Single-stranded polynucleotide

Abstract

Provided is a polynucleotide having an exon skipping effect on SNCA exon 3. This single-stranded polynucleotide includes a base sequence A complementary to at least a part of an SNCA gene sequence, and the base sequence A includes a base sequence a1 complementary to a base sequence (5'-CATGGTGTGGCAAC) represented by SEQ ID NO: 1 and / or a base sequence a2 complementary to a base sequence (5'-AGGTAAGCTCCATTGTGC) represented by SEQ ID NO: 2.

Description

single-stranded polynucleotide

[0001] The present invention relates to single-stranded polynucleotides and the like.

[0002] Parkinson's disease is a neurodegenerative disorder characterized by the degeneration of dopamine neurons in the substantia nigra of the midbrain, resulting in motor symptoms such as akinesia, rigidity, and tremor, as well as non-motor symptoms such as mental and cognitive dysfunction and autonomic dysfunction. The prevalence of Parkinson's disease in Japan is high, with 150,000–200,000 patients, and the majority of cases are sporadic neurodegenerative disorders. While symptomatic treatments, such as dopamine replacement and deep brain stimulation, are available, no curative treatments that can prevent neurodegeneration have yet been developed. The pathology is understood to be primarily driven by the formation of aggregates of α-synuclein (SNCA), a component of Lewy bodies, a neuropathological finding. Research and development of antisense oligonucleotides (ASOs) targeting the SNCA gene mRNA is ongoing. However, gapmer-type ASOs with knockdown efficacy require frequent administration due to structural limitations that limit the duration of pharmacological effects (References 1 and 2). Furthermore, the risk of lumbar puncture-related adverse events is a concern in diseases requiring long-term treatment, such as Parkinson's disease. SNCA is also thought to be involved in regulating synaptic function, and it is expected that SNCA knockdown will inhibit neurophysiological functions.

[0003] Tabrizi SJ, et al. N Engl J Med. 2019;380:2307-2316. Miller TM, et al. N Engl J Med. 2022;387:1099-1110.

[0004] In the course of their research, the present inventors focused on exon skipping using antisense nucleic acids. SNCA isoforms that do not contain exon 3 do not exhibit the aggregation that causes synucleinopathy (Test Example 1, Figures 1 and 2).

[0005] An objective of the present invention is to provide a polynucleotide having an exon skipping effect on SNCA exon 3.

[0006] In the course of their research, the present inventors noticed that exon skipping of SNCA exon 3 is possible using a single-stranded polynucleotide. Based on this, the inventors further researched and found that the above-mentioned problem can be solved by a single-stranded polynucleotide that contains a base sequence A complementary to at least a portion of the SNCA gene sequence, and that the base sequence A contains a base sequence a1 complementary to the base sequence shown in SEQ ID NO: 1 (5'-CATGGTGTGGCAAC) and / or a base sequence a2 complementary to the base sequence shown in SEQ ID NO: 2 (5'-AGGTAAGCTCCATTGTGC). Based on this finding, the present inventors further researched and completed the present invention. Specifically, the present invention encompasses the following aspects:

[0007] Item 1. A single-stranded polynucleotide comprising a base sequence A complementary to at least a portion of an SNCA gene sequence, wherein the base sequence A comprises a base sequence a1 complementary to the base sequence shown in SEQ ID NO: 1 (5'-CATGGTGTGGCAAC) and / or a base sequence a2 complementary to the base sequence shown in SEQ ID NO: 2 (5'-AGGTAAGCTCCATTGTGC).

[0008] Item 2. The single-stranded polynucleotide according to Item 1, wherein the base length of the base sequence A is 16 or more.

[0009] Item 3. The single-stranded polynucleotide according to Item 1 or 2, wherein the base length of the base sequence A is 18 or more.

[0010] Item 4. The single-stranded polynucleotide according to any one of Items 1 to 3, wherein the base sequence A comprises the base sequence a1.

[0011] Item 5. The single-stranded polynucleotide according to Item 4, wherein the base sequence A comprises, as a sequence comprising the base sequence a1, a base sequence a1' complementary to the base sequence (5'-GCATGGTGTGGCAAC) shown in SEQ ID NO: 38.

[0012] Item 6. The single-stranded polynucleotide according to Item 4 or 5, wherein the base sequence A comprises, as a sequence containing the base sequence a1, a base sequence a11 complementary to a base sequence of 18 bases or more in length within the base sequence (5'-GGTGCATGGTGTGGCAACAGGT) shown in SEQ ID NO: 3.

[0013] Item 7. The single-stranded polynucleotide according to any one of Items 4 to 6, wherein the base sequence A comprises, as a sequence containing the base sequence a1, a base sequence a111 that is complementary to a base sequence of 18 bases or more in length within the base sequence (5'-GGTGCATGGTGTGGCAACAGG) shown in SEQ ID NO: 4.

[0014] Item 8. The single-stranded polynucleotide according to any one of Items 1 to 7, wherein the base length of the base sequence A is 50 or less.

[0015] Item 9. The single-stranded polynucleotide according to any one of Items 1 to 8, which comprises a modified nucleotide.

[0016] Item 10. The single-stranded polynucleotide according to Item 1, consisting of the base sequence shown in SEQ ID NO: 14 or 32, wherein in the base sequence, C and T are 2'-O,4'-C-ethylenenucleosides (ENA), G and A are 2'-O-methylated nucleosides (2'OMe), and all internucleoside linkages are phosphorothioate linkages.

[0017] Item 11. A double-stranded polynucleotide comprising an active strand consisting of the single-stranded polynucleotide according to any one of Items 1 to 10 and a carrier strand complementary thereto.

[0018] Item 12. A polynucleotide comprising the coding sequence of the single-stranded polynucleotide according to any one of Items 1 to 10.

[0019] Item 13. The polynucleotide according to Item 12, which is an expression vector for the single-stranded polynucleotide.

[0020] Item 14. A cell comprising at least one polynucleotide selected from the group consisting of the single-stranded polynucleotide according to any one of Items 1 to 10, the double-stranded polynucleotide according to Item 11, and the polynucleotide according to Item 12 or 13.

[0021] Item 15. An exon skipping agent comprising at least one species selected from the group consisting of the single-stranded polynucleotide according to any one of Items 1 to 10, the double-stranded polynucleotide according to Item 11, the polynucleotide according to Item 12 or 13, and the cell according to Item 14.

[0022] Item 15A. A method for exon skipping of SNCA exon 3, comprising administering to a subject at least one selected from the group consisting of the single-stranded polynucleotide of any one of Items 1 to 10, the double-stranded polynucleotide of Item 11, the polynucleotide of Item 12 or 13, and the cell of Item 14.

[0023] Item 15B. An agent for use as an exon skipping agent, comprising at least one selected from the group consisting of the single-stranded polynucleotide of any one of Items 1 to 10, the double-stranded polynucleotide of Item 11, the polynucleotide of Item 12 or 13, and the cell of Item 14.

[0024] Item 15C. Use of at least one selected from the group consisting of the single-stranded polynucleotide of any one of Items 1 to 10, the double-stranded polynucleotide of Item 11, the polynucleotide of Item 12 or 13, and the cell of Item 14, for producing an exon skipping agent.

[0025] Item 15D. Use of at least one selected from the group consisting of the single-stranded polynucleotide of any one of Items 1 to 10, the double-stranded polynucleotide of Item 11, the polynucleotide of Item 12 or 13, and the cell of Item 14 as an exon-skipping agent.

