Kluyveromyces marxianus LRCC 8279 and LRCC 8325 suitable for non-alcohol beverages and fermented drinks

Abstract

The present invention relates to (Kluyveromyces marxianus LRCC 8325 and Kluyveromyces marxianus LRCC 8279 strains suitable for the production of non-alcoholic beverages and root vegetable-based fermented drinks, and to a use thereof.

Description

Kluyveromyces marcianus LRCC 8279 and LRCC 8325, suitable for non-alcoholic beverages and fermented beverages

[0001] This patent application claims priority to Republic of Korea Patent Application No. 10-2023-0126551, filed with the Korean Intellectual Property Office on September 21, 2023, the disclosure of which is incorporated herein by reference.

[0002] The present invention relates to Kluyveromyces marxianus LRCC 8325 strain and Kluyveromyces marxianus LRCC 8279 strain suitable for producing non-alcoholic alcoholic beverages and root vegetable fermented beverages, and their uses.

[0003] As the beverage market has become more specialized and segmented in recent years, products tailored to individual consumer preferences are being released. Among these, alcohol-free and low-alcohol beverages are gaining popularity in the domestic liquor market. This popularity is particularly evident as the recent spread of infectious diseases like COVID-19, coupled with restrictions on going out and bar operations, has led to a rise in the number of consumers enjoying alcohol alone at home, often referred to as "honsul" (literally, "honsul") or "home drinking."

[0004] Meanwhile, with the global trend of home drinking taking hold, the average amount consumed per session has decreased, but the frequency of drinking has increased. In particular, women's alcohol consumption has increased as they seek alcohol as a stress reliever due to increased housework and childcare responsibilities. Furthermore, the growing trend of casual drinking at home with family or alone has led to a surge in popularity of low-alcohol products like fruit wines, low-alcohol drinks, and cocktails. The growing interest among younger generations is also driving significant market expansion.

[0005] In the domestic liquor market, non-alcoholic beverages are defined as beverages with an alcohol content of less than 1%, which do not qualify as alcoholic beverages and are manufactured through a non-fermentation process that does not use yeast. Low-alcohol beverages are alcoholic beverages with an alcohol content of approximately 1% to 3%. These beverages are manufactured by selectively removing alcohol using a separation process during the final filtration stage of the conventional beer brewing process or by briefly halting the fermentation process to prevent alcohol production.

[0006] However, this manufacturing process often compromises the unique flavor and taste of fermented beer, leading to the artificial addition of flavoring ingredients to satisfy consumer needs. To overcome this, yeast strains with low maltose utilization in wort have been proposed. However, these methods rely on genetically modified organisms (GMOs), and thus fall short of alleviating consumer concerns.

[0007] The present invention has been made to solve the above-mentioned problems, and the purpose of the present invention is to provide a Kluyveromyces marxianus LRCC 8325 strain that is suitable for the production of non-alcoholic alcoholic beverages and root vegetable fermented beverages and is not genetically modified, and its use.

[0008] In addition, the present invention aims to provide a non-genetically modified Kluyveromyces marxianus LRCC 8279 strain and its use.

[0009] The purpose of the present invention is not limited to the purposes mentioned above. The purpose of the present invention will become clearer from the following description, and may be realized by the means and combinations thereof described in the claims.

[0010] Hereinafter, the present invention will be described in more detail.

[0011] One embodiment of the present invention relates to the strain Kluyveromyces marcianus LRCC 8325 deposited under the designation KCCM 13373P.

[0012] Another embodiment of the present invention relates to a composition for producing ethanol comprising at least one of the strain Kluyveromyces marcianus LRCC 8325 deposited under the registration number KCCM 13373P, a culture of the strain, and a combination thereof.

[0013] Another embodiment of the present invention relates to an ethanol-containing food comprising at least one of the strain Kluyveromyces marcianus LRCC 8325 deposited under the registration number KCCM 13373P, a culture of the strain, and a combination thereof.

[0014] The above food may include at least one of beverages, tea, drinks, makgeolli, soju, whiskey, wine, beer, and combinations thereof.

[0015] Another embodiment of the present invention relates to a method for producing an ethanol-containing food, comprising the step of culturing the Kluyveromyces marcianus LRCC 8325 strain deposited as KCCM 13373P in the presence of a substrate.

[0016] The above substrate may include at least one of malt, kudzu, burdock, ginger, doraji, and combinations thereof.

[0017] The sugar content of the above substrate may be 10 plato to 11 plato.

[0018] The step of culturing the above strain can be performed at 5°C to 35°C for 12 to 72 hours.

[0019] The step of culturing the above strain is to have the initial inoculation concentration of the strain be 10 5 CFU / ml to 10 7 It could be CFU / ml.

[0020] One embodiment of the present invention relates to the strain Kluyveromyces marcianus LRCC 8279 deposited under the identification number KCCM 13372P.

[0021] Another embodiment of the present invention relates to a composition for producing ethanol comprising at least one of the strain Kluyveromyces marcianus LRCC 8279 deposited under the registration number KCCM 13372P, a culture of the strain, and a combination thereof.

[0022] Another embodiment of the present invention relates to an ethanol-containing food comprising at least one of the strain Kluyveromyces marcianus LRCC 8279 deposited under the registration number KCCM 13372P, a culture of the strain, and a combination thereof.

[0023] The above food may include at least one of beverages, tea, drinks, makgeolli, soju, whiskey, wine, beer, and combinations thereof.

[0024] Another embodiment of the present invention relates to a method for producing an ethanol-containing food, comprising the step of culturing the Kluyveromyces marcianus LRCC 8279 strain deposited under the registration number KCCM 13372P in the presence of a substrate.

[0025] The above substrate may include at least one of malt, kudzu, burdock, ginger, doraji, and combinations thereof.

[0026] The sugar content of the above substrate may be 10 plato to 11 plato.

[0027] The step of culturing the above strain can be performed at 5°C to 35°C for 12 to 72 hours.

