substantially does not hybridize to non-target sequences. Stringent conditions are generally sequence-dependent and vary depending on several factors. In general, the longer the sequence, the higher the temperature at which the sequence specifically hybridizes to its target sequence. Non-limiting examples of stringent conditions are described in detail in Tijssen (1993), Laboratory Techniques In Biochemistry And Molecular Biology-Hybridization With Nucleic Acid Probes Part I, Second Chapter "Overview of principles of hybridization and the strategy of nucleic acid probe assay", Elsevier, N.Y . Where reference is made to a polynucleotide sequence, then complementary or partially complementary sequences are also envisaged. These are preferably capable of hybridising to the reference sequence under highly stringent conditions. Generally, in order to maximize the hybridization rate, relatively low-stringency hybridization conditions are selected: about 20 to 25° C. lower than the thermal melting point (Tm). The Tm is the temperature at which 50% of specific target sequence hybridizes to a perfectly complementary probe in solution at a defined ionic strength and pH. Generally, in order to require at least about 85% nucleotide complementarity of hybridized sequences, highly stringent washing conditions are selected to be about 5 to 15° C. lower than the Tm. In order to require at least about 70% nucleotide complementarity of hybridized sequences, moderately-stringent washing conditions are selected to be about 15 to 30° C. lower than the Tm. Highly permissive (very low stringency) washing conditions may be as low as 50° C. below the Tm, allowing a high level of mis-matching between hybridized sequences. Those skilled in the art will recognize that other physical and chemical parameters in the hybridization and wash stages can also be altered to affect the outcome of a detectable hybridization signal from a specific level of homology between target and probe sequences. Preferred highly stringent conditions comprise incubation in 50% formamide, 5×SSC, and 1% SDS at 42° C., or incubation in 5×SSC and 1% SDS at 65° C., with wash in 0.2×SSC and 0.1% SDS at 65° C. “Complementary,” as used herein, refers to the capacity for pairing between two nucleotides. For example, if a nucleotide at a certain position of an oligonucleotide is capable of hydrogen bonding with a nucleotide at the same position of a DNA or RNA molecule, then the oligonucleotide and the DNA or RNA are considered to be complementary to each other at that position. The oligonucleotide and the DNA or RNA are complementary to each other when a sufficient number of corresponding positions in each molecule are occupied by nucleotides which can hydrogen bond with each other. Thus, “specifically hybridizable” and “complementary” are terms which are used to indicate a sufficient degree of complementarity or precise pairing such that stable and specific binding occurs between the oligonucleotide and the DNA or RNA target. Oligonucleotides of the invention which hybridize to a target are identified through experimentation, and the sequences of these compounds are herein identified as preferred embodiments of the invention. The target sites to which these preferred sequences are complementary may herein be referred to as “target region” and are therefore preferred sites for targeting. Therefore, another embodiment of the invention encompasses compounds which hybridize to these target regions, preferably a target region of the TGM1 gene according to SEQ ID No.13. In embodiments, the term “hybridizing” refers to a single guide RNA (sgRNA) molecule that is designed in a way that enables hybridization to a selected target region under the respective experimental conditions, under which the sgRNA is used. A skilled person is aware of the design criteria for such sgRNAs. Reports in the literature indicate that less than 100% sequence identity between the sgRNA and the target sequence may be tolerated or even beneficial to the overall efficiency of base editing, depending on the target sequence. The efficiency of base editing with relation to the position of mismatches between guide RNA and target can be determined without undue effort. For example, mismatches between the seed region of the sgRNA (the region that interacts directly with the target site) and the target site can have a substantial impact on outcome of base editing, but are not necessarily detrimental. For example, at the 5’ distal end from the PAM position (positions 2-6), mismatches of up to two nucleotides are generally well tolerated and occasionally improve base editing efficiency (refer Zhao et al, “Imperfect guide-RNA (igRNA) enables CRISPR single-base editing with ABE and CBE” Nucleic Acids Res.2022 Apr 22;50(7):4161-4170) and can reduce bystander editing (refer Chen et al, “Genomic allele-specific base editing with imperfect gRNA” J Genet Genomics.2023 Oct;50(10):799-802). Additionally, it has been shown that the mismatch tolerance of base editors can vary depending in part on the addition of fidelity variants to the cas9 enzyme component of the base editor (Tálas et al “BEAR reveals that increased fidelity variants can successfully reduce the mismatch tolerance of adenine but not cytosine base editors”. Nat Commun.12, 6353, 2021). Based on the potential benefits of including 1 or 2 mismatches within the seed region of the sgRNA, a sequence identity of 80% or more (for example 16 / 20, 17 / 20, 18 / 20, or 19 / 20 nucleotides) within a seed region of a sgRNA remains plausible to effect gene editing using the base editors and sgRNAs described herein. Gene editing: Gene editing is a type of genetic engineering in which DNA is inserted, deleted or replaced in the genome of a living organism by manipulated nucleases, such as an RNA-guided endonuclease such as the CRISPR / Cas system, a base editor or a prime editor. These nucleases either modify one or more nucleotides or generate site-specific double-strand breaks (DSBs) at desired sites in the genome. In the context of the present invention, the term “double strand break” or “DSB” refers to interruption of both strands of a dsDNA molecule leading to the separation of the parts of the dsDNA molecule that lie upstream and downstream of the side of the double strand break. The induced double-strand breaks are repaired by non-homologous end compound (HEJ) or homologous recombination (HR), resulting in targeted mutations ("edits"). The term “upstream” refers to a position within a sequence towards the 5’ end of the sequence and the term “downstream” refers to a position within a sequence towards the 3’ of the sequence. In the context of the present invention, the term “modifying” a c.877-2 A>G mutation of the TGM1 gene refers to any kind of alteration, modification or change of the gene. In particular, modifying relates to replacing or substituting one or one or more nucleotides or pairs of nucleotides or nucleotide sequences from the gene, preferably from a target region of the gene according to SEQ ID No.13. The term “replacement” or "substitution" in the sense of “replacing a sequence of the target region of the TGM1 gene”, as used herein, is defined in accordance with the pertinent art and refers to the replacement of one or more (such as a sequence) of nucleotides with other nucleotides. The term includes for example the replacement or modification (e.g., by a base editor) of single nucleotides resulting in point mutations. Said point mutations can lead to an amino acid exchange in the resulting protein product. Also encompassed by the term "substitution" are mutations resulting in the replacement of multiple nucleotides (a nucleotide sequence). The number of nucleotides that replace the originally present nucleotides may be the same or different (i.e. more or less) as compared to the number of nucleotides removed. Preferably, the number of replacement nucleotides corresponds to the number of originally present nucleotides that are substituted. In the context of the present invention, the term “RNA guided endonuclease” refers to DNA endonucleases that interact with at least one RNA-Molecule. In the context of the present invention the terms RNA guided DNA endonuclease and RNA guided endonuclease are used interchangeably. DNA endonucleases are enzymes that cleave the phosphodiester bond within a DNA polynucleotide chain. In case of RNA guided DNA endonuclease the interacting RNA- oligonucleotide may guide the RNA guided DNA endonuclease to the site or location in a DNA where the endonuclease becomes active. In particular, the term RNA guided DNA endonuclease refers to naturally occurring or genetically modified Cas nuclease components or CRISPR-Cas systems, which include, without limitation, multi-subunit Cas protein effectors of class 1 CRISPR- Cas systems as well as single large effector Cas proteins of class 2 systems. In the context of the invention, the RNA guiding the DNA endonuclease to the target region / target site / target sequence is a guide RNA, preferably a single guide RNA (sgRNA). CRISPR is an abbreviation of Clustered Regularly Interspaced Short Palindromic Repeats and is a family of DNA sequences in bacteria. The sequences contain snippets of DNA from viruses that have attacked the bacterium. These snippets are used by the bacterium to detect and destroy DNA from further attacks by similar viruses. These sequences play a key role in a bacterial defense system, and form the basis of a technology known as CRISPR / Cas that effectively and specifically changes genes within organisms. Sequences of the CRISPR loci are transcribed and processed into CRISPR RNAs (crRNAs) which, together with a trans-activating crRNAs (tracrRNAs), complex with CRISPR-associated (Cas) proteins to dictate specificity of DNA cleavage by Cas nucleases through Watson-Crick base pairing between nucleic acids (Wiedenheft, B et al (2012). Nature 482: 331–338; Horvath, P et al (2010). Science 327: 167– 170; Fineran, PC et a. (2012). Virology 434: 202–209). It was shown that the three components required for the type II CRISPR nuclease system are the Cas9 protein, the mature crRNA and the tracrRNA, which can be reduced to two components by fusion of the crRNA and tracrRNA into a single guide RNA (sgRNA) and that re-targeting of the Cas9 / sgRNA complex to new sites could be accomplished by altering the sequence of a short portion of the gRNA (Garneau, JE et al (2010). Nature 468: 67–71; Deltcheva, E et al. (2011). Nature 471: 602–607, Jinek, M et al (2012) Science 337: 816–821). CRISPR-Cas systems are RNA-guided adaptive immune systems of bacteria and archaea that provide sequence-specific resistance against viruses or other invading genetic material. This immune-like response has been divided into two classes on the basis of the architecture of the effector module responsible for target recognition and the cleavage of the invading nucleic acid (Makarova KS et al. Nat Rev Microbiol.2015 Nov; 13(11):722-36.). Class 1 comprises multi- subunit Cas protein effectors and Class 2 consists of a single large effector protein. Both Class 1 and 2 use CRISPR RNAs (crRNAs) to guide a Cas nuclease component to its target site where it cleaves the invading nucleic acids. Due to their simplicity, Class 2 CRISPR-Cas systems are the most studied and widely applied for genome editing. The most widely used CRISPR-Cas system is CRISPR-Cas9. It was demonstrated that the CRISPR / Cas9 system could be engineered for efficient genetic modification in mammalian cells. The only sequence limitation of the CRISPR / Cas system appears to derive from the necessity of a protospacer-adjacent motif (PAM) located immediately 3’ to the target site. The PAM sequence is specific to the species of Cas9. For example, the PAM sequence 5’-NGG-3’ is necessary for binding and cleavage of DNA by the commonly used Cas9 from Streptococcus pyogenes. However, Cas9 variants with novel PAMs have been and may be engineered by directed evolution, thus dramatically expanding the number of potential target sequences. Cas9 complexed with the crRNA and tracrRNA (e.g., fused into a single guide RNA) undergoes a conformational change and associates with PAM motifs throughout the genome interrogating the sequence directly upstream to determine sequence complementarity with the gRNA. The formation of a DNA-RNA heteroduplex at a matched target site allows for cleavage of the target DNA by the Cas9-RNA complex. These methods and mechanisms are well known in the art. Upon binding of the Cas9-RNA complex (preferably comprising a sgRNA) to the target site / target sequence of a dsDNA to be modified, an RNA / DNA Cas9 complex is formed. As known in the art, CRISPR / Cas9 has been exploited to develop potent tools for genome manipulation in animals, plants and microorganisms. By the guide RNA the RNA-guided Cas9 endonuclease first recognizes a 2- to 4-base-pair conserved sequence named the protospacer- adjacent motif (PAM), which flanks a target DNA site (target sequence also termed target region). Upon binding to the PAM, Cas9 interrogates the flanking DNA sequences for base-pairing complementarity to a guide RNA. If there is complementarity between the first 12 base pairs (the ‘seed’ sequence) of the guide RNA and the target DNA strand, RNA strand invasion accompanies local DNA unwinding to form an R-loop. Precise cleavage of each DNA strand by the RuvC and HNH domains of Cas9 generates a blunt double-strand DNA (dsDNA) break (DSB) at a position three base pairs upstream of the 3′ edge of the protospacer sequence, measuring from the PAM. CRISPR / Cas9 genome-editing experiments have been exploiting the host cell machinery to repair the genome precisely at the site of the Cas9-generated DSB. Mutations can arise either by non- homologous end joining (NHEJ) or homology-directed repair (HDR) of DSBs. NHEJ can produce small insertions or deletions (INDELs) at the cleavage site, whereas HDR uses a native (or engineered) DNA template to replace the targeted allele with an alternative sequence by recombination. Additional DNA repair pathways such as single-strand annealing, alternative end joining, microhomology-mediated joining, mismatch and base- and nucleotide-excision repair can also produce genome edits. Cas9, also named Csn1 is a large protein that participates in both crRNA biogenesis and in the destruction of invading DNA. Cas9 has been described in different bacterial species such as S. thermophilus (Sapranauskas, Gasiunas et al.2011), listeria innocua (Gasiunas, Barrangou et al. 2012; Jinek, Chylinski et al.2012) and S. Pyogenes (Deltcheva, Chylinski et al.2011). The large Cas9 protein (>1200 amino acids) contains two predicted nuclease domains, namely HNH (McrA- like) nuclease domain that is located in the middle of the protein and a splitted RuvC-like nuclease domain (RNase H fold) (Haft, Selengut et al.2005; Makarova, Grishin et al.2006). In wild-type Cas9, these two domains result in blunt cleavage of the invasive DNA within the same target sequence (proto-spacer) in the immediate vicinity of the PAM (Jinek, Chylinski et al.2012). Details of the technical application of CRISPR / Cas systems and suitable RNA guided endonuclease are known to the skilled person and have been described in detail in the literature, as for example by Barrangou R et al. (Nat Biotechnol.2016 Sep 8;34(9):933-941), Maeder ML et al. (Mol Ther.2016 Mar;24(3):430-46) and Cebrian-Serrano A et al. (Mamm Genome.2017; 28(7): 247–261). Any RNA guided DNA endonuclease known in the art may be employed in accordance with the present invention. A suitable RNA guided DNA endonuclease may be selected from the group comprising, without limitation, Cas proteins of class 1 CRISPR-Cas systems, such as Cas3, Cas8a, Cas5, Cas8b, Cas8c, Cas10d, Cse1, Cse2, Csy1, Csy2, Csy3, GSU0054, Cas10, Csm2, Cmr5, Csx11, Csx10 and Csf1; Cas proteins of class 2 CRISPR-Cas systems, such as Cas9, Csn2, Cas4, Cpf1, C2c1, C2c3 and C2c2; corresponding orthologous enzymes / CRISPR effectors from various bacterial and archeal species; engineered CRISPR effectors with for example novel PAM specificities such as SpCas9-NG, increased fidelity, such as SpCas9-HF1 / eSpCas9, or altered functions. Particularly preferred are RNA guided DNA endonuclease selected from the group comprising Streptococcus pyogenes Cas9 (SpCas9), Staphylococcus aureus Cas9, Streptococcus thermophilus Cas9, Neisseria meningitidis Cas9 (NmCas9), Francisella novicida Cas9 (FnCas9), Campylobacter jejuni Cas9 (CjCas9), Cas12a (Cpf1) and Cas13a (C2C2) (Makarova KS et al. (November 2015). Nature Reviews Microbiology.13 (11): 722–36). The definition and explanations provided herein are mainly focused on the Cas9 Crispr / Cas system. However, the person skilled in the art is aware of how to use alternative Crispr / Cas systems as well as tools and methods that provide or allow the gain of information on the details of such alternative systems. Homology directed repair (HDR) is a mechanism in cells to repair double-strand DNA lesions. The most common form of HDR is homologous recombination. The HDR mechanism can only be used by the cell when there is a homologous piece of DNA present in the nucleus. Other examples of homology-directed repair include single-strand annealing and breakage-induced replication. When the homologous DNA is absent, non-homologous end joining (NHEJ) takes place instead. In proliferating cells, HDR is mediated by the homologous recombination (HR) pathway, wherein the native pathway uses the intact homologous sequences of sister chromatids as template for the repair of DSB sites and leads to the reconstitution of the wild-type allele. It has been shown in the art that it is possible to achieve precise sequence modifications at targeted DSBs. Therefore, the HR pathway can be co-opted by providing an exogenous DNA donor template (may also be referred to as a repair template or homology directed repair (HDR)-template) containing sequence regions homologous the DSB ends. The sequence between the homologous ends, either an insertion or replacement, is then transferred into the targeted locus during HR, enabling the generation of precisely modified ‘knockin’ alleles, e.g., for codon replacements or the insertion of reporter genes. HDR-mediated DSB repair is a well-established process or mechanism that is known to the person skilled in the art and have been described by Danner et al. (Mamm Genome 28, 262-274). As used herein the terms “HDR template” refers to an exogenous DNA molecule that is introduced into the cell and that comprises a sequence to be integrated into a target region of the TGM1 gene according to SEQ ID No.13. In the context of the present invention, the HDR template replaces a DNA sequence of the target region of the TGM1 gene according to SEQ ID No.13. In preferred embodiments, the sequence to be replaced is a mutated sequence resulting in a functionally impaired or inactive gene product, and the HDR template sequence comprises a corrected / functional version of the respective sequence, so that replacement of the mutated sequence by the template sequence leads to expression of a functional gene product. The term “base editor” refers to a fusion protein consisting of catalytically impaired RNA guided endonuclease such as a Cas protein (such as dCas9, dCas12 or nCas9) linked to a single stranded DNA (ssDNA)- specific nucleobase modifying enzyme such as a deaminase (e.g., rat cytosine deaminase APOBEC1 (rAPOBEC) or a mutated E. coli tRNA adenosine deaminase (TadA)). A deaminase introduces single nucleotide polymorphisms (SNPs) by chemically altering the target DNA sequence without the intentional generation of a DNA double-strand break (DSB). The base editor is targeted to a specific DNA target region by a guide RNA. Upon localization of the base editor to the target region, hybridization of the guide RNA to its complementary DNA sequence comprising the PAM region displaces and exposes a small stretch of ssDNA at the PAM-distal region of the non-complementary strand of the target region. This exposure allows the ssDNA modifying enzyme to gain access to and chemically modify its target base within this ssDNA window. The area of the target region in which bases can be modified is called base editing window. Depending on the base editor the base editing window is 3 to 15 nucleotides in length, such as 3, 4, 5, 6, 7, 8, 9, 10, 11 ,12, 13, 14 or 15 nucleotides in length. To date two classes of base editors have been developed, including cytosine base editors (CBE) and adenine base editors (ABE). Cytosine base editors mediate a change from cytosine (C) to thymine (T) via the deamination of deoxycytidine to deoxyuridine, which has binding properties similar to deoxythymidine. Adenine base editors mediate a change from adenine (A) to guanine (G) via the deamination of deoxyadenosine to form deoxyinosine, which has binding properties similar to deoxyguianine. Deoxyuridine and deoxyinosine are recognized as DNA lesions by the cell and repaired by cellular DNA repair mechanisms, resulting in the formation of a T:A base pair subsequent to editing by a CBE and the formation of a G:C base pair subsequent to editing by a ABE. Within first generation cytosine base editors (BE1) usually a catalytically impaired dCas9 protein is linked to a desaminase. The first generation of base editors encountered low base editing efficiency. As CBEs mediate the deamination of cytosines, generating an uracil (U) base, recognized as thymine by the cell’s DNA polymerases. However, uracil can be recognized and eliminated by the enzyme uracil DNA N-glycosylase (UNG) during the initiation of BER, resulting in less C to T edits and increased C to A or C to G edits. Second generation cytosine base editors (BE2) additionally comprise an uracil glycosylase inhibitor (UGI) fused to the base editor. UGI inhibits the action of UNG, thus conserving the uracil base and achieving higher editing efficiency and purity. In third generation base editors (BE3) instead of a catalytically dead Cas 9 (dCas9) protein the nickase Cas9n is used, introducing a nick on the non-modified DNA strand. This nick serves to bias the cellular repair mechanisms to preferentially replace this strand and use the mutagenic intermediate as a template for repair, thus increasing editing efficiency. Fourth generation cytosine base editors (BE4) comprise an additional copy of UGI, thus further reducing C-to G or C to A conversions due to UNG. Any cytosine base editor known in the art may be employed in accordance with the present invention. A suitable cytosine base editor may be selected from the group comprising, without limitation, A3G-BE, A3G-BE5.14, Target-AID, Target-AIDmax, Target-AID-NG, SpCas9- TadCBEa, SpCas9-TadCBEb, SpCas9-TadCBEc, SpCas9-TadCBEd, SpCas9-TadCBEe, SpCas9-TadCBEa-V106W, SpCas9-TadCBEd-V106W, SpCas9-TadCBEd-N108Q / L145T, SpRY- Cas9, SpCas9-TadCBEd-V106W / N108Q / L145T, BE4max-NG, BE4max-NRCH, AncBE4-max- NG, YE2-BE3, EE-BE3, YEE-BE3, eAID-BE4max, BE4-max, AncBE4-max, YE2-BE4-NG, EE- BE4-NG, YEE-BE4-NG, R33A+ K34A-BE4-NG, xCas9-BE, SpCas9-NRRH-BE, Td-CBEs and EQR-BE A nickase (or nicking enzyme or nicking endonuclease) is an enzyme that cuts one strand of a double-stranded DNA at a specific recognition nucleotide sequences known as a restriction site. Such enzymes hydrolyse (cut) only one strand of the DNA duplex, to produce DNA molecules that are “nicked”, rather than cleaved. Over 200 nicking enzymes have been studied, and 13 of these are available commercially and are routinely used for research and in commercial products. Nickases can be and have been generated by mutating the nuclease domains of Cas9 independently of each other to create DNA nickase capable of introducing a single-strand cut with the same specificity as a regular CRISPR / Cas9 nuclease (Gasiunas G, Barrangou R, Horvath P, Siksnys V. Cas9-crRNA ribonucleoprotein complex mediates specific DNA cleavage for adaptive immunity in bacteria. Proc. Natl Acad. Sci. USA 109, E2579–E2586 (2012). The use of Cas9 nickases is essentially the same as the use of the fully functional enzyme. Cas9 nickase is created by mutating one of two Cas9 nuclease domains. Cas9 nickase creates a single-strand rather than a double-strand break. For example, the D10A mutation inactivates the RuvC domain, so this nickase cleaves only the target strand. Conversely, the H840 mutation in the HNH domain creates a non-target strand-cleaving nickase. Instead of cutting both strands bluntly with WT Cas9 and one gRNA, a staggered cut using a Cas9 nickase and two gRNAs. In other words, in RNA guided DNA nickases the naturally occurring endonucleases function of cleaving both strands of a double-stranded target DNA, is altered into an endonuclease that cleaves (i.e. nicks) only one of the strands. Means and methods of modifying RNA guided DNA endonuclease such as Cas9 accordingly are well known in the art, and include for example the introduction of amino acid replacements into Cas9 that render one of the nuclease domains inactive. More specifically, aspartate can be replaced against alanine at position 10 of the Streptococcus pyogenes Cas9 (SpCas9 D10A; Cong et al. (2013) Science 339:819-823). Further examples are known in the art, for example the H840A replacement in SpCas9 (Mali P et al. Nat Biotechnol.2013 Sep; 31(9):833-8; Ran FA et al. Cell.2013 Sep 12; 154(6):1380-9). The term “prime editor” refers to a fusion protein consisting of catalytically impaired RNA guided endonuclease such as a Cas protein (such as dCas9, dCas12 or nCas9) linked to a reverse transcriptase enzyme (such as M-MLV reverse transcriptase). The prime editor is binding to a prime editing guide RNA (pegRNA), also termed extended guide RNA, comprises a primer binding site (PBS) and a reverse transcriptase (RT) template sequence. Similar to a guide RNA, the primer binding site hybridizing to a target region such as a region of the TGM1 gene according to SEQ ID No.13, whereas the RT template sequence provides a template for replacing one or more nucleotides of the target region. The prime editing system of prime editor and pegRNA mediates targeted insertions, deletions, and base-to-base conversions without the need for double strand breaks (DSBs) or donor DNA templates such as a HDR template. Once bound to the target region, the fusion protein nicks the target DNA sequence (nicking site), exposing a 3’-hydroxyl group that initiates (prime) the reverse transcription of the RT template portion of the pegRNA. This results in a branched intermediate that contains two DNA flaps: a 3’ flap that contains the newly synthesized (edited) sequence, and a 5’ flap that contains the dispensable, unedited DNA sequence. The 5’ flap is then cleaved by structure-specific endonucleases or 5’ exonucleases. This process allows 3’ flap ligation, and creates a heteroduplex DNA composed of one edited strand and one unedited strand. The reannealed double stranded DNA contains nucleotide mismatches at the location where editing took place. In order to correct the mismatches, the cells exploit the intrinsic mismatch repair mechanism, with two possible outcomes: (i) the information in the edited strand is copied into the complementary strand, permanently installing the edit; (ii) the original nucleotides are re-incorporated into the edited strand, excluding the edit. In order to reduce option (ii) an additional single guide RNA (nicking guide RNA, ngRNA) can be introduced (third generation prime editors, Prime editor 3, PE3), which is designed to match the edited sequence introduced by the pegRNA. It directs the Cas9 nickase portion of the fusion protein to nick the unedited strand at a nearby site, opposite to the original nicking site, thereby favouring the repair of the unedited strand. A “guide RNA” refers to RNA molecules interacting with RNA guided endonucleases, base editors or prime editors, leading to the recognition of the target sequence to be cleaved by the RNA guided endonuclease or edited by the base editor or prime editor. According to the present invention, the term “guide RNA” therefore comprises, without limitation, target sequence specific CRISPR RNAs (crRNA), trans-activating crRNAs (tracrRNA), single guide RNAs (sgRNA) and prime editing guide RNA (pegRNA). A person skilled in the art knows tools to design guide RNAs such as sgRNAs and pegRNA suitable for use in the gene editing techniques according to the present invention. For example, pegRNAs can be designed without undue burden by using the prime design tool (Hsu, J.Y., Grünewald, J., Szalay, R. et al. PrimeDesign software for rapid and simplified design of prime editing guide RNAs. Nat Commun 12, 1034 (2021). https: / / doi.org / 10.1038 / s41467-021-21337-7). In accordance with the method of the invention, the RNA guided endonuclease, base editor or prime editor may be introduced as a protein, but alternatively the RNA guided endonuclease, base editor or prime editor may also be introduced in form of a nucleic acid encoding said protein. It will be appreciated that the nucleic acid encodes said RNA guided endonuclease, base editor or prime editor in expressible form such that expression in the cell results in a functional the RNA guided endonuclease, base editor or prime editor protein such as Cas9 protein, BE4max-NG base editor or BE4max-NRch base editor. Means and methods to ensure expression of a functional polypeptide are well known in the art. In embodiments the RNA guided endonuclease, base editor or prime editor is introduced as an mRNA encoding said protein. As used herein “nucleic acid” shall mean any nucleic acid molecule, including, without limitation, DNA, RNA and hybrids or modified variants thereof. An “exogenous nucleic acid” or “exogenous genetic element” relates to any nucleic acid introduced into the cell, which is not a component of the cells “original” or “natural” genome. The nucleic acids used in accordance with the invention may be nucleic acid mimicking molecules known in the art such as synthetic or semi-synthetic derivatives of nucleic acid molecules and mixed polymers. They may contain additional non-natural or derivatized nucleotide bases, as will be readily appreciated by those skilled in the art. Nucleic acid mimicking molecules or nucleic acid derivatives according to the invention include, without being limiting, phosphorothioate nucleic acid, phosphoramidate nucleic acid, morpholino nucleic acid, hexitol nucleic acid (HNA), peptide nucleic acid (PNA) and locked nucleic acid (LNA). lt will be readily appreciated by the skilled person that more than one nucleic acid may encode an RNA guided endonuclease, base editor or prime editor in accordance with the present invention due to the degeneracy of the genetic code. Degeneracy results because a triplet code designates 20 amino acids and a stop codon. Because four bases exist which are utilized to encode genetic information, triplet codons are required to produce at least 21 different codes. The possibilities for bases in triplets give 64 possible codons, meaning that some degeneracy must exist. As result, some amino acids are encoded by more than one triplet, i.e., by up to six. The degeneracy mostly arises from alterations in the third position in a triplet. This means that nucleic acid molecules having different sequences, but still encoding the same RNA guided DNA endonuclease, base editor or prime editor, can be employed in accordance with the present invention. The nucleic acids used in accordance with the present invention may be of natural as well as of (semi) synthetic origin. Thus, the nucleic acids may, for example, be nucleic acids that have been synthesized according to conventional protocols of organic chemistry. The person skilled in the art is familiar with the preparation and the use of said probes (see, e.g., Sambrook and Russel "Molecular Cloning, A Laboratory Manual", Cold Spring Harbor Laboratory, N.Y. (2001)). In embodiments, the nucleic acids encoding for the RNA guided endonuclease, base editor or prime editor, in the context of the present invention includes nucleic acids, preferably mRNA, containing modified backbones, non-natural internucleoside linkages, modified nucleotides, a poly-(A)-tail and / or untranslated regions (UTRs). The invention encompasses nucleic acids with at least one structural modification that provides improved stability, reduced immunogenicity and / or half-life of said nucleic acid molecule post-administration in a cell and / or organism compared to a structurally unmodified nucleic acid of the same sequence. Preferred modified oligonucleotide backbones include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates. Various salts, mixed salts and free acid forms are also included. In some embodiments of nucleic acid variants, both the sugar and the internucleoside linkage, i.e., the backbone, of the nucleotide units are replaced with non-natural groups. The base units are maintained for hybridization with an appropriate nucleic acid target compound. One such oligomeric compound, an oligonucleotide mimetic that has been shown to have excellent hybridization properties, is referred to as a peptide nucleic acid (PNA). In PNA compounds, the sugar-backbone of an oligonucleotide is replaced with an amide containing backbone, in particular an aminoethylglycine backbone. The nucleobases are retained and are bound directly or indirectly to aza nitrogen atoms of the amide portion of the backbone. Representative United States patents that teach the preparation of PNA compounds include, but are not limited to, U.S. Pat. Nos.: 5,539,082; 5,714,331; and 5,719,262 A further modification includes Locked Nucleic Acids (LNAs) in which the 2'-hydroxyl group is linked to the 3' or 4' carbon atom of the sugar ring thereby forming a bicyclic sugar moiety. The linkage is preferably a (-CH2-)n group bridging the 2' oxygen atom and the 4' carbon atom wherein n is 1 or 2. LNAs and preparation thereof are described in WO 98 / 39352 and WO 99 / 14226. Modified nucleobases include other synthetic and natural nucleobases such as N’- methylpseudouridine, 5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2- propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2- thiocytosine, 5-halouracil and cytosine, 5-propynyl (-C≡C-CH3) uracil and cytosine and other alkynyl derivatives of pyrimidine bases, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8- substituted adenines and guanines, 5-halo particularly 5-bromo, 5-trifluoromethyl and other 5- substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 2-F-adenine, 2-amino- adenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-deazaadenine and 3- deazaguanine and 3-deazaadenine. Further modified nucleobases include tricyclic pyrimidines such as phenoxazine cytidine(1H-pyrimido[5,4-b][1,4]benzoxazin-2(3H)-one), phenothiazine cytidine (1H-pyrimido[5,4-b][1,4]benzothiazin-2(3H)-one), G-clamps such as a substituted phenoxazine cytidine (e.g.9-(2-aminoethoxy)-H-pyrimido[5,4-b][1,4]benzoxazin-2(3H)-one), carbazole cytidine (2H-pyrimido[4,5-b]indol-2-one), pyridoindole cytidine (H- pyrido[3′,2′:4,5]pyrrolo[2,3-d]pyrimidin-2-one). Modified nucleobases may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-deaza- adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone. It is not necessary for all positions in a given nucleic acid to be uniformly modified, and in fact more than one of the aforementioned modifications may be incorporated in a single compound or even at a single nucleoside within a nucleic acid. A skilled person is aware of appropriate methods of nucleic acid synthesis. Modern techniques enable rapid and inexpensive custom-made nucleic acids of a desired sequence. For example, a common process relates to solid-phase synthesis using phosphoramidite method and phosphoramidite building blocks derived from protected 2'-deoxynucleosides (dA, dC, dG, and T), ribonucleosides (A, C, G, and U), or chemically modified nucleosides, e.g. LNA, BNA. To obtain the desired oligonucleotide, the building blocks (modified or naturally occurring) are sequentially coupled to the growing oligonucleotide chain in the order required by the sequence of the product. Upon the completion of the chain assembly, the product is released from the solid phase to solution, deprotected, and collected. Products may be isolated by high-performance liquid chromatography (HPLC) to obtain the desired nucleic acids in high purity, if required. Established techniques and structures for modifying oligonucleotides, which are contemplated for the present invention, comprise, without limitation, 2’-O-Me RNA modified bases with phosphorothioate linkages added to the first and last three nucleotides on the 5’ and 3’ ends of the sgRNA: positions 1-3 and 98-100 (refer Jiang et al “Chemical modifications of adenine base editor mRNA and guide RNA expand its application scope”. Nat Commun 11, 1979 (2020). In other embodiments, hypermodified (sgRNA) oligonucleotides are contemplated, including, without limitation, optionally in addition to the end modifications listed above, sgRNA that has 2’- O-Me RNA modified bases added into the three stem loops within the gRNA structure: positions 29-40 and 69-97(refer Finn et al, “A Single Administration of CRISPR / Cas9 Lipid Nanoparticles Achieves Robust and Persistent In Vivo Genome Editing”. Cell Rep.2018 Feb 27;22(9):2227- 2235). In embodiments, the following oligonucleotide modifications are preferred: Potential gRNAs modifications that can be employed include, without limitation, 2′-O-methylation, 3′- phosphorothioate, 2′-O-methyl-3'phosphorothioate, 2′-O-methyl 3′ thiophosphonoacetate, 4′-O- methyl, 2‘-deoxy-2‘-fluoro, Locked nucleic acid (+ (S)-cEt), Bridged nucleic acid, Unlocked nucleic acid, 2’-O-Methoxyethyl, 2’-Fluorarabino, 2’,5’-RNA, 2’,4’-di-C(alpha)-O-methyl, 2’F-4’-C(alpha)- O-methyl. Considering the above, various formats for delivering the sgRNA and mRNA into target cells is envisaged. For example, in embodiments, the invention may employ a DNA vector expressing the gRNA, a single guide RNA oligonucleotide, which may or may not include modified RNA or DNA bases, a circular RNA oligonucleotide, a self-amplifying RNA oligonucleotide, a circular RNA oligonucleotide, a hairpin guide RNA or self-cleaving guide RNAs (refer Katrekar et al “Efficient in vitro and in vivo RNA editing via recruitment of endogenous ADARs using circular guide RNAs”. Nat Biotechnol.2022 Jun;40(6):938-945, and Kocak et al “Increasing the specificity of CRISPR systems with engineered RNA secondary structures”. Nat Biotechnol.2019 Jun;37(6):657-666, and Tiyaboonchai et al “Self-cleaving guide RNAs enable pharmacological selection of precise gene editing events in vivo”. Nat Commun.2022 Nov 30;13(1):7391). Compositions and mode of treatment: A "pharmaceutical composition" refers to a composition formulated in pharmaceutically- acceptable or physiologically- acceptable solutions for administration to a cell or an animal, either alone, or in combination with one or more other modalities of therapy. It will also be understood that, if desired, the compositions of the invention may be administered in combination with other agents as well, such as, e.g., cytokines, growth factors, hormones, small molecules, chemotherapeutics, pro-drugs, drugs, antibodies, or other various pharmaceutically-active agents. There is virtually no limit to other components that may also be included in the compositions, provided that the additional agents do not adversely affect the ability of the composition to deliver the intended therapy. The term "pharmaceutically acceptable" is employed herein to refer to those compounds, materials, compositions, and / or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit / risk ratio. As used herein "pharmaceutically acceptable carrier, diluent or excipient" includes without limitation any adjuvant, carrier, excipient, glidant, sweetening agent, diluent, preservative, dye / colorant, flavor enhancer, surfactant, wetting agent, dispersing agent, suspending agent, stabilizer, isotonic agent, solvent, surfactant, or emulsifier which has been approved by the United States Food and Drug Administration as being acceptable for use in humans or domestic animals. Pharmaceutical compositions of the present invention may comprise buffers such as neutral buffered saline, phosphate buffered saline and the like; carbohydrates such as glucose, mannose, sucrose or dextrans, mannitol; proteins; polypeptides or amino acids such as glycine; antioxidants; chelating agents such as EDTA or glutathione; adjuvants (e.g., aluminum hydroxide); and preservatives. Compositions of the present invention are preferably formulated for topical administration. Methods for introducing exogenous molecules, e.g., oligonucleotides or nucleic acids encoding for RNA guided endonucleases, base editors or prime editors, into cells are well known to experts and include lipid-mediated transfer (i.e., liposomes and lipid nanoparticles (LNP), including neutral and cationic lipids), electroporation, direct injection, cell fusion, particle bombardment, biopolymer nanoparticles, calcium phosphate co-precipitation, DEAE-dextran-mediated transfer and viral vector-mediated transfer. “Gene transfer”, “nucleic acid transfer”, gene sequence transfer”, “transgene transfer” are used interchangeably. In embodiments, nucleic acids and oligonucleotides constructs are preferably transferred into cells by non-viral vectors and methods such as lipid nanoparticles. In embodiments, the pharmaceutical composition as used herein is configured for delivery by lipofection and / or lipid nanoparticles (LNPs). However, in the context of the present invention the delivery of the synthetic oligonucleotides is not limited to by lipofection and lipid nanoparticles. The oligonucleotide of present invention can be delivered by lipid-like material, polymers and protein derivatives know in the art. In embodiments, the pharmaceutical composition as used herein is configured for peptide-based delivery systems, antibody-based delivery systems or polymer-based delivery system for the delivery of the oligonucleotide. In embodiments of peptide-based delivery systems, the cell- penetrating peptides (CPP) can be used as a carrier-based drug delivery system. The stability of CPP-oligonucleotide nanocomplex is governed by the electrostatic and hydrophobic type of interactions between the cationic peptides and anionic oligonucleotides. In comparison to conjugated CPP-oligonucleotides, peptide-based delivery systems are considerably more amphipathic and incorporate additional chemical alterations to the CPP sequence like hydrophobic fatty acid segments to the CPP sequences that enhance the efficiency of delivery to the target site and stability of the oligonucleotide in the formulation. In embodiments of antibody-based delivery systems, antibodies, apart from being used in their conjugated forms, are also used as carrier delivery systems where the antibodies and antibody fragments are fused with either avidin or protamine groups. Here, antibody–avidin molecules are fused with biotinylated oligonucleotides to achieve target-specific delivery. Various means and methods are enabled for delivering the therapeutic elements of the invention to target cells. Viruses have a natural ability to deliver nucleic acid cargos to various cell types, making them attractive candidates for gene therapy. Many viral vectors, including adeno-associated virus (AAV), lentivirus, adenovirus, vaccinia virus, herpes simplex virus, and poxvirus, have been developed for this purpose and used in clinical trials to deliver therapeutic genes. They have emerged as promising vehicles for delivering gene-editing agents as they mimic the structure of viruses without containing viral genomes, thus combining key advantages of both viral and non-viral vectors. Non-viral vehicles may also be Unlike viral vectors, non-viral vectors do not integrate into the host genome, which reduces the risk of triggering an immune response. They also provide several benefits like the ability to deliver diverse payloads in vivo, tissue targeting, scalability, reproducibility, and cost-efficiency, making them a favoured option for drug delivery. Among the non-viral delivery systems, LNPs are effective for delivering genetic material to various tissues. Compared to viral vectors like AAV, they demonstrate lower immunogenicity and mutagenicity as they do not integrate into the host cell genome. They can carry significant amounts of genetic material and are generally considered safe (e.g., COVID-19 vaccines). Furthermore, the size of mRNA for gene editing tools, such as base editors and prime editors, exceeds the packaging capacity of a single AAV vector system. Polymer based vectors have also shown promising results in cell culture studies. Electroporation, another non-viral delivery system, is highly effective for gene delivery and is mainly used for in vitro or ex vivo applications. It can also be applied in vivo by directly applying electrodes to the target tissue. Extracellular vesicles such as exosomes have also gained attention as potential therapeutic agents for drug delivery due to their natural role in intercellular biomolecule exchange, biocompatibility, biodegradability, and low immunogenicity. Polymer-based systems are carriers of oligonucleotide and nucleic acid therapies, as they confer chemical flexibility, high structural stability and stability during storage, and monomeric sequences and side group functionalities can be engineered. Polylactic-co-glycolic acid (PLGA) is one highly biocompatible copolymer that is being explored. Encapsulation of small anionic oligonucleotides drugs in cationic polymeric nanoparticles can be achieved. For this purpose, cationic polymers like poly(amidoamine), poly(propylene imine) (PEI), poly-(beta-amino ester) (PBAE) and poly(L-lysine) (PLL) or mixtures or copolymers thereof may be used. A hyperbranched class of polymers, namely dendrimers, may be used to complex with many oligonucleotide molecules. Apart from these, synthetic polymers like polyphosphazenes are known to be highly biocompatible and chemically flexible promising vectors used to deliver therapeutic oligonucleotides. For topical delivery usually polyethyleneimine (PEI), and poly-(beta- amino ester) (PBAE), mixtures thereof or copolymers thereof are used. Lipid-polymer hybrid nanoparticles (LPHNs) having dual properties of lipid and polymer nanoparticles, consist of a polymer-based coat surrounding the oligonucleotide therapeutic, which is, in turn, encapsulated by a lipid-based exterior. Biodegradable polymers like polylactic acid, chitosan, polycaprolactone, etc., may be used to form the polymeric core, and the lipidic shell’s composition could be modified based on the therapeutic agent to confer desirable drug release, cellular uptake, and biodistribution. The term “lipofection” refers to “lipid transfection” or “liposome-based transfection,” which uses a lipid complex to deliver an oligonucleotide to target cells. Lipids are a broad class of fat-soluble biomolecules, such as fats, oils, and waxes. The cell membranes of animal cells are composed of a bilayer of phospholipids with hydrophilic surfaces facing the cytoplasm and extracellular environment. Lipofection technology uses tiny vesicular structures called liposomes that have the same composition as the cell membrane. Depending on the liposome and cell type, the liposome can be endocytosed or directly fuse with the cell membrane to release the DNA construct into cells. The advantage to lipofection is that it works in many cell types, including cultured neurons. Commercially available kits allow transfection reactions to be performed within 30 min and gene expression to be assayed within hours. However, like the calcium phosphate method, lipofection is almost exclusively used in cell culture experiments. The oligonucleotides as described herein is preferably formulated in lipid nanoparticles (LNP). Lipid-based delivery systems show a reduced immunogenicity, can carry large amounts of nucleic acids and offer inexpensive manufacturing that can be easily upscaled. LNPs possess a hydrophobic, nanostructured core, which is dense in electrons. In contrast to liposomes, they do not express a lipid bilayer encapsulating an aqueous core, but rather have a micelle-like structure. Liposomes are made mainly of phospholipids and sphingolipids, while LNPs are made mainly of cationic or ionisable lipids. In one embodiment, the LNP comprise one or more cationic lipids, a neutral polymer conjugated lipid, an ionizable lipid, a steroid, and the oligonucleotide and / or nucleic acid encoding an RNA guided endonuclease, a base editor or a prime editor. In one embodiment, the one or more cationic lipid is DOTAP and / or DOPE, the neutral polymer- conjugated lipid is PEG-DMG and the steroid is cholesterol. In one embodiment the LNP additionally comprises apolipoprotein E4. The preferred mode of administration of the pharmaceutical composition is topical administration. 