[0026] Item 16. A pharmaceutical comprising at least one selected from the group consisting of the single-stranded polynucleotide of any one of Items 1 to 10, the double-stranded polynucleotide of Item 11, the polynucleotide of Item 12 or 13, and the cell of Item 14.

[0027] Item 17. The pharmaceutical agent according to Item 16, which is used for the prevention or treatment of synucleinopathy.

[0028] Item 17A. A method for preventing or treating a synucleinopathy, comprising administering to a subject (preferably a subject having a synucleinopathy) at least one selected from the group consisting of the single-stranded polynucleotide of any one of Items 1 to 10, the double-stranded polynucleotide of Item 11, the polynucleotide of Item 12 or 13, and the cell of Item 14.

[0029] Item 17B. An agent for use in the prevention or treatment of synucleinopathy, comprising at least one selected from the group consisting of the single-stranded polynucleotide of any one of Items 1 to 10, the double-stranded polynucleotide of Item 11, the polynucleotide of Item 12 or 13, and the cell of Item 14.

[0030] Item 17C. Use of at least one selected from the group consisting of the single-stranded polynucleotide of any one of Items 1 to 10, the double-stranded polynucleotide of Item 11, the polynucleotide of Item 12 or 13, and the cell of Item 14, for the manufacture of a medicament for the prevention or treatment of synucleinopathy.

[0031] Item 17D. Use of at least one selected from the group consisting of the single-stranded polynucleotide of any one of Items 1 to 10, the double-stranded polynucleotide of Item 11, the polynucleotide of Item 12 or 13, and the cell of Item 14 as a pharmaceutical for preventing or treating synucleinopathy.

[0032] Item 18. A reagent comprising at least one species selected from the group consisting of the single-stranded polynucleotide according to any one of Items 1 to 10, the double-stranded polynucleotide according to Item 11, the polynucleotide according to Item 12 or 13, and the cell according to Item 14.

[0033] According to the present invention, a polynucleotide having an exon skipping effect on SNCA exon 3 can be provided.

[0034] Overview of the Invention: This figure shows the results of an α-synuclein (SNCA) aggregation assay using HEK293T cells (Test Example 1). The figure shows the results of Western blot analysis (left) and the ratio of oligomers to monomers quantified by Western blot analysis (right). This figure shows the results of ASO screening using HEK293T cells (Test Example 2). The sequence surrounding exon 3 of the SNCA gene to which each ASO (ENA#1 to #12) is complementary (top row) and the results of RT-PCR (bottom row). This figure shows the results of an analysis of the effect of ASO on SNCA126 protein expression (Test Example 3) (Western blot results). This figure shows the results of an analysis of the effect of ASO on full-length SNCA protein (Test Example 4). This figure shows the results of Western blot analysis (left) and the ratio of SNCA to GAPDH quantified by Western blot analysis (right). This figure shows the results of an analysis of the effect of chemical modification of ASO on skipping efficiency (Test Example 5) (RT-PCR results). Figure 1 shows the results when HEK293T cells were used (top) and the results when SH-SY5Y cells were used (bottom). Figure 2 shows the results (RT-PCR results) of an exon skipping test in human iPS-derived dopamine neurons (Test Example 6). Figure 3 shows the results of an analysis of the effect on SNCA protein in primary cultured neurons (Test Example 7). Figure 4 shows the results of Western blot (left) and the ratio of SNCA to GAPDH quantified by Western blot (right). Figure 5 shows the results of an analysis of the effect on the SNCA126 isoform in SNCA E46K mice (Test Example 8). Figure 6 shows an outline of primer design (left) and the result of RT-PCR (right). Figure 7 shows the results of an analysis of the effect on human SNCA protein in SNCA E46K mice (Test Example 9). Figure 7 shows the results of Western blot (left) and the ratio of hSNCA to GAPDH quantified by Western blot (right). Figure 8 shows the results of screening for sequences surrounding ENA#9 (Test Example 10). The figure shows the sequence surrounding exon 3 of the SNCA gene to which each ASO is complementary (top row) and the results of RT-PCR (bottom row). The results of a comparison of the exon skipping efficiency of ENA#9-2 and ENA#9 (Test Example 11) are shown. The results of RT-PCR (left) and the ratio of SNCA126 to total SNCA quantified by RT-PCR (right) are shown.Figure 1 shows the results (Western blot results) of induction of SNCA126 protein expression by ENA#9-2 (Test Example 12). Figure 2 shows the splicing regulation effect of ASO in adult mice (Test Example 13). Figure 3 shows the long-term splicing regulation effect of ASO (Test Example 14). Figure 4 shows the long-term SNCA protein suppression effect of ASO (Test Example 15). Figure 5 shows the therapeutic effect of ASO in SNCA E46K mice (Test Example 16).

[0035] In this specification, the expressions "contain" and "comprise" include the concepts of "contain", "include", "consist essentially of" and "consist only of".

[0036] When upper and lower limits for a numerical range are separately disclosed herein, ranges consisting of any combination of any upper and any lower limits are also disclosed herein.

[0037] 1. Single-Stranded Polynucleotide In one aspect, the present invention relates to a single-stranded polynucleotide (sometimes referred to herein as the "single-stranded polynucleotide of the present invention") comprising a base sequence A complementary to at least a portion of an SNCA gene sequence, wherein the base sequence A comprises a base sequence a1 complementary to the base sequence shown in SEQ ID NO: 1 (5'-CATGGTGTGGCAAC) and / or a base sequence a2 complementary to the base sequence shown in SEQ ID NO: 2 (5'-AGGTAAGCTCCATTGTGC).

[0038] The SNCA gene is a human-derived SNCA gene, and is not particularly limited in this respect. The entire sequence of the SNCA gene is publicly known. Specifically, the SNCA gene is identified by NCBI Gene ID: 6622, and various sequences thereof (such as the genome sequence and mature mRNA sequence) are also registered in the NCBI database.

[0039] As used herein, the SNCA gene sequence refers to the base sequence on the genomic DNA of the sense strand of the SNCA gene, and is a base sequence including exon sequences and intron sequences.

[0040] The term "at least a portion of the SNCA gene sequence" is not particularly limited as long as it is long enough to enable specific recognition of a polynucleotide containing a complementary sequence, and is, for example, 14 bases or longer. From the viewpoints of suppression of off-target effects, exon skipping efficiency, etc., it is preferably 15 bases or longer, more preferably 16 bases or longer, even more preferably 17 bases or longer, and even more preferably 18 bases or longer. The upper limit of the base length is not particularly limited, but from the viewpoints of synthesis efficiency, exon skipping efficiency, etc., it is preferably 50 bases or shorter, more preferably 40 bases or shorter, even more preferably 30 bases or shorter, even more preferably 25 bases or shorter, and particularly preferably 20 bases or shorter.

[0041] An example of "at least a part of the SNCA gene sequence" is at least a part of the base sequence shown in SEQ ID NO: 5 (5'-GTTTTTGTAGGCTCCAAAACCAAGGAGGGAGTGGTGCATGGTGTGGCAACAGGTAAGCTCCATTGTGCTTATATCCAAAGATGATATTTAAAGTATCTAG), which is exon 3 and its surrounding sequence.