[0028] The step of culturing the above strain is to have the initial inoculation concentration of the strain be 10 5 CFU / ml to 10 7 It could be CFU / ml.

[0029] By using the novel isolated strain of the present invention, non-alcoholic liquor and fermented root vegetable beverages with a low ethanol content of about 1% to 3% can be produced without a separate ethanol removal process or the use of genetically modified organisms (GMOs).

[0030] In addition, the non-alcoholic liquor and root vegetable fermented beverage manufactured according to the present invention can have a strong floral aroma and a weak fatty and oily aroma, thereby realizing a fragrant and clean taste.

[0031] In addition, by using the strain according to the present invention, the efficiency of the manufacturing process of non-alcoholic alcoholic beverages and root vegetable fermented beverages can be improved and the cost can be reduced, and fermented beverages can be manufactured using various root vegetables.

[0032] The effects of the present invention are not limited to those mentioned above. It should be understood that the effects of the present invention encompass all effects inferred from the following description.

[0033] FIG. 1 illustrates a phylogenetic tree of the Kluyveromyces marxianus LRCC 8325 strain (hereinafter, LRCC 8325 strain) according to one embodiment of the present invention.

[0034] FIG. 2 shows a phylogenetic tree of the Kluyveromyces marxianus LRCC 8279 strain (hereinafter, LRCC 8279 strain) according to one embodiment of the present invention.

[0035] Figure 3 is a photograph confirming the non-glycosylation enzyme activity of the LRCC 8325 and LRCC 8279 strains.

[0036] Figure 4 is a graph analyzing the alcohol production ability of yeast in a medium containing a single sugar.

[0037] Figure 5 is a graph analyzing the alcohol production ability of yeast in a medium containing mixed sugars.

[0038] Figure 6 is a graph analyzing the alcohol production ability and growth rate of yeast according to the culture time at a culture temperature of 10 ℃.

[0039] Figure 7 is a graph analyzing the alcohol production ability and growth rate of yeast according to the culture time at a culture temperature of 15 ℃.

[0040] Figure 8 is a graph analyzing the alcohol production ability and growth rate of yeast at a culture temperature of 20°C and according to culture time.

[0041] Figure 9 is a graph analyzing the alcohol production ability and growth rate of yeast according to the culture time at a culture temperature of 25 ℃.

[0042] Figure 10 is a graph analyzing the alcohol production ability and growth rate of yeast according to the culture time at a culture temperature of 30°C.

[0043] Figure 11 is a graph analyzing the amount of alcohol produced when fermenting wort using yeast according to an experimental example of the present invention.

[0044] Figure 12 is a graph showing RE (Real Extract) calculated when fermenting wort using yeast according to an experimental example of the present invention.

[0045] Fig. 13 is a graph showing the RDF (Real degree of fermentation) calculated when fermenting wort using yeast according to an experimental example of the present invention.

[0046] Fig. 14 is a graph comparing and analyzing the aroma components of fermented wort using gas chromatography / mass spectrometer (GC-MS) according to one experimental example of the present invention.

[0047] Figure 15 shows an analysis of the similarity according to the aroma pattern of the fermented wort according to one experimental example of the present invention.

[0048] Figure 16 is a graph analyzing the amount of alcohol produced and the number of viable bacteria when fermenting root vegetable concentrate.

[0049] Figure 17 is a graph comparing and analyzing the fragrance components of kudzu according to GC-MS according to one experimental example of the present invention.

[0050] Figure 18 shows an analysis of the similarity according to the fragrance pattern of kudzu according to an experimental example of the present invention.

[0051] Figure 19 is a graph comparing and analyzing the fragrance components of burdock according to GC-MS according to one experimental example of the present invention.

[0052] Figure 20 shows an analysis of the similarity according to the scent pattern of burdock according to an experimental example of the present invention.

[0053] Figure 21 is a graph comparing and analyzing the aroma components of ginger according to GC-MS according to one experimental example of the present invention.

[0054] Figure 22 shows an analysis of the similarity according to the scent pattern of ginger according to an experimental example of the present invention.

[0055] Fig. 23 is a graph comparing and analyzing the fragrance components of Doraji by GC-MS according to an experimental example of the present invention.

[0056] Figure 24 shows an analysis of the similarity according to the scent pattern of Doraji according to an experimental example of the present invention.

[0057] Kluyveromyces marcianus LRCC 8325 strain deposited under the accession number KCCM 13373P.

[0058] Kluyveromyces marcianus LRCC 8279 strain deposited under the accession number KCCM 13372P.

[0059] The above-described purposes, other purposes, features, and advantages of the present invention will be readily understood through the following preferred embodiments, illustrated in the accompanying drawings. However, the present invention is not limited to the embodiments described herein and may be embodied in other forms. Rather, the embodiments presented herein are provided to ensure that the disclosure is thorough and complete, and to ensure that the spirit of the present invention is fully conveyed to those skilled in the art.

[0060] In describing each drawing, similar reference numerals are used to designate similar components. In the attached drawings, the dimensions of structures are shown exaggerated for clarity of the present invention. Terms such as first, second, etc. may be used to describe various components, but the components should not be limited by the terms. The terms are used only to distinguish one component from another. For example, a first component may be referred to as a second component, and similarly, a second component may also be referred to as a first component, without departing from the scope of the present invention. The singular expression includes the plural expression unless the context clearly indicates otherwise.

[0061] In this specification, terms such as "include" or "have" are intended to specify the presence of a feature, number, step, operation, component, part, or combination thereof described in the specification, but should be understood as not excluding in advance the possibility of the presence or addition of one or more other features, numbers, steps, operations, components, parts, or combinations thereof. In addition, when it is said that a part such as a layer, film, region, or plate is "on" another part, this includes not only the case where it is "directly above" the other part, but also the case where there is another part in between. Conversely, when it is said that a part such as a layer, film, region, or plate is "under" another part, this includes not only the case where it is "directly below" the other part, but also the case where there is another part in between.