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE) is a so-called helper lipid with two unsaturated tails and a conical shape, supporting endosomal escape by destabilising the endosomal membrane. Steroids such as cholesterol enhance stability of LNPs and modulate membrane fluidity. Polyethylene glycol (PEG) conjugated lipids enhance the stability of LNPs, reduce particle aggregation, reduce unspecific uptake by immune cells and reduce cytotoxicity. In preferred embodiments the LNPs comprise 1,2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol-2000 (PEG2000-DMG). Apolipoprotein E4 supports uptake of LNPs via low-density lipoprotein (LDL) receptor on the cell surface. Cationic lipids have a head group with permanent positive charges. For example, 1,2-di-O- octadecenyl-3-trimethylammonium-propane (DOTMA), a quaternary ammonium lipid, has been applied for RNA delivery in multiple cell types, and was commercialized as Lipofectin in combination with 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE).1,2-dioleoyl-3- trimethylammonium-propane (DOTAP), a biodegradable analogue of DOTMA, was also studied for RNA delivery25, and is part of the commercial agent MegaFectin, together with DOPE or cholesterol. DOTMA and DOTAP have both been applied either alone or combined with other materials for RNA delivery; for example, spleen-targeted DOTMA–RNA lipoplexes (RNA-LPX) have been developed as systemic cancer vaccine. Ionizable lipids are protonated at low pH, which makes them positively charged, but they remain neutral at physiological pH. The pH-sensitivity of ionizable lipids is beneficial for nucleic acid delivery in vivo, because neutral lipids have less interactions with the anionic membranes of blood cells and, thus, improve the biocompatibility of lipid nanoparticles. Trapped in endosomes, in which the pH is lower than in the extracellular environment, ionizable lipids are protonated and, therefore, become positively charged, which may promote membrane destabilization and facilitate endosomal escape of the nanoparticles. The pKa values of ionizable lipids for optimal loading and physiological tolerance are in a range from 6.2 to 6.5. The ionizable lipid 1,2-dilinoleyloxy-N,N-dimethyl-3-aminopropane (DLin-DMA) was initially synthesized for siRNA delivery, and delivery efficacy was improved by modification of the linker and hydrophobic regions, resulting in 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (DLin- KC2-DMA). Further optimization of the amine head group of DLin-KC2-DMA led to (6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetraen-19-yl 4-(dimethylamino) butanoate (DLin-MC3- DMA; MC3), which is a key delivery component of Onpattro, the first United States Food and Drug Administration (FDA)-approved siRNA drug. MC3-based lipid nanoparticles have also been tested for RNA therapeutics, such as protein replacement therapies and antiviral therapies. Incorporation of biodegradable lipids improves the tolerability of lipid nanoparticles, by allowing fast metabolism while retaining RNA delivery efficacy. Zwitterionic ionizable lipids can also be applied for oligonucleotide delivery; for example, lipids composed of a pH-switchable zwitterion and three hydrophobic tails assemble into a cone in the endosomal acidic environment, enabling membrane hexagonal transformation and allowing them to leave the endosome. Thus, lipid nanoparticle–nucleic acid formulations based on zwitterionic ionizable lipids can escape the endosome, leading to efficient protein expression and genome editing in vivo. Other types of lipid used for delivery by lipo-nanoparticle is referred to review article from Hou et al.2021 (Lipid nanoparticles for mRNA delivery, Nature Reviews Materials 6, 1078-1094 (2021)). Oligonucleotides as described herein such as ssRNA may also be administered formulated as particles. In the context of the present invention, the term "particle" relates to a structured entity formed by molecules or molecule complexes. In one embodiment, the term "particle" relates to a micro- or nano-sized structure, such as a micro- or nano-sized compact structure dispersed in a medium. In one embodiment, a particle is a nucleic acid containing particle such as a particle comprising DNA, RNA or a mixture thereof. Electrostatic interactions between positively charged molecules such as polymers and lipids and negatively charged nucleic acid are involved in particle formation. This results in complexation and spontaneous formation of nucleic acid particles. In one embodiment, a nucleic acid particle is a nanoparticle. A "nucleic acid particle" can be used to deliver nucleic acid to a target site of interest (e.g., cell, tissue, organ, and the like). A nucleic acid particle may be formed from at least one cationic or cationically ionizable lipid or lipid-like material, at least one cationic polymer such as protamine, or a mixture thereof and a nucleic acid such as an oligomer, a nucleic acid encoding for an RNA guided endonuclease, a prime editor or a prime editor and / or a HDR template. Nucleic acid particles include lipid nanoparticle (LNP)-based and lipoplex (LPX)-based formulations. Cationic or cationically ionizable lipids or lipid-like materials and / or a cationic polymer may combine with the nucleic acid to form aggregates, and this aggregation results in colloidally stable particles. In one embodiment, particles as described herein further comprise at least one lipid or lipid-like material other than a cationic or cationically ionizable lipid or lipid-like material, at least one polymer other than a cationic polymer, or a mixture thereof. In some embodiments, nucleic acid particles comprise more than one type of nucleic acid molecules. In embodiments, the molecular parameters of the nucleic acid molecules may be similar or different from each other, with respect to molar mass or fundamental structural elements such as sequence, molecular architecture, capping, coding regions or other features. Nucleic acid particles as described herein may have an average diameter, in one embodiment, that ranges from about 30 nm to about 1000 nm, from about 50 nm to about 800 nm, from about 70 nm to about 600 nm, from about 90 nm to about 400 nm, or from about 100 nm to about 300 nm. With respect to nucleic acid particles, the N / P ratio gives the ratio of the nitrogen groups in the lipid to the number of phosphate groups in the nucleic acid. It is correlated to the charge ratio, as the nitrogen atoms (depending on the pH) are usually positively charged, and the phosphate groups are negatively charged. The N / P ratio, where a charge equilibrium exists, depends on the pH. Lipid formulations are frequently formed at N / P ratios larger than four, up to twelve, because positively charged nanoparticles are considered favourable for transfection. In that case, the nucleic acid is considered to be completely bound to nanoparticles. Medical conditions The term “genodermatoses” refers to a diverse group of genetically caused rare, often severe diseases of the skin. In embodiments the term refers to diseases of the skin that are caused by a single point mutation (also termed monigenic mutation) in a gene. One example for a genodermatosis is autosomal, recessive, congenital ichthyosis (ARCI) which refers to a heterogeneous group of severe keratinization disorders of the skin. ARCI includes a spectrum of disease presentations such as lamellar ichthyosis (LI, OMIM 242300) and congenital ichthyosiform erythroderma (CIE, OMIM 242100) and harlequin ichthyosis (HI, OMIM 242500), the latter being the most severe form with a mortality rate of more than 50% in newborns. ARCI is caused by a monogenic mutation in one out of a range of genes. So far twelve genes have been identified that, if affected, cause ARCI. These still do not account for 15% of documented cases, which are caused by mutations in genes outside of that range. One of the genes most often affected is TGM1 (NM_000359.3). It encodes the transglutaminase-1 enzyme (TGase-1), which is part of the protein crosslinking mechanism in the cornified envelope of the skin.32% to 68% of ARCI cases are linked to mutations in TGM1, and even higher percentages in cases of LI. The splice site point mutation c.877-2A>G was found in a third of all TGM1 mutation alleles and leads to a premature stop codon. These indications represent preferred embodiments of the use of the invention in the treatment of a medical condition associated with a c.877-2 A>G mutation of the TGM1 gene. As used herein "treatment" or "treating," includes any beneficial or desirable effect on the symptoms or pathology of a disease or pathological condition, and may include even minimal reductions in one or more measurable markers of the disease or condition being treated. Treatment can involve optionally either the reduction or amelioration of symptoms of the disease or condition, or the delaying of the progression of the disease or condition. "Treatment" does not necessarily indicate complete eradication or cure of the disease or condition, or associated symptoms thereof. As used herein, "prevent," and similar words such as "prevented," "preventing" or "prophylactic" etc., indicate an approach for preventing, inhibiting, or reducing the likelihood of the occurrence or recurrence of, a disease or condition. It also refers to delaying the onset or recurrence of a disease or condition or delaying the occurrence or recurrence of the symptoms of a disease or condition. As used herein, "prevention" and similar words also includes reducing the intensity, effect, symptoms and / or burden of a disease or condition prior to onset or recurrence of the disease or condition. As used herein, the “patient” or "subject" may be a vertebrate. In the context of the present invention, the term "subject" includes both humans and animals, particularly mammals, and other organisms. In one embodiment, a method of preventing and / or treating a medical condition associated with a c.877-2 A>G mutation of the TGM1 gene in a subject comprises administering an effective amount, e.g., therapeutically effective amount of a composition comprising the oligonucleotide and / or gene editing system contemplated herein. The quantity and frequency of administration will be determined by such factors as the condition of the patient, and the type and severity of the patient's disease, although appropriate dosages may be determined by clinical trials. The administration of the compositions contemplated herein may be carried out in any convenient manner, including by aerosol inhalation, injection, ingestion, transfusion, implantation or transplantation. In a preferred embodiment, compositions are administered parenterally. The phrases "parenteral administration" and "administered parenterally" as used herein refers to modes of administration other than enteral and topical administration, usually by injection, and includes, without limitation, intravascular, intravenous, intramuscular, intraarterial, intrathecal, intracapsular, intraorbital, intratumoral, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticular, subcapsular, subarachnoid, intraspinal and intrasternal injection and infusion. In a preferred embodiment the composition is configured for topical administration. In a preferred embodiment the administration of the composition according to the present invention is carried out by topical administration. The instant disclosure also includes kits, packages and multi-container units containing the herein described pharmaceutical compositions, oligonucleotides, gene editing systems, and / or means for administering the same for use in the treatment of diseases and other conditions in mammalian subjects. FIGURES The invention is further described by the following figures. These are not intended to limit the scope of the invention but represent preferred embodiments of aspects of the invention provided for greater illustration. Brief description of the figures Figure 1: The TGM1 c.877-2 A>G mutation is the most common mutation affecting up to 68% of all ARCI patients. Figure 2: Design of a CRISPR / Cas9 based editing strategy using homology directed repair (HDR). Figure 3: Schematic of CBE editing strategies designed for the TGM1 c.877-2 A>G mutation. Figure 4: Sequences of the TGM-1 gene (i), healthy keratinocytes (ii) and diseased cells (iii). Figure 5: Western blot incubated with (i) TGase1 antibody and (ii) GAPDH antibody. Figure 6: Skin models of diseased cells (i) and healthy cells (ii). Figure 7: GFP expression in untreated cells (i), cells treated with unencapsulated GFP-mRNA (ii), cells treated with GFP-mRNA and lipofectamine (iii, vi) and cells treated with mRNA-loaded LNPs (v, vi). Figure 8: Editing of HEK293 cells via HDR. Figure 9: Editing of cells with the ARCI TGM1 c.877-2 A>G mutation pretreated or not treated with cytokines via HDR (i) and chromatograms of the edited sequence (ii). Figure 10: Base editing of diseased cells using the NG-BE4max editor with 15 µg / mL modified and unmodified mRNA (i) and chromatogram showing editing with lipofectamine (ii). Figure 11: Base editing of diseased cells using the NRCH-BE4max editor with 15 µg / mL RNA (i) and chromatogram showing editing (ii). Figure 12: Editing of the bystander G next to the splice site mutation with NG-BE4max (i) and NRCH-BE4max (ii). Figure 13: Lipid nanoparticle-(LNP) mediated delivery of Cas9 mRNA or ribonucleoprotein (RNP)-loaded LNPs (RNP) yields efficient and safe in situ gene editing in human skin. Figure 14: Schematic depiction of lipid nanoparticles (LNPs) and chemical structures of the helper lipids (DSPC, DOPC, DOPE, ES, DSPG) used for LNP preparation and cellular uptake and gene editing efficiency. Figure 15: Cell viability and cellular internalization pathways of primary human keratinocytes (KCs) after exposure to unloaded LNPs, RNP-loaded LNPs, and mRNA-loaded LNPs. Figure 16: Investigation of internalization and endosomal pathways of primary human keratinocytes (KCs) after exposure to RNP-loaded LNPs, and mRNA-loaded LNPs. Figure 17: Impact of ionizable lipids and their pKa on the frequency of indel % (normalized to wild-type (WT) cells) and cell viability of primary human KCs after a 48h treatment with the different LNP formulations. Figure 18: Schematic representation of the pre-treatment of bioengineered 3D skin models by microneedles and laser ablation and measurement of the frequency of indel % of topically applied RNP or mRNA-loaded LNP in 3D skin models. Figure 19: Analysis of Cas9 protein expression in primary human keratinocytes (KCs) and primary human bronchial epithelial cells and assessment of off-target effects. Figure 20: Base editing of TGM1 c.877-2 A>G ARCI patient cells using RNAimax and NG- BE4max editor. Detailed description of the figures Figure 1: The TGM1 c.877-2 A>G mutation is the most common mutation affecting up to 68% of all ARCI patients. C.877-2 denotes a base in the intron, A>G a change from adenine to guanine. This mutation introduces a preliminary splice site, introducing guanine in the cDNA and therefore leading to a frameshift. This introduces a preliminary stop codon, which leaves a truncated protein. (State of the art, Illustration adapted from Pigg et al. (1998)). Figure 2: Design of a CRISPR / Cas9 based editing strategy using homology directed repair (HDR). An sgRNA and a ssDNA template were designed. The mutation, NGG-PAM and the changes introduced in the template are marked. Figure 3: Schematic of CBE editing strategies designed for the TGM1 c.877-2 A>G mutation. Two editing strategies for CBE-BE4max were designed. One of them uses an NGG-PAM and the other one an NRCH-PAM. The editing window on both is four to seven bases from the 5’ end of the sgRNA. There is a G in the wildtype TGM1 gene neighboring the mutation G, which is at risk of being edited as a bystander mutation. Figure 4: Sequences of the TGM-1 gene (i), healthy keratinocytes (ii) and diseased cells (iii). The sequence of the healthy gene (i) was obtained from NCBI (Kobian et al., 2018) and displayed using SnapGene software. Sanger sequencing chromatograms from healthy keratinocytes (ii) and cells with the TGM1 c.877-2 A>G mutation (iii) were aligned with the gene sequence in SnapGene. Figure 5: Western blot incubated with (i) TGase1 antibody and (ii) GAPDH antibody. All bands on the ladder ranging from 15 kDa to 250 kDa were visible in the first imaging, so that the bands could be identified as the appropriate sizes. The same sample was run on two lanes for a duplicate assessment. Figure 6: Skin models of diseased cells (i) and healthy cells (ii). Models were visualized under a microscope at 20x and 40x magnification. The epidermis (e) and the dermis (d) are separated by a dashed line. Triangles show keratinocytes in the dermis. Figure 7: GFP expression in untreated cells (i), cells treated with unencapsulated GFP-mRNA (ii), cells treated with GFP-mRNA and lipofectamine (iii, vi) and cells treated with mRNA-loaded LNPs (v, vi). Nuclei were stained with DAPI and detected by blue fluorescence (examples indicated by arrows), GFP was detected by green fluorescence (examples indicated by brighter arrows). Treatment with lipofectamine and treatment with LNPs were done in duplicates. Figure 8: Editing of HEK293 cells via HDR. Significant editing results are achieved in the secondary site. The editing on the coding and the non-coding strand is displayed as the mean of three technical replicates with the error bars showing standard deviation (SD) and is normalized to untreated cells with the mutation. A two-way ANOVA was conducted to determine significant editing with a P value < 0.0001 (****) in comparison to the negative control with scrambled sgRNA. Figure 9: Editing of cells with the ARCI TGM1 c.877-2 A>G mutation pretreated or not treated with cytokines via HDR (i) and chromatograms of the edited sequence (ii). The editing on the coding and the non-coding strand (i) is displayed as the mean of two biological replicates with the error bars showing standard deviation (SD). A chromatogram of the coding strand sequence after treatment (ii) shows double peaks at both editing sites. The target site is marked with a brighter arrow and the site of the secondary edit is marked with a darker arrow. Figure 10: Base editing of diseased cells using the NG-BE4max editor with 15 µg / mL modified and unmodified mRNA (i) and chromatogram showing editing with lipofectamine (ii). Editing of the A>G mutation on the coding strand is displayed as the mean normalized editing rates from three technical replicates with the error bars showing standard deviation (SD). Significance was assessed with a two-way multiple comparisons ANOVA. For P values <0.05, significance was assigned to the comparisons. (**): p < 0.0021 (***): p < 0.0002. Chromatogram of sequences after treatment via lipofection (ii) shows a double peak at the edited site for the sequence after lipofection treatment. The edited site is marked with an arrow. Figure 11: Base editing of diseased cells using the NRCH-BE4max editor with 15 µg / mL RNA (i) and chromatogram showing editing (ii). Editing of the A>G mutation on the coding strand and the noncoding strand (i) is displayed as the mean editing rate from three technical replicates ± standard deviation (SD). Significance was assessed with a two- ANOVA. The significant comparisons showed P values <0.0001 (****). Chromatogram of sequences after treatment via lipofection (ii) show a double peak at the edited site for the sequence after lipofection treatment. The edited site is marked with an arrow. There was some visible background in the chromatogram, but the sequence was still easy to distinguish and of good quality. Figure 12: Editing of the bystander G next to the splice site mutation with NG-BE4max (i) and NRCH-BE4max (ii). Cells were treated with formulations containing RNA at a concentration of 15 µg / mL. The editing