[0042] As used herein, "complementary" refers not only to a perfect base complementarity (e.g., A and T or U, and G and C), but also to a degree of complementarity that allows hybridization under stringent conditions. Stringent conditions can be determined based on the melting temperature (Tm) of the nucleic acid, as taught by Berger and Kimmel (1987, Guide to Molecular Cloning Techniques Methods in Enzymology, Vol. 152, Academic Press, San Diego, CA). For example, typical post-hybridization washing conditions include 1×SSC, 0.1% SDS, and 37°C. It is preferred that the hybridization state be maintained even after washing under such conditions. While not particularly limited, more stringent hybridization conditions include washing conditions of approximately 0.5×SSC, 0.1% SDS, and 42°C, and even more stringent hybridization conditions include washing conditions of approximately 0.1×SSC, 0.1% SDS, and 65°C.

[0043] As mentioned above, the complementary relationship is based on a one-to-one relationship between bases, so a certain base sequence X and a base sequence Y complementary to the base sequence X have the same base length.

[0044] The base length of base sequence A is, for example, 14 or more bases, and from the viewpoints of suppression of off-target effects, exon skipping efficiency, etc., it is preferably 15 or more bases, more preferably 16 or more bases, even more preferably 17 or more bases, and even more preferably 18 or more bases. The upper limit of the base length is not particularly limited, but from the viewpoints of, for example, synthesis efficiency, exon skipping efficiency, etc., it is preferably 50 or less bases, more preferably 40 or less bases, even more preferably 30 or less bases, still more preferably 25 or less bases, and particularly preferably 20 or less bases.

[0045] Base sequence A is a base sequence that has, for example, 85% or more identity, preferably 90% or more identity, more preferably 95% or more identity, even more preferably 98% or more identity, still more preferably 99% or more identity, and particularly preferably 100% identity to a base sequence that is completely complementary to at least a portion of the SNCA gene sequence.

[0046] As used herein, the "identity" of a base sequence refers to the degree of match between the base sequences of two or more comparable base sequences. Therefore, the greater the match between two base sequences, the greater the identity or similarity between those sequences. The level of identity between base sequences can be determined, for example, using the sequence analysis tool FASTA with default parameters. Alternatively, it can be determined using the BLAST algorithm by Karlin and Altschul (Karlin S, Altschul SF. "Methods for assessing the statistical significance of molecular sequence features by using general scoring schemes," Proc Natl Acad Sci USA. 87:2264-2268 (1990); Karlin S, Altschul SF. "Applications and statistics for multiple high-scoring segments in molecular sequences," Proc Natl Acad Sci USA. 90:5873-7 (1993)). A program called BLASTX, based on the BLAST algorithm, has been developed. Specific techniques for these analysis methods are known and can be found on the National Center of Biotechnology Information (NCBI) website (http: / / www.ncbi.nlm.nih.gov / ).

[0047] The base sequence A includes a base sequence a1 complementary to the base sequence shown in SEQ ID NO: 1 (5'-CATGGTGTGGCAAC) and / or a base sequence a2 complementary to the base sequence shown in SEQ ID NO: 2 (5'-AGGTAAGCTCCATTGTGC).

[0048] The base sequence (5'-CATGGTGTGGCAAC) shown in SEQ ID NO: 1 is an overlapping portion of the SNCA gene sequence (see Figure 11) to which the single-stranded polynucleotides (#9-3, #9-2, #9-1, #9, and #9+1) are complementary. All of these single-stranded polynucleotides exhibit exon skipping activity (see Test Example 10, Figure 11). Therefore, by targeting the overlapping portion, SEQ ID NO: 1, they can exert their exon skipping activity.

[0049] From the viewpoint of exon skipping efficiency, it is preferable that base sequence A contains, as a sequence containing base sequence a1, a base sequence a1' complementary to the base sequence (5'-GCATGGTGTGGCAAC) shown in SEQ ID NO: 38. The base sequence (5'-GCATGGTGTGGCAAC) shown in SEQ ID NO: 38 is an overlapping portion of the SNCA gene sequence to which the single-stranded polynucleotides (#9-3, #9-2, #9-1, #9) are complementary (see Figure 11). These single-stranded polynucleotides exhibit stronger exon skipping activity (see Test Example 10, Figure 11), and therefore, by targeting the overlapping portion, SEQ ID NO: 38, a stronger exon skipping activity can be exerted.

[0050] The base sequence (5'-AGGTAAGCTCCATTGTGC) shown in SEQ ID NO: 2 is the SNCA gene sequence (see Figure 3) to which the single-stranded polynucleotide (#12) is complementary. This single-stranded polynucleotide exhibits exon skipping activity (see Test Example 2, Figure 3), and so by targeting SEQ ID NO: 2, the exon skipping activity can be exerted.

[0051] The base sequence a1 is a base sequence that has, for example, 78% or more identity, preferably 85% or more identity, more preferably 92% or more identity, and particularly preferably 100% identity to a base sequence that is completely complementary to the base sequence shown in SEQ ID NO: 1.

[0052] Base sequence a2 is a base sequence that has, for example, 83% or more identity, preferably 88% or more identity, more preferably 94% or more identity, and particularly preferably 100% identity to a base sequence that is completely complementary to the base sequence shown in SEQ ID NO: 2.

[0053] From the viewpoint of exon skipping efficiency, the base sequence A preferably contains the base sequence a1.

[0054] From the viewpoint of exon skipping efficiency, the base sequence A preferably contains the base sequence a1 as a sequence including the base sequence a1, and more preferably contains the base sequence a11 that is complementary to a base sequence of 18 bases or more in the base sequence shown in SEQ ID NO: 3 (5'-GGTGCATGGTGTGGCAACAGGT), and particularly preferably contains the base sequence a111 that is complementary to a base sequence of 18 bases or more in the base sequence shown in SEQ ID NO: 4 (5'-GGTGCATGGTGTGGCAACAGG).

[0055] Specific preferred examples of the base sequence A include base sequences containing a base sequence having, for example, 83% or more identity, preferably 88% or more identity, more preferably 94% or more identity, and particularly preferably 100% identity to the base sequence shown in any of SEQ ID NOs: 14, 17, and 31 to 34 (preferably SEQ ID NOs: 14, and 31 to 34, more preferably SEQ ID NOs: 14, and 31 to 33, and particularly preferably SEQ ID NO: 32).

[0056] The single-stranded polynucleotide of the present invention may have another base sequence added to one or both ends of base sequence A. The base length of base sequence A relative to the total base length (100%) of the single-stranded polynucleotide of the present invention is preferably 50% or more, more preferably 60% or more, even more preferably 70% or more, still more preferably 80% or more, particularly preferably 90% or more, and particularly preferably 100%.

[0057] Polynucleotides can be DNA, RNA, etc., and can be based on these and contain modified nucleosides or modified internucleotide linkages.

[0058] Modified nucleosides include ribonucleosides, deoxyribonucleosides, and RNA or DNA molecules modified to improve or stabilize nuclease resistance, increase affinity with complementary nucleic acids, increase cell permeability, or facilitate visualization, compared to RNA or DNA. Examples include sugar-modified nucleosides such as 2'-OMe, 2'-MOE, LNA, ENA, AmNA, GuNA, and scpBNA. Polynucleotides may contain, for example, modified nucleic acid molecules disclosed in Khvorova & Watts (Nature Biotechnology 35, 238-248 (2017) doi:10.1038 / nbt.3765).