[0062] Unless otherwise indicated, all numbers, values ​​and / or expressions expressing quantities of ingredients, reaction conditions, polymer compositions and blends used herein are approximations that inherently reflect, among other things, the various uncertainties of measurement that arise in obtaining such values ​​and therefore should be understood as being modified in all instances by the term "about." Furthermore, whenever a numerical range is disclosed herein, such range is continuous and includes every value from the minimum value to the maximum value inclusive, unless otherwise indicated. Furthermore, whenever such a range refers to integers, every integer from the minimum value to the maximum value inclusive, unless otherwise indicated, is included.

[0063] In this specification, when a range is described for a variable, the variable will be understood to include all values ​​within the described range including the described endpoints of the range. For example, the range '5 to 10' will be understood to include the values ​​5, 6, 7, 8, 9, and 10, as well as any subranges such as 6 to 10, 7 to 10, 6 to 9, 7 to 9, etc., and any value between integers that fall within the described range, such as 5.5, 6.5, 7.5, 5.5 to 8.5, and 6.5 to 9. Also, for example, a range of '10% to 30%' would be understood to include not only values ​​such as 10%, 11%, 12%, 13%, etc., and all integers up to and including 30%, but also any subranges such as 10% to 15%, 12% to 18%, 20% to 30%, and any value between reasonable integers within the stated range, such as 10.5%, 15.5%, 25.5%, etc.

[0064]

[0065] An example of the present invention relates to the strain Kluyveromyces marxianus LRCC 8325 deposited under the designation KCCM 13373P.

[0066] In the present invention, the Kluyveromyces marxianus LRCC 8325 strain may be the Kluyveromyces marxianus LRCC 8325 strain deposited with the Korea Microbiological Conservation Center, Republic of Korea, on July 26, 2023, under the accession number KCCM 13373P.

[0067] The 26S rRNA base sequence of the above Kluyveromyces marxianus LRCC 8325 strain may include the base sequence of sequence number 1.

[0068] The above Kluyveromyces marcianus LRCC 8325 strain may be derived from malt or rice nuruk.

[0069] The above Kluyveromyces marxianus LRCC 8325 strain may have a decomposition ability for at least one of glucose (D-Glucose), xylose (D-Xylose), xylitol (Xylitol), galactose (D-Galactose), sorbitol (D-Sorbitol), lactose (D-Lactose), sucrose (D-Saccharose), raffinose (D-Raffinose), and combinations thereof.

[0070] Another example of the present invention relates to a composition for producing ethanol comprising at least one of the strain Kluyveromyces marcianus LRCC 8325 deposited under the registration number KCCM 13373P, a culture of the strain, and a combination thereof.

[0071] In this specification, the term 'culture' refers to a liquid corresponding to a culture solution containing a strain after culturing the strain, an isolate or fraction thereof separated from the culture solution of the strain, a culture filtrate, a fermentation broth, or a supernatant separated therefrom, or may refer to a dried product obtained by freeze-drying the supernatant, but is not limited thereto.

[0072] In the present invention, the composition may be prepared in the form of, but is not limited to, a directly sprayable solution, powder, or suspension, or a highly concentrated aqueous, oily, or other suspension, dispersion, emulsion, oily dispersion, paste, dust, dustable substance, or granule.

[0073] Another example of the present invention relates to an ethanol-containing food comprising at least one of the strain Kluyveromyces marcianus LRCC 8325 deposited under the registration number KCCM 13373P, a culture of the strain, and a combination thereof.

[0074] The above ethanol-containing food may include at least one of beverages, tea, drinks, makgeolli, soju, whiskey, wine, beer, and combinations thereof, and may also include health functional foods in the general sense as long as they are drinkable foods, but are not particularly limited thereto.

[0075] The ethanol-containing food may, like conventional foods including beverages, contain various natural carbohydrates or sweeteners as additional ingredients. The natural carbohydrates may be monosaccharides such as glucose and fructose, disaccharides such as maltose and sucrose, polysaccharides such as dextrin and cyclodextrin, and sugar alcohols such as xylitol, sorbitol, and erythritol. As the sweetener, natural sweeteners such as thaumatin and stevia extract, or synthetic sweeteners such as saccharin and aspartame may be used. The ethanol-containing food of the present invention may contain, for example, about 0.00001 g to 10 g of the natural carbohydrate or sweetener per 100 ml, but is not limited thereto.

[0076] In the present invention, the ethanol-containing food may include additives such as various nutrients, vitamins, electrolytes, flavoring agents, coloring agents, pectic acid and its salts, alginic acid and its salts, organic acids, protective colloid thickeners, pH adjusters, stabilizers, preservatives, glycerin, and carbonating agents used in carbonated beverages. In addition, the food may contain fruit pulp for the production of natural fruit juice, fruit juice drinks, and vegetable drinks. These ingredients may be used independently or in combination. The ratio of these additives is, for example, 0.001 to 10 parts by weight of the additives per 100 parts by weight of the ethanol-containing food of the present invention, but is not limited thereto.

[0077] In the present invention, the ethanol-containing food may contain various nutrients, vitamins, electrolytes, flavoring agents, coloring agents, pectic acid and its salts, alginic acid and its salts, organic acids, protective colloid thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohol, carbonating agents used in carbonated beverages, etc. In addition, it may contain fruit pulp for the production of natural fruit juice, fruit juice drinks, and vegetable drinks, but is not particularly limited thereto.

[0078] Another example of the present invention relates to a method for producing an ethanol-containing food, comprising the step of culturing the Kluyveromyces marcianus LRCC 8325 strain deposited as KCCM 13373P in the presence of a substrate.

[0079] The substrate may include at least one of malt, kudzu, burdock, ginger, doraji, and a combination thereof, and the substrate may be pretreated in a solution form.

[0080] The sugar content of the above substrate may be, but is not limited to, 10 plato to 11 plato, 10 plato to 10.8 plato, or 10 plato to 10.6 plato, and may be selected within an appropriate range in consideration of the sugar content of the ethanol-containing food.