is displayed as the mean editing rate from three technical replicates with the error bars showing standard deviation (SD). Figure 13: Lipid nanoparticle-(LNP) mediated delivery of the inventive sgRNA and a Cas9 mRNA or the inventive sgRNA with a Cas9 protein (ribonucleoprotein (RNP)-loaded LNPs (RNP)) yields efficient and safe in situ gene editing in human skin. Figure 14: (A) Schematic depiction of lipid nanoparticles (LNPs) and chemical structures of the helper lipids (DSPC, DOPC, DOPE, ES, DSPG) used for LNP preparation. (B) Cell uptake efficiency of LNPs containing different helper lipids 24 h after incubation with primary keratinocytes (KCs). (C) Frequency of indel % (normalized to wild-type (WT) cells) in the model gene HPRT after transfection of KCs with RNP- and D) mRNA-loaded LNPs at three different L / R and N / P ratios, respectively. * indicates statistically significant differences over RNAimax; *p < 0.05; **p < 0.01; ***p < 0.001. (E) Effect of RNP-loading at different pH on indel % (normalized to WT) indicative of gene editing efficacies in the model gene HPRT. Data are presented as mean ± SD of at least three biologically independent replicates. Figure 15: Cell viability and cellular internalization pathways of primary human keratinocytes (KCs) after exposure to unloaded LNPs, RNP-loaded LNPs, and mRNA-loaded LNPs. Cell viability of primary human keratinocytes (KCs) after exposure to (A) unloaded LNPs, (B) RNP- loaded LNPs, and (C) mRNA-loaded LNPs at different concentrations and ratios after 48 h. Data are presented as mean of three biological replicates ± SD. (D) Representative live / dead cell assay images comparing the toxicity of RNP and mRNA-loaded LNP over 48h. (E) Pre-incubation with endocytosis pathway inhibitors indicate that LNP internalization in KCs is mainly dynamin- dependent. Scale bars = 50 µm (F) Confocal microscopy images showing the time-dependent cell uptake kinetic of RNP-loaded LNPs over 24h. Figure 16: Investigation of internalization and endosomal pathways of primary human keratinocytes (KCs) after exposure to RNP-loaded LNPs, and mRNA-loaded LNPs. Immunofluorescence staining against EEA1 (early endosome marker), RAB11A (recycling endosome marker), and LAMP1 (late endosome marker) in primary human keratinocytes 24 h after treatment with unloaded, mRNA-loaded, and RNP-loaded LNP. Scale bar = 50 µm. Figure 17: Impact of ionizable lipids and their pKa on the frequency of indel % (normalized to wild-type (WT) cells) and cell viability of primary human KCs after a 48h treatment with the different LNP formulations. Impact of ionizable lipids and their pKa on the frequency of indel % (normalized to wild-type (WT) cells) in (A) primary human keratinocytes and (B) bronchial epithelial cells as well as non-epithelial cells including endothelial cells and dermal fibroblasts. (C) Cell viability of primary human KCs after a 48h treatment with the different LNP formulations. Data are presented as mean ± SD of at least three biologically independent replicates. * indicates statistical significance over RNAimax: *p < 0.05; **p < 0.01; ***p < 0.001. Figure 18: Schematic representation of the pre-treatment of bioengineered 3D skin models by microneedles and laser ablation and measurement of the frequency of indel % of topically applied RNP or mRNA-loaded LNP in 3D skin models. A) Schematic representation of the pre-treatment of bioengineered 3D skin models by microneedles and laser ablation. B) Frequency of indel % (normalized to wild-type (WT) models) of topically applied RNP or mRNA-loaded DOPE LNP in 3D skin models after 48 h following pre-treatment with 400 µm solid microneedles. C) Frequency of indel % (normalized to WT) of topically applied mRNA-loaded DOPE LNP and LNP H in 3D skin models after 48 h following pre-treatment with laser ablation. D) IL-6 and IL-8 levels of untreated (control), DOPE-LNP and LNP H treated skin models after pre-treatment with laser ablation. Figure 19: Analysis of Cas9 protein expression in primary human keratinocytes (KCs) and primary human bronchial epithelial cells and assessment of off-target effects. (A) Western blot analysis of Cas9 protein expression in primary human keratinocytes (KCs) and primary human bronchial epithelial cells 24h, 48h, and 72h after treatment with Cas9 RNP loaded onto DOPE- LNPs. GAPDH served as housekeeper. (B) Using rhAMPseq, effective on-target editing of our model target HPRT with LNP H was confirmed while no off-target effects were observed in any of the eight predicted sgRNA-dependent off-target sites. (C) Visualization of the distribution of the most frequently identified alleles around the cleavage site for the sgRNA AATTATGGGGATTACTAGGA (SEQ ID No.17) in donor 1. Substitutions are shown in bold font. Rectangles highlight inserted sequences. Horizontal dashed lines indicate deleted sequences. The vertical dashed line indicates the predicted cleavage site. Figure 20: Base editing of TGM1 c.877-2 A>G ARCI patient cells using RNAimax and NG- BE4max editor. (B) Schematic depiction of the underlying mechanism of a cytosine base editor. C) Base editing of TGM1 c.877-2 A>G ARCI patient cells using RNAimax and NG-BE4max editor with 15 μg / mL modified and unmodified mRNA. Editing of the A>G mutation on the coding strand is displayed as the mean normalized editing rates from three technical replicates. Chromatograms of sequences after treatment with (C) RNAimax show a double peak at the target site indicative of base editing. The edited sites are marked with a green arrow. EXAMPLES The invention is demonstrated through the examples disclosed herein. The examples provided represent particular embodiments and are not intended to limit the scope of the invention. The examples are to be considered as providing a non-limiting illustration and technical support for carrying out the invention. The nucleic acids employed in the examples are disclosed in the sequence table above (Table 1). Materials and methods Chemicals, Proteins and Enzymes For cell staining, 4% formaldehyde solution (SF98-4), Shandon™ Gill 2 Hematoxylin (28-601-08), Shandon™ Eosin Y (28-600-86), Shandon™ xylene substitute (9990505), and Shandon™ xylene substitute mountant (28-600-57) as well as sodium acetate (MW: 82.03 g / mol, S210-500) were purchased from Fisher Scientific. Ethanol 100% (P016EAAN) was obtained from Commercial Alcohols. Glacial acetic acid (MW: 60.05 g / mol, A38-500) was bought from Fisher Chemical. Agarose (9012-36-6) was obtained from Fisher BioReagents. Pierce™ protease and phosphatase inhibitor mini tablets (A32961), 50X TAE electrophoresis buffer (B49), and RNase AWAY™ surface decontaminant (7002) were purchased from Thermo Scientific. Clear frozen section compound (95057-838), Triton X-100 (M143-1L), and 1 N hydrochloric acid (HCl) (BDH7202-2) were bought from VWR. SYBR® Safe DNA gel stain (S33102), 3M sodium acetate buffer pH 5.5 (AM9740), 20X TE buffer (T11493), and 3-(4,5-dimethylthiazol-2-yl)-2,5- diphenyl tetrazolium bromide 5 mg / mL (M6494) were obtained from Invitrogen. Sodiumhydroxide (NaOH) platelets (221465), dimethyl sulfoxide (472301-1L), radioimmunoprecipitation assay buffer (R0278-50ML), Laemmli lysis-buffer (38733-5ML), and Hanks’ Balanced Salt Solution (H4641-500) were purchased from Sigma-Aldrich. PureCol collagen (5005-100ML) was bought from Advanced BioMatrix. 30% Acrylamide / Bis Solution 37.5 / 1 (1610158) and TEMED (1610801) were purchased from Bio- Rad. DEPC-treated water in molecular biology grade was obtained from EMD Millipore Corp (693520-1L). Tap water was purified to double- distilled water using a Milli-Q® Integral 10 Water Purification System (Millipore, ZRXQ010US). Human recombinant Apolipoprotein E4 (A3234) was acquired from Sigma-Aldrich. The enzymes and polymerase master mixes used were Alt-R® S.p. Cas9 nuclease V35 mg (10000735) for gene editing and PrimeTime® Gene Expression master mix (1055770) for the drop-off qPCR. These were purchased from IDT. The Q5® HighFidelity 2X master mix (M0492S) was from New England Biolabs. Solutions & Buffers Buffers were prepared as follows: 25mM Sodium Acetate Buffer (pH 4): Sterile Water 800.00 mL, Sodium Acetate (MW: 82.03 g / mol) 465.23 mg, Acetic Acid (MW: 60.05 g / mol) 1161.00 mg Adjust pH with HCl or NaOH to a final pH of 4. Add distilled water to a final volume of 1 L. Filtrate with a sterile filter and store the solution in a sterile 50 ml tube at 4°C. Solutions were prepared as follows: 1% hydrochloric acid (HCl) solution: 70% Ethanol 250 mL, 1N HCl 2.5 mL 0.075% ammonium solution: Distilled Water 400 mL, Ammonium hydroxide solution 30% 1 mL Plasmids & mRNA CleanCap® Cas9 mRNA (L-7606) and CleanCap® eGFP mRNA (L-7601) were purchased from TriLink. BE4max-NG was acquired as pBT376 (Addgene plasmid #125617; http: / / n2t.net / addgene:125617; RRID:Addgene_125617) in the form of a bacterial stab. The bacteria were streaked on LB agar plates with 100 µg / mL ampicillin and incubated for 24 hours at 37°C. Single colonies were inoculated in 3 mL of LB medium with 100 µg / mL of ampicillin and grown overnight at 37°C while shaking. BE4max-NG mRNA was synthesised by Yihang Chen, Jan Lab, UBC. The plasmid was linearised, transcribed into mRNA, capped and poly(A) tailed. A batch of the RNA was modified with N1-methylpseudouridine-5'-Triphosphate (TriLink, N-1081). BE4max-NRCH mRNA was provided by Alice Yu, Ross Lab, UBC and modified with N1- methylpseudouridine-5'-Triphosphate. The employed plasmid was pCMV- BE4max-NRCH (Addgene plasmid #136920; http: / / n2t.net / addgene:136920; RRID:Addgene_136920) Oligonucleotides Single guide RNAs (sgRNAs) and donor template ssDNA oligos for gene editing experiments, as well as PCR and sequencing primers TGM-E5 and qPCR primers HPRT1, were ordered from IDT. Negative control scrambled #1 mod EZ sgRNA was ordered from Synthego. The HPRT control probe and the HPRT dropoff probe were custom ordered from IDT. Oligonucleotides were reconstituted in IDTE resuspension buffer pH 8.0. To make a 100 µM solution 1 nmol was dissolved in 10 µL of buffer. The respective sequences are listed in Table 1. Antibodies Primary antibodies used for Western blot were the Anti-TGase1 antibody (E-6) mouse monoclonal IgG2a 200 µg / mL (Santa Cruz Biotechnology, sc-166467) and GAPDH (14C10) rabbit mAb (Cell Signaling Technology, 2118). As a secondary antibody, the IRDye® 689 RD goat anti-mouse (Li-Cor, 925-68070) was used. Ladders and Loading Dye For Western blot, the PageRuler™ plus pre-stained protein ladder (Thermo Scientific, 26619) was used. For gel electrophoresis, the Quick-Load® purple 100 bp DNA Ladder (N0551S) and the gel loading dye, Purple (6X), no SDS (B7025S) were acquired from New England BioLabs. Lipids Lipofectamine™ RNAiMax transfection reagent (13778-150) was obtained from Invitrogen and Lipofectamine™ 3000 transfection reagent (L3000001) distributed by Thermo Fisher. DOPE (850725), DOTAP (890890), and DMG-PEG (880151) were purchased from Avanti Polar Lipids. Cholesterol (C8667) was obtained from Sigma-Aldrich. DLin-MC3-DMA was obtained from Dr. Marco Ciufolini, UBC. The preformulated LNPs contain 50 mol% (ionisable) cationic lipid, 10 mol% DOPE as phospholipid, 38.5 mol% cholesterol and 1.5 mol% PEG-lipid, in this case DMG- PEG. The ionisable cationic lipid used was DLin-MC3-DMA. For increasing concentrations of DOTAP lipids the percentage of DLin-MC3-DMA was adjusted down accordingly. The lipid compositions testes are shown in table 2. Table 2: Lipid nanoparticle formulations and corresponding compositions. Cell Culture Media Phosphate buffered saline (10010023), EpiLife™ medium (MEPI500CA), human keratinocyte growth supplement (S0015), EpiLife™ defined growth supplement (S0125), Opti-MEM™ I reduced serum medium (31985062), trypsin / EDTA (0.25%) (25200072), Dulbecco’s modified eagle’s medium – high glucose, no glutamine (11960-044), and Ham’s F12 nutrient mix (31765- 027) were bought from Gibco. Dulbecco’s modified eagle’s medium – high glucose (D6429), FBS superior (F1051), penicillin-streptomycin (P4333), L-glutamine (G7513), hydrocortisone (H0888), epidermal growth factor (E9644), adenine (A2786), and cholera toxin (C8052) were purchased from Sigma-Aldrich. Insulin (11376497001) was acquired from Roche. The media was supplemented as follows: Fibroblast Growth Medium: DMEM – high glucose 500 mL, FBS 50 mL, Penicillin-Streptomycin 5 mL, L-Glutamine 5 mL EpiLife™, supplemented: EpiLife™ 500 mL, HKGS or EDGS 5 mL Keratinocyte Differentiation Medium (KDM): DMEM – high glucose, no glutamine 64.5 mL, Ham’s F1221.5 mL, FBS Superior 10 mL, L- Glutamine 2 mL, Hydrocortisone 1 mL, Epidermal growth factor 0.01 mL, Insulin 0.1 mL, Adenine 0.2 mL, Cholera toxin 0.001 mL Stock solutions to make KDM were prepared as follows: Hydrocortisone / EtOH (5 mg / ml): Hydrocortisone 1 g, Ethanol 100% 200 mL Epidermal growth factor (human recombinant) 1 µg / mL: EGF 200 µg, DMEM – high glucose, no glutamine 200 mL Insulin (bovine pancreas) (5 mg / ml) (Filtrate with a sterile filter): Insulin 250 mg, 0.005 M HCl 50 mL Adenine (base) (Filtrate with a sterile filter): Adenine 243.2 mg, 5 N NaOH 2 mL, Sterile-water ad 10 mL Cholera enterotoxin (from Vibrio Cholerae): Cholera enterotoxin 500 µg, Sterile-water 5 mL Cell culture Primary human keratinocytes and fibroblasts were isolated from excised human skin or juvenile foreskin according to standard procedures based on methods previously described (Gysler et al., 1997). Keratinocytes were cultured in EpiLife™ supplemented with either Human Keratinocyte Growth Supplement (HKGS) or EpiLife™ Defined Growth Supplement (EDGS). Fibroblasts were cultured in DMEM - high glucose, supplemented with 10% FBS and 1% penicillin-streptomycin. The cells were used at passage 1-3. Cells with the TGM1 e5 hom c.877-2 A>G mutation causing ARCI were obtained from Keith Choate, Yale University, as immortalised patient keratinozytes (ICH102-1K / 12 E6E7). Diseased immortalised keratinocytes ICH102-1K / 12, E6E7, were cultured in EpiLife™ supplemented with HKGS. HEK293 cells were supplied by Lukas Hohenwarter (Li Lab, UBC Faculty of Pharmaceutical Sciences). They were cultured in DMEM – high glucose, supplemented with 10% FBS and 1% penicillin-streptomycin. For lipofection, cells were cultured in serum-free Opti-MEM™. All cell culture was conducted in a LabGard ES NU-540 Class II Type A2 Biosafety Cabinet (NuAire). Cells were counted with a Model R1 automated cell counter (Olympus LS). The incubator used was a Forma Direct Heat CO2 Incubator (Thermo Scientific). LNP formulations were prepared by Jerry Leung (Michael Smith Laboratories and Department of Biochemistry and Molecular Biology, UBC). The desired lipids dissolved in ethanol (10 mM) were mixed in a 1: 3 ratio with 25 mM sodium acetate buffer pH 4 using a T-junction mixer (48). The resulting suspension was dialysed 500X in 25 mM sodium acetate buffer pH 4 overnight to remove ethanol. Following dialysis, the LNPs were sterile filtered (Acrodisc, 0.2 µm) and concentrated using an Amicon ultracentrifugation unit (10 k MWCO). The final lipid content was determined by assessing cholesterol concentration using the Wako Cholesterol E Assay Kit (Fujifilm, 999-02601). LNP loading Preformulated LNPs were used to prepare cell treatments with unloaded LNPs, CRISPR-Cas- loaded LNPs (RNP-loaded LNPs) and mRNA-loaded LNPs as described previously (Tam et al., 2022).1 mL of unloaded LNPs was prepared by adding 50 nmol (16.67 µL) of LNPs at a working stock concentration of 3 mM to a micro tube and adding 25 mM sodium acetate buffer pH 4 (32.33 µL). Finally, 950 µL cell culture medium combined with 1 µL of Apolipoprotein E4 was added. To prepare 1 mL of RNP-loaded LNPs the RNP complex was formed by adding 100 µM sgRNA and 62 µM Cas9 protein stock together in a 1:1 equimolar ratio. IDTE buffer pH 7.5 was added to bring the concentration of the RNP complex to a working stock concentration of 25 µM. The complex was incubated for 10 mins at room temperature. To combine LNPs and RNP complex, 100 nmol (4 µL) RNP (pH 7.5) was mixed with 50 nmol (16.67 µL) LNPs at a working stock concentration of 3 mM (L / R 500).25 mM sodium acetate buffer pH 4 was added (28.33 µL) and the mixture was incubated again 10 minutes at room temperature. To finish the formulation 950 µL cell culture media spiked with 1 µL Apolipoprotein E4 was added to the mix. The mRNA formulation was started by mixing Cas9 mRNA at a working stock of 100 µg / mL with sgRNA at a working stock of 100 µg / mL in a 1:1 ratio. To encapsulate the RNA, 1 µg (10 µL) of the sgRNA / Cas9 mRNA solution was mixed with LNPs at a working stock concentration of 3 mM at an N / P ratio of 6 (34 nmol LNPs, 11.49 µL). Next, 77.51 µL of 25 mM sodium acetate buffer pH 4 was added and the mixture was incubated for 10 minutes. As a last step, 900 µL cell culture medium with an added 1 µL of Apolipoprotein E4 was mixed into the RNA / lipids mixture. Evaluation of LNP formulations with varying amounts of cationic lipids Cell treatments for the LNP assays were prepared as previously described in the LNP loading section for the HPRT drop-off qPCR assay and the DLS measurements using HPRT sgRNA. For measurements at pH 4, the media to complete the formulation was substituted with 25mM sodium acetate buffer pH4. Transfections with the prepared formulations were conducted with keratinocytes that had been seeded the day before and incubated overnight. For a 12-well cell culture plate, 1*105cells were seeded in 1 mL of supplemented EpiLife™ cell culture medium perwell. Per well on a 96-well cell culture plate 2*104 cells were seeded in 200 µL of supplementedEpiLife™ cell culture media. Before the formulation was added, the wells were washed at least once with 1X PBS. The plates were incubated with the formulation treatment at 37°C and 5% CO2 for 48 hrs. Gene Editing Efficiency The gene editing efficiency of the LNP formulations was assessed by quantification of indel formation via an HPRT drop-off qPCR assay. Gene editing that results in indels and gene inactivation can be detected by a drop-off qPCR. A primer pair is designed to amplify the region of the predicted cut site. A reference probe binding distant from the cut site counts all copies of the amplicon in the qPCR. A second “drop-off” probe is designed to bind at the predicted cut site in the wildtype sequence. It will bind to amplicons with the wildtype sequence present but will not bind after insertion or deletion occurred. The editing is then calculated from the loss of the signal generated by the drop-off probe while maintaining the signal of the reference probe (Falabella et al., 2017; Findlay et al., 2016). Cells were seeded in a 12-well plate at a density of 1*105cells per well and were incubated overnight. They were transfected with formulations prepared as described in the LNP loading section. Per well, 1 mL of RNP- or mRNA-loaded LNP preparation with HPRT sgRNA was used. After 48 hrs, the wells were washed once with 1X PBS. Next, cells were collected in 200 µL PBS using a cell scraper. The genomic DNA was isolated with the QIAamp® DNA Mini Kit (Qiagen, 51306) using the spin protocol provided by the manufacturer for DNA purification from blood or body fluids. Adjustments made were elution in 50 µL DEPC-water instead of the buffer AE provided and an added 5 min incubation of the water in the spin column before centrifugation. DNA concentrations were determined with a NanoDrop 2000 Spectrophotometer (Thermo Scientific). Subsequently, the genomic DNA was amplified in a PCR with a reaction volume of 20 µL. A master mix for one more than the targeted number of samples was prepared with PrimeTime® master mix (10 µL), 10 µM forward- and reverse HPRT1 primers (1 µL each), 5 µM of reference- and drop-off probes (1 µL each), and water. The genomic DNA template samples were diluted such that all samples had the same concentration in the PCR well plate, with a load of 20-100 ng total DNA per well. The PrimeTime® gene expression master mix was prepared with low reference dye (4 µL / mL). The QuantStudio™ 7 Flex PCR system was programmed on an initial denaturation at 95°C for 3 mins, followed by 40 cycles of denaturation at 95°C for 15s and annealing at 60°C for 1 min each. Indel formation was determined by ΔΔCT values of drop-off and reference probes (Livak et al., 2001). Western Blot TGase-1 The presence and size of TGase1 protein were assessed by Western blotting. A confluent cell culture flask of ICH102-1K / 12 cells was collected by scraping with radioimmunoprecipitation assay buffer containing proteinase inhibitor cocktail. The lysate was incubated for 30 minutes on ice in the dark and subsequently centrifuged at 14000 rpm for 30 mins at 4°C. Protein concentration was quantified using a Biochionic Acid (BCA) Protein Assay Kit (G-Biosciences, 786-570). The sample was prepared with 2X Laemmli Buffer and separated via 10% SDS-PAGE in a Mini-PROTEAN® Tetra System (Bio-Rad) with a PowerPac™ Basic Power Supply (Bio- Rad). Protein was then transferred to a polyvinylidene difluoride (PVDF) membrane using a Trans-Blot® Turbo™ (Bio-Rad). After washing, the membrane was incubated with mouse monoclonal IgG2a antibody anti-TGase1 (1:500 in blocking buffer) overnight at 4°C. Fluorescence dye conjugated goat anti-mouse secondary antibody (1:5000 in blocking buffer, 1 hr incubation) was used for detection in the Odyssey CLx imaging system (LI-COR). To normalise detected protein levels, equal loading across the gel was confirmed by probing for GAPDH. The membrane was incubated with rabbit monoclonal antibody anti-GAPDH (1:5000 in blocking buffer) overnight and detection was done with fluorescence dye conjugated goat anti-mouse secondary antibody (1:5000 in blocking buffer, 1 hr incubation) on the Odyssey CLx imaging system (LI-COR). Generation of skin models To build skin models, fibroblasts (patient cells, 3*105 per model) and ARCI ICH102- 1K / 12 E6E7 cells (immortalised patient cells, 4.2*106per model) were cultured in cell culture flasks to confluency. Notched 6-well cell culture plates were prepared with cell culture inserts using sterile forceps. Fibroblasts were dissociated from the flask using 0.25% trypsin. Per well, 3*105fibroblasts were resuspended in 0.3 mL FBS Superior (1 mL FBS Superior per 1*106cells) and stored on ice. For each well, 2.5 mL collagen gel were made by mixing 8 parts PureCol with 1 part HBSS and 1 part fibroblast / FBS Superior in a 50 mL tube. Enough gel was prepared for one more than the number of wells to account for pipetting errors. HBSS was first added to the Pure Col, at which point the mixture showed a yellow colour. The mixture was then titrated with 1 N NaOH until the colour changed to pink. The fibroblast / FBS Superior mix was added in last. All mixing steps were conducted carefully as to not introduce air bubbles.2.5 mL gel were carefully pipetted into the inserts, making sure there were no bubbles. The plate was incubated for 1 hour at room temperature and for another hour at 