[0059] Modified sugar refers to a sugar having a substitution and / or any change from a natural sugar moiety (i.e., a sugar moiety found in DNA (2'-H) or RNA (2'-OH)), and sugar-modified nucleoside refers to a modified nucleoside containing a modified sugar. The sugar-modified nucleoside may be any nucleoside in which any chemical structural substance has been added or substituted to a part or all of the chemical structure of the sugar of the nucleoside, and examples thereof include modified nucleosides substituted with 2'-O-methylribose, modified nucleosides substituted with 2'-O-propylribose, modified nucleosides substituted with 2'-methoxyethoxyribose, modified nucleosides substituted with 2'-O-methoxyethylribose, modified nucleosides substituted with 2'-O-[2-(guanidium)ethyl]ribose, modified nucleosides substituted with 2'-O-fluororibose, bridged nucleic acids (BNAs) that have two cyclic structures by introducing a bridged structure into the sugar moiety, more specifically, locked nucleic acids (LNAs) in which the oxygen atom at the 2' position and the carbon atom at the 4' position are bridged via a methylene, and ethylene bridged nucleic acids (Ethylene bridged nucleic acids). Examples of such nucleic acids include peptide nucleic acids (PNA) [Nucleic Acid Research, 32, e175 (2004)], peptide nucleic acids (PNA) [Acc. Chem. Res., 32, 624 (1999)], oxypeptide nucleic acids (OPNA) [J. Am. Chem. Soc., 123, 4653 (2001)], and peptide ribonucleic acid (PRNA) [J. Am. Chem. Soc., 122, 6900 (2000)].

[0060] The 2'-O-methyl (2'-OMe) modification of RNA (2'-OMe-RNA) is a naturally occurring modification that improves the binding affinity and nuclease resistance of modified oligonucleotides while reducing their immunostimulatory potential. The 2'-O-methoxyethyl (2'-MOE) modification provides even greater nuclease resistance than the 2'-OMe modification, significantly increasing the binding affinity (ΔTm) of the modified nucleotide. The 2'-fluoro (2'-F) modification of RNA (2'-F-RNA) can also be used to increase the affinity of oligonucleotides. Other 2'-modified nucleic acids include 2'-F-ANA and the 2'-modified derivatives described by Sekine et al. (Patent No. 5194256, JP 2015-020994).

[0061] Locked nucleic acid (LNA), which links the 2' oxygen and 4' carbon of ribose, significantly increases binding affinity. In LNA, the 2' oxygen and 4' carbon of the ribose sugar of RNA are locked in a ring structure. This modification increases specificity, affinity, and half-life, allowing for effective delivery to target tissues with reduced toxicity. However, fully modified LNA oligomers longer than approximately eight nucleotides tend to aggregate, and are generally used in combination with DNA or other sugar-modified nucleic acids. A methylated analog of LNA, cEt, is also useful. Tricyclo-DNA (tcDNA) is a constrained nucleotide based on a three-ring backbone.

[0062] Other examples of modified nucleosides include those in which an atom (e.g., hydrogen atom, oxygen atom) or functional group (e.g., hydroxyl group, amino group) in the base portion of a nucleic acid is substituted with another atom (e.g., hydrogen atom, sulfur atom), functional group (e.g., amino group), or alkyl group having 1 to 6 carbon atoms, or those protected with a protecting group (e.g., methyl group or acyl group), and molecules in which another chemical substance such as a lipid, phospholipid, phenazine, folate, phenanthridine, anthraquinone, acridine, fluorescein, rhodamine, coumarin, or dye is attached to a nucleoside.

[0063] Particularly preferred modified nucleosides include ENA and 2'-MOE, with ENA being particularly preferred.

[0064] The number of modified nucleotides relative to 100% of the number of nucleosides in the single-stranded polynucleotide of the present invention is not particularly limited, but is, for example, 20% or more, preferably 50% or more, more preferably 60% or more, even more preferably 70% or more, still more preferably 80% or more, and particularly preferably 90% or more. In one embodiment of the present invention, all nucleotides may be modified nucleotides.

[0065] Modified internucleoside linkages refer to internucleoside linkages that have been substituted or have any changes from naturally occurring internucleoside linkages (i.e., phosphodiester linkages), and include internucleoside linkages that contain a phosphorus atom and internucleoside linkages that do not contain a phosphorus atom. Modified internucleoside linkages may be those in which any chemical substance has been added to or substituted for part or all of the chemical structure of the phosphodiester bond of a nucleotide, and examples include modified internucleoside linkages substituted with phosphorothioate linkages and modified internucleoside linkages substituted with N3'-P5' phosphoamidate linkages. Other modified internucleoside linkages include (SC5'Rp)-α,β-CNA and PMO.

[0066] Representative phosphorus-containing internucleoside linkages include, for example, phosphodiester linkages, phosphorothioate linkages (also called thiophosphate linkages), phosphorodithioate linkages, phosphotriester linkages, as well as methylphosphonate linkages, methylthiophosphonate linkages, boranophosphate linkages, and phosphoramidate linkages.

[0067] A particularly preferred example of the modified internucleotide bond is a phosphorothioate bond.

[0068] The number of modified internucleotide bonds relative to the total number of internucleotide bonds (100%) in the single-stranded polynucleotide of the present invention is not particularly limited, but is, for example, 20% or more, preferably 50% or more, more preferably 60% or more, even more preferably 70% or more, still more preferably 80% or more, and particularly preferably 90% or more. In one embodiment of the present invention, all internucleotide bonds can be modified internucleotide bonds (e.g., phosphorothioate bonds).

[0069] In a preferred embodiment of the present invention, the single-stranded polynucleotide of the present invention contains ENA (more preferably ENA and 2'-MOE) as a modified nucleoside and phosphorothioate internucleoside linkages. In this embodiment, the number of the modified nucleotides (ENA or the sum of ENA and 2'-MOE) relative to 100% of the number of nucleosides is, for example, 20% or more, preferably 50% or more, more preferably 60% or more, even more preferably 70% or more, even more preferably 80% or more, particularly preferably 90% or more, and particularly preferably 100%. The number of the modified internucleotide linkages (phosphorothioate linkages) relative to 100% of the number of internucleotide linkages is, for example, 20% or more, preferably 50% or more, more preferably 60% or more, even more preferably 70% or more, even more preferably 80% or more, particularly preferably 90% or more, and particularly preferably 100%. In this embodiment, it is particularly preferred that the base sequence A is SEQ ID NO: 14, 17, or 31 to 34 (particularly preferably SEQ ID NO: 14 or 32).

[0070] In this specification, the bases constituting a polynucleotide include not only typical bases in natural nucleic acids such as RNA and DNA (e.g., adenine (A), thymine (T), uracil (U), guanine (G), cytosine (C), etc.), but also other bases such as hypoxanthine (I) and modified bases. Modified bases include, for example, pseudouracil, 3-methyluracil, dihydrouracil, 5-alkylcytosine (e.g., 5-methylcytosine), 5-alkyluracil (e.g., 5-ethyluracil), 5-halouracil (5-bromouracil), 6-azapyrimidine, 6-alkylpyrimidine (6-methyluracil), 4-acetylcytosine, 5-(carboxyhydroxymethyl)uracil, 5'-carboxymethylaminomethyl-2-thiouracil, 5-carboxymethylaminomethyluracil, 1-methyladenine, 1-methylhypoxanthine, etc. Examples of suitable amino acids include uracil, 2,2-dimethylguanine, 3-methylcytosine, 2-methyladenine, 2-methylguanine, N6-methyladenine, 7-methylguanine, 5-methoxyaminomethyl-2-thiouracil, 5-methylaminomethyluracil, 5-methylcarbonylmethyluracil, 5-methyloxyuracil, 5-methyl-2-thiouracil, 2-methylthio-N6-isopentenyladenine, uracil-5-oxyacetic acid, 2-thiocytosine, purine, 2-aminopurine, isoguanine, indole, imidazole, xanthine, and cyanuric acid.