[0081] The step of culturing the above strain may be performed at 5°C to 35°C, 5°C to 30°C, 10°C to 35°C, or 10°C to 30°C.

[0082] The step of culturing the above strain may be performed for 12 to 72 hours or 24 to 72 hours.

[0083] The step of culturing the above strain is to have an initial inoculation concentration of the above strain of 10 5 CFU / ml to 10 7 CFU / ml, 10 6 CFU / ml to 10 7 CFU / ml, or 106 It could be CFU / ml.

[0084] In this specification, 'cultivation' may mean growing microorganisms under appropriately artificially controlled environmental conditions.

[0085] The above cultivation may be performed continuously in a batch process or a fed batch or repeated fed batch process, but is not limited thereto.

[0086] Additionally, the method for producing the ethanol-containing food may include a step of concentrating ethanol produced from a strain or a culture thereof. The method for concentrating ethanol may use any method widely known in the art, such as distillation.

[0087] The method for producing the above ethanol-containing food may include substantially overlapping contents with the contents of the Kluyveromyces marcianus LRCC 8325 strain deposited as KCCM 13373P described above, the composition including the strain and its culture, and the ethanol-containing food, and the description of the overlapping portion is omitted.

[0088] Another example of the present invention relates to the strain Kluyveromyces marcianus LRCC 8279 deposited under the identification number KCCM 13372P.

[0089] In the present invention, the Kluyveromyces marxianus LRCC 8279 strain may be the Kluyveromyces marxianus LRCC 8279 strain deposited with the Korea Microbiological Conservation Center, Republic of Korea, on July 26, 2023, under the accession number KCCM 13372P.

[0090] The 26S rRNA base sequence of the above Kluyveromyces marxianus LRCC 8279 strain may include the base sequence of sequence number 2.

[0091] The above Kluyveromyces marcianus LRCC 8279 strain may be derived from malt or rice nuruk.

[0092] The above Kluyveromyces marxianus LRCC 8279 strain may have a decomposition ability for at least one of glucose (D-Glucose), xylose (D-Xylose), xylitol (Xylitol), galactose (D-Galactose), sorbitol (D-Sorbitol), lactose (D-Lactose), sucrose (D-Saccharose), raffinose (D-Raffinose), and combinations thereof.

[0093] Another example of the present invention relates to a composition for producing ethanol comprising at least one of the strain Kluyveromyces marcianus LRCC 8325 deposited under the registration number KCCM 13372P, a culture of the strain, and a combination thereof.

[0094] Another example of the present invention relates to an ethanol-containing food comprising at least one of the strain Kluyveromyces marcianus LRCC 8279 deposited under the registration number KCCM 13372P, a culture of the strain, and a combination thereof.

[0095] Another example of the present invention relates to a method for producing an ethanol-containing food, comprising the step of culturing the Kluyveromyces marcianus LRCC 8279 strain deposited as KCCM 13372P in the presence of a substrate.

[0096] The composition for producing ethanol, the ethanol-containing food and the method for producing the same regarding the strain Kluyveromyces marcianus LRCC 8279 deposited under the above KCCM 13372P may include substantially overlapping contents with the contents of the composition for producing ethanol, the ethanol-containing food and the method for producing the same regarding the strain Kluyveromyces marcianus LRCC 8325 deposited under the above KCCM 13373P, and the description of the overlapping portion is omitted.

[0097] The following experimental examples illustrate other aspects of the present invention in more detail. These examples are merely illustrative and serve to aid understanding of the present invention, and are not intended to limit the scope of the present invention.

[0098]

[0099] Experimental example

[0100] 1. Isolation and identification of yeast

[0101] Malt and rice nuruk from Mangwon Traditional Market (Mapo-gu, Seoul) were enriched in YPD broth for 24 hours, then diluted in multiple stages and cultured in YPD Agar for 48 hours. Pure colonies were then subcultured three times to isolate the yeast.

[0102] The base sequence of 26S rRNA of the isolated yeast was amplified with universal primers, 785F and 907R, and the base sequence similarity with Kluyveromyces marxianus was analyzed using the NCBI GenBank database. As a result, two new yeasts were isolated and identified, and they were named K. marxianus LRCC 8325 (hereinafter referred to as LRCC 8325 strain) and K. marxianus LRCC 8279 (hereinafter referred to as LRCC 8279 strain). The K. marxianus LRCC 8325 strain was deposited with the Korea Microbiological Conservation Center, a depository under the Budapest Treaty, on July 26, 2023, and was assigned the accession number KCCM 13373P. The strain marxianusLRCC 8279 was deposited at the Korea Microbiological Conservation Center on July 26, 2023, and was assigned the accession number KCCM 13372P.

[0103] The 26S rRNA base sequence of the Kluyveromyces marxianus LRCC 8325 strain may include the base sequence of SEQ ID NO: 1, and the 26S rRNA base sequence of the Kluyveromyces marxianus LRCC 8279 strain may include the base sequence of SEQ ID NO: 2, as shown in Table 1 below.

[0104] Sequence number name sequence (5`->3`) Remarks 126S rRNA_LRCC 8325TGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGTGGAGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCCGGACGGTGGCCATGGAAGTCGGAATCCGCTAAG GAGTGTGTAACAACTCACCGGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCTATACTCCACCGTCAGGGTTAATATGATGCCCTGACGAGTAGGCAGGCGTGGAGGTCAGTGACGAAGCCTA1296 nts226S rRNA_LRCC 8279GTAAGCAGAACTGGCGATGCGGGATGAACCGAACGTGGAGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCCGGACGGTGGCCATGGAAGTCGGAATCCGCTAAG GAGTGTGTAACAACTCACCGGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCTATACTCCACCGTCAGGGTTAATATGATGCCCTGACGAGTAGGCAGGCGTGGAGGTCAGTGACGAAGC1291 nts3785FPrimerGGATTAGATACCCTGGTA18 nts4907RPrimerCCGTCAATTCMTTTRAGTTT20 nts

[0105]

[0106] The phylogenetic relationship of the isolated strain with other strains belonging to the genus Kluyveromyces is shown in Figures 1 and 2.