37°C in a HeraTherm Oven (Thermo Scientific).2 mL of supplemented EpiLife™ media were added to the well and 2 mL of supplemented EpiLife™ media were added to the inserts. The plate was incubated for 2 hours at 37°C and 5% CO2. ARCI ICH102-1K / 12 E6E7 cells were dissociated from the flask with 0.25% trypsin.4.2*106cells were resuspended in 2 mL supplemented EpiLife™ media per well (1 mL supplemented EpiLife™ per 2.1*106cells). In each well, 2 mL of the cell suspension were added and incubated for 24 hours at 37°C, 5% CO2. After 24 hours, the supplemented EpiLife™ medium was carefully removed from the well and from the inserts without disturbing the gel.1.8 mL of KDM media were added to the well. The plate was incubated at 37°C, 5% CO2 for 14 days, replacing the KDM every other day. KDM was changed more frequently if high cell growth was seen (indicated by a colour change from red to yellow in the KDM). Skin model sectioning and staining Freezing skin models for cutting. Finished skin models were frozen for preparation of sections. In a first step, a 5 mm thick layer of clear frozen section compound was added to an embedding mould. Care was taken as to not introduce any bubbles. With a disposable scalpel, the membrane the model had been grown on was carefully cut out of the cell culture insert. Using forceps, the model on the membrane was transferred onto the prepared frozen section compound layer. A second layer of clear frozen section compound was added. Air bubbles, especially on the model, were avoided as much as possible. The mould was dipped into liquid nitrogen with the base using long forceps. The complete freeze of the model was confirmed through a visual and audible check. The model was transferred to a freezer (-80°C) and stored for a minimum of 3 hours before proceeding to cutting. Cutting skin models using the cryostat. The cryostat was set to -15°C and a section thickness of 6 µm. For cutting, the model in the mould was kept in the freezer at -20°C for 20 minutes to make it less brittle. It was fixed on the holder by freezing it in place with a drop of clear frozen section compound. The holder was inserted into the CM1520 cryostat (Leica), and sections of about 100 µm were cut at a time, while taking 6 µm sections in between and checking them under the microscope throughout the process to locate the model. When a good section was found, multiple sections were cut consecutively and mounted on a slide, which was then checked under a Primo Vert Cell Culture Microscope (Zeiss). Sections were mounted until the middle of the model was reached. The model was then returned to the freezer (-80°C). H+E staining. Slides with mounted sections were inserted into the staining slide unit (VWR) and fixed with 4% formaldehyde for 5 minutes at room temperature. The slide was immersed and dipped repeatedly in double distilled water for 30 s. The sections were then stained by inserting the staining slide unit into a staining dish (VWR) containing hematoxylin and repeatedly dipping for 3.5 mins. They were rinsed in tap water for 5 mins, again keeping them in continuous motion throughout. In sequence, the staining slide unit containing the slides with the mounted sections was dipped once into 1% hydrochloric acid (HCl) solution, rinsed in distilled water with 5 dips, dipped once into 0.075% ammonium solution and again rinsed in distilled water by dipping it 5 times. In the next staining step, the slides in the staining slide unit were dipped into eosin solution and moved up and down for 30 s. A serial dehydration was performed with 2 dips into 70% ethanol followed by 2 dips into 80% ethanol and 2 dips each in 2 staining dishes of 96% ethanol. The sections were fully dehydrated by immersing the slides in 100% ethanol for 5 mins two times using separate dishes. The slide staining unit was dipped 5 times into a mixture of xylene substitute and 100% ethanol (1:1). Ethanol was extracted by inserting the slide unit into xylene substitute for 5 mins twice using two separate dishes. The slides were dried under a fume hood for 25 to 30 mins.2 drops of xylene substitute mounting medium were added to each slide and each slide was covered with a cover glass. The final mounted slides were stored at 4°C. Imaging. Slides were imaged with an Evos M5000 microscope (Invitrogen). The sections were first inspected at 20x magnification and images were taken at 20x and 40x magnification. GFP-mRNA transfection of diseased cells Transfectability of diseased keratinocytes was assessed via transfection with green fluorescent protein (GFP). Cells were seeded in a 12-well plate at a seeding density of 1*105cells in 1 mL and incubated overnight. LNPs were prepared with eGFP mRNA and HPRT sgRNA to a total RNA content of 1 µg / mL as described previously in the LNP loading section. Cells were washed once with 1X PBS before adding 1 mL of the prepared LNP treatment. The plates were incubated for 48 hrs and imaged with an Evos M5000 microscope (Invitrogen) at 20x and 40x magnification. Base Editing c.877-2 A>G All transfections for base editing assessments were carried out on 12-well cell culture plates. The wells were seeded with 1*105cells in 1 mL of cell culture media one day in advance and were incubated overnight. Homology directed repair: The TGM1 mutation was addressed with CRISPR / Cas9 by homology directed repair (HDR). For an RNP-loaded LNP delivery approach, the previously described method of encapsulation was adjusted following a method previously described by Mirjalili et al. (2022).62 µM Cas9 Protein and 100 µM sgRNA were mixed at equimolar ratio and incubated for 5 mins. An equimolar amount of 100 µM donor template was added before the mix was brought to 25 µM concentration by adding IDTE buffer pH 7.5 and was incubated for a further 5 mins. Subsequently, normal LNP loading procedure was followed. To deliver RNA-loaded LNPs, the protocol for loading previously described in the LNP loading section was modified slightly: Cas9 mRNA, sgRNA and donor template in equal concentrations were mixed and incubated for 5 mins, while the rest of the method was not modified from base editing. The HDR editing strategy was assessed in HEK293 cells (sgRNA mismatch in one position) and immortalized ARCI patient keratinocytes. Formulations were prepared with Opti-MEM™ medium for HEK-293 cells and with supplemented EpiLife™ medium for ARCI keratinocytes. To increase proliferation, cytokines were added to some of the treatments. IL-17 and IL-22 were added to the media / Apolipoprotein E4 mix to a final concentration of 100 ng / mL each before adding it to the LNPs. The treated cells were incubated for 48 hrs at 37°C and 5% CO2. Cytosine base editors (CBEs): LNP formulations for the delivery of cytosine base editors to cells were prepared similarly to the standard preparation of mRNA-loaded LNP formulations described previously in the LNP loading section. The working stock concentration for the sgRNA / base editor mRNA solution varied between the 100 µg / mL described above and 1500 µg / mL, such that the final concentration of RNA in the formulation was up to 15 µg / mL. Accordingly, 10 µL of the sgRNA / base editor mRNA solution were mixed with LNPs at a working stock concentration of 10 mM to an N / P ratio of 6 (34.5 nmol or 3.45 µL LNPs per ng RNA, or per 11.49 µL RNA). Next, 25 mM sodium acetate buffer pH 4 was added until the mixture reached 100 µL, before it was incubated for 10 mins. As a last step, 900 µL of cell culture media with an added 1 µL of Apolipoprotein E4 was mixed into the RNA / lipids mixture. Base editor mRNA and sgRNA were additionally delivered via Lipofectamine™ RNAiMax as a secondary control for transfection. For each well, 90 µL of supplemented EpiLife™ media were added to 10 µL of base editor mRNA / sgRNA mix in a micro tube. In a second tube, 12 µL of Lipofectamine™ RNAiMax were combined with 88 µL of supplemented EpiLife media. The diluted RNA was mixed with the diluted Lipofectamine™ RNAiMax and incubated for 20 mins at room temperature.800 µL of cell culture media were added to the wells. After incubation, the RNA-Lipofectamine™ RNAiMax complex was added to the well, bringing the final volume to 1000 µL. The treated cells were then incubated for 48 hrs at 37°C and 5% CO2. In the base editing experiments, modified and unmodified BE4max-NG mRNA and modified BE4max-NRCH mRNA were assessed, using the corresponding sgRNA for each particular base editor. As a negative control, scrambled sgRNA without any targets in the human genome replacing the corresponding sgRNA in the formulation was used. The base editors were assessed in immortalized ARCI patient keratinocytes. Formulations were prepared with supplemented EpiLife™ medium for ARCI keratinocytes. DNA extraction, PCR, PCR-Purification After treatment, DNA was extracted from cells from base editing experiments and amplified for subsequent Sanger sequencing with PCR. PCR amplicon integrity was confirmed with agarose gel electrophoresis. Cells were collected in 200 µL of PBS into a 1.5 mL micro tube using a cell scraper. The genomic DNA was isolated from the suspension using a QIAamp® DNA Mini Kit (Qiagen, 51306), following the spin protocol for DNA purification from blood or body fluids. The DNA was eluted with 50 µL of DEPC-treated water, which was then incubated on the column for 5 mins before centrifugation. The DNA concentration was measured with a NanoDrop 2000 Spectrophotometer (Thermo Scientific). PCR was performed in a 25 µL reaction volume with Q5® High-Fidelity Polymerase as 2X Master Mix. Primers TGM1-E5 were used at a final concentration of 0.5 µM with a total amount of genomic DNA template of 60-70 ng. Initial denaturation was done at 98°C for 30 seconds, followed by 35 cycles of denaturation at 98°C for 10 seconds, extension at 71°C for 30 seconds and annealing at 72°C for 20 seconds, ending with a final extension at 72°C for 2 mins in a C1000 Touch® Thermal Cycler (Bio-Rad).20 µL of the amplicon were purified using the QIAquick® PCR Purification Kit (Qiagen, 28106) as per manufacturer’s protocol. Elution was done in 30 µL of elution buffer. Nucleic acid concentration was determined with a NanoDrop 2000 Spectrophotometer (Thermo Scientific). A sample of each amplicon was loaded on a 1% SYBR-safe stained agarose gel along a 1000 bp ladder to confirm integrity and size of the DNA. Visualisation was done on a Gel Doc XR+ imaging system (Bio-Rad). Sanger Sequencing Edits not resulting in indels cannot be quantified using the drop-off qPCR assay. A method to track those changes is sequencing the gene at the predicted editing site via Sanger sequencing. A double-stranded DNA template (dsDNA) is amplified in a PCR reaction with dideoxynucleotide triphosphates (ddNTPs) present. These do not possess a 3’-OH group, which prevents the formation of a diester bond and therefore binding of further nucleotides. The DNA polymerase generating the DNA sequence incorporates ddNTPs instead of dNTPs at random, which then terminates the chain. The extension products resulting from the PCR vary in length and are purified before sequencing. They are injected into a glass capillary containing a gel polymer, where an applied electrical field migrates anionic DNA products towards a cationic electrode. Products are separated by size, as smaller amplicons move through the gel at a faster rate. The ddNTPs at the end of the sequence are fluorescently labelled and detected by light emission at the end of the capillary. A software translates the signal into a base call and generates a data file with the DNA sequence, which can then be analysed for single base editing results (Kluesner et al., 2018). DNA sequencing of samples was performed by the Sequencing and Bioinformatics consortium, UBC, using a BigDye™ Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems). The extension products after PCR were separated in a 373048-capillary DNA Analyzer (Applied Biosystems), and were then detected by fluorescence emission. The results were finally analysed using SnapGene software (Insightful Science) and EditR software (Kluesner et al., 2018). Results were recorded as parts of the total area under the curve in the chromatogram for each base. Statistical analysis Values were displayed as the mean of three technical replicates ± standard deviation. If multiple biological replicated were measured, the mean of the biological replicates ± standard deviation was calculated from the technical means. Significance comparisons were done with a two-way ANOVA multiple comparisons test at a confidence level of 95% (P value < 0.05). Example 1: Design of the gene editing system Two editing strategies were designed for the TGM1 c.877-2 A>G mutation: Homology Directed Repair (HDR) and Cytosine Base Editors (CBEs). The design of the CRISPR / Cas9 based editing strategy using homology directed repair (HDR) is shown in Figure 2. An NGG-PAM close to the mutation site was chosen and an asymmetric, single strand RNA was designed as template. Other than the change from the mutation G to the wildtype A, a secondary mutation from G to C was introduced in the NGG-PAM to keep the Cas9 protein from binding again after a successful repair. The design of this base editing strategy was based on a cytosine base editor (CBE), which edits the C on the non-coding strand opposite of the A>G mutation to a T, and therefore also changes the mutation G on the coding strand to an A. The CBE chosen was BE4max with an editing window four to seven bases from the 5’ end of the sgRNA (Fig.3), and a preliminary strategy was designed for an NG-PAM with the mutation G being at the sixth base from the 5’ end. Alternatively, a strategy for an NRCH-PAM was designed to avoid editing of the bystander G neighbouring the mutation. For the NRCH-BE4max, the bystander was in position three from the 5’ end of the sgRNA and therefore outside the editing window. Example 2: Cell characterization and confirmation of the presence of a c.877-2 A>G mutation of the transglutaminase-1 (TGM1) gene The presence of the disease causing mutation TGM1 c.877-2 A>G ARCI was confirmed by sequencing (Fig 4), Western blot (Fig 5) and microscopically in skin models (Fig 6). The sequencing of cells with the TGM1 c.877-2 A>G ARCI mutation showed a clear chromatogram with guanosine (G) in place of adenosine (A) on the coding strand (Fig.4 iii). In comparison, sequencing of healthy keratinocytes did not show the splice site mutation (Fig.4 ii). The location of the splice site mutation was confirmed by alignment with the healthy gene sequence obtained from the National Center for Biotechnology Information (NCBI) (Fig.4 i). TGase-1, expressed as a truncated protein by mutated cells (Pigg et al., 1998), was imaged via Western blot. The loading was verified by imaging GAPDH. The membrane in Figure 5 i showed bands at approximately 50 kDa, and fainter bands to up to 65 kDa after incubation with TGase-1 antibody. After secondary incubation with GAPDH antibody the same membrane in Figure 5 ii showed additional bands at about 35 kDa. Skin models of ARCI cells (Fig.6 i) showed a less organised epidermis layer than a model of healthy keratinocytes (Fig.6 ii). The epidermis showed multiple disconnected sections and seemed porous in parts. The sections also showed a lighter colour in diseased models than in the model of healthy skin. Multiple visible dark spots in the dermis show invasion of keratinocytes in those layers. Summary and discussion of results: Sequencing of healthy keratinocytes was assessed qualitatively by checking the chromatogram and aligning the deducted sequence to the gene sequenced obtained from NCBI (Homo sapiens transglutaminase 1 (TGM1), mRNA [Internet].2022 Available from: http: / / www.ncbi.nlm.nih.gov / nuccore / NM_000359.3). The chromatogram of healthy cells allows clear statements about the sequence. Results were further confirmed by positive and negative quality controls run in parallel to the Sanger sequencing and by sequencing the samples on the coding and the non-coding strand. In alignment with the sequence from NCBI and the sequence from healthy keratinocytes, the mutation site could be clearly identified. It is the TGM1 c.877-2 A>G splice site mutation (also named TGM12526A®G or IVS5-2A®G), which was described previously in various publications (Pigg et al., 1998; Herman et al., 2009; Farasat et al., 2009; Bourrat et al., 2012) as a gene affected in patients with ARCI. On the Western blot membrane, bands are visible at approximately 50 kDa, with fainter bands ranging up to 65 kDa. Intact TGase- 1 protein would show at 92 kDa (Rice et al., 1990), so that it can be concluded that a truncated version of the protein is expressed in the ICH102 TGM1 c.877-2 A>G cells (Herman et al., 2009). This can be explained by the splice site mutation as illustrated in Figure 4. The splice site mutation leads to an additional G in the cDNA, which leads to a frame shift and a premature stop codon, truncating the protein. The fainter bands might indicate more intact, but nevertheless truncated versions of the protein resulting from a small fraction of intact cells. The molecular weight of the loading control GAPDH is given as 37 kDa by the supplier (GAPDH (14C10) Rabbit mAb [Internet]. Cell Signaling Technology. Available from: https: / / www.cellsignal.com / products / primary-antibodies / gapdh-14c10-rabbitmab / 2118). This concurs with the bands seen at approximately 35 kDa. The skin models built with diseased cells show signs of ARCI, such as parakeratosis, which describes insufficient maturation of keratinocytes and retention of nuclei in the epidermal layer. Histopathology of ARCI biopsy shows some of these symptoms, but the skin section is much clearer in the cut and shows a porous stratum corneum with many layers of flattend keratinocytes (Yang et al., 2016). The epidermal layer in the model appears much thinner, porous, and disordered. However, the models have a low number of cells and show little staining, apparent by the much lighter colour in comparison to the skin model of healthy keratinocytes. Example 3: Treatment of diseased cells To evaluate if the cells can be successfully transfected, cells were transfected GFP-mRNA was conducted. While the untreated control (Fig.7 i) and treatment with unencapsulated GFP-mRNA (Fig 7 ii) showed no GFP-expression, transfection with a lipofection agent (Fig.7 iii, iv) showed GFP expression, shown in green, in cells. Transfection with mRNA-loaded DOPE LNPs (Fig.7 v vi) showed some GFP- expression, yet at a lower rate than with lipofection. The HDR design was tested in HEK293 cells (Fig.8), as they are proliferating at a higher rate than keratinocytes. However, the mutation is not present in those cells, therefore editing of the mutation site was not expected. Editing with a P value < 0.0001 (****) of the secondary site within the NGG-PAM was achieved with a treatment of 10 µg mRNA / mL. Normalised to unedited HEK cells, 30.8 ± 1.1% of cells showed the edit in the coding strand and 9.4 ± 0.5% of cells the edit on the non-coding strand. No editing was achieved in transfection with mRNA-loaded LNPs. The delivery of 10 µg mRNA and sgRNA / mL via lipofection was repeated in diseased cells with the TGM1 c.877-2 A>G mutation. To assess if proliferation influenced editing efficiency, cells treated with cytokines to induce proliferation were also edited (Fig.9 i). For the primary edit of the mutation site, higher efficiencies were achieved on the non-coding strand, with 5.9 ± 0.4% editing in cells without cytokines and 5.1 ± 0.3% editing in cells treated with cytokines. The highest editing rates were achieved in the secondary site on the coding strand. Cells not treated with cytokines showed 53.5 ± 6.1% editing, while cells treated with cytokines showed 42.5 ± 4.9% editing on average. In the chromatogram of the edited coding strand (Fig.9 ii) double peaks can be seen at both editing sites. The peaks are distinguishable from background. In cells treated with 15 µg / mL NG-BE4max mRNA and sgRNA (Fig.10 i), significant editing was achieved with delivery via transfection. The highest editing rate of 4.6 ± 0.9% was achieved with modified mRNA delivered via lipofection. This is significantly higher than the editing values for the negative control with a P value < 0.0002 (***). In comparison to unmodified mRNA, significantly higher editing percentages were achieved with modified mRNA with a P value < 0.0021 (**). Lipofection of unmodified mRNA yielded a mean editing percentage of 1.0%. A chromatogram of the edited sites (Fig.10 ii) after lipofection treatment show a double peak for lipofection. NRCH-BE4max was only used as modified mRNA. When cells were treated with mRNA in a concentration of 15 µg / mL, significant editing compared to the negative control was achieved via lipofection (Fig.11 i). On the coding strand, 4.9 ± 0.2% of cells were edited, while on the non- coding strand 5.3 ± 0.6% of cells were edited. Differences are due to uncertainties in the measurement method. A chromatogram (Fig.11 ii) confirms the data by showing a clearly from the background distinguishable edited peak after lipofection treatment. Editing efficiency of the G neighbouring the target mutation was calculated. After treatment with NG-BE4max via different transfection measures at a high dose the bystander shows some editing, but less than 2%. The difference to the negative control is not significant. For NRCH- BE4max, a similar pattern of slight editing shows, but no significant difference to the negative control is seen. Especially the transfection with mRNA- loaded LNPs seems to lead to better editing rates. Results are displayed in Figure 12. Methods established to edit the mutation causing ARCI were all shown to result in editing of the target as confirmed when modified base editor mRNA was delivered via lipofection. Example 4: Exemplary lipid nanoparticle formulations for gene editing Results A pool of LNP formulations was screened to identify compositions that are efficiently taken up by the target cells - primary human keratinocytes (KC), that constitute ≥ 90% of the epidermal skin layer. Therefore, internalization of LNP composed of five different helper lipids that vary structurally and charge-wise (Fig.14 A; 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), DOPE, 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), ES, and 1,2-dioctadecanoyl-sn- glycero-3-phospho-(1′racglycerol) (DSPG)) was assessed (Figure 14). Simultaneously, the impact of increasing PEG concentrations (0.5%, 1.5%, and 5%) and cell uptake in the presence and absence of apolipoprotein (Apo) E which facilitates cell uptake via the low-density lipoprotein receptor in vitro and in vivo was tested. ApoE improved the LNP cell internalization for most helper lipids, although the impact varied (Figure 14 B). Except for DSPG LNPs, 1.5% pegylated LNPs consistently yielded the highest uptake rates.5% PEG decreased the cell internalization which is also in line with previous studies