[0071] In one aspect, the present invention relates to a double-stranded polynucleotide (sometimes referred to herein as the "double-stranded polynucleotide of the present invention") comprising an active strand consisting of a single-stranded polynucleotide of the present invention and a carrier strand complementary thereto.

[0072] The double-stranded polynucleotide of the present invention can be an HDO (Hetero Duplex Oligonucleotide; also referred to as a "heteroduplex nucleic acid"). HDO is an artificial functional nucleic acid composed of two strands: an active strand and a complementary carrier strand (see, for example, Nishina et al., Nature Communications volume 6, Article number: 7969 (2015), Japanese Patent Nos. 6112569, 6638923, 6416301, and 6604544). It can contain an active strand (also referred to as the first strand) and a carrier strand (also referred to as the second strand) complementary to the active strand. The nucleotide length of the carrier strand is generally about 13 to 30 bases, for example, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22 bases, but is not particularly limited. The nucleotide lengths of the active strand and the carrier strand do not need to be the same; for example, the carrier strand can be shorter or longer than the active strand. Furthermore, the carrier strand does not need to be completely complementary to the active strand and may contain mismatches or bulges. The above complementarity can be, for example, 90% or more or 95% or more. Without intending to be bound by any particular theory, it is believed that after HDO is delivered into a cell, the active strand and the carrier strand separate, and the active strand functions as a single-stranded polynucleotide of the present invention within the cell.

[0073] In one aspect, the present invention relates to a polynucleotide (sometimes referred to herein as "polynucleotide of the present invention") comprising a coding sequence of a single-stranded polynucleotide of the present invention.

[0074] The coding sequence is not particularly limited as long as it is a nucleotide sequence that, when transcribed by RNA polymerase, results in the single-stranded polynucleotide of the present invention.

[0075] The polynucleotide of the present invention can be, for example, DNA, and can be linear or circular.

[0076] The polynucleotide of the present invention can be an expression vector for the single-stranded polynucleotide of the present invention.

[0077] A typical example of the polynucleotide of the present invention comprises a promoter and a coding sequence of the single-stranded polynucleotide of the present invention placed under the control of said promoter.

[0078] The promoter is not particularly limited, and a pol II promoter can also be used, but a pol III promoter is preferred from the viewpoint of more accurate transcription of relatively short RNAs. Examples of pol III promoters include, but are not limited to, mouse and human U6-snRNA promoters, human H1-RNase P RNA promoter, and human valine-tRNA promoter.

[0079] The polynucleotide of the present invention may contain other elements (e.g., a multiple cloning site (MCS), a drug resistance gene, a replication origin, etc.) as necessary. Examples of drug resistance genes include a chloramphenicol resistance gene, a tetracycline resistance gene, a neomycin resistance gene, an erythromycin resistance gene, a spectinomycin resistance gene, a kanamycin resistance gene, a hygromycin resistance gene, and a puromycin resistance gene. The type of vector is not particularly limited, and examples include plasmid vectors such as animal cell expression plasmids; and viral vectors such as retroviruses, lentiviruses, adenoviruses, adeno-associated viruses, herpes viruses, and Sendai viruses.

[0080] The single-stranded polynucleotides, double-stranded polynucleotides, and polynucleotides of the present invention can be easily prepared by known genetic engineering techniques, such as chemical synthesis, PCR, restriction enzyme digestion, and DNA ligation.

[0081] 2. Cells In one aspect, the present invention relates to cells (sometimes referred to herein as "cells of the present invention") containing at least one selected from the group consisting of the single-stranded polynucleotide of the present invention, the double-stranded polynucleotide of the present invention, and the polynucleotide of the present invention.

[0082] The cells of the present invention can be obtained, for example, by introducing at least one selected from the group consisting of the single-stranded polynucleotide of the present invention, the double-stranded polynucleotide of the present invention, and the polynucleotide of the present invention.

[0083] The cells of the present invention are preferably isolated cells. The cells of the present invention may be cultured cells, and may be primary cultured cells or subcultured cells. The cells of the present invention may be established cell lines. The cells may be iPS cells.

[0084] Examples of the cells of the present invention include Escherichia coli K12 and other Escherichia coli, Bacillus bacteria such as Bacillus subtilis MI114, yeast such as Saccharomyces cerevisiae AH22, the Sf cell line derived from Spodoptera frugiperda or the HighFive cell line derived from Trichoplusia ni, insect cells such as olfactory nerve cells, animal cells, etc. Preferred animal cells include cultured cells derived from mammals, specifically COS7 cells, CHO cells, HEK293 cells, HEK293FT cells, Hela cells, PC12 cells, N1E-115 cells, SH-SY5Y cells, etc.

[0085] 3. Uses The single-stranded polynucleotide of the present invention, the double-stranded polynucleotide of the present invention, the polynucleotide of the present invention, and the cell of the present invention (hereinafter, these may be collectively referred to as "active ingredients") can be used, for example, as medicines, reagents, etc. (hereinafter, they may be referred to as "agents of the present invention"), as well as, for example, as exon skipping agents, agents for preventing or treating synucleinopathy, etc.

[0086] Specifically, exon skipping involves skipping exon 3 of the SNCA gene / mRNA. This allows expression of exon 3-deleted α-synuclein mRNA / protein while reducing full-length α-synuclein mRNA / protein. Unlike conventional knockdown, this approach preserves the α-synuclein isoform, offering the advantage of suppressing α-synuclein aggregation while maintaining its physiological function.

[0087] Synucleinopathies are neurodegenerative diseases characterized by the pathological formation and accumulation of α-synuclein protein aggregates, including Parkinson's disease, dementia with Lewy bodies, pure autonomic failure, and multiple system atrophy.

[0088] The pharmaceutical agent of the present invention is not particularly limited as long as it contains an active ingredient, and may further contain additives as necessary, such as bases, carriers, solvents, dispersants, emulsifiers, buffers, stabilizers, excipients, binders, disintegrants, lubricants, thickeners, moisturizers, colorants, fragrances, and chelating agents.

[0089] The mode of use of the agent of the present invention is not particularly limited, and an appropriate mode of use can be adopted depending on the type of agent. Depending on the intended use, the agent of the present invention can be used, for example, in vitro (e.g., added to a culture medium for cultured cells) or in vivo (e.g., administered to an animal).

[0090] The agents of the present invention may be applied to any mammal, including, but not limited to, humans, monkeys, mice, rats, dogs, cats, rabbits, pigs, horses, cattle, sheep, goats, and deer. Examples of cells include animal cells. The types of cells are also not particularly limited, including, but not limited to, blood cells, hematopoietic stem cells and progenitor cells, gametes (sperm, eggs), fibroblasts, epithelial cells, vascular endothelial cells, nerve cells, hepatocytes, keratinocytes, muscle cells, epidermal cells, endocrine cells, ES cells, iPS cells, tissue stem cells, and cancer cells.