[0107]

[0108] 2. Confirmation of sugar utilization and non-glycosidase activity of yeast

[0109] 2-1. Sugar availability

[0110] The sugar utilization of strains LRCC 8325 and LRCC 8279 was analyzed using the API 20C AUX kit (Biomerieux, France). This kit allows for the identification of yeast strains by testing their biochemical ability to utilize 19 types of sugars. Diluted strains were dispensed onto strips containing the 19 types of sugar substrates in the kit, cultured for 48 to 72 hours, and the results of each strain's sugar substrate fermentation were read, and the results are shown in Tables 2 and 3.

[0111] Classification CONGLUGLY2KGARAXYLADOXLTGALINOLRCC 8325 Sugar availability-+---+-++- Sugar preference 01002701181251000 LRCC 8279 Sugar availability-+---+-++- Sugar preference 01002701181251000

[0112]

[0113] ClassificationSORMDGNAGCELLACMALSACTREMLZRAFLRCC 8325Sugar Availability+---+--+Sugar Preference340019511001196LRCC 8279Sugar Availability+---+--+Sugar Preference340019511001196

[0114]

[0115] (Where, CON: No sugar substrate added, GLU: D-Glucose, GLY: Glycerol, 2KG: Ca 2-keto-Gluconate, ARA: L-Arabinose, XYL: D-Xylose, ADO: Adonitol, Methyl-αD-Glusopyranoside, NAG: N-Acetyl-Glucosamine, CEL: D-Cellobiose, LAC: D-Lactose, MAL: D-Maltose, SAC: D-Saccharose, TRE: D-Trehalose, MLZ: D-Melezitose, RAF: D-Raffinose.)

[0116] As shown in Tables 2 and 3, strains LRCC 8325 and LRCC 8279 were able to utilize glucose (D-Glucose), xylose (D-Xylose), xylitol (Xylitol), galactose (D-Galactose), sorbitol (D-Sorbitol), lactose (D-Lactose), sucrose (D-Saccharose, Sucrose), and raffinose (D-Raffinose) as carbon sources.

[0117]

[0118] 2-2. Non-glycosylation enzyme activity

[0119] In Bile Esculin Agar medium, LRCC 8325 strains and LRCC 8279 strains were dispensed onto paper discs, and the black ring formed as esculin was decomposed was confirmed, and the results are shown in Fig. 3.

[0120] Here, + control is a strain with high aglycone activity selected from the genus Saccharomyces cerevisiae and set as a control group, and - control is a strain with low aglycone activity selected from the genus Saccharomyces and set as a control group.

[0121] Referring to Figure 3, it can be confirmed that since LRCC 8279 and LRCC 8325 have excellent β-glucosidase activity, a large amount of non-glycosidic compounds that increase the body's availability can be produced while fermenting root vegetables.

[0122]

[0123] 3. Confirmation of yeast alcohol production ability and growth at different temperatures

[0124] 3-1. Alcohol production capacity according to sugar type

[0125] The initial inoculation concentrations of strains LRCC 8325, LRCC 8279, and the control strain Saccharomyces cerevisiae were 10 6 CFU / ml, and using five types of media (YP, YPD, YPF, YPM, and YPS), the alcohol production ability according to sugar type was confirmed by culturing at 30°C for 48 hours.

[0126] The five media commonly contain 1 wt% yeast extract and 2 wt% peptone, and the YPD medium further contains 2 wt% glucose, the YPF medium further contains 2 wt% fructose, the YPM medium further contains 2 wt% maltose, and the YPS medium further contains 2 wt% sucrose. The wt% is based on the total weight of the medium.

[0127] The results of confirming the alcohol production ability of yeast are shown in Fig. 4 and Table 4.

[0128] ClassificationYPYPDYPFYPMYPSAlcohol production (v / v%)S. cerevisiae0.31.491.481.521.56LRCC 82790.31.411.310.291.34LRCC 83250.31.381.330.281.45

[0129]

[0130] 3-2. Alcohol production capacity according to mixed sugar content

[0131] The initial inoculation concentrations of strains LRCC 8325, LRCC 8279, and the control strain Saccharomyces cerevisiae were 10 6 CFU / ml, and using four types of mixed carbon source media, the alcohol production ability according to the content of mixed sugar was confirmed by culturing at 30°C for 5 days.

[0132] Mixed carbon source media commonly contain 1 wt% yeast extract and 2 wt% peptone, YPDM0.8 medium contains 0.8 wt% glucose and maltose each, YPDM1 medium contains 1 wt% of each sugar, YPDM1.5 medium contains 1.5 wt% of each sugar, and YPDM2 medium contains 2 wt% of each sugar. The wt% is based on the total weight of the medium.

[0133] The results of confirming the alcohol production ability of yeast are shown in Fig. 5 and Table 5.

[0134] ClassificationYPDM0.8YPDM1YPDM1.5YPDM2Alcohol production (v / v%)S. cerevisiae1.311.552.162.73LRCC 82790.740.851.121.37LRCC 83250.730.851.121.38

[0135]

[0136] Referring to FIG. 5 and Table 5 together with FIG. 4 and Table 4 above, it was confirmed that the control strain produced ethanol by utilizing both glucose and maltose when exposed to glucose and maltose, whereas the LRCC 8325 strain and the LRCC 8279 strain had low maltose utilization and mainly consumed glucose to produce a small amount of ethanol.

[0137]

[0138] 3-3. Alcohol production and yeast growth according to culture temperature and time

[0139] LRCC 8325 strain, LRCC 8279 strain, and S. cerevisiae2 (maltose-negative) as a control were prepared.

[0140] The initial inoculation concentration is 10 6 CFU / ml, and was cultured at 10°C, 15°C, 25°C, and 30°C for 1 to 5 days using YPD medium (containing 2 wt% glucose).