[0033] . Based on these results, we decided to proceed with ApoE addition and 1.5% pegylated DSPC-, DOPE, and DOPC-LNPs. Next LNPs were loaded with Cas9 RNP (1:1 weight ratio Cas9 protein / sgRNA) or Cas9 mRNA (1:1 ratio mRNA / sgRNA). The gene editing efficacies of the different LNP formulations in primary human KC were quantified and the impact of different lipid-to-RNP (L / R) (250, 500, 750; for RNP) and nitrogen-to-phosphate ratios (N / P 3, 6; for mRNA) assessed. Gene editing efficacies were determined by a PrimeTime qPCR assay that quantifies the percentage of indel formation indicative of gene editing in our exemplary target loci HPRT using intercalating dyes. This assay accurately detects the frequency of gene edits at ≥ 5%. In KCs, indels of 5-15% with RNP-loaded LNPs and 10-16% with mRNA-loaded LNPs were observed, depending on the ratio and the helper lipid (Figure 14 C, D). Although the overall impact of the L / R and N / P ratio low, L / R ratio 500 and N / P ratio 6 consistently performed best. Lipofection with RNAimax, which served as a reference, yielded the highest gene editing efficacies with ~24% for RNP, but proved less efficient for mRNA delivery than LNP. This finding may also point toward challenges related to RNP loading in LNP. They are typically loaded in an acidic buffer (~pH 4) which ensures that the ionizable lipids are positively charged and the negatively charged genetic cargo can be efficiently encapsulated. As outlined above, pH 4 causes protein denaturation and, hence activity loss. To assess the impact of the buffer pH on RNP activity, the pH during loading was varied and the editing efficacy assessed. Less acidic conditions resulted in significantly higher indel formation indicative of higher RNP activity (Fig.14 E). This data shows that the RNP complex tolerates an acidic pH for a short period of time without undergoing complete inactivation. Next, cytotoxicity of LNPs in KC was determined by assessing their metabolic activity via MTT assay and live / dead cell staining. First, the MTT data indicate distinct inter-individual sensitivity dependent on the cell donor. Overall, empty and RNP-loaded LNPs resulted in cell viabilities >70%, whereas mRNA loaded LNPs triggered more pronounced cytotoxicity especially at N / P 6 and N / P 9 (Fig.15 A-C) which may be attributed to mRNA immunogenicity (Sahin et al., 2014). Live / dead cell assays confirmed the MTT (Fig.15 D, S3). Cell uptake kinetics and intracellular trafficking of LNPs in KCs was determined. While only little intracellular localization was visible after 30 min and 2 h, significant uptake of both DiI-labelled LNPs and GFP-tagged RNP occurred after 8h which further increased over 24h (Fig.15 F). LNP uptake mechanisms in KCs were assessed by pre-incubating the cells with endocytosis pathway inhibitors. No difference in LNP uptake was observed after pre-treatment with clathrin- and actin- mediated cell uptake inhibitors. However, a dramatic decline of LNP uptake was observed when blocking dynamin-dependent pathways (Fig.15 E) suggesting that LNP uptake in KCs is largely dynamin-dependent (Stadelmann et al., 2022). It is well established that LNP internalization is cell-type specific and contingent on the LNP composition (Rennick et al., 2021). Alternative dynamin-dependent processes such as caveolae- and endophilin-mediated endocytosis may also contribute to LNP internalization. Once internalized, LNPs enter endosomes from which they need to escape to yield functional effects. In general, less than ≤ 2% eventually reach the cytosol ultimately limiting LNP efficacy and requiring higher doses to induce a therapeutic effect (Gilleron et al., 2013; Maugeri et al., 2019). The endosomal route of a particle once more depends on the LNP composition, size, zeta potential and the cell type (Schlich et al., 2021; Zheng et al., 2022). The endosomal localization of mRNA and RNP-loaded LNPs in KCs was investigated (Fig.16) noting a different compartmentalization for these genetic cargos. RNP-LNPs predominantly colocalized in recycling (RAB11A+) and late (LAMP1+) endosomes, whereas only few mRNA-loaded LNPs were detected in late endosomes. No colocalization with EEA1+ early endosomes was observed for both mRNA and RNP. Ionizable lipids (IL) are often used in LNPs as they govern distinct RNA protecting effects, facilitate the cytosolic transport and, thus, determine LNP efficacy (Kuökarni et al., 2019; Han et al., 2021). IL possess a pKa which ensures that the lipid is neutral under physiological conditions (Kulkarni et al., 2020), and positively charged at acidic pH to enable efficient entrapment of genetic cargo. By incorporating IL, carrier-related side effects are significantly reduced while the therapeutic index can be improved by several orders of magnitude (Ankic et al., 2019; Kulkarni et al., 2021). A variety of mRNA-loaded LNP formulations containing IL that cover a pKa range between 5.4– 8.1 was tested while the rest of the LNP composition remained unchanged. While no major differences were observed for LNPs containing IL with a slightly acidic pKa, increased editing efficacies (≥ 50%) for IL with pKa ≥7.0 were observed (Fig.17 A). Compared to the initial MC3-based LNP formulation, gene editing efficacy increased to 72% for LNP H, 68% for LNP J, 65% for LNP K, 55% for LNP L, and 64% for LNP M. Similar to the cytotoxicity data shown in Fig.15, these mRNA-loaded formulations also reduced cell viabilities by 50% after 48 h in KC monolayers (Fig.17 C). Intrigued by the fact that a more neutral pKa increased gene editing efficacies in primary human KCs, this concept was gransferred to other primary epithelial cells and cells derived from different germ layers. A similar trend in primary human bronchial epithelial cells, endothelial cells and, fibroblasts in which LNP H (pKa 7.1) resulted in significantly higher gene editing rates compared to other LNPs (Fig.17 B). Across all tested cell types, LNPs with an IL pKa of 8.1 yielded the lowest editing efficacies. Such a bell-shaped relationship between pKa and potency has been previously demonstrated for siRNA, for which the pKa optimum was ~ 6.2 - 6.5 beyond which LNP potency declined rapidly (Jayaraman et al., 2012). Next the performance of the lead LNPs (DOPE-MC3 LNP and LNP H) was tested in actual 3D skin tissue. Freshly excised human skin from plastic surgeries and 3D bioengineered skin models were used to closely recapitulate clinical scenarios. The skin models closely resemble human skin, are well differentiated and as such exhibit all relevant skin layers and terminal skin differentiation markers (Hönzke et al., 2016). Human skin is a first defense line of the human body and, thus, forms a very restrictive barrier which efficiently prevents the penetration of nanoparticles even in diseased states (Giulbudagian et al., 2018). Consequentially, when aiming for in situ gene editing in epidermal skin layers, a pre-treatment of the skin is warranted to aid the penetration of LNPs across the stratum corneum and into the viable epidermis. This is particularly important for genetic disease like congenital ichthyoses which are accompanied by a thickening of the stratum corneum (hyperkeratosis). Two approaches were utilized: a microneedle-based approach (400 µm length) and a clinically approved Er:YAG fractional ablative laser (P.L.E.A.S.E.® Professional) which allowed targeted pore formation in epidermal skin layers and perforation of the stratum corneum. Subsequently, RNP- or mRNA-loaded LNPs were topically applied (Fig.18A). Overall, in situ gene editing rates between 5%-12% were obtained after a single-application of mRNA or RNP-loaded LNPs in excised human skin and bioengineered 3D skin models (Fig.18 A). Notably, due to limited availability of freshly excised human skin, the predictivity of 3D skin models was assessed noting matching editing rates. This is also particularly relevant for future proof-of-concept studies in disease models as excised skin from genodermatoses patients is typically not available, rendering bioengineered disease models critical for further preclinical testing. Overall, no significant differences between skin pre-treatments with MN or the laser were observed. Varying the pulse energies of the laser also did not affect the outcomes significantly. This is in line with previous studies showing that while higher pule energies influence the depth of the micropores, the total drug delivery does not necessarily increase (Bachhav et al., 2010; Weiss et al., 2012). No significant differences were observed between DOPE-LNPs (~14% editing in KC monolayers) and LNP H (~71% editing in KC monolayers) in actual skin tissue (Fig.18 B, C). It is noteworthy, that correcting 5%-10% of disease-causing mutations suffice to alleviate the most severe symptoms (Hainzl et al., 2017; Wu et al., 2017) and restore the skin barrier function (Aufenvenne et al., 2009). The editing rates of the tested LNP formulations fall within this window. In situ editing efficiency might be increased by repeated application. To assess a potential skin irritating effect of the treatments, the release of classic pro- inflammatory cytokines IL-6 and IL-8 from both skin models was quantified (Fig.18 D) and excised human skin. In both cases, cytokine release was in the low nanogram range and no significant increase in was observed for all tested conditions compared to untreated skin samples (Fig.18 D) RNP could still be detected after 72 h in primary human KCs and bronchial epithelial cells (Fig.19 A) indicative of the cell specific kinetics for RNP degradation. Previous studies mostly determined intracellular Cas9 protein presence in rapidly proliferating cancer cell lines which may be one reason for the discrepancy. Primary epithelial cells usually proliferate at much slower rates which results in less dilutive effects. To gain a first indication for potential off-target edits, the frequency of off-target effects in eight predicted sgRNA-dependent off-target sites after treatment with the efficient formulation LNP H using rhAmpSeq analysis were tested (Fig.19 B, C). Due to similar efficiencies and the ease of manufacturing, mRNA loaded LNPs produced via rapid mixing were selected only for all subsequent studies. With rhAMPSeq, an allele frequency analysis was performed to identify indels (small insertions or deletions of ≤50 base pairs) and single nucleotide variants (SNV). While the sequencing confirmed the on-target effects (see Fig.17 A), no off-target edits were detected in any of the predicted off-target sites (Fig.19 B). Background indel frequencies in both, treated and control samples in the very low percentile range were observed. It should be noted that rhAMPSeq detects edits at frequencies ≥ 0.5% with very high specificity and sensitivity, whereas ≤ 0.5% is the detection limit (Kath et al., 2022). The indels ranging between 0.44 – 0.5% that occur in both, treated and untreated samples are most likely due to a genomic motif that rhAMPSeq has difficulties reading which is corroborated by the fact that this was observed across different donors. This example provides proof-of-concept that lipid-based delivery systems can correct actual disease-causing mutations. For the disease of interest, ARCI, the most common mutation is TGM1 c.877-2 A>G which affects up to 1 / 3 of ARCI patients (Fig.20A, B) (Herman et al., 2009). This splice site mutation causes a premature stop codon resulting in a truncated and, thus non- functional version of transglutaminase 1 (TGase 1). TGase 1, however, is a critical enzyme for the crosslinking of the skin’s outermost barrier, the stratum corneum. A lack of TGase 1 results in a significantly disturbed skin barrier function characterized by increased transepidermal water loss and increased susceptibility to skin infections which can even cause life-threatening conditions especially in newborns (Crumrine et al., 2019). To correct TGM1 c.877-2 A>G, exemplarily the cytosine base editor NG-BE4max was selected which targets the non-coding strand, thus, causing a base exchange from the mutant G back to the wild-type A on our target strand (Shan et al., 2021; Koblan et al., 2018). A modified and an unmodified base editor mRNA were prepared and their editing efficacy assessed in ARCI patient cells using RNAimax. This treatment resulted in editing rates of 4.6 ± 0.9% with the modified mRNA, while unmodified (uridine 5'-triphosphate) mRNA yielded no detectable edits (Fig.20). The modified base we used is N1-methyl pseudouridine to replace normal uridine triphosphate during in vitro transcription as it has previously been suggested to enhance protein expression and reduce immunogenicity in mammalian cells and mice (Andries et al., 2015; Nance et al., 2021). Conclusion A topically applicable in situ gene editing approach resulting in clinically relevant editing rates in human skin tissue via LNP mediated gene delivery is presented. While only minor LNP composition effects on gene editing rates were detected when varying helper and PEG lipids, ionizable lipids with a pKa > 7.0 increased the gene editing efficacy in primary epithelial and mesenchymal cells while no guide RNA-dependent off-target effects were detectable. Following skin pre-treatment with microneedles and laser ablation to facilitate and guide intraepidermal LNP, in situ editing rates ≥5% in skin tissue were obtained without inducing pro-inflammatory cytokine release. Correcting 5-10% of disease-causing mutation of ARCI suffices to offset the most severe symptoms. Hence, the gene editing rates resulting from the demonstrated one-time application are putatively in the therapeutic window. Taken together, this example describes a topical LNP-based approach yielding clinically relevant in situ gene editing of TGM1 c.877-2 A>G ARCI in human skin. Methods used within example 4 Materials and primary cells: Single guide RNAs (sgRNAs), GFP-tagged siRNA, Cas9 protein nuclease, PCR primers and probes and PrimeTime qPCR mix, rhAMP sequencing library kit, and index primers were obtained from IDT (San Jose, CA, USA). The Cas9 mRNA was purchased from TriLink Biotechnologies (San Diego, CA, USA) and GFP-labeled Cas9 protein nuclease from GenScript (Piscataway, NJ, USA). Epilife® medium and Epilife® defined growth supplements, Dulbecco’s modified eagle’s medium (DMEM), fetal bovine serum, and penicillin were purchased from Fisher Scientific (Mississauga, ON, Canada). Mouse monoclonal antibody against Cas9 (ab191468) and live and dead cell assay were purchased from Abcam (Cambridge, MA, USA). ApoE4 (Apolipoprotein 4) was purchased from Peprotech (Rocky Hill, NJ, USA). Primary human keratinocytes (KCs) were isolated from excised human skin or juvenile foreskin according to standard procedures (written consent was obtained, CREB# H19-03096). KCs were maintained in Epilife® media. All cells were maintained at 37°C in a humidified atmosphere of 5% CO2. were prepared by injecting the lipid mixture dissolved in ethanol at appropriate ratios to a final concentration of 10 mM lipid with an aqueous phase containing Cas9 or NG-BE4max mRNA and HPRT or TGM1 sgRNA through a T-junction at a 3:1 volume ratio and an amine-to-phosphate (N / P) ratio of 6 (Kulkarni et al., 2018). Flow rates were set to 5 mL / min for the lipid phase syringe and 15 mL / min for the aqueous phase syringe containing the RNA dissolved in 25 mM sodium acetate (pH 4) culminating in an output flow rate of 20 mL / min. The resulting formulation was then dialyzed in Spectra / Por 212-14kD MWCO dialysis tubing (Spectrum Labs) against 1000-fold volume of phosphate-buffered-saline (pH 7.4) overnight at room temperature to remove the ethanol. Formulations were then sterile filtered and concentrated to target nucleic acid concentrations in 10kDa Amicon filters (Sigma-Aldrich). For the bench-top mixing approach, empty LNPs were prepared as described above followed by cargo loading (Kulkarni et al., 2020). Here, RNP complexes were formed by combining sgRNA with the Cas9 protein at 1:1 equimolar ratio in ITDE buffer at pH 7.5 to a final working concentration of 25 µM, followed by incubation at room temperature for 5 minutes. For LNP-RNP complexation, 100 nM RNP (pH 7.5) were mixed with LNPs at L / R 250, 500 and 750 (LNPs amounts with initial stock of 3 mM; 0.026 μmol (L / R 250) 0.053 μmol (L / R 500) and 0.079 μmol (L / R 750)). For mRNA encapsulation, sgRNA and Cas9 mRNA were mixed with 1:1 equimolar ratio to 10 µg / ml final working concentration. To prepare LNP-mRNA formulations, 1 µg of 10 µg / ml working concentration was mixed with LNPs at N / P ratios of 3, 6, or 9. After initial complexation of mRNA or RNP with LNPs in sodium acetate buffer (pH 4), media was added and ApoE was spiked in yielding a final concentration of 1 µg / ml. The final lipid concentration was measured using the Total Cholesterol Assay kit (Wako Chemicals, Richmond, VA, USA). A typical LNP formulation would contain the following lipids: ionizable cationic lipid, phospholipid, cholesterol, and PEG-lipid at 50 / 10 / 38.5 / 1.5 mol% respectively. For systems containing fluorescent labels, DiI-C18 (Invitrogen, Carlsbad, CA) was included at 0.2 mol% at the expense of cholesterol. Similarly, for higher PEG-lipid contents, cholesterol was decreased. Except for MC3, all other ionizable lipids were novel proprietary cationic lipids synthesized by NanoVation Therapeutics. To assess the impact of buffer pH on RNP activity, we prepared the RNP solution in buffer of varying pH (pH 4 – pH 7) before adding it to the lipids that were dispersed in a pH 4 acetate buffer. Following the addition of the RNP to the lipids, a neutral buffer or cell culture medium was quickly added to adjust the formulation to pH 7.4. Cellular Internalization Studies: Cellomics ArrayScan: Keratinocyte internalization was semi- quantified using the Cellomics ArrayScan (ThermoFisher, Burnaby, BC, Canada). After cell seeding, 1 µg / ml siGFP-RNA was loaded onto the fluorescently labelled LNPs, being composed of DOPC, DSPC, DOPE, DSPG and ES as ionizable lipids, with 0.5%, 1.5%, and 5% polyethylene glycol (PEG) content at N / P 6. Subsequently, 3 µl sodium acetate buffer (pH 4.0) and cell culture media was added to a final volume of 100 µl. Lastly, ApoE4 was spiked in at 1 µg / ml, followed by 10 min incubation at room temperature. The uptake efficiency was then tested in the presence or absence of ApoE. After 24 hours of treatment, the cells were washed twice with PBS and subsequently fixed with 4% formaldehyde. Fluorescence intensity was then quantified using a Cellomics ArrayScan Infinity HCS Reader. study the cellular uptake, 5×105KCs were seeded onto 35 mm glass plates overnight and were subsequently incubated with RNP complexes (GFP-Cas9 nuclease protein + sgRNA) loaded onto and Dil-labeled DOPE-LNPs (L / R 500). DAPI Fluoromount-G (Southern Biotech, AL, USA) was used for nucleus staining. Live cell images were taken every 30 min for up to 3 h using a Carl Zeiss confocal laser scanning microscope (LSM510 META NLO, Carl Zeiss Jena GmbH, Germany). analyze the endocytic mechanisms of LNP uptake in KCs, DiI- labeled-LNPs were added to KCs that were pre-treated with 10 µM Dyngo (inhibitor dynamin- dependent cell uptake; Abcam, CatNr. ab120689), 5 µM PitStop (inhibitor clathrin-mediated cell uptake; Abcam, CatNr. ab120687), and 2 µM CytochalasinD (macropinocytosis inhibitor; Sigma- Aldrich, CatNr. C8273) and co-incubated for 6 h. Subsequently, the cells were fixed with 4 % formaldehyde solution, washed, and mounted with Fluoroshield™ containing DAPI (Sigma- Aldrich, CatNr. F6057) overnight at 4 ^C. Fluorescence imaging was conducted with a Keyence BZ-X810 All-in-One Fluorescence Microscope. Intracellular trafficking: To determine the localization of LNP in endosomes, KCs were treated with empty, mRNA, and RNP DiI-labelled LNPs for 6 h and 24 h. Subsequently, immunofluorescence staining was conducted as per standard protocols. Briefly, cells were fixed with a 4 % formaldehyde solution washed with PBS, and permeabilized with 0.5 % (v / v) Triton-X- 100 (VWR, CatNr.97063-864). Blocking was achieved with normal goat serum (ThermoFisher Scientific, CatNr. PCN5000, 1:20 diluted in PBS) for 30 min at RT. Primary antibodies against EEA1 (Invitrogen, CatNr.14-9114-82, dilution 1:1000), RAB11A (Invitrogen, CatNr.71-5300, dilution 1:350), and LAMP1 (Abcam, CatNr. ab25630, dilution 1:1000) were added to the cells overnight at 4 °C. Then, KCs were washed and incubated with the corresponding Alexa Fluor® 488-conjugated secondary antibodies (Abcam CatNr. ab150113 & ab150077, dilution 1:400). After air drying, KCs were mounted with Fluoroshield™ with DAPI overnight at 4 °C. The cytotoxicity of unloaded and loaded LNPs was investigated by 3-(4,5- dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT) assay. Here, 1×104cells KCs and HKPs were seeded in 96 well culture plates, respectively and cultivated until ~70% confluency. Subsequently, the cells were treated with 1 µg / ml mRNA, 100 nmol RNP-loaded, or unloaded LNPs at 37℃ for 24 hours. Subsequently, 10 μl of a 5 mg / mL MTT solution was added to each well and the plates were incubated for 4 hours. The MTT formazan crystals were then dissolved in 50 μl DMSO. Finally, the absorbance was measured in a microplate reader (BioTekuQuant, Winooski, VT, USA). Live and dead cell assay: To visualize the cytotoxic effect of RNP- and mRNA- loaded LNPs on the viability of KCs, live dead cell assay (ab115347, Abcam, UK) was performed according to the manufacturer’s instructions. KCs were cultured as described and seeded in the chamber slides (177445, Thermo Fisher Scientific, USA) and treated with RNP- and mRNA- loaded LNPs (DOPE, L / R 500) for 24h and 48h. Cells were rinsed with PBS and stained with 10x dye solution diluted in PBS and imaged using a fluorescence microscope (EVOS M5000 cell Imaging System, Thermo Fisher Scientific). cellular uptake of RNP complexes (GFP-Cas9+sgRNA)-loaded onto Dil-labelled LNPs was visualized by confocal microscopy. KCs were seeded on sterile coverslips overnight and treated with RNP-loaded LNPs (DOPE, L / R 500). After 30 min, 1h, 2h, 8h and 24 h, cells were washed and fixed with 4% formaldehyde for 5 minutes at RT. Cell nuclei was stained with DAPI (ab104139, Abcam, UK) and the slides were imaged using a confocal microscope (LSM700, ZEISS). First, 5x105KCs were seeded in 6-well plates.24 h later, the cells were transfected according to the above-mentioned protocol with both RNP- and mRNA-loaded LNPs. After 48 h, the genomic DNA was isolated using the Qiagen DNeasy Blood&Tissue Kit (Toronto, ON, Canada) according to the manufacturer’s protocol. Then, the genomic DNA was amplified by PCR using 10 µM HPRT primers and 5 µM of reference and drop-off probes, PrimeTime master mix and water at a final reaction volume of 20 µl. The drop-off probe is designed to bind the wild type template only and targets the predicted cut sites. A PCR program was run with an initial denaturation of 95°C for 3 mins, followed by 40 cycles of 95°C for 15s, and annealing / extension at 60°C for 1 min. Gene editing efficiency (= indel formation) of the formulations was determined by ΔΔCT values of drop-off and reference probes and normalized to the wild-type cells. In situ gene editing efficacy: To evaluate the gene editing efficacy in situ freshly excised and reconstructed human skin was utilized.3D bioengineered skin models were generated according to previously published procedures (Hönzke et al., 2016). First, primary human fibroblasts and keratinocytes were isolated from juvenile foreskin (CREB approval # H19-03096). Then, 3x105fibroblasts were embedded in a matrix consisting of fetal bovine serum and bovine collagen I (PureCol, Advanced BioMatrix, San Diego, USA) at a neutral pH. After solidification, primary human keratinocytes (4.2 x 106per model) were seeded on top. After 24 h, the skin models were lifted to the air-liquid interface and further cultivated with media change every other day. At day 14, the models were treated as described below. Alternatively, excised human belly skin was obtained from plastic surgeries (CREB approval # H19-03096). The excised skin was cleaned from adipose layers and punched into 2 cm discs. To facilitate intraepidermal delivery, the skin was then pretreated with 400 µm long solid microneedle arrays and subsequently mounted onto Franz diffusion cells (static-type, volume 12 mL, diameter 15 mm) (Honzke et al., 2016). The stratum corneum was facing the air and the dermis in contact with PBS pH 7.4 which served as receptor fluid. After 30 min equilibration time, 50 µL DOPE-LNPs (5 mM) loaded with Cas9 mRNA or RNP complexed with HPRT sgRNA was topically applied. After 48 h, the skin sections were removed from the Franz cells system followed by overnight incubation at 4°C in dispase (Worthington Biochemical Corp, Lakewood, NJ, USA) for dermis-epidermis separation. On the next day, gDNA was isolated from the epidermal layer as described above. For laser-assisted microporation, skin models were pre-treated using the P.L.E.A.S.E. ® device (Precise Laser Epidermal System, Pantec Biosolutions AG, Liechtenstein) with the following parameters: with 2 pulses per pore, pore density of 5%, array size of 14 mm, pulse duration of 125 us, pulse energy or fluence of 14.5 J / cm2(repetition rate of 300 Hz, 1.1 W) and 17.8 J / cm2 (repetition rate of 200 Hz, 0.9 W). Subsequently, 50 ul of DOPE and LNP H formulations loaded with Cas9 mRNA were topically applied and incubated for 48 h followed by gDNA isolation. To visualize the micropores in the skin excised human skin were topically treated with Dil-labeled LNPs for 24h. The non-laser treated skin samples served as control. The tissue blocks were then cryo-sectioned using a cryostat (Leica CM 1520) and imaged using a fluorescence microscope. ELISA: Media from skin models and excised human skin after microneedle or laser and / or LNP treatment was diluted at a ratio of 1:100 up to 1:500 and probed for cytokine expression using the IL6 or IL8 Human Uncoated ELISA Kit (ThermoFisher, Burnaby, BC, Canada) as directed by the manufacturer. Absorbance was measured at 450 nm in a microplate reader (BioTekuQuant, Winooski, VT, USA). Western Blot: 1×105KCs were seeded in 12-well plates and transfected with RNP (L / R 500) loaded DOPE-LNP for 24h, 48h and 72h. Subsequently, the cell lysates were extracted with radioimmunoprecipitation assay buffer containing proteinase inhibitor cocktail, incubated for 30 min on ice and centrifuged at 14,000 rpm for 30 min. The amount of proteins was quantified using Bradford assay (Bio-Rad, Mississauga, ON, Canada).10 μg of protein were then separated using an 8% gradient polyacrylamide gel under reducing conditions. Protein was then transferred to the nitrocellulose membrane and after washing the blots were incubated with a rabbit polyclonal antibody against Cas9 (1:1,000 in TBST) overnight. To normalize detected protein levels, equal loading across the gel was confirmed by probing for GAPDH. The membrane was incubated with rabbit monoclonal antibody anti-GAPDH (1:5,000 in TBST) overnight and detection was done with fluorescence dye conjugated goat anti-rabbit secondary antibody (1:5,000 in TBST, 1 hr incubation) on the Odyssey CLx imaging system (LI-COR). Off-target effect analysis and rhAMP sequencing: Potential off-target binding sites of the gRNA were nominated using GUIDEseq as described previously by Tsai et al (Tsai et al., 2015). Here, we focused on the eight most likely off-target sites based on which the rhAMP Seq amplification and index primer panels were selected and prepared according to the manufacturer’s protocol (IDT, Coralville, IA, USA). KCs were treated with mRNA-loaded LNP H 48 h as described above. Subsequently, the genomic DNA was amplified by PCR using 50 µM rhAMP reverse and forward primers pool, 5 µl of 4X library mix and water for the final reaction volume of 20 µl. The first PCR used 14 cycles with annealing temperature at 61 °C for each sample. The PCR products were immediately cleaned with Agencourt AMPure XP beads (Beckman Coulter, Canada) followed by washing with 80% ethanol and drying at room temperature for 3-5 mins. Next, for indexing PCR, 5 µM of both i5 and i7 indexing primers were used along with 5 µl of library mix and water for the final reaction volume of 20µl. Amplification was performed using 24 cycles with an annealing temperature at 60 °C. The indexed PCR products were pooled and again cleaned with Agencourt AMPure XP beads as mentioned before. Finally, the indexed libraries were quantified, and sequenced on an Illumina (Illumina, San Diego, CA, USA) MiSeq (2 × 150 bp) sequencer (San Diego, CA, USA). rhAMP Seq sequencing data for all the samples were analyzed using rhAMP analysis Tool (IDT, Coralville, Iowa, USA). plasmid (pBT376, plasmid #125617) containing T7-SV40(NLS)-Apobec-1-Cas9(N) was purchased from Addgene and was linearized with PmeI (NEB, Whitby, ON, Canada). RNAs were in vitro transcribed using T7 RNA polymerase and GTP, CTP, ATP and N1-methyl pseudo-UTP (ChemilyBio, Peachtree Corners, GA, USA).5’ Cap and poly(A) tail were added post-transcriptionally with ScriptCap¬¬TM m7G Capping System and A-PlusTM Polymerase Tailing Kit (CellScript, Madison, WI, USA). RNA was purified using a Qiagen RNeasy Kit (Toronto, ON, Canada). The integrity of the RNA was verified by gel analysis. patient cells harbouring the disease-relevant mutation c.877-2 A>G were provided by Dr. Keith Choate (Dermatology, Yale University).1*105ARCI cells were seeded and subsequently treated with a final concentration of 15 µg / mL sg / mRNA encapsulated in the lipid transfection agent RNAiMax. Scrambled sgRNA served as negative control. After 48 h, gDNA was extracted and amplified followed by Sanger sequencing with PCR (Table S1). PCR was performed in a 25 µL reaction volume with Q5® High-Fidelity Polymerase as 2X Master Mix. Primers TGM1-E5 were used at a final concentration of 0.5 µM with a total amount of genomic DNA template of 20 ng. PCR amplicon integrity was confirmed with agarose gel electrophoresis.20 µL of the amplicon were purified using the QIAquick® PCR Purification Kit. A sample of each amplicon was loaded on a 1% SYBR-safe stained agarose gel along a 1000 bp ladder to confirm integrity and size of the DNA. Visualisation was done on a Gel Doc XR+ imaging system. Edits were determined by Sanger sequencing (Kluesner et al., 2018). Statistical analysis was performed using Prism Graphed 9.5 software (San Diego, CA, USA). Each experiment was performed at least in triplicates and results are shown as mean ± standard deviation (SD). The statistical significance was determined using one-way ANOVA followed by Dunnett or Tukey’s multiple comparison test. p values ≤ 0.05 were considered statistically significant. For base editing experiments, statistical significance was assessed with a two-way multiple comparison ANOVA.