[0091] The agents of the present invention can be in any dosage form, for example, oral formulations such as tablets (including orally disintegrating tablets, chewable tablets, effervescent tablets, lozenges, jelly drops, etc.), pills, granules, fine granules, powders, hard capsules, soft capsules, dry syrups, liquids (including drinks, suspensions, syrups), and jellies; or parenteral formulations such as injectable preparations (e.g., drip injections (e.g., intravenous drip preparations), intravenous injections, intramuscular injections, subcutaneous injections, and intradermal injections), topical preparations (e.g., ointments, poultices, lotions), suppositories, inhalants, eye drops, eye ointments, nasal drops, and ear drops. The active ingredient can also be administered in a complexed state with particles (e.g., lipid particles or exosomes) or encapsulated in the particles.

[0092] The route of administration of the drug of the present invention is not particularly limited as long as the desired effect can be obtained, and examples thereof include oral administration; enteral administration such as tube feeding and enema administration; and parenteral administration such as intravenous administration, intraarterial administration, intramuscular administration, intracardiac administration, subcutaneous administration, intradermal administration, intraperitoneal administration, and nasal administration.

[0093] The content of the active ingredient in the drug of the present invention depends on the mode of use, the subject to which it is applied, the condition of the subject to which it is applied, etc., and is not limited thereto, but can be, for example, 0.0001 to 100% by weight, preferably 0.001 to 50% by weight.

[0094] The dosage of the agent of the present invention when administered to an animal is not particularly limited as long as it is an effective amount that exerts a pharmacological effect, and is generally 0.1 to 1000 mg / kg body weight, preferably 0.5 to 500 mg / kg body weight per day in terms of the weight of the active ingredient, when administered orally, and 0.01 to 100 mg / kg body weight, preferably 0.05 to 50 mg / kg body weight per day in terms of the weight of the active ingredient when administered parenterally. The dosage can be increased or decreased as appropriate depending on the age, pathological condition, symptoms, etc.

[0095] The present invention will be described in detail below based on examples, but the present invention is not limited to these examples.

[0096] Test Example 1: α-Synuclein (SNCA) Aggregation Assay Using HEK293T Cells HEK293T cells (24-well plate) were overexpressed with 500 ng of full-length SNCA (FL), mutant SNCA with a deletion of amino acids 10-20 (Δ), SNCA 126 isoform (126) lacking exon 3, and A53T mutant SNCA (A53T). After 48 hours, oligomer formation was assessed by Western blotting. Transfection was performed using Lipofectamine 2000 (Thermo Fisher), and 400 ng / well of α-synuclein fibrillization protein (Cosmobio, CSR-SYN03) was added as an aggregation promoter.

[0097] The results are shown in Figure 2. It was found that the SNCA 126 isoform (126), which does not contain exon 3, does not exhibit aggregation.

[0098] Test Example 2: ASO screening using HEK293T cells Twelve ASOs (ENA#1 to #12) were designed for the sequence surrounding exon 3 of the SNCA gene (sequences shifted by 5 bases each), and their synthesis was outsourced to Kobe Natural Products Chemicals Co., Ltd.

[0099] In the ASOs (ENA#1 to #12) below, C and T are 2'-O,4'-C-ethylenenucleosides (ENA), G and A are 2'-O-methylated (2'OMe), and all bases are modified with phosphorothioate (PS). ENA #1. AGCCTACAAAAACAAATT (SEQ ID NO: 6) ENA #2. TTTGGAGCCTACAAAAAC (SEQ ID NO: 7) ENA #3. TTGGTTTTGGAGCCTACA (SEQ ID NO: 8) ENA #4. CCTCCTTGGTTTTGGAGC (SEQ ID NO: 9) ENA #5. CACTCCCTCCTTGGTTTT (SEQ ID NO: 10) ENA #6. TGCACCACTCCCTCCTTG (SEQ ID NO: 11) ENA #7. CACCATGCACCACTCCCT (SEQ ID NO: 12) ENA #8. TGCCACACCATGCACCAC (SEQ ID NO: 13) ENA #9. CCTGTTGCCACACCATGC (SEQ ID NO: 14) ENA #10. GCTTACCTGTTGCCACAC (SEQ ID NO: 15) ENA #11. ATGGAGCTTACCTGTTGC (SEQ ID NO: 16) ENA #12. GCACAATGGAGCTTACCT (SEQ ID NO: 17).

[0100] HEK293T cells were transfected with 50 nM each of ENA#1 to #12 using Lipofectamine RNAiMAX (Thermo Fisher) as a transfection reagent, and RNA was collected 48 hours later. The collected RNA was reverse transcribed to create cDNA, and isoform changes due to exon 3 skipping were examined by PCR using the following primer sequences: SNCA forward: ATGGATGTATTCATGAAAGGACT (SEQ ID NO: 18), SNCA reverse: TTAGGCTTCAGGTTCGTAGT (SEQ ID NO: 19), GAPDH forward: GAGTCAACGGATTTGGTCGT (SEQ ID NO: 20), GAPDH reverse: TTGATTTTGGAGGGATCTCG (SEQ ID NO: 21).

[0101] The results are shown in Figure 3. Expression of the SNCA 126 isoform was observed following administration of ENA#9 and ENA#12, and slight changes in the isoform were also observed following administration of ENA#10 and ENA#11.

[0102] Test Example 3: Analysis of the effect of ASO on SNCA126 protein expression. HEK293T cells were treated with ENA#6 (control), ENA#9, or ENA#12 at 0, 5, 10, or 50 nM using Lipofectamine RNAiMAX, and changes in SNCA protein isoforms were examined 48 hours later by Western blotting. Antibodies used were anti-SNCA antibody C-20 (Santa Cruz Biotechnology) and anti-GAPDH antibody ab9485 (Abcam).

[0103] The results are shown in Figure 4. Expression of the SNCA 126 isoform due to exon skipping was confirmed in the administration of ENA#9 and ENA#12, but expression of this isoform was not observed in the administration of ENA#6.

[0104] Test Example 4: Analysis of the effect of ASO on full-length SNCA protein. HEK293T cells were treated with 50 nM each of ENA#6 (control), ENA#9, and ENA#12 using Lipofectamine RNAiMAX, and the expression level of full-length SNCA protein 72 hours later was examined by Western blotting. The antibodies used were the anti-SNCA antibody MJFR1 (Abcam) and the anti-GAPDH antibody ab9485 (Abcam).

[0105] The results are shown in Figure 5. Compared to ENA#6 (control), administration of ENA#9 and ENA#12 resulted in a decrease in full-length SNCA protein. Unexpectedly, no adverse effects such as decreased cell death or cell proliferation were observed.

[0106] Test Example 5: Analysis of the effect of chemical modification of ASO on skipping efficiency An ASO (MOE#12) with the same sequence as ENA#12 but in which all bases were modified with 2'-O-methoxyethyl (MOE) was designed, and its synthesis was outsourced to Hokkaido System Science Co., Ltd.

[0107] The following ASO (MOE#12) contains MOE and PS modifications in all bases: MOE #12. GCACAATGGAGCTTACCT (SEQ ID NO: 17).

[0108] HEK293T cells were treated with 50 nM each of ENA #9, ENA #12, and MOE #12 using Lipofectamine RNAiMAX, and RNA was collected 48 hours later. SH-SY5Y cells were treated with 50 nM each of ENA #6, ENA #9, ENA #12, and MOE #12 using Lipofectamine RNAiMAX, and RNA was collected 72 hours later. The collected RNA was reverse transcribed to prepare cDNA, and isoform changes due to exon 3 skipping were examined by PCR using the primers with the following sequences. Primer sequences (forward is the same as in Test Example 2, reverse is a different sequence from Test Example 2): SNCA forward: ATGGATGTATTCATGAAAGGACT (SEQ ID NO: 18); SNCA reverse: CCTTCTTCATTCTTGCCCAA (SEQ ID NO: 22).