[0141] The alcohol production ability and yeast growth ability were confirmed according to the culture temperature and culture time, and the results are shown in Figs. 6 to 10 and Table 6.

[0142] Classification 1 day 2 days 3 days 4 days 5 days 10 ℃ Alcohol production (v / v%) S. cerevisiae 20.250.280.520.791.37 LRCC 82790.250.330.390.450.56 LRCC 83250.250.310.390.450.56 Viable cell count (Log CFU / ml) S. cerevisiae 26.36.77.27.57.6 LRCC 82796.77.27.47.57.6 LRCC 83256.87.17.37.47.615 ℃ Alcohol production (v / v%) S. cerevisiae 20.390.861.471.51.51LRCC 82790.250.460.70.841.09LRCC 83250.260.460.650.831.04Vital cell count (Log CFU / ml)S. cerevisiae 26.97.57.77.77.7LRCC 82797.27.47.67.67.7LRCC 83257.27.47.77.77.820 ℃Alcohol production (v / v%)S. cerevisiae 20.751.441.461.471.47LRCC 82790.440.811.111.291.35LRCC 83250.430.761.071.181.33Violent count (Log CFU / ml)S. cerevisiae 27.47.87.77.67.5LRCC 82797.57.77.87.87.6LRCC 83257.57.87.87.87.825 ℃Alcohol production (v / v%)S. cerevisiae 21.451.481.461.461.47LRCC 82790.61.181.341.371.39LRCC 83250.61.181.311.361.4Vital cell count (Log CFU / ml)S. cerevisiae 27.87.77.47.36.4LRCC 82797.57.87.87.87.8LRCC 83257.77.987.87.830 ℃Alcohol production (v / v%)S. cerevisiae 21.461.451.461.51.5LRCC 82790.851.341.351.431.43LRCC 83250.91.31.41.381.39 Viable bacteria count (Log CFU / ml)S. cerevisiae 27.87.56.65.85.6LRCC 82797.77.87.87.67.6LRCC 83257.77.77.97.97.7.

[0143]

[0144] As can be seen in Figures 6 to 10 and Table 6, there was no significant difference in the number of viable cells according to the culture temperature and culture time among the control strain, LRCC 8325 strain, and LRCC 8279 strain.

[0145] However, when the culture temperature was 10 ℃ to 15 ℃, the number of viable cells was similar to that of the control group until about 5 days, when it was 20 ℃, until about 3 days, and when it was 25 ℃ to 30 ℃, until about 1 day. However, the alcohol production of the LRCC 8325 strain and the LRCC 8279 strain were measured to be significantly lower than that of the control group. Therefore, as the culture temperature increases, the culture time should be shorter to be advantageous in producing low-alcohol beverages. It was confirmed that the culture conditions for excellent growth ability compared to the initial inoculum amount and alcohol production of less than 1% were 15 ℃ and 3 days.

[0146]

[0147] 4. Fermentation of wort using yeast

[0148] 4-1. Wort fermentation

[0149] The initial inoculation concentrations of strains LRCC 8325, LRCC 8279, and the control strain Saccharomyces cerevisiae were 10 6 CFU / ml, and the wort adjusted to 10.4 sugar content (Plato) was fermented at 30°C for 1 to 3 days to prepare a wort fermentation product.

[0150] The wort was prepared through a process of grinding malt, saccharification, initial sugar content adjustment, filtering, and then adding hops. Furthermore, considering the final product's sugar content of 1.8 Plateau after fermentation, the wort's sugar content was adjusted to 10.4 Plateau.

[0151] The alcohol production measured from the wort fermentation is shown in Fig. 11, RE (Real Extract) in Fig. 12, and RDF (Real Degree of Fermentation) in Fig. 13, and the experimental values ​​are summarized in Table 7. RDF is an index for measuring the degree of fermentation, and its calculation was performed using the following mathematical formula presented in "William Hardwick, (1994). Handbook of Brewing, CRC Press."

[0152] [Mathematical formula]

[0153]

[0154] - O stands for original gravity (°P).

[0155] - E stands for real extract (°P).

[0156] Classification 0 Day 1 Day 2 Day 3 Alcohol production (v / v%) S. cerevisiae-2.46 4.3 24.38 LRCC 8279-0.48 1.17 1.52 LRCC 8325-0.5 11.35 1.9 RE (w / w%) S. cerevisiae 8.98 4.96 2.06 2.01 LRCC 8279 8.98 8.09 6.79 5.93 LRCC 8325 8.98 8.16 7.07 6.51 RDF (w / w%) S. cerevisiae 044.49 77.45 78.14 LRCC 8279 08.55 20.98 27.21 LRCC 8325 09.13 24.08 34.05

[0157]

[0158] (Here, RE: residual sugar after wort fermentation, RDF: degree of sugar in wort fermented into alcohol.) As can be seen in FIGS. 11, 12, 13, and Table 7, malt accounts for 60% to 70% of the sugar composition in wort, and when exposed to glucose and maltose, the control strain produced ethanol by utilizing both glucose and maltose, while the LRCC 8325 strain and the LRCC 8279 strain had low utilization of maltose, mainly consuming glucose and producing a small amount of ethanol.

[0159]

[0160] 4-2. Sensory evaluation of fermented wort

[0161] The fermented wort prepared in 4-1 was analyzed for changes in taste and aroma patterns using gas chromatography-mass spectrometry (GC-MS) (GC: Aglient Technologies 7890B, MS: Aglient Technologies 5977A) and electronic nose Hercles II (Alpha MOS, Toulouse, France), and the results are shown in Figs. 14 and 15, and the experimental values ​​of Fig. 14 are shown in Table 8.

[0162] The main components according to the taste variables are Isoamyl alcohol and ethyl acetate for fermented aroma, Ethyl hexanoate, Ethyl decanoate, and Ethyl butanoate for fruity aroma, 2-phynylethyl acetate and phenylethyl alcohol for floral aroma, Octanoic acid for fatty aroma, Ethyl octanoate for waxy and oily aroma, and Guaiacol for phenolic aroma.