[0002] REFERENCES Aida Maranduca M, Liliana Hurjui L, Constantin Branisteanu D, Nicolae Serban D, Elena Branisteanu D, Dima N, et al. Skin - a vast organ with immunological function (Review). Exp Ther Med.2020 Jul;20(1):18–23. Kabashima K, Honda T, Ginhoux F, Egawa G. The immunological anatomy of the skin. Nat Rev Immunol.2019 Jan;19(1):19–30. Matsui T, Amagai M. Dissecting the formation, structure and barrier function of the stratum corneum. Int Immunol.2015 Jun;27(6):269–80. Candi E, Schmidt R, Melino G. The cornified envelope: a model of cell death in the skin. Nat Rev Mol Cell Biol.2005 Apr;6(4):328–40. Ain QU, Campos EVR, Huynh A, Witzigmann D, Hedtrich S. Gene Delivery to the Skin – How Far Have We Come? Trends Biotechnol [Internet].2020 Aug 29 [cited 2022 Oct 11]; Available from: https: / / www.ncbi.nlm.nih.gov / pmc / articles / PMC7456264 / Oji V, Tadini G, Akiyama M, Blanchet Bardon C, Bodemer C, Bourrat E, et al. Revised nomenclature and classification of inherited ichthyoses: results of the First Ichthyosis Consensus Conference in Sorèze 2009. J Am Acad Dermatol.2010 Oct;63(4):607–41. Chulpanova DS, Shaimardanova AA, Ponomarev AS, Elsheikh S, Rizvanov AA, Solovyeva VV. Current Strategies for the Gene Therapy of Autosomal Recessive Congenital Ichthyosis and Other Types of Inherited Ichthyosis. Int J Mol Sci.2022 Jan;23(5):2506. Cottle DL, Ursino GMA, Ip SCI, Jones LK, Ditommaso T, Hacking DF, et al. Fetal inhibition of inflammation improves disease phenotypes in harlequin ichthyosis. Hum Mol Genet.2015 Jan 15;24(2):436–49. Dreyfus I, Chouquet C, Ezzedine K, Henner S, Chiavérini C, Maza A, et al. Prevalence of inherited ichthyosis in France: a study using capture-recapture method. Orphanet J Rare Dis. 2014 Jan 6;9(1):1. Pigg M, Gedde-Dahl T, Cox D, Hausser I, Anton-Lamprecht I, Dahl N. Strong founder effect for a transglutaminase 1 gene mutation in lamellar ichthyosis and congenital ichthyosiform erythroderma from Norway. Eur J Hum Genet EJHG.1998 Dec;6(6):589–96. Pigg MH, Bygum A, Gånemo A, Virtanen M, Brandrup F, Zimmer AD, et al. Spectrum of Autosomal Recessive Congenital Ichthyosis in Scandinavia: Clinical Characteristics and Novel and Recurrent Mutations in 132 Patients. Acta Derm Venereol.2016 Nov 2;96(7):932–7. Herman ML, Farasat S, Steinbach PJ, Wei MH, Toure O, Fleckman P, et al. Transglutaminase-1 gene mutations in autosomal recessive congenital ichthyosis: summary of mutations (including 23 novel) and modeling of TGase-1. Hum Mutat.2009 Apr;30(4):537–47. Shevchenko YO, Compton JG, Toro JR, DiGiovanna JJ, Bale SJ. Splice-site mutation in TGM1 in congenital recessive ichthyosis in American families: molecular, genetic, genealogic, and clinical studies. Hum Genet.2000 May;106(5):492–9. Vahlquist A, Gånemo A, Virtanen M. Congenital ichthyosis: an overview of current and emerging therapies. Acta Derm Venereol.2008;88(1):4–14. Plank R, Yealland G, Miceli E, Lima Cunha D, Graff P, Thomforde S, et al. Transglutaminase 1 Replacement Therapy Successfully Mitigates the Autosomal Recessive Congenital Ichthyosis Phenotype in Full-Thickness Skin Disease Equivalents. J Invest Dermatol.2019 May;139(5):1191–5. Gysler A, Lange K, Korting HC, Schäfer-Korting M. Prednicarbate Biotransformation in Human Foreskin Keratinocytes and Fibroblasts. Pharm Res.1997 Jun 1;14(6):793–7. Tam A, Kulkarni J, An K, Li L, Dorscheid D, Singhera G, et al. Lipid nanoparticle formulations for optimal RNA-based topical delivery to murine airways. Eur J Pharm Sci.2022 Sep 1;176:106234. Falabella M, Sun L, Barr J, Pena AZ, Kershaw EE, Gingras S, et al. Single-Step qPCR and dPCR Detection of Diverse CRISPR-Cas9 Gene Editing Events in Vivo. G3 GenesGenomesGenetics. 2017 Aug 31;7(10):3533–42. Findlay SD, Vincent KM, Berman JR, Postovit LM. A Digital PCR-Based Method for Efficient and Highly Specific Screening of Genome Edited Cells. PLoS ONE.2016 Apr 18;11(4):e0153901. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods San Diego Calif.2001 Dec;25(4):402–8. Mirjalili Mohanna SZ, Djaksigulova D, Hill AM, Wagner PK, Simpson EM, Leavitt BR. LNPmediated delivery of CRISPR RNP for wide-spread in vivo genome editing in mouse cornea. J Control Release Off J Control Release Soc.2022 Oct;350:401–13. Kluesner MG, Nedveck DA, Lahr WS, Garbe JR, Abrahante JE, Webber BR, et al. EditR: A Method to Quantify Base Editing from Sanger Sequencing. CRISPR J.2018 Jun;1:239–50. Farasat S, Wei MH, Herman M, Liewehr DJ, Steinberg SM, Bale SJ, et al. Novel transglutaminase-1 mutations and genotype–phenotype investigations of 104 patients with autosomal recessive congenital ichthyosis in the USA. J Med Genet.2009 Feb;46(2):103–11. Bourrat E, Blanchet-Bardon C, Derbois C, Cure S, Fischer J. Specific TGM1 mutation profiles in bathing suit and self-improving collodion ichthyoses: phenotypic and genotypic data from 9 patients with dynamic phenotypes of autosomal recessive congenital ichthyosis. Arch Dermatol. 2012 Oct;148(10):1191–5. Rice RH, Rong XH, Chakravarty R. Proteolytic release of keratinocyte transglutaminase. Biochem J.1990 Jan 15;265(2):351–7. Yang CS, Pomerantz H, Mannava KA, Corwin J, Weinstock MA, Fleckman P, et al. Comparing histopathology from patients with X-linked recessive ichthyosis and autosomal recessive congenital ichthyosis with transglutaminase 1 mutation: a report from the National Registry for Ichthyosis and Related Skin Disorders. J Am Acad Dermatol.2016 May;74(5):1008- 1010.e2. Koblan LW, Doman JL, Wilson C, Levy JM, Tay T, Newby GA, et al. Improving cytidine and adenine base editors by expression optimization and ancestral reconstruction. Nat Biotechnol. 2018 Oct;36(9):843–6. Pope, E., Epidermolysis bullosa: a 2020 perspective. Br J Dermatol, 2020.183(4): p.603. Ul Ain, Q., et al., Gene Delivery to the Skin - How Far Have We Come? Trends Biotechnol, 2020. Sugiura, K. and M. Akiyama, Update on autosomal recessive congenital ichthyosis: mRNA analysis using hair samples is a powerful tool for genetic diagnosis. J Dermatol Sci, 2015.79(1): p.4-9. Pigg, M.H., et al., Spectrum of Autosomal Recessive Congenital Ichthyosis in Scandinavia: Clinical Characteristics and Novel and Recurrent Mutations in 132 Patients. Acta Derm Venereol, 2016.96(7): p.932-937. Fleckman, P., et al., Topical treatment of ichthyoses. Dermatol Ther, 2013.26(1): p.16-25. Finlay, A.Y., The burden of skin disease: quality of life, economic aspects and social issues. Clin Med (Lond), 2009.9(6): p.592-4. Sahin, U., K. Karikó, and Ö. Türeci, mRNA-based therapeutics — developing a new class of drugs. Nature Reviews Drug Discovery, 2014.13(10): p.759-780. Stadelmann, C., et al., mRNA-mediated delivery of gene editing tools to human primary muscle stem cells. Mol Ther Nucleic Acids, 2022.28: p.47-57. Rennick, J.J., A.P.R. Johnston, and R.G. Parton, Key principles and methods for studying the endocytosis of biological and nanoparticle therapeutics. Nat Nanotechnol, 2021.16(3): p.266- 276. Gilleron, J., et al., Image-based analysis of lipid nanoparticle-mediated siRNA delivery, intracellular trafficking and endosomal escape. Nat Biotechnol, 2013.31(7): p.638-46. Maugeri, M., et al., Linkage between endosomal escape of LNP-mRNA and loading into EVs for transport to other cells. Nat Commun, 2019.10(1): p.4333. Schlich, M., et al., Cytosolic delivery of nucleic acids: The case of ionizable lipid nanoparticles. Bioeng Transl Med, 2021.6(2): p. e10213. Zheng, L., S.R. Bandara, and C. Leal, Lipid nanoparticle topology regulates endosomal escape and delivery of RNA to the cytoplasm. bioRxiv, 2022: p.2022.05.20.492895. Kulkarni, J.A., et al., Fusion-dependent formation of lipid nanoparticles containing macromolecular payloads. Nanoscale, 2019.11(18): p.9023-9031. Han, X., et al., An ionizable lipid toolbox for RNA delivery. Nature Communications, 2021.12(1): p.7233. Akinc, A., et al., The Onpattro story and the clinical translation of nanomedicines containing nucleic acid-based drugs. Nature Nanotechnology, 2019.14(12): p.1084-1087. Kulkarni, J.A., et al., The current landscape of nucleic acid therapeutics. Nat Nanotechnol, 2021. 16(6): p.630-643. Kulkarni, J.A., et al., Spontaneous, solvent-free entrapment of siRNA within lipid nanoparticles. Nanoscale, 2020.12(47): p.23959-23966. Jayaraman, M., et al., Maximizing the potency of siRNA lipid nanoparticles for hepatic gene silencing in vivo. Angew Chem Int Ed Engl, 2012.51(34): p.8529-33. Hönzke, S., et al., Influence of Th2 Cytokines on the Cornified Envelope, Tight Junction Proteins, and ß-Defensins in Filaggrin-Deficient Skin Equivalents. J Invest Dermatol, 2016.136(3): p.631- 9. Giulbudagian, M., et al., Breaking the Barrier - Potent Anti-Inflammatory Activity following Efficient Topical Delivery of Etanercept using Thermoresponsive Nanogels. Theranostics, 2018.8(2): p. 450-463. Bachhav, Y.G., et al., Effect of controlled laser microporation on drug transport kinetics into and across the skin. J Control Release, 2010.146(1): p.31-6. Weiss, R., et al., Transcutaneous vaccination via laser microporation. J Control Release, 2012. 162(2): p.391-9. Hainzl, S., et al., COL7A1 Editing via CRISPR / Cas9 in Recessive Dystrophic Epidermolysis Bullosa. Mol Ther, 2017.25(11): p.2573-2584. Wu, W., et al., Efficient in vivo gene editing using ribonucleoproteins in skin stem cells of recessive dystrophic epidermolysis bullosa mouse model. Proc Natl Acad Sci U S A, 2017. 114(7): p.1660-1665. Aufenvenne, K., et al., Transglutaminase-1 and bathing suit ichthyosis: molecular analysis of gene / environment interactions. J Invest Dermatol, 2009.129(8): p.2068-71. Kath, J., et al., Pharmacological interventions enhance virus-free generation of TRAC-replaced CAR T cells. Molecular Therapy - Methods & Clinical Development, 2022.25: p.311-330. Herman, M.L., et al., Transglutaminase-1 gene mutations in autosomal recessive congenital ichthyosis: summary of mutations (including 23 novel) and modeling of TGase-1. Hum Mutat, 2009.30(4): p.537-47. Crumrine, D., et al., Mutations in Recessive Congenital Ichthyoses Illuminate the Origin and Functions of the Corneocyte Lipid Envelope. J Invest Dermatol, 2019.139(4): p.760-768. Shan, H., et al., Reduced off-target effect of NG-BE4max by using NG-HiFi system. Mol Ther Nucleic Acids, 2021.25: p.168-172. Koblan, L.W., et al., Improving cytidine and adenine base editors by expression optimization and ancestral reconstruction. Nat Biotechnol, 2018.36(9): p.843-846. Andries, O., et al., N1-methylpseudouridine-incorporated mRNA outperforms pseudouridine- incorporated mRNA by providing enhanced protein expression and reduced immunogenicity in mammalian cell lines and mice. Journal of Controlled Release, 2015.217: p.337-344. Nance, K.D. and J.L. Meier, Modifications in an Emergency: The Role of N1-Methylpseudouridine in COVID-19 Vaccines. ACS Central Science, 2021.7(5): p.748-756. Kulkarni, J.A., et al., On the Formation and Morphology of Lipid Nanoparticles Containing Ionizable Cationic Lipids and siRNA. ACS Nano, 2018.12(5): p.4787-4795. Honzke, S., et al., Tailored dendritic core-multishell nanocarriers for efficient dermal drug delivery: A systematic top-down approach from synthesis to preclinical testing. J Control Release, 2016. 242: p.50-63. Tsai, S.Q., et al., GUIDE-seq enables genome-wide profiling of off-target cleavage by CRISPR- Cas nucleases. Nature Biotechnology, 2015.33(2): p.187-197. Kluesner, M.G., et al., EditR: A Method to Quantify Base Editing from Sanger Sequencing. Crispr j, 2018.1(3): p.239-250.