[0109] The results are shown in Figure 6. Expression of the SNCA 126 isoform was observed in both HEK293T cells and SH-SY5Y cells following administration of ENA#9, ENA#12, and MOE#12.

[0110] Test Example 6 Exon Skipping Test in Human iPS Cell-Derived Dopamine Neurons ENA#9 and ENA#12 were administered at 50 nM each to iCell® DopaNeurons SNCA A53T (FUJIFILM), which are dopamine neurons derived from iPS cells in a Parkinson's disease model, and RNA was collected 48 hours after administration.

[0111] Transfection was performed using Lipofectamine 2000 Reagent (Thermo Fisher) at half the volume recommended by the manufacturer (0.5 μl / well in a 24-well plate). The collected RNA was reverse transcribed to prepare cDNA, and the isoform change due to exon 3 skipping was verified by PCR using the primers with the following sequences. Primer sequences (same as in Test Example 2): SNCA forward: ATGGATGTATTCATGAAAGGACT (SEQ ID NO: 18); SNCA reverse: TTAGGCTTCAGGTTCGTAGT (SEQ ID NO: 19).

[0112] The results are shown in Figure 7. Expression of the SNCA 126 isoform was observed in both ENA#9 and ENA#12.

[0113] Test Example 7 Analysis of the effect on SNCA protein in primary cultured neurons B6N.Cg-Tg(SNCA*E46K)3Elan / J (Strain #:018768, hereinafter referred to as SNCA E46K mice), which express the full-length E46K mutant SNCA gene using a baby artificial chromosome (BAC), were purchased from Jackson Laboratory.

[0114] Cortical neurons were collected from SNCA E46K mice at embryonic day 15 using a neuronal cell suspension (FUJIFILM) and cultured in neuronal medium (FUJIFILM). On day 2 of culture, the neurons were transfected with 50 nM ENA#9 using Lipofectamine RNAiMAX (Thermo Fisher). Five days after transfection, SNCA protein expression was verified by Western blotting.

[0115] The results are shown in Figure 8. Decreased expression of full-length SNCA protein was observed in cerebral cortical neurons administered with ENA#9.

[0116] Test Example 8: Analysis of the effect on SNCA126 isoforms in SNCA E46K mice. Normal saline or ENA#9 was administered intracerebroventricularly to SNCA E46K mice on postnatal day 2 (P2). Nine days later, on P11, the mice were dissected, the cerebral cortex was collected, and RNA was extracted. The RNA was reverse transcribed to create cDNA, and the expression of SNCA140 and SNCA126 isoforms was examined by PCR using the primers with the following sequences. PCR was performed using HiDi DNA polymerase (myPOLS Biotec), which can distinguish between single-nucleotide differences at the 3' end of the primer. SNCA 140 forward: AGAGGGTGTTCTCTATGTAGG (G primer) (SEQ ID NO: 23) SNCA 126 forward: AGAGGGTGTTCTCTATGTAGT (T primer) (SEQ ID NO: 24) SNCA reverse (common to 140 and 126): CTTCTTCATTCTTGCCCAA (SEQ ID NO: 25) Gapdh forward: CGTCCCGTAGACAAAATGGT (SEQ ID NO: 26) Gapdh reverse: GAATTTGCCGTGAGTGGAGT (SEQ ID NO: 27).

[0117] The results are shown in Figure 9. SNCA 126 expression was observed after administration of 15 μg and 20 μg of ENA#9, whereas no SNCA 126 expression was observed after administration of saline. Furthermore, administration of 20 μg of ENA#9 reduced the expression of SNCA 140.

[0118] Test Example 9: Analysis of the effect on human SNCA protein in SNCA E46K mice ENA#9 (10 μg) was administered intracerebroventricularly to SNCA E46K mice on postnatal day 1 (P1). Protein was extracted from the mouse cerebral cortex 6 days after administration (P7), and the protein amount of human SNCA (hSNCA) was evaluated by Western blotting.

[0119] The results are shown in Figure 10. Compared to the mice administered with physiological saline, the amount of hSNCA protein was reduced in the cerebral cortex of the mice administered with ENA#9.

[0120] Test Example 10. Screening of sequences surrounding ENA#9 To examine the sequences surrounding ENA#9, eight ASOs (3-6, 8-11 below) differing in sequence by one base from ENA#9 were designed, along with two control ASOs (1 and 2 below) consisting of scrambled sequences of ENA#9. Their synthesis was outsourced to Kobe Natural Products Chemical Co., Ltd.

[0121] All of the ASOs below contain 2'-O,4'-C-ethylenenucleosides (ENA) for C and T, 2'-O-methylated (2'OMe) for G and A, and phosphorothioate (PS) modifications on all bases. 1. ENA #9 scramble-a. CACTACCAGCTGTTCCGC (SEQ ID NO:28) 2. ENA #9 scramble-b. ACCCCGGCCTCACTGTTA (SEQ ID NO:29) 3. ENA #9-4. TTGCCACACCATGCACCA (SEQ ID NO:30) 4. ENA #9-3. GTTGCCACACCATGCACC (SEQ ID NO:31) 5. ENA #9-2. TGTTGCCACACCATGCAC (SEQ ID NO:32) 6. ENA #9-1. CTGTTGCCACACCATGCA (SEQ ID NO:33) 7. ENA #9. CCTGTTGCCACACCATGC (SEQ ID NO:14) 8. ENA #9+1. ACCTGTTGCCACACCATG (SEQ ID NO:34) 9. ENA #9+2. TACCTGTTGCCACACCAT (SEQ ID NO:35) 10. ENA #9+3. TTACCTGTTGCCACACCA (SEQ ID NO:36) 11. ENA #9+4. CTTACCTGTTGCCACACC (SEQ ID NO: 37).

[0122] The above ASOs (1-11) were administered at 50 nM each to SH-SY5Y cells using Lipofectamine RNAiMAX, and RNA was collected 72 hours later. The collected RNA was reverse transcribed to produce cDNA, and isoform changes due to exon 3 skipping were examined by PCR using the primers with the following sequences. Primer sequences (same as in Test Example 5): SNCA forward: ATGGATGTATTCATGAAAGGACT (SEQ ID NO: 18); SNCA reverse: CCTTCTTCATTCTTGCCCAA (SEQ ID NO: 22).

[0123] The results are shown in Figure 11. Expression of the SNCA 126 isoform was observed following administration of ENA#9-3, #9-2, #9-1, #9, and #9+1.

[0124] Test Example 11: Comparison of exon skipping efficiency between ENA#9-2 and ENA#9 As in Test Example 10, SH-SY5Y cells were treated with 50 nM each of ENA#9 scramble-a, ENA#9-2, and ENA#9. 72 hours after administration, RNA was collected and the SNCA exon 3 skipping efficiency was compared using the following primers. Primer sequences (same as in Test Example 5): SNCA forward: ATGGATGTATTCATGAAAGGACT (SEQ ID NO: 18), SNCA reverse: CCTTCTTCATTCTTGCCCAA (SEQ ID NO: 22).

[0125] The results are shown in Figure 12. The ratio of SNCA126 (SNCA126 / total SNCA) was approximately 0.2 for ENA #9 scramble-a, approximately 0.55 for ENA#9-2, and approximately 0.4 for ENA#9, with ENA#9-2 being the most efficient.