[0163] As a result of analyzing the fragrance components through GC-MS (GC: Aglient Technologies 7890B, MS: Aglient Technologies 5977A), the main components by fragrance characteristics were found to be as follows:

[0164] - Fermented aroma characteristics: Isoamyl alcohol and ethyl acetate

[0165] - Fruity aroma characteristics: Ethyl hexanoate, Ethyl decanoate, and Ethyl butanoate

[0166] - Floral aroma characteristics: 2-phenylethyl acetate and phenylethyl alcohol

[0167] - Fatty acid properties: caprylic acid (octanoic acid)

[0168] - Oily fragrance characteristics (Waxy & Oily): Ethyl octanoate

[0169] - Phenolic aroma characteristics: Guaiacol

[0170] Classification (Unit: Area(1E6))FermentedFruityFloralFattyWaxy & OilyPhenolicS. cerevisiae9728130423917414LRCC 8279150137953172114LRCC 83251371541,08021211

[0171]

[0172] As can be seen in Fig. 14 and Table 8, the floral aroma characteristics were relatively strong. Therefore, it was confirmed that the use of the LRCC 8279 strain and the LRCC8235 strain according to the present invention is advantageous in the production of low-alcohol beverages with enhanced floral aroma.

[0173] As can be seen in Fig. 15, the values ​​of PC1 and PC2 were 93.719 and 5.039, respectively, and the differences between samples were mainly determined by PC1 corresponding to the x-axis. The LRCC 8279 and LRCC 8325 strains show negative values ​​based on the x-axis compared to the S. cerevisiae strain, confirming that there are differences in the fragrance components. However, they are relatively closer to each other, confirming that the fragrance components are similar.

[0174]

[0175] 5. Fermentation of root vegetable concentrate

[0176] 5-1. Fermentation of concentrate

[0177] The initial inoculation concentrations of strains LRCC 8325, LRCC 8279, S. cerevisiae, and S. cerevisiae2 were 10 6CFU / ml, and the root vegetable concentrate was fermented at 15℃ for 3 days to prepare a fermented root vegetable product. The root vegetables used were kudzu, ginger, bellflower root, and burdock.

[0178] Root vegetable concentrate may be prepared by preparing refrigerated or frozen root vegetables (kudzu, ginger, bellflower root, and burdock), pressing or heating the root vegetables, and extracting the extract using a filtration and concentration device such as a filter press. The root vegetables may be dried, if necessary. In addition, the root vegetable concentrate may be subjected to a sterilization process, if necessary.

[0179] The alcohol production and number of viable cells in the fermented root vegetables by strain were measured and shown in Fig. 16 and Table 9.

[0180] Classification: Arrowroot, Ginger, Bellflower Root, Burdock, Alcohol-producing (v / v%), No strain added, 00.01, 0.02, 0.03, S. cerevisiae, 0.8, 0.4, 0.11, 1, S. cerevisiae, 20.6, 0.10, 11.0, LRCC, 8279, 0.3, 10, 30.4, LRCC, 8325, 0.3, 10, 30.4, Viable cell count (Log CFU / ml), S. cerevisiae, 7.4, 7.2, 57.6, S. cerevisiae, 27.5, 7.1, 57.7, LRCC, 8279, 7.4, 4, 4, 57.6, LRCC, 8325, 7.4, 57.4, 57.6

[0181]

[0182] As can be seen in Fig. 16 and Table 9, the LRCC 8279 strain and the LRCC 8325 strain showed growth potential similar to or superior to that of the S. cerevisiae strain, but tended to have lower alcohol production. Accordingly, it was confirmed that the LRCC 8279 strain and the LRCC 8325 strain of the present invention are advantageous in the production of low-alcohol beverages.

[0183]

[0184] 5-2. Sensory Evaluation of Fermented Root Vegetables

[0185] According to the above 5-1, the root vegetable fermentation product was prepared and the changes in taste and aroma patterns by strain according to the fermentation product were analyzed using GC-MS (GC: Aglient Technologies 7890B, MS: Aglient Technologies 5977A) and electronic nose Hercles II (Alpha MOS, Toulouse, France). The results are shown in Figs. 17 to 24 and Tables 10 to 13.

[0186] The results of the analysis of the aroma pattern of the fermented kudzu product are shown in Figures 17, 18, and Table 10.

[0187] Category (Unit: Area(1E6))FruityEtherealFloralFermentedRoasted&BurntPhenolicWaxyS. cerevisiae732512613125LRCC 8279895048531472LRCC 8325675267631342S. cerevisiae 2982553414214

[0188]

[0189] As can be seen in Fig. 17 and Table 10, the fermented kudzu product exhibited relatively strong ethereal and fermented aromas, and the main components were ethyl acetate with ethereal aroma characteristics and isoamyl alcohol with fermented aroma characteristics.

[0190] As can be seen in Fig. 18, in the case of fermented kudzu, the values ​​of PC1 and PC2 were 96.763 and 2.718, respectively, and it was determined that there was a difference between the samples mainly due to PC1 corresponding to the x-axis. The LRCC 8279 and LRCC 8325 strains showed positive values ​​based on the x-axis compared to the S. cerevisiae strain, indicating that there were differences in the aroma components, and since they were relatively closer to each other, it can be confirmed that the aroma components were similar.

[0191] The results of the fragrance pattern analysis of the fermented burdock are shown in Figures 19, 20, and Table 11.

[0192] Category (Unit: Area(1E6))FloralFruityFermentedEtherealSourWaxyPhenolicS. cerevisiae9365413-95LRCC 8279378627078654LRCC 83256105173681054S. cerevisiae 211659542-104

[0193]

[0194] As can be seen in Fig. 19 and Table 11, the burdock fermentation product showed relatively strong floral and ethereal scents, and the main components were methyl salicylate and phenyl alcohol with floral scent characteristics, and ethyl acetate with ethereal scent characteristics.