Claims

CLAIMS 1. An oligonucleotide, comprising a sequence that targets a c.877-2 A>G mutation of the transglutaminase-1 (TGM1) gene, wherein a. the oligonucleotide hybridizes to a target region of the TGM1 gene according to SEQ ID No.13, said target region comprising the c.877-2 A>G mutation (mutation site), and b. the oligonucleotide is 10 to 35 nucleotides in length.

2. The oligonucleotide according to claim 1, wherein a. the target region of the TGM1 gene according to SEQ ID No.13 and / or the complementary strand of the target region of the TGM1 gene according to SEQ ID No.12 comprises a protospacer adjacent motif (PAM) or a sequence complementary to the PAM, and b. the oligonucleotide hybridizes to a sequence within the target region adjacent to the PAM or adjacent to a sequence complementary to the PAM.

3. The oligonucleotide according to any one of the preceding claims, wherein the oligonucleotide has a nucleic acid sequence according to the formula (X)n- GGA -(X)m(5’ to 3’) wherein a. m and n are, independently of each other, 0 to 20, preferably 0 to 18, more preferably 0 to 17, and b. X is, independently of each other, any nucleotide(s).

4. The oligonucleotide according to any one of the preceding claims, wherein the oligonucleotide has a sequence according to any one of SEQ ID No.1 to 10, or a sequence with an at least 80%, preferably 90%, sequence identity thereto.

5. The oligonucleotide according to any one of the preceding claims, configured as a guide RNA for a base editor, prime editor and / or RNA-guided endonuclease, preferably a CRISPR / Cas protein.

6. A gene editing system targeting a c.877-2 A>G mutation of the TGM1 gene, said system comprising: a. an oligonucleotide according to any one of claims 1-5, and b. a base editor, prime editor or RNA-guided endonuclease, preferably a CRISPR / Cas protein, or a nucleic acid molecule, preferably an mRNA, encoding the same.

7. The gene editing system according to claim 6, wherein the base editor is selected from the group consisting of BE4max-NG, BE4max-NRCH, A3G-BE, A3G-BE5.14, Target-AID,Target-AID-NG, SpCas9-TadCBEa, SpCas9-TadCBEb, SpCas9-TadCBEc, SpCas9- TadCBEd, SpCas9-TadCBEe, SpCas9-TadCBEa-V106W, SpCas9-TadCBEd-V106W, SpCas9-TadCBEd-N108Q / L145T and SpCas9-TadCBEd-V106W / N108Q / L145T, AncBE4-max-NG, YE2-BE3, EE-BE3, YEE-BE3, eAID-BE4max, BE4-max, AncBE4-max, YE2-BE4-NG, EE-BE4-NG, YEE-BE4-NG, R33A+ K34A-BE4-NG, xCas9-BE, SpCas9- NRRH-BE, Td-CBEs, and EQR-BE.

8. The gene editing system according to any one of claims 6 or 7, comprising: - (a) an oligonucleotide according to SEQ ID No.4 and (b) a BE4max-NG or AncBE4-max-NG base editor or a nucleic acid molecule, preferably an mRNA, encoding the same, - (a) an oligonucleotide according to SEQ ID No.5 and (b) a YE2-BE3, EE-B3, YEE-BE3, eAID-BE4max, BE4-max, AncBE4-max, YE2-BE4-NG, EE-BE4- NG, YEE-BE4-NG, R33A+K34A-BE4-NG, xCas9-BE or SpCas9-NRRH-BE editor or a nucleic acid molecule, preferably an mRNA, encoding the same, or - (a) an oligonucleotide according to SEQ ID No.6 and (b) a BE4-max, YE1- BE4max, AncBE4-max, Td-CBEs, EQR-BE or xCas9-BE editor or a nucleic acid molecule, preferably an mRNA, encoding the same 9. The gene editing system according to any one of claims 6 to 8, additionally comprising a homology directed repair (HDR)-Template, wherein the HDR-template has at least a 90%, preferably 95%, sequence identity to the target region of the TGM1 gene, and wherein the nucleobase of the HDR-template corresponding to the mutation site is A.

10. The gene editing system according to the preceding claim, wherein the HDR-template is a ssDNA template and 80 to 130 nucleotides in length, preferably 90 to 120, more preferably 100 to 115 nucleotides in length.

11. The gene editing system according to any one of claims 9 and 10, wherein the HDR template comprises or consists of a sequence according to SEQ ID No.

11.

12. The gene editing system according to any one of claims 9 to 11, comprising an oligonucleotide according to SEQ ID No.9 or 10, an HDR-Template according to SEQ ID No.11 and an RNA-guided endonuclease, preferably a CRISPR / Cas protein, or a nucleic acid molecule, preferably an mRNA, encoding the same.

13. The oligonucleotide or the gene editing system according to any one of the preceding claims for use in the treatment of a medical condition associated with a c.877-2 A>G mutation of the TGM1 gene.

14. The oligonucleotide or the gene editing system for use according to the preceding claim, wherein the medical condition is autosomal, recessive, congenital ichthyosis (ARCI).

15. A pharmaceutical composition, preferably for use in the treatment of a condition associated with a c.877-2 A>G mutation of the TGM1 gene, comprising anoligonucleotide or a gene editing system according to any one of claims 1 to 12, with a pharmaceutically acceptable carrier.

16. The pharmaceutical composition according to the preceding claim, wherein the oligonucleotide and / or gene editing system is encapsulated in a lipid nanoparticle (LNP).

17. The pharmaceutical composition according to any one of claims 15 and 16, wherein the composition is configured for topical administration.

18. An in vitro method for modifying a c.877-2 A>G mutation of the TGM1 gene, comprising administering an oligonucleotide or a gene editing system according to any one of claims 1 to 12 to a cell in which the TGM1 c.877-2 A>G mutation is to be modified.

Images