[0126] Test Example 12: Induction of SNCA126 protein expression by ENA#9-2 As in Test Example 3, HEK293T cells were treated with 50 nM each of scramble-a and ENA#9-2 using Lipofectamine RNAiMAX, and SNCA protein isoform changes were examined 48 hours later by Western blotting. The antibodies used were anti-SNCA antibody C-20 (Santa Cruz Biotechnology) and anti-GAPDH antibody ab9485 (Abcam).

[0127] The results are shown in Figure 13. Expression of the SNCA 126 isoform due to exon skipping was confirmed in the case of ENA#9-2 administration, but expression of this isoform was not observed in the case of scramble-a.

[0128] Test Example 13: Splicing-regulating effect of ASO in adult mice. 11-week-old SNCA E46K mice were intracerebroventricularly administered ENA#9 at 0 (physiological saline), 120, or 150 μg, and the cerebral cortex and midbrain of the mice were collected two weeks later. RNA was extracted from the collected tissue, and the expression of SNCA140 and SNCA126 isoforms was verified by PCR using the primers with the following sequences. PCR was performed using HiDi DNA polymerase (myPOLS Biotec), which can distinguish between single-nucleotide differences at the 3' end of the primer. SNCA 140 forward: AGAGGGTGTTCTCTATGTAGG (G primer) (SEQ ID NO: 39) SNCA 126 forward: AGAGGGTGTTCTCTATGTAGT (T primer) (SEQ ID NO: 40) SNCA reverse (common to 140 and 126): CTTCTTCATTCTTGCCCAA (SEQ ID NO: 41) Gapdh forward: CGTCCCGTAGACAAAATGGT (SEQ ID NO: 42) Gapdh reverse: GAATTTGCCGTGAGTGGAGT (SEQ ID NO: 43).

[0129] The results are shown in Figure 14. SNCA 126 expression was observed after administration of 120 μg and 150 μg of ENA#9, whereas no SNCA 126 expression was observed after administration of saline. Furthermore, administration of 150 μg of ENA#9 reduced the expression of SNCA 140.

[0130] Test Example 14: Long-term splicing control effect of ASO 20 μg of saline or ENA#9 was administered intracerebroventricularly to SNCA E46K mice on postnatal day 2 (P2), and the cerebral cortex of the mice was collected one year after administration. RNA was extracted from the collected tissue, and the expression of SNCA isoforms was examined using the same method as in Supplementary Figure 1.

[0131] The results are shown in Figure 15. SNCA126 expression was observed in the ENA#9-treated group, whereas no SNCA126 expression was observed in the saline-treated group. Furthermore, Western blotting analysis of human SNCA (hSNCA) protein levels revealed that hSNCA protein levels were reduced in the cerebral cortex of mice treated with ENA#9.

[0132] Test Example 15. Long-term SNCA protein suppression effect by ASO As in Test Example 14, the cerebral cortex of SNCA E46K mice was administered 20 μg of saline or ENA#9 on P2, and one year later, the cortex was collected and protein was extracted. The protein amount of full-length human SNCA (hSNCA) was evaluated by Western blotting.

[0133] The results are shown in Figure 16. Compared with the saline-administered group, the hSNCA protein level was significantly reduced in the cerebral cortex of mice in the ENA#9-administered group.

[0134] Test Example 16. Therapeutic Effect of ASO in SNCA E46K Mice Homozygous SNCA E46K mice were administered 20 μg of ENA#9 (n=5) or saline (n=6) on day 2 of age, and grip strength was measured every two weeks from 6 to 14 weeks of age. Additionally, a balance beam test was performed three times at 12 weeks of age. The results are shown in Figure 17. The ENA#9-treated group demonstrated increased grip strength compared to the saline-treated group. Furthermore, the ENA#9-treated group also demonstrated a shorter time to reach the target compared to the saline-treated group.

Claims

1. A single-stranded polynucleotide comprising a base sequence A complementary to at least a portion of an SNCA gene sequence, and wherein the base sequence A comprises a base sequence a1 complementary to the base sequence (5'-CATGGTGTGGCAAC) shown in SEQ ID NO:1, and / or a base sequence a2 complementary to the base sequence (5'-AGGTAAGCTCCATTGTGC) shown in SEQ ID NO:

2.

2. The single-stranded polynucleotide according to claim 1, wherein the base sequence A has a length of 16 or more bases.

3. The single-stranded polynucleotide according to claim 1, wherein the base length of said base sequence A is 18 or more.

4. The single-stranded polynucleotide of claim 1, wherein the base sequence A comprises the base sequence a1.

5. The single-stranded polynucleotide according to claim 4, wherein the base sequence A contains, as a sequence including the base sequence a1, a base sequence a1' complementary to the base sequence (5'-GCATGGTGTGGCAAC) shown in SEQ ID NO:

38.

6. The single-stranded polynucleotide according to claim 4, wherein the base sequence A includes, as a sequence including the base sequence a1, a base sequence a11 that is complementary to a base sequence of 18 or more bases in length within the base sequence (5'-GGTGCATGGTGTGGCAACAGGT) shown in SEQ ID NO:

3.

7. The single-stranded polynucleotide according to claim 4, wherein the base sequence A includes, as a sequence containing the base sequence a1, a base sequence a111 that is complementary to a base sequence of 18 or more bases in length within the base sequence (5'-GGTGCATGGTGTGGCAACAGG) shown in SEQ ID NO:

4.

8. The single-stranded polynucleotide according to claim 1, wherein the base length of said base sequence A is 50 or less.

9. The single-stranded polynucleotide of claim 1, comprising modified nucleotides.

10. The single-stranded polynucleotide according to claim 1, which consists of the base sequence shown in SEQ ID NO: 14 or 32, wherein in the base sequence, C and T are 2'-O,4'-C-ethylene nucleosides (ENA), G and A are 2'-O-methylated nucleosides (2'OMe), and all internucleoside bonds are phosphorothioate bonds.

11. A double-stranded polynucleotide comprising an active strand consisting of the single-stranded polynucleotide according to any one of claims 1 to 10 and a carrier strand complementary thereto.

12. A polynucleotide comprising the coding sequence of a single-stranded polynucleotide according to any one of claims 1 to 10.

13. The polynucleotide of claim 12, which is an expression vector for said single-stranded polynucleotide.

14. A cell comprising at least one polynucleotide selected from the group consisting of the single-stranded polynucleotide according to any one of claims 1 to 10, the double-stranded polynucleotide according to claim 11, and the polynucleotide according to claim 12.

15. An exon skipping agent comprising at least one selected from the group consisting of a single-stranded polynucleotide according to any one of claims 1 to 10, a double-stranded polynucleotide according to claim 11, a polynucleotide according to claim 12, and a cell according to claim 14.

16. A pharmaceutical comprising at least one selected from the group consisting of the single-stranded polynucleotide according to any one of claims 1 to 10, the double-stranded polynucleotide according to claim 11, the polynucleotide according to claim 12, and the cell according to claim 14.

17. The pharmaceutical composition according to claim 16, which is for the prevention or treatment of synucleinopathy.

18. A reagent comprising at least one species selected from the group consisting of the single-stranded polynucleotide according to any one of claims 1 to 10, the double-stranded polynucleotide according to claim 11, the polynucleotide according to claim 12, and the cell according to claim 14.

Images