[0195] As can be seen in Fig. 20, in the case of fermented burdock, the values ​​of PC1 and PC2 were 92.323 and 7.285, respectively, and it was determined that there was a difference between the samples mainly due to PC1 corresponding to the x-axis. The LRCC 8279 and LRCC 8325 strains showed positive values ​​based on the x-axis compared to the S. cerevisiae strain, indicating that there were differences in the aroma components, and since they were relatively closer to each other, it can be confirmed that the aroma components were similar.

[0196] The results of the aroma pattern analysis of the fermented ginger are shown in Figs. 21, 22, and Table 12.

[0197] Category (Unit: Area(1E6))FloralEtherealFermentedFruityWaxyPhenolicSourS. cerevisiae883407293-LRCC 8279255825851674LRCC 8325495806350538S. cerevisiae 211125465108-

[0198]

[0199] As can be seen in Fig. 21 and Table 12, the fermented ginger product exhibited relatively strong floral and ethereal aromas, and the main components were methyl salicylate and phenyl alcohol with floral aroma characteristics, and ethyl acetate with ethereal aroma characteristics.

[0200] As can be seen in Fig. 22, in the case of fermented ginger, the values ​​of PC1 and PC2 were 60.680 and 33.536, respectively, and it was determined that there was a difference between the samples mainly due to PC1 corresponding to the x-axis. The LRCC 8279 and LRCC 8325 strains showed positive values ​​based on the x-axis compared to the S. cerevisiae strain, indicating that there were differences in the aroma components, and since they were relatively closer to each other, it can be confirmed that the aroma components were similar.

[0201] The results of the analysis of the aroma pattern of fermented doraji are shown in Figures 23, 24, and Table 13.

[0202] Category (Unit: Area(1E6))FloralEtherealFermentedFruityWaxySourPhenolicS. cerevisiae922417410-3LRCC 8279264856054642LRCC 8325483846349582S. cerevisiae 21072546511-2

[0203]

[0204] As can be seen in Fig. 23 and Table 13, the fermented ginger product exhibited relatively strong floral and ethereal aromas, and the main components were methyl salicylate and phenyl alcohol, which had floral aroma characteristics, and ethyl acetate, which had ethereal aroma characteristics.

[0205] As can be seen in Fig. 24, in the case of fermented ginger, the values ​​of PC1 and PC2 were 98.257 and 1.393, respectively, and it was determined that there was a difference between the samples mainly due to PC1 corresponding to the x-axis. The LRCC 8279 and LRCC 8325 strains showed positive values ​​based on the x-axis compared to the S. cerevisiae strain, indicating that there were differences in the aroma components, and since they were relatively closer to each other, it can be confirmed that the aroma components were similar.

[0206] Accordingly, it was confirmed that the use of the LRCC 8279 and LRCC 8325 strains according to the present invention has an advantage in the production of low-alcohol beverages with an overall enhanced ethereal flavor and an enhanced fermented or floral flavor depending on the type of root vegetable.

[0207]

[0208]

[0209] The present invention relates to Kluyveromyces marxianus LRCC 8325 strain and Kluyveromyces marxianus LRCC 8279 strain suitable for producing non-alcoholic alcoholic beverages and root vegetable fermented beverages, and their uses.

Claims

1. Kluyveromyces marcianus LRCC 8325 strain deposited under the accession number KCCM 13373P.

2. A composition for producing ethanol comprising at least one of the strain Kluyveromyces marcianus LRCC 8325 deposited under the registration number KCCM 13373P, a culture of the strain, and a combination thereof.

3. An ethanol-containing food comprising at least one of the strain Kluyveromyces marcianus LRCC 8325 deposited under the registration number KCCM 13373P, a culture of the strain, and a combination thereof.

4. In paragraph 3, The above food is an ethanol-containing food including at least one of beverages, tea, drinks, makgeolli, soju, whiskey, wine, beer, and combinations thereof.

5. A step of culturing the Kluyveromyces marcianus LRCC 8325 strain deposited as KCCM 13373P in the presence of a substrate, The above substrate comprises a wort or root vegetable extract, A method for producing an ethanol-containing food, wherein the root vegetable comprises at least one of kudzu, burdock, ginger, and a combination thereof.

6. In paragraph 5, A method for producing an ethanol-containing food, wherein the step of culturing the above strain is performed at 5°C to 35°C for 12 to 72 hours.

7. In paragraph 5, The step of culturing the above strain is to have an initial inoculation concentration of the above strain of 10 5 CFU / ml to 10 7 A method for producing an ethanol-containing food having a CFU / ml content.

8. Kluyveromyces marcianus LRCC 8279 strain deposited under the accession number KCCM 13372P.

9. A composition for producing ethanol comprising at least one of the strain Kluyveromyces marcianus LRCC 8279 deposited under KCCM 13372P, a culture of the strain, and a combination thereof.

10. Ethanol-containing food comprising at least one of the strain Kluyveromyces marcianus LRCC 8279 deposited under KCCM 13372P, a culture of the strain, and a combination thereof.

11. In paragraph 10, The above food is an ethanol-containing food including at least one of beverages, tea, drinks, makgeolli, soju, whiskey, wine, beer, and combinations thereof.

12. A step of culturing the Kluyveromyces marcianus LRCC 8279 strain deposited as KCCM 13372P in the presence of a substrate, The above substrate comprises a wort or root vegetable extract, A method for producing an ethanol-containing food, wherein the root vegetable comprises at least one of kudzu, burdock, ginger, and a combination thereof.

13. In paragraph 12, A method for producing an ethanol-containing food, wherein the step of culturing the above strain is performed at 5°C to 35°C for 12 to 72 hours.

14. In paragraph 12, The step of culturing the above strain is to have the initial inoculation concentration of the strain be 10 5 CFU / ml to 10 7 A method for producing an ethanol-containing food having a CFU / ml